JPH0354556B2 - - Google Patents

Description

[Detailed description of the invention]

Industrial Application Field The present invention is directed to the use of methionine-enkephalin (Tyr-Gly-Gly-Phenylalanine (Phe)-Met), a peptide that exhibits morphine-like analgesic action. A peptide consisting of a 5 amino acid sequence, hereinafter:
It is abbreviated as MEK. ), a novel recombinant plasmid pMEK2 that enables large-scale production of fusion proteins containing
Escherichia coli contained in pMEK2, dihydrofolate reductase with MEK on the carboxy-terminal side of the enzyme -
MEK fusion protein (hereinafter abbreviated as DHFR-MEK), DHFR-MEK separation and purification method, and
This relates to a method for producing MEK. The novel recombinant plasmid pMEK2 of the present invention has the DNA sequence shown in FIG. The present invention is suitable for fields such as fermentation industry and pharmaceutical industry. Conventional technology MEK is leucine enkephalin (hereinafter referred to as
Abbreviated as LEK. ), it is known as an endogenous peptide that exhibits morphine-like analgesic effects, and is an interesting physiologically active peptide that is expected to be used as a non-addictive analgesic or anesthetic. The analgesic effect of MEK is
It is said to be approximately 1.5 times that of LEK. The technical background of the present invention is so-called genetic manipulation technology. However, regarding the efficient production method of MEK using genetic manipulation,
unknown. On the other hand, the present inventors have already developed a plasmid vector pTP70-1 for heterologous gene expression (Japanese Patent Application Laid-Open No.
63-46193) and a method for creating a fusion gene using the same (Japanese Patent Application Laid-open No. 144992/1999). When these methods are used, the amount of the fusion protein obtained as a result of the expression of the fusion gene accumulated in E. coli cells is expected to be approximately 20% of the total cell protein. However, there is no example of using the above expression vector for MEK production. Purpose of the Invention The purpose of the present invention is to develop a method for mass production of MEK using genetic engineering techniques, which has not yet been established. The present inventors have already constructed (1) an expression plasmid that expresses a large amount of E. coli DHFR (Japanese Patent Application Laid-open No. 62-69990), and (2) the carboxy-terminal sequence of E. coli DHFR. (3) We have constructed a plasmid vector pTP70-1 that makes it possible to fuse a heterologous peptide to the carboxy-terminal side of E. coli DHFR (Japanese Patent Laid-Open No. 63 −46193), (4)
It has been revealed that the modified DHFR on pTP70-1 is efficiently expressed in E. coli. Utilizing the above knowledge and as a result of intensive research, the present inventors chemically synthesized the MEK gene and pTP70-1
They discovered that DHFR-MEK could be produced in large quantities by creating a fusion gene between the MEK gene and DHFR gene and expressing the fusion gene in E. coli.
- It was revealed that MEK can be effectively produced by using MEK, and the present invention was completed. Structure of the Invention The present invention provides (1) a novel recombinant plasmid pMEK2 that enables large-scale expression of DHFR-MEK;
E. coli cells containing pMEK2, (3) DHFR-MEK produced by E. coli containing pMEK2, (4)
DHFR-MEK from E. coli containing pMEK2
separation and purification, and (5) using DHFR-MEK.
The invention consists of a method for producing MEK. (1) Novel recombinant plasmid pMEK2 Figure 1 shows the entire nucleotide sequence of pMEK2 of the present invention. The figure shows that only one DNA strand sequence of the double-stranded circular DNA is cut at the 5'-ATCGAT-
3', the first "A" is counted as number 1, and it is written in the direction from the 5' end to the 3' end. of the present invention
pMEK2 is a novel recombinant plasmid.
pMEK2 has a size of 4640 base pairs and can confer trimethoprim and ampicillin resistance to the host E. coli. pMEK2
has a structure in which 32 base pairs of chemically synthesized DNA containing a sequence encoding MEK is bound to the BamH site of pTP70-1. In Figure 1,
The sequence from 533rd to 564th is chemically synthesized DNA
This is the origin sequence. Other sequences are pTP70
-1-derived sequence. Restriction enzymes are used to sequence chemically synthesized DNA.
The Xho recognition cleavage site, 5'-CTCGAG-3' (sequence from position 558 to position 563 in Figure 1), is included. The part derived from pTP70-1 contains
No Xho site is present. Therefore, pMEK2
By replacing the sequence from the BamH site (sequence 532nd to 537th in Figure 1) to the Xho site with another sequence, we introduce the foreign DNA in a determined direction and create a fusion gene with the DHFR gene. can be done even more easily. The array from 57th to 554th in Figure 1 is as follows:
MEK encodes DHFR-LEK, which is bound to the carboxy-terminal side of DHFR via arginine. Upstream of the sequence encoding DHFR-LEK,
There is a sequence that allows efficient expression of the DHFR-LEK gene (Japanese Patent Application Laid-Open No. 63-46193).
In other words, the sequence from 43rd to 50th is called the SD sequence, which is useful for efficient translation and
Positions 4598 to 4626 are the consensus transcription promoter and contribute to efficient transcription. From this, pMEK2 produces many types of DHFR-MEK when introduced into E. coli.
The produced DHFR-LEK accumulates in a soluble state within the bacterial body, accounting for approximately 20% of the bacterial protein. This makes E. coli containing pMEK2 resistant to trimethoprim.
Furthermore, pMEK2 has an ampicillin resistance gene derived from pTP70-1. From this, E. coli into which pMEK2 has been introduced also exhibits resistance to ampicillin. pMEK2 is introduced into Escherichia coli and kept in a stable state, and the Escherichia coli containing pMEK2 has been deposited as FERMBP-1816 at the Institute of Fine Technology. pMEK2 having such features can be constructed according to Example 1, but the present invention is not limited by the method for constructing the recombinant plasmid. (2) E. coli containing pLEK1 E. coli containing pMEK2 shows resistance to trimethoprim and ampicillin.
E. coli containing pMEK2
As a result of efficient expression of the DHFR-MEK gene, a large amount of DHFR-MEK is accumulated in the bacterial body in a soluble state. E. coli containing pMEK2
YT + Ap medium (in 1 liter of medium, 5 g of NaCl, 8
g of tryptone, 5 g of yeast extract, and
When cultured at 37°C until the stationary phase using a liquid medium containing 50 mg of ampicillin sodium, the accumulated DHFR-MEK reaches approximately 20% of the bacterial protein. When cultured bacterial cells are suspended in an appropriate buffer such as phosphate buffer, disrupted by French press or sonication, and separated into supernatant and precipitate by centrifugation, almost all of the DHFR- MEK is recovered in the supernatant. E. coli containing pMEK2 was sent to the Microtech Institute.
It has been deposited as FERMBP-1816. (3) DHFR-MEK Figure 2 shows the DNA sequence encoding DHFR-MEK and the amino acid sequence of the protein predicted to be made from it.
DHFR-MEK is a novel protein consisting of 166 amino acids. The sequence from positions 1 to 159, counting from the amino terminal side, is a sequence in which one amino acid substitution has occurred in E. coli wild type DHFR (Cys-152 (Wild type) → Glu-152), and from position 162 to Glu-152. The MEK array is up to the 166th. The amino acid immediately preceding the MEK sequence is arginine (Arg). Due to this,
By treating DHFR-MEK with trypsin, MEK can be specifically excised.
Isoleucine (Ile) at position 160 is pTP70−
DNA encoding MEK at the BamH site of 1
This sequence was created to match the reading frame of the genetic code when introducing the gene. DHFR produced by pTP70-1 consists of 162 amino acids, and of the amino acid sequence of DHFR-MEK shown in Figure 2,
The sequence from positions 1 to 160 counting from the amino terminus is a combination of two Gln-Ile amino acid sequences. The molecular weight of DHFR-MEK is 18,850. DHFR-MEK is a novel protein. DHFR-MEK has a structure in which MEK is fused to the carboxy terminal side of DHFR, but it has DHFR enzyme activity. For this reason, when E. coli produces large amounts of DHFR-MEK, it becomes resistant to trimethoprim, a DHFR inhibitor and antibacterial agent. (4) Separation and purification of DHFR-MEK The method for separating and purifying DHFR-MEK of the present invention is as follows:
It consists of the following steps: culture of bacterial cells, disruption of bacterial cells, DEAE-Toyopearl column treatment, mesotrixate (MTX)-conjugated affinity chromatography, and DEAE-Toyopearl column chromatography. Culture of bacterial cells Culture of E. coli containing pMEK2 is carried out using YT
+Ap medium (5 g NaCl, 8 g in 1 liter medium)
of tryptone, 5g of yeast extract and
Liquid medium containing 50 mg ampicillin sodium. ) can be cultured. In addition to this, other media include ST+Ap medium (2 liters per liter of medium).
g glucose, 1 g dipotassium phosphate,
Liquid medium containing 5 g polypeptone, 5 g yeast extract and 50 mg ampicillin sodium. ), any medium can be used as long as it allows the bacterial cells to grow, but as far as we have investigated, YT+Ap medium is optimal for producing DHFR-MEK. E. coli containing pMEK2 is inoculated into a medium and cultured at 37°C until the late logarithmic growth phase or stationary phase. Depending on the culture temperature,
The amount of DHFR-MEK accumulated varied, and as far as we investigated, the higher the culture temperature, the greater the amount accumulated. The cultured bacterial cells are collected by centrifugation at 5000 rpm. A wet weight of 2 to 4 g of bacterial cells can be obtained from 1 liter of culture medium. Bacterial collection and subsequent operations are performed at low temperatures (between 0 and 10°C, preferably 4°C) unless otherwise specified. Disruption of bacterial cells The bacterial cells obtained by culturing were suspended in buffer solution 1 (10 mM potassium phosphate buffer containing 0.1 mM sodium ethylenediaminetetraacetate (EDTA), PH 7.0) at 3 times the wet weight, Crush the bacterial cells using a French press. Centrifuge the cell suspension at 5000 rpm for 10 minutes to obtain a supernatant. Furthermore, the supernatant is subjected to ultracentrifugation at 35,000 rpm for 1 hour to obtain a supernatant (cell-free extract). DEAE-Toyopearl column treatment This operation is performed for the purpose of pretreatment for the next purification process. Prepare cell-free extract at 0.1M in advance.
Apply to a DEAE Toyopearl column equilibrated with Buffer 1 containing 0.1M KCl, and wash the column with Buffer 1 containing 0.1M KCl. Enzyme elution is
Perform using buffer 1 containing 0.3M KCl.
Fractionate a certain amount of the eluate using a fraction collector. About the fractionated eluate
Measure DHFR activity and collect fractions containing enzyme activity. MTX binding affinity chromatography The enzyme solution obtained by the above procedure was equilibrated with buffer 1 beforehand.
Adsorb onto Sepharose affinity column. After adsorption, buffer 2 (0.1
Wash with 10 mM potassium phosphate buffer containing mM EDTA, pH 8.5). For washing, measure the absorbance of the eluate from the column at 280 nm, and continue to flow the same buffer until the absorbance becomes 0.1 or less. Elution of the enzyme is performed using Buffer 2 containing 1M KCl and 3mM folic acid, and the eluate is fractionated in fixed amounts using a fraction collector. DHFR for fractionated eluate
Measure the activity and collect fractions containing enzyme activity. The obtained enzyme solution is dialyzed against buffer solution 1 three times. At this stage, DHFR-MEK with a purity of 90% or more is obtained. DEAE-Toyopearl column chromatography The dialyzed enzyme solution is adsorbed onto a DEAE-Toyopearl column equilibrated with buffer 1 in advance. After adsorption, buffer 1 containing 0.1M KCl
wash with Washing is done by washing the eluate from the column.
Measure the absorbance at 280 nm, and continue to flow the same buffer until the absorbance becomes 0.01 or less. Enzyme elution was performed using buffer 1 from 0.1M to 0.3M.
A linear concentration gradient of KCl is used, and a fixed amount of the eluate is fractionated using a fraction collector. 280nm for fractionated eluate
The absorbance and DHFR activity are measured. Collect fractions with a constant value of enzyme activity/absorbance at 280 nm. Through the above operations, DHFR-MEK can be highly purified and homogenized with good reproducibility. According to the invention, the purification of DHFR-MEK consists of
It can be carried out within one week including culturing, and a homogeneous enzyme preparation can be obtained with a recovery rate of 50% or more. DHFR enzyme activity was determined using the reaction solution (0.05mM dihydrofolate, 0.06mM NADPH, 12mM 2-
The measurement is carried out by taking 1 ml of mercaptoethanol and 50 mM phosphate buffer (PH7.0) into a cuvette, adding the enzyme solution to the cuvette, and measuring the change in absorbance at 340 nm over time. One unit of enzyme is
Under the above reaction conditions, it is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute. This measurement can be easily performed using a spectrophotometer. (5) Production of MEK using DHFR-MEK MEK is cleaved and separated from purified DHFR-MEK by treatment with trypsin. Trypsin is applied in buffer solution 1 at 30° C. in an amount of 1/100 of DHF-MEK. The trypsin cleavage reaction is almost completely completed in about 90 minutes. Add 1/2 volume of acetic acid to the trypsinization solution. Trypsin-treated samples were collected using an HPLC device (Shimadzu).
LC-4A, inertsil-0DS column)
Elution and separation can be performed using a concentration gradient of 15% to 50% acetonitrile in 0.1% trifluoroacetic acid. Eluates can be detected by measuring absorbance at 220 nm. Figure 3 shows a high performance liquid chromatogram of a trypsinized DHFR-MEK sample. The peak approximately 15 minutes after sample injection is MEK. Separate this peak fraction. After drying the separated eluate using an evaporator, MEK can be obtained by adding a small amount of water and freeze-drying to remove the solvent.
Furthermore, the amino acid composition can be confirmed by acid hydrolyzing the obtained peptide and then performing amino acid analysis. In the example of the present invention, bacterial cells with a wet weight of approximately 11 g were obtained from 3 liters of culture medium, and this bacterial cell (calculated approximately
Contains 115 mg DHFR-MEK, approximately 3.5 mg MEK. )
Approximately 63 mg of DHFR-MEK (yield: 54.7%, calculated to contain approximately 1.9 mg of MEK) can be obtained by purification, and 20 mg of DHFR-MEK was treated with trypsin, then separated and purified by HPLC. By doing approx.
We were able to obtain 0.48 mg of MEK. Next, examples and reference examples of the present invention will be shown. Example 1 Creation of pMEK2 The DNA encoding MEK is 1 5'- GATCCGTTACGGTGGTTTCATGTAAC
TCGAGA-3' 2 5'- GATCTCTCGAGTTACATGAAACCACCG
DNA consisting of two 32 nucleotides of TAACG-3' was chemically synthesized according to the phosphoramidite method, and after purification, the 5' end of each DNA was phosphorylated using polynucleotide kinase. Approximately 0.1ml of phosphorylated DNA
(contains about 0.01 μg of DNA) and incubating it at 60°C.
The DNA was annealed (this is called DNA1). Approximately 1 μg of pTP70-1 was cleaved with BamH and then treated with alkaline phosphatase. The alkaline phosphatase-treated DNA was treated with phenol to denature and remove coexisting enzyme proteins, and then the DNA was precipitated with ethanol. After washing the precipitated DNA with 70% ethanol,
The ethanol was removed and the precipitate was dried under reduced pressure.
The operations of DNA cleavage with BamH, alkaline phosphatase treatment, phenol treatment, and ethanol precipitation are all performed using the “Molecular
Cloning A Loboratory Manual” (T.
Maniatis, EFFritsch, J. Sambrook, eds.Cold
Spring Harbor Laboratory (1982), hereinafter referred to as Document 1. ).
Add the dried DNA to 50 μl of ligase reaction solution (10
mM Tris-HCl, PH7.4, 5mM _MgCl2 , 10
After dissolving in 5mM dithiothreitol, 5mM ATP), add 5μl of DNA1, and add 1 unit of DNA1 to this.
Add T4-DNA ligase and keep at 10℃ for 12 hours.
A DNA ligation reaction was performed. This reaction product was transformed using a transformation method (reference 1 mentioned above).
was incorporated into E. coli according to the method described in . The treated cells were transferred to a nutrient agar medium (medium 11 containing 50 mg/ml ampicillin sodium and 10 mg/ml trimethoprim, 2 g glucose, 1 g
of dipotassium phosphate, 5 g of yeast extract, 5
Contains 15g of polypeptone and 15g of agar. ) and cultured at 37°C for 24 hours, we were able to obtain 19 colonies. Select 8 of these colonies and add 1.5 ml of YT+Ap medium (in medium 11, 5 g of NaCl, 5 g of yeast extract,
Contains 8g tryptone, 50mg ampicillin sodium. ), the bacterial cells were cultured overnight at 37°C.
Transfer the culture solution to each Etzpendorf centrifuge tube,
The cells were centrifuged at 12,000 rpm for 10 minutes and collected as a precipitate. Add to this 0.1ml of electrophoresis sample preparation solution (0.0625M Tris-HCl, PH6.8, 2%
sodium lauryl sulfate (SDS), 10% glycene, 5% 2-mercaptoethanol, 0.001
Contains % Bromophenol Blue. ) and
The bacterial cells were suspended and kept in boiling water for 5 minutes to dissolve the bacterial cells. SDS−
Polyacrylamide gel electrophoresis (UK
Lammli; Nature, vol. 227, p. 680 (1970)). pTP70-1 as standard sample
Escherichia coli containing
20100), trypsinogen (molecular weight 24000), carbonic anhydrase (molecular weight 29000), glyceraldehyde 3-phosphate dehydrogenase (molecular weight 36000), egg albumin (molecular weight 45000), and bovine serum albumin (molecular weight 66000). A gradient gel of 10 to 20% polyacrylamide concentration was run. As a result, in 4 of the 8 colonies (hereinafter referred to as type C recombinants), the DHFR band of pTP70-1 disappeared, and a protein whose molecular weight was clearly larger than that of pTP70-1 was found. (The molecular weight is estimated to be approximately 22,000.) In addition, the three colonies (hereinafter referred to as R-type recombinants)
The DHFR band of pTP70-14 disappeared, and a protein with a clearly larger molecular weight was detected.
(estimated molecular weights of approximately 21,500 and 23,500, respectively) are newly produced, and the remaining 1
pTP70-1 produces a protein with approximately the same size as DHFR, and DHFR (molecular weight
18379) was found to migrate as a protein with a molecular weight of approximately 21,000 under these conditions. One strain each was selected from the C-type and R-type recombinants, and each strain was cultured in YT+Ap medium.
Tanaka and Weisblum's method (T.Tanaka, B.
Weisblum; J.Bacteriology, vol.121, p.354
(1975)). The obtained plasmids were named pMEK2 and pMEK1. pMEK1 or pMEK2 is pTP70-1
It should have a structure in which a chemically synthesized DNA sequence is inserted into the BamH site of . Synthetic DNA contains a sequence recognized by the limiting oxygen Xho, 5′-
Since CTCGAG−3′ is included, Xho
When we tried to cleave pLEK1 and pMEK2, they were indeed cleaved. Also, pMEK1 and pMEK2
EcoR (sequences 471-476 in Figure 1) and Sal
(Sequences 85-862 in Figure 1) were used to obtain approximately 400 nucleotides of DNA using the dideoxy method using M13 phage (J.
Messing;Mehtods in Enzymology, vol.101,
20 (1983)), the base sequence was determined. As a result, the sequence of pMEK2 from position 471 to approximately position 857 of the sequence shown in FIG. 1 was confirmed. On the other hand, in pME1, it was revealed that the sequence from position 533 to position 567 is reversed. That is, pMEK1 and pMEK2 were chemically synthesized.
It was revealed that the DNA sequences were inserted into the BamH site of pTP70-1 in opposite directions. Furthermore, by examining the nucleotide sequence, it became clear that pMEK2 encodes DHER-MEK. Therefore, pMEK2 is the recombinant plasmid of interest. The nucleotide sequence of pTP70-1 has been revealed by the present inventors (Japanese Unexamined Patent Publication No. 63-46193), and the sequence of EcoR-Sal of pMEK2 is
BamH between EcoR-Sal of pTP70-1
This is a sequence in which a 32 nucleotide long sequence is inserted at the site. In addition, the approximately 4.2 kilobase pair DNA obtained by EcoR-Sal cleavage of pMEK2 is Pst,
The results of restriction enzyme cleavage experiments using Hind, Pha, Aat, Pvu, Bgl, and Cla revealed that the DNA is exactly the same as the approximately 4.2 kilobase pair DNA obtained by EcoR-Sal cleavage of pTP70-1. Shown. From the above results, the entire base sequence of pMEK2 is the first
The arrangement shown in the figure was decided upon. Example 2 DHFR produced by E. coli containing pMEK2
DHFR produced by E. coli containing MEK pMEK2
The amino acid sequence of MEK can be predicted from the base sequence of the DHFR-MEK gene. Figure 1
Since the sequence from positions 57 to 554 encodes DHFR-MEK, the amino acid sequence was deduced using a triplet code table. As a result, the amino acid sequence shown in FIG. 2 was obtained. From E. coli containing pMEK2, DHFR-
MEK was isolated and purified, and the properties of the purified protein were investigated. Purification of DHFR-MEK A Amount of bacterial cells used: wet weight 11g B Enzyme purification table The purification process in the table is cell-free extract,
DEAE-Toyopearl column treatment, mesotrixate-coupled affinity chromatography,
and DEAE-Toyopearl Column Chromatography.

[Table] DHFR enzyme activity was measured using the reaction solution (0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 50mM phosphate buffer (PH).
7.0)) was carried out by taking a 1 ml cuvette, adding the enzyme solution thereto, and measuring the change in absorbance at 340 nm over time. One unit of oxygen was defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. When the obtained enzyme protein chamber was analyzed by SDS electrophoresis (method described in the above example),
Approximately 22,000 single protein bands were shown, indicating that the obtained enzyme preparation was homogeneous. Properties of isolated and purified DHFR-MEK When the purified protein exhibiting DHFR activity was examined by enzyme immunoassay,
It was shown to react with antibodies against ME. In other words, the purified protein is immunologically
It was revealed that it has a structure equivalent to MEK. In order to clarify the amino acid sequence of the carboxy-terminal side of the purified protein, carboxypeptidase Y was applied to the purified protein at varying times, and the released amino acids were quantified (using the carboxypeptidase method). Method for determining the carboxy-terminal amino acid sequence). the result,
-Gly-Gly-Met (carboxy terminal) was expected. Furthermore, when the purified protein was subjected to acid hydrolysis and then subjected to amino acid analysis, results were obtained that matched the amino acid composition expected from the base sequence. Example 3 Separation of MEK from purified and separated DHFR-MEK 2 ml of the purified protein solution obtained in Example 2 (approximately 20 mg, approximately 1060 nmole of DHFR-MEK in buffer 1)
(containing MEK), add 0.2 mg of trypsin,
Incubate for 90 minutes at °C. After the reaction, add 1 ml of acetic acid. Of this, 0.5 ml (approximately 177 nmole of DHFR−
(should contain MEK) and lnertsil-
Separation was performed using an 0DS 5μm column. Elution was performed using a gradient of acetonitrile (15%) in 0.1% trifluoroacetic acid.
% to 50%). From 0 to 2 minutes, 15% acetonitrile was used, and from 2 minutes to 32 minutes, a linear gradient of 15% to 50% acetonitrile was applied. As a result, an elution curve as shown in FIG. 3 was obtained. The peak fraction approximately 15 minutes after sample injection was separated, and the separated eluate was dried in an evaporator, and a small amount of water was added and lyophilized to remove the solvent to obtain a peptide. After acid hydrolysis of the obtained peptide, one-tenth of the peptide was used for amic acid analysis. As a result, tyrosine, glycine, phenylalanine, and methionine were each 14.1,
27.5, 13.8 and 13.9 nmole were detected. The amino acid composition is consistent with that of MEK,
In addition, the analyzed sample contained approximately 13.9 nmole (approximately 8.0 μg).
It became clear that it contained MEK. Using this result, by separating 0.5 ml of the sample obtained by trypsin treatment using HPLC, the yield is approximately 79% (13.9x10 nmole/177 nmole).
We were able to recover MEK, and by repeating this operation, approximately 480μ was recovered from 20mg of DHFR-MAK.
It is shown that 8.0 μg×10×6 of MEK can be obtained. Furthermore, the yield of purification of DHFR-MEK is approximately 55%, and the yield of separation of LEK from DHFR-MEK is approximately
80%, it is calculated that the isolation yield of the peptide portion of MEK produced by E. coli is approximately 44%. Effects of the invention As mentioned above, the novel recombinant plasmid pMEK2
encrypts DHFR-MEK and
E. coli harboring pMEK2 accumulates and produces large amounts of DHFR-MEK in a soluble state. Furthermore, the produced DHFR-MEK retains DHFR enzyme activity and can be easily purified. Also,
MEK can be easily isolated by treating DHFR-MEK with trapsin and then separating it by HPLC. Because of these properties, the present invention provides DHFR-MEK and MEK using the same.
It is beneficial for the production of Furthermore, pMEK2 has a new Xho site added, and is considered to be useful as an expression vector for heterologous genes.

[Brief explanation of drawings]

Figure 1 shows the entire base sequence of pMEK2, with only one DNA strand sequence of the double-stranded DNA described in the direction from the 5' end to the 3' end. The symbols in the figure represent nucleic acid bases, A is adenine, C
indicates cytosine, G indicates guanine, and T indicates thymine. The number in the figure indicates the restriction enzyme Cla that exists in two places in pLEK2, which is closer to the Hind site.
Numbers are shown starting from the first "A" of the Cla cleavage recognition site, 5'-ATCGAT-3'. Figure 2 shows DHFR-MEK present in pMEK2.
FIG. 2 is a diagram showing the base sequence of the portion encoding the protein and the amino acid sequence of the protein. The symbols in the figure represent nucleobases and amino acids, A represents adenine, C
stands for cytosine, G stands for guanine, T stands for thymine,
Ala is alanine, Arg is arginine, Asn is asparagine, Asp is aspartic acid, Cys
is cysteine, Gln is glutamine, Glu is glutamic acid, Gly is glycine, His is histidine, Ile is isoleucine, Leu is leucine, Lys is lysine, Mut is methionine, Phe
is phenylalanine, Pro is proline, Ser
represents serine, Thr represents threonine, Trp represents tryptophan, Tyr represents tyrosine, and Val represents valine. The number in the figure is “A” of the ATG codon that encodes the first amino acid, methionine.
It shows the number counted starting from 1. Figure 3 shows trypsinized DHFR-MEK.
A high performance liquid chromatogram of the sample is shown. The horizontal axis is the time after sample injection in minutes, and the vertical axis is
Absorbance at 220 nm is expressed in arbitrary units. The peak indicated by the arrow is the elution peak of MEK.

Claims (1)

[Claims] 1. A novel recombinant product that is stably replicated in E. coli, can confer trimethoprim resistance and ampicillin resistance to the host E. coli, has a size of 4640 base pairs, and has the DNA sequence shown below. Plasmid pMEK2. [Table] [Table] [Table] [Table] [Table] 2 E. coli containing pMEK2. 3. A dihydrofolate reductase-methionine enkephalin fusion protein produced by Escherichia coli containing pMEK2 and having the amino acid sequence shown below. [Table] 4 E. coli containing pMEK2 was cultured, and dihydrofolate reductase-methionine enkephalin fusion protein was extracted from the cell-free extract of the cultured cells using an ion exchange column, using the dihydrofolate reductase activity as a guideline. 1. A method for separating and purifying a dihydrofolate reductase-methionine enkephalin fusion protein, the method comprising purifying it using mesotrixate-coupled affinity column chromatography and anion exchange column chromatography. 5. A method for producing methionine enkephalin, which comprises decomposing a dihydrofolate reductase-methionine enkephalin fusion protein produced by Escherichia coli containing pMEK2 using trypsin, and then separating and purifying methionine enkephalin.