JPH0354554B2 - - Google Patents

Description

[Detailed description of the invention]

Industrial Application Field The present invention relates to angiotensin (aspartic acid (AsP)-arginine (Arg)-valine (Val)-tyrosine (Tyr)), which is a precursor peptide of angiotensin and an interesting physiologically active peptide.
A peptide consisting of a 10 amino acid sequence of - isoleucine (Ile) - histidine (His) - proline (Pro) - phenylalanine (Phe) - histidine (His) - leucine (Leu), hereinafter abbreviated as ANG1. )
New recombinant plasmids pANG1-23, pANG1-23 that enable mass production of fusion proteins containing
E. coli containing E. coli, dihydrofolate reductase-ANG1 fusion protein (hereinafter abbreviated as DHFR-ANG1), which has ANG1 on the carboxy-terminal side of the enzyme;
The present invention relates to a method for separating and purifying DHFR-ANG1 and a method for producing ANG1. The novel recombinant plasmid pANG1-23 of the present invention has the DNA sequence shown in FIG. The present invention is directed to the fermentation industry,
Suitable for fields such as the pharmaceutical industry. Prior Art ANG1 is a blood peptide and a substance of the renin-angiotensin system that is thought to control blood pressure. ANG1 produces angiotensin converting enzyme (angitensin converting enzyme).
enzyme, hereinafter abbreviated as ACE. ) is active due to the action of angiotensin (hereinafter abbreviated as ANG2).
is generated. Further, when ANG1 is acted upon by aminopeptidase, [des-Asp ¹ ]-ANG1 is generated, and when ACE acts on this, angiotensin (hereinafter abbreviated as ANG3) is generated. ANG2 acts on ANG2 receptors in peripheral arteries to increase blood pressure through vasoconstriction, and acts on the globus layer of the accessory cortex to promote aldesterone secretion. ANG3 has a blood pressure increasing effect of 23 to 50% that of ANG2, and an aldesterone secretion promoting activity comparable to that of ANG2. In this way, ANG1
It is an interesting substance as a precursor peptide of ANG2 and ANG3. The technical background of the present invention is so-called genetic manipulation technology. However, regarding the efficient production method of ANG1 using genetic manipulation,
unknown. As a result of modifying the E. coli-derived dihydrofolate reductase (hereinafter referred to as DHFR) gene, the present inventors have already developed a plasmid vector pTP70-1 (Japanese Unexamined Patent Application Publication No. 1983-1972) for expressing a heterologous gene.
46193) and pTP104-4 (Unexamined Japanese Patent Publication No. 1999-1-
144979) and a method for creating a fusion gene using it (Japanese Patent Application No. 302153/1982).
Furthermore, we have developed an efficient method for producing LEK by incorporating chemical DNA encoding leucine enkephalin (hereinafter abbreviated as LEK) into pTP104-4 (Japanese Patent Application Laid-open No. 102698/1983). efficient
The recombinant plasmid pLEK1 obtained when developing the method for producing LEK was created using restriction enzymes BamH and Mlu.
A fusion gene with DHFR can be easily created by simply replacing the sequence between the sites with foreign DNA.
Furthermore, when a fusion gene is created using pLEK1, the amount of the fusion protein obtained as a result of expression of the fusion gene accumulated in E. coli cells is expected to be approximately 20% of the total bacterial protein. However, ANG1
There is no example of using the above expression vector for the production of. Purpose of the Invention The purpose of the present invention is to develop a method for mass production of ANG1 using genetic engineering techniques, which has not yet been established. The present inventors have already constructed (1) an expression plasmid that expresses a large amount of E. coli DHFR (Japanese Patent Application Laid-open No. 62-69990), and (2) the carboxy-terminal sequence of E. coli DHFR. (3) The plasmid vector pTP104-4 has been constructed, which enables the fusion of a heterologous peptide to the carboxy-terminal side of E. coli DHFR (Japanese Patent Application Laid-open No. 1999-1-1). Publication No. 144979), (4)
The modified DHFR on pTP104-4 can be efficiently expressed in Escherichia coli. (5) A plasmid pLEK1 was created by incorporating a chemical DNA encoding LEK into pTP104-4, and the restriction enzyme BamH and Mlu sites of pLEK1 were used. By doing so, it is easy to create a fusion gene between heterologous DNA and DHFR (Japanese Patent Application Laid-Open No.
252290). The present inventors utilized the above knowledge and, as a result of intensive research, designed and chemically synthesized the ANG1 gene,
By integrating into pLEK1, the ANG1 gene and
By creating a fusion gene of the DHFR gene and expressing the fusion gene in E. coli, DHFR-
They discovered that ANG1 can be produced in large quantities, and further revealed that ANG1 can be effectively produced by using DHFR-ANG1, thereby completing the present invention. Structure of the Invention The present invention provides (1) a novel recombinant plasmid pANG1-23 that enables large-scale expression of DHFR-ANG1;
E. coli cells containing pANG1-23, (3) pANG1
-DHFR produced by E. coli containing -23-
from E. coli containing ANG1, (4) pANG1-23.
Separation and purification of DHFR-ANG1, and (5) DHFR-
The invention consists of a method for producing ANG1 using ANG1. (1) Novel recombinant plasmid pANG1-23 Figure 1 shows the entire nucleotide sequence of pANG1-23 of the present invention. The figure shows only one DNA strand sequence of a double-stranded circular DNA. Numbers are counted and written in the direction from the 5′ end to the 3′ end. pANG1-23 of the present invention is a novel recombinant plasmid. pANG1−23 is
It has a size of 4222 base pairs and can confer trimethoprim and ampicillin resistance to the host E. coli. pANG1−23 is pLEK1
A 28 base pair sequence containing the sequence encoding LEK between the BamH and Mlu sites of 43 base pairs of chemically synthesized DNA containing the sequence encoding ANG1
It has a structure that has been replaced with In Figure 1, the sequence from 533rd to 575th is chemically synthesized.
It is a sequence derived from DNA. Other arrays
This is a sequence derived from pLEK1. The array from 57th to 572nd in Figure 1 is as follows:
DHFR-ANG1, in which ANG1 is bound to the carboxy-terminal side of DHFR via methionine (Met)
is encrypted. Upstream of the sequence encoding DHFR-ANG1, there is a sequence that allows efficient expression of the DHFR-ANG1 gene (Japanese Unexamined Patent Publication No. 46193/1983). In other words, the array from 43rd to 50th is
For efficient translation, it is called SD array.
Furthermore, positions 4180 to 4208 are the consensus transcription promoter and contribute to efficient transcription. From this, pANG1−23 is
When introduced into E. coli, a wide variety of DHFR−
Make ANG1. The produced DHFR-ANG1 is soluble in the bacterial body and contains about 20% of the bacterial protein.
Accumulates about %. By this, pANG1
E. coli containing -23 becomes trimethoprim resistant. In addition, pANG1-23 is
Contains an ampicillin resistance gene derived from pLEK1. From this, E. coli into which pANG1-23 has been introduced also exhibits resistance to ampicillin.
pANG1-23 is introduced into E. coli and kept in a stable state, and E. coli containing pANG1-23 is
It has been deposited with the National Institute of Fine Technology as FERM BP-1819. pANG1-23 having such features can be constructed according to Example 1, but the present invention is not limited by the method of constructing the recombinant plasmid. (2) E. coli containing pANG1-23 E. coli containing pANG1-23 shows resistance to trimethoprim and ampicillin.
E. coli containing pANG1-23 is DHFR-
As a result of efficient expression of the ANG1 gene,
DHFR-ANG1 accumulates in large amounts in a soluble state within the bacterial body. E. coli containing pANG1-23 was grown in YT+Ap medium (in medium 1, 5 g of NaCl,
When cultured at 37° C. until the stationary phase using a liquid medium containing 8 g of tryptone, 5 g of yeast extract, and 50 mg of ampicillin sodium, the accumulated DHFR-ANG1 reaches about 20% of the bacterial protein. When cultured bacterial cells are suspended in an appropriate buffer such as phosphate buffer, disrupted by French press or sonication, and separated into supernatant and precipitate by centrifugation, almost all of the DHFR- ANG1 is recovered in the supernatant. E. coli containing pANG1-23 has been deposited with the Institute of Fine Technology as FERMBP-1819. (3) DHFR-ANG1 Figure 2 shows the DNA sequence encoding DHFR-ANG1 and the amino acid sequence of the protein predicted to be made from it.
DHFR-ANG1 is a novel protein consisting of 170 amino acids. The sequence from positions 1 to 159, counting from the amino terminal side, is a sequence in which one amino acid substitution has occurred in E. coli wild type DHFR (Cys-152 (wild type) → Glu-152), and from position 163 to Glu-152. The sequence up to the 172nd is ANG1. The amino acid immediately preceding the ANG1 sequence is methionine (Met). Due to this,
By treating DHFR-ANG1 with bromcyan, ANG1 can be specifically excised. The isoleucine (Ile)-leucine (Leu) sequences at positions 160 and 161 are BamH of pLEK1.
This sequence was created to match the reading frame of the genetic code when introducing DNA encoding ANG1 into the site (the origin of pLEK1).
DHFR produced by pTP104-4 consists of 162 amino acids, counting from the amino terminal side of the amino acid sequence of DHFR-ANG1 in Figure 2.
The sequence from position 160 to position 160 is a combination of two Gln-Ile amino acid sequences. ).
The molecular weights of DHFR-ANG1 and ANG1 are 19661 and 1297, respectively. DHFR-ANG1 is a novel protein. DHFR-ANG1 has a structure in which ANG1 is fused to the carboxy terminal side of DHFR, but it has DHFR enzyme activity. For this reason, when E. coli produces large amounts of DHFR-ANG1, it becomes resistant to trimethoprim, a DHFR inhibitor and antibacterial agent. (4) Separation and purification of DHFR-ANG1 The method for separating and purifying DHFR-ANG1 of the present invention is as follows:
It consists of the following steps: culture of bacterial cells, disruption of bacterial cells, DEAE-Toyopearl column treatment, mesotrixate (MTX)-conjugated affinity chromatography, and DEAE-Toyopearl column chromatography. Cultivation of bacterial cells Culture of E. coli containing pANG1-23 is as follows:
YT+Ap medium (5 g of NaCl in medium 1,
Liquid medium containing 8 g tryptone, 5 g yeast extract and 50 mg ampicillin sodium. ) can be cultured. Other media include ST+Ap medium (liquid medium containing 2g of glucose, 1g of dipotassium phosphate, 5g of polypeptone, 5g of yeast extract, and 50mg of ampicillin sodium in medium 1). Any growth medium can be used, but as far as we have investigated, DHFR-
YT+Ap medium was optimal for ANG1 production. E. coli containing pANG1-23 is inoculated into a medium and cultured at 37°C until the late logarithmic growth phase or stationary phase. Depending on the culture temperature,
The amount of DHFR-ANG1 accumulated varied, and as far as we investigated, the higher the culture temperature, the greater the amount accumulated. The cultured bacterial cells are collected by centrifugation at 5000 rpm. A wet weight of 2 to 4 g of bacterial cells can be obtained from 1 liter of culture medium. Bacterial collection and subsequent operations are performed at low temperatures (between 0 and 10°C, preferably 4°C) unless otherwise specified. Disruption of bacterial cells The bacterial cells obtained by culturing were suspended in buffer solution 1 (10 mM potassium phosphate buffer containing 0.1 mM sodium ethylenediaminetetraacetate (EDTA), PH 7.0) at 3 times the wet weight, Crush the bacterial cells using a French press. Centrifuge the cell suspension at 5000 rpm for 10 minutes to obtain a supernatant. Furthermore, the supernatant is subjected to ultracentrifugation at 35,000 rpm for 1 hour to obtain a supernatant (cell-free extract). DEAE-Toyopearl column treatment This operation is performed for the purpose of pretreatment for the next purification process. Prepare cell-free extract at 0.1M in advance.
Apply to a DEAE Toyopearl column equilibrated with Buffer 1 containing 0.1M KCl, and wash the column with Buffer 1 containing 0.1M KCl. Enzyme elution is
Perform using buffer 1 containing 0.3M KCl.
Fractionate a certain amount of the eluate using a fraction collector. About the fractionated eluate
Measure DHFR activity and collect fractions containing enzyme activity. MTX-bound affinity chromatography The enzyme solution obtained by the above procedure was pre-equilibrated with buffer 1 and then MTX-bound
Adsorb onto Sepharose affinity column. After adsorption, buffer 2 (0.1
Wash with 10 mM potassium phosphate buffer containing mM EDTA, pH 8.5). For washing, measure the absorbance of the eluate from the column at 280 nm, and continue to flow the same buffer until the absorbance becomes 0.1 or less. Elution of the enzyme is performed using Buffer 2 containing 1M KCl and 3mM folic acid, and the eluate is fractionated in fixed amounts using a fraction collector. DHFR for fractionated eluate
Measure the activity and collect fractions containing enzyme activity. The obtained enzyme solution is dialyzed against buffer solution 1 three times. At this stage, DHFR-ANG1 with a purity of 90% or more is obtained. DEAE-Toyopearl column chromatography The dialyzed enzyme solution is adsorbed onto a DEAE-Toyopearl column equilibrated with buffer solution 1 in advance. After adsorption, buffer 1 containing 0.1M KCl
wash with Washing is done by washing the eluate from the column.
Measure the absorbance at 280 nm, and continue to flow the same buffer until the absorbance becomes 0.01 or less. Enzyme elution was performed using buffer 1 from 0.1M to 0.3M.
A linear concentration gradient of KCl is used, and a fixed amount of the eluate is fractionated using a fraction collector. 280nm for fractionated eluate
The absorbance and DHFR activity are measured. Collect fractions with a constant value of enzyme activity/absorbance at 280 nm. Through the above operations, DHFR-ANG1 can be highly purified and homogenized with good reproducibility. According to the invention, the purification of DHFR-ANG1 consists of
It can be carried out within one week including culturing, and a homogeneous enzyme preparation can be obtained with a recovery rate of 45% or more. DHFR enzyme activity was determined using the reaction solution (0.05mM dihydrofolate, 0.06mM NADPH, 12mM 2-
The measurement is carried out by taking 1 ml of mercaptoethanol and 50 mM phosphate buffer (PH7.0) into a cuvette, adding the enzyme solution to the cuvette, and measuring the change in absorbance at 340 nm over time. One unit of enzyme is
Under the above reaction conditions, it is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute. This measurement can be easily performed using a spectrophotometer. (5) Production of ANG1 using DHFR-ANG1 Cleavage and separation of ANG1 from purified DHFR-ANG1 is performed by treatment with bromcyan. Lyophilize purified DHFR-ANG1,
Add to this 1 to 10 mg protein/ml.
After adding and dissolving 70% formic acid, add about 20 times the amount of crystalline bromic cyanide to the amount of protein, seal tightly, and react for 24 hours with stirring at room temperature under a nitrogen atmosphere. After diluting the reaction solution with 10 times the volume of water, freeze-dry to remove excess reagents, etc. 1 lyophilized sample
Dissolve in 30% acetic acid to give 10 mg protein/ml. The dissolved sample was collected using an HPLC device (Shimadzu).
LC-4A, inertsil-ODS column)
Elution and separation can be performed using a concentration gradient of 15% to 50% acetonitrile in 0.1% trifluoroacetic acid. Eluates can be detected by measuring absorbance at 220 nm. Figure 3 shows DHFR-
High performance liquid chromatogram of ANG1 sample is shown. The peak approximately 20 minutes after sample injection is ANG1. Separate this peak fraction. After drying the separated eluate using an evaporator, a small amount of water is added and lyophilized to remove the solvent, yielding ANG1. Furthermore, the amino acid composition can be confirmed by acid hydrolyzing the obtained peptide and then performing amino acid analysis. In the example of the present invention, bacterial cells with a wet weight of approximately 6 g were obtained from 3 liters of culture medium, and this bacterial cell (calculated approximately
Contains 60 mg DHFR-ANG1, approximately 4.0 mg ANG1. ), approximately 28 mg of DHFR-ANG1 (yield, 46.8
%, calculated to contain approximately 1.8 mg of ANG1. ), of which 10 mg of DHFR-
Approximately 0.36 mg of ANG1 could be obtained by treating ANG1 with bromcyane and then separating and purifying it by HPLC. Next, examples and reference examples of the present invention will be shown. Example 1 Creation of pANG1-23 The DNA encoding ANG1 is 1 5'- GATCCTGATGGATCGCGTGTACATCCA
CCCGTTCCACCTGTAA-3' 2 5'- CGCGTTACAGGTGGAACGGGTGGATGT
DNA consisting of two 43 nucleotides of ACACGCGATCCATCAG-3' was chemically synthesized according to the phosphoramidite method, and after purification, the 5' end of each DNA was phosphorylated using polynucleotide kinase. Approximately 0.1ml of phosphorylated DNA
(contains about 0.01 μg of DNA) and incubating it at 60°C.
The DNA was annealed (this is called DNA1). Approximately 1 μg of pLEK1 (Japanese Patent Application Laid-open No. 1-252290)
was digested with BamH and Mlu and then treated with alkaline phosphatase. By treating the alkaline phosphatase-treated DNA with phenol, the coexisting enzyme protein is denatured and removed.
The DNA was then precipitated with ethanol. After washing the precipitated DNA with 70% ethanol, the ethanol was removed and the precipitate was dried under reduced pressure. BamH
DNA cleavage, alkaline phosphatase treatment, phenol treatment, and ethanol precipitation are all performed as described in “Molecular Cloning A
Loboratory Manual” (T.Maniatis, EF
Fritsch, J. Sambrook, eds. Cold Spring
Harbor Laboratory (1982), hereinafter referred to as Document 1. ). Transfer the dried DNA to 50μ of ligase reaction solution (10m
M Tris-HCl, PH7.4, 5mM _MgCl2 , 10m
After dissolving in M dithiothreitol, 5mM ATP), add 5μ of DNA1, and add 1 unit of DNA1 to this.
Add T4-DNA ligase and keep at 10℃ for 12 hours.
A DNA ligation reaction was performed. This reaction product was transformed using a transformation method (reference 1 mentioned above).
was incorporated into E. coli according to the method described in . The treated bacterial cells were transferred to a nutrient agar medium containing 50 mg/ampicillin sodium and 10 mg/trimethoprim (in medium 1, 2 g glucose,
Contains 1g dipotassium phosphate, 5g yeast extract, 5g polypeptone, and 15g agar. )
By coating on the top and culturing at 37℃ for 24 hours,
We were able to obtain 33 colonies. Each of these colonies was added to 1.5 ml of YT+Ap medium (in medium 1, 5 g of NaCl, 5 g of yeast extract,
Contains 8g tryptone, 50mg ampicillin sodium. ), the bacterial cells were cultured overnight at 37°C.
Transfer the culture solution to each Etzpendorf centrifuge tube,
The cells were centrifuged at 12,000 rpm for 10 minutes and collected as a precipitate. Add to this 0.1ml of electrophoresis sample preparation solution (0.0625M Tris-HCl, PH6.8, 2%
of sodium lauryl sulfate (SDS), 10% glycerin, 5% 2-mercaptoethanol,
Contains 0.001% Bromophenol Blue. ) was added to suspend the bacterial cells, and this was kept in boiling water for 5 minutes to dissolve the bacterial cells. A sample that has undergone this treatment
SDS-polyacrylamide gel electrophoresis (U.
K. Lammli; Nature, vol. 227, p. 680 (1970)). pTP70− as a standard sample
E. coli containing 1 was treated in the same way, and lactalbumin (molecular weight 14200) and trypsin inhibitor (molecular weight
20100), trypsinogen (molecular weight 24000), carbonic anhydrase (molecular weight 29000), glyceraldehyde 3-phosphate dehydrogenase (molecular weight 36000), egg albumin (molecular weight 45000), and bovine serum albumin (molecular weight 66000). A gradient gel of 10 to 20% polyacrylamide concentration was run. As a result, the DHFR band of pLEK1 disappeared in 3 of the 33 colonies, indicating that they were producing a new protein with a clearly larger molecular weight (estimated to have a molecular weight of approximately 23,000). , and for the remaining 30 pieces,
It was revealed that pLEK1 produces a protein that is approximately the same size as DHFR-LEK (which migrates as a protein with a molecular weight of approximately 22,000). Select one strain from among the colonies that produce a new protein with a large molecular weight, and inject this into each colony.
Cultivate in YT+Ap medium and use Tanaka and Weisblum's method (T. Tanaka, B. Weisblum; J.
Bacteriology, vol. 121, p. 354 (1975)), the plasmid was prepared. The obtained plasmid was named pANG1-23. pANG1−231 is
The sequence between the BamH and Mlu sites of pLEK1 should have been replaced with the synthetic DNA. EcoR of pANG1−23 (471− in Figure 1)
About 100 nucleotides of DNA obtained by cleavage with 476th sequence) and Sal (581st to 586th sequence in Figure 1) were subjected to the dideoxy method using M13 phage (J. Messing; Mehtods in
Enzymology, vol.101, p.20 (1983)),
The base sequence was determined. As a result, the sequence from position 471 to approximately position 586 of the sequence shown in FIG. 1 was confirmed. The base sequence of pLEK1 has been revealed by the present inventors (Japanese Unexamined Patent Publication No. 1-252290).
The EcoR-Mlu sequence of pANG1-13 is
The 28 base pair sequence between EcoR and Mlu of pLEK1 was designed and synthesized as a sequence encoding ANG1.
The sequence replaced 43 base pairs of DNA. In addition, the approximately 4.2 kilobase pair DNA obtained by EcoR-Mlu cleavage of pANG1-23 is Pst,
Hind, Hpa, Aat, Pvu, Bgl, Sal
The results of restriction enzyme cleavage experiments using Cla and Cla showed that the DNA was completely identical to the approximately 4.2 kilobase pair DNA obtained by EcoR-Mlu cleavage of pLE1. From the above results, it was determined that the entire base sequence of pANG1-23 is the sequence shown in FIG. Example 2 DHFR- produced by E. coli containing pANG1-23
DHFR− produced by E. coli containing ANG1 pANG1−23
The amino acid sequence of ANG1 can be predicted from the base sequence of the DHFR-ANG1 gene. Figure 1
Since the sequence from positions 57 to 572 encodes DHFR-ANG1, the amino acid sequence was estimated using the Torplett code table. As a result, the amino acid sequence shown in FIG. 2 was obtained. From E. coli containing pANG1-23, DHFR-
We isolated and purified ANG1 and investigated the properties of the purified protein. Purification of DHFR-ANG1 A Amount of bacterial cells used: wet weight 6 g B Enzyme purification table The purification process in the table is cell-free extract,
DEAE-Toyopearl column treatment, mesotrixate-coupled affinity chromatography,
and DEAE-Toyopearl Column Chromatography.

[Table] DHFR enzyme activity was measured using the reaction solution (0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 50mM phosphate buffer (PH).
7.0)) was carried out by taking a 1 ml cuvette, adding the enzyme solution thereto, and measuring the change in absorbance at 340 nm over time. One unit of enzyme was defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. When the obtained enzyme protein was analyzed by SDS electrophoresis (method described in the above example),
Approximately 23,000 single protein bands were shown, indicating that the obtained enzyme preparation was homogeneous. Properties of isolated and purified DHFR-ANG1 When the purified protein exhibiting DHFR activity was examined by enzyme immunoassay,
It was shown to react with antibodies against ANG1.
In other words, the purified protein is immunologically
It was revealed that it has a structure equivalent to ANG1. In order to clarify the amino acid sequence of the carboxy-terminal side of the purified protein, carboxypeptidase Y was applied to the purified protein at varying times, and the released amino acids were quantified (using the carboxypeptidase method). Method for determining the carboxy-terminal amino acid sequence). the result,
-Tyr-Ile-His-Pro-Phe-His-Leu (carboxy terminal) was expected. Furthermore, when the purified protein was subjected to acid hydrolysis and then subjected to amino acid analysis, results were obtained that matched the amino acid composition expected from the base sequence. Example 3 Separation of ANG1 from purified and separated DHFR-ANG1 The purified protein obtained in Example 2 (approximately 10 mg,
About 508 nmole of DHFR-ANG1) was freeze-dried,
Dissolve this in 2ml of 70% formic acid and add about 200mg
Bromsyanide was added and dissolved, the mixture was sealed tightly under a nitrogen atmosphere, and the mixture was allowed to react at room temperature with stirring for 24 hours. After the reaction, 20 ml of water was added and then freeze-dried.
The specimen obtained by freeze-drying was dissolved in 10 ml of 30% acetic acid. 0.5ml of it (approximately 25nmole)
(which should contain DHFR-ANG1) was separated using an HPLC device (Shimadzu LC-4A) and an Inertsil-ODS 5 μm column. Elution is a concentration gradient of acetonitrile (15% to 50%) in 0.1% trifluoroacetic acid.
This was done by multiplying. From 0 to 2 minutes,
A linear concentration gradient of 15% to 50% acetonitrile was applied from 2 minutes to 32 minutes using 15% acetonitrile. As a result, an elution curve as shown in FIG. 3 was obtained. The peak about 20 minutes after sample injection was collected, and the separated eluate was dried in an evaporator, and a small amount of water was added and lyophilized to remove the solvent to obtain the peptide. The obtained peptide was acid-hydrolyzed,
A quarter of the volume was used for amino acid analysis. As a result, aspartic acid (Asp), valine (Val), leucine (Leu), isoleucine (Ile), tyrosine (Tyr), phenylalanine (Phe), histidine (His), arginine (Arg), and proline (Pro ) are 3.2, 2.4, 3.0, 2.5, 2.4, respectively.
3.0, 5.6, 2.9 and 3.1 nmole were detected. The amino acid composition was consistent with that of ANG1, and the preparation used for amino acid analysis was approximately
It was revealed that it contained 2.8 nmole (approximately 3.6 μg) of ANG1. Using this result, by separating 0.5 ml of the specimen obtained by treating with bromic cyanide using HPLC, the yield will be approximately 58%.
(3.6x4nmole/25nmole) and by repeating this operation 20 times.
It is shown that approximately 360 μg of ANG2 is obtained from 10 mg of DHFR-ANG1. In addition, the yield of purification of DHFR-ANG1 was approximately 47%.
Since the yield of separation of ANG1 from DHFR-ANG1 is approximately 58%, ANG1 produced by E. coli
The isolation yield of the peptide moiety is calculated to be approximately 27%. Effects of the invention As mentioned above, the novel recombinant plasmid pANG1
-23 encodes DHFR-ANG1, and E. coli containing pANG1-23 is DHFR-ANG1.
Accumulates and produces large amounts of ANG1 in a soluble state. Furthermore, the produced DHFR-ANG1 retains DHFR enzyme activity and can be easily purified. Furthermore, ANG1 can be easily isolated by treating DHFR-ANG1 with bromide cyanide and then separating it by HPLC. Because it has such properties, the present invention is useful for DHFR-ANG1 and the production of ANG1 using the same.

[Brief explanation of drawings]

FIG. 1 shows the entire base sequence of pANG1-23, in which only one DNA strand sequence of the double-stranded DNA is written in the direction from the 5' end to the 3' end. The symbols in the figure represent nucleic acid bases; A represents adenine, C represents cytosine, G represents guanine, and T represents thymine. The numbers in the figure are 1 for pANG1-23.
The cleavage recognition site of the restriction enzyme Cla,
5'-ATCGAT-3', the first "A" is counted as number 1. Figure 2 shows pANG1
FIG. 2 is a diagram showing the base sequence of the portion encoding DHFR-ANG1 present in -23 and the amino acid sequence of the protein. The symbols in the figure represent nucleobases and amino acids, A for adenine, C for cytosine, G for guanine, T for thymine, Ala for alanine, Arg for arginine, Asn for asparagine, and Asp for asparagine. Acid, Cys is cysteine, Gln is glutamine, Glu is glutamic acid, Gly is glycine, His is histidine, Ile
is isoleucine, Leu is leucine, Lys is lysine, Met is methionine, Phe is phenylalanine, Pro is proline, Ser is serine,
Thr represents threonine, Trp represents tryptophan,
Tyr represents tyrosine and Val represents valine.
The numbers in the figure indicate the numbers counted starting from "A" of the ATG codon that encodes the first amino acid, methionine. FIG. 3 shows a high performance liquid chromatogram of a DHFR-ANG1 sample treated with bromocyanide. The horizontal axis represents the time after sample injection in minutes, and the vertical axis represents the absorbance at 220 nm in arbitrary units. The peak indicated by the arrow
This is the elution peak of ANG1.

Claims (1)

[Claims] 1. A DNA that is stably replicated in E. coli, can confer trimethoprim resistance and ampicillin resistance to the host E. coli, has a size of 4222 base pairs, and has the DNA sequence shown in FIG. Novel recombinant plasmid pANG1-23. 2 E. coli containing pANG1-23. 3. A dihydrofolate reductase-angiotensin fusion protein produced by E. coli containing pANG1-23 and having the amino acid sequence shown in FIG. 4. E. coli containing pANG1-23 was cultured, and dihydrofolate reductase-angiotensin fusion protein was extracted from the cell-free extract of the cultured cells using dihydrofolate reductase activity, treated with an ion exchange column, and mesotrixate-conjugated affinizer. 1. A method for separating and purifying a dihydrofolate reductase-angiotensin fusion protein, the method comprising purifying a dihydrofolate reductase-angiotensin fusion protein using column chromatography and anion exchange column chromatography. 5. A method for producing angiotensin, which comprises decomposing a dihydrofolate reductase-angiotensin fusion protein produced by Escherichia coli containing pANG1-23 by a bromcyan degradation method, and then separating and purifying angiotensin.