CN111349623B - 9 ℃ N DNA polymerase mutant - Google Patents
9 ℃ N DNA polymerase mutant Download PDFInfo
- Publication number
- CN111349623B CN111349623B CN201811581182.0A CN201811581182A CN111349623B CN 111349623 B CN111349623 B CN 111349623B CN 201811581182 A CN201811581182 A CN 201811581182A CN 111349623 B CN111349623 B CN 111349623B
- Authority
- CN
- China
- Prior art keywords
- glu
- lys
- leu
- ala
- arg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Abstract
The invention provides a separated protein, which has a sequence similar to SEQ ID NO:1, and a mutation at least one site selected from the group consisting of: 349 th bit, 384 th bit, 389 th bit, 496 th bit, 589 th bit, 674 th bit, 676 th bit, 680 th bit and 709 th bit. Compared with wild type, the 9-degree N DNA polymerase mutant provided by the invention has higher polymerization activity, and in a sequencing process, the speed of enzyme reaction is higher, so that the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
Description
Technical Field
The present invention relates to the field of biology. In particular, the invention relates to 9 ° N DNA polymerase mutants. More specifically, the invention relates to isolated proteins, isolated nucleic acids, constructs, recombinant cells, recombinant microorganisms, kits and uses thereof in DNA replication and methods of obtaining isolated proteins.
Background
The 9 ℃ N DNA polymerase belongs to B-family DNA polymerase, can quickly and accurately copy DNA, is a heat-resistant DNA polymerase, has wide application range, and the most important application is applied to genome sequencing, such as: and (4) sequencing by SBS. The SBS sequencing method uses nucleotides with modifications at the 3' sugar hydroxyl group to block the addition of other nucleotides. The use of nucleotides with 3' blocking groups allows for the incorporation of the nucleotides into the polynucleotide strand in a controlled manner. After addition of each nucleotide, the presence of a 3' blocking group prevents the addition of other nucleotides to the strand. After removal of the blocking group, the natural free 3' hydroxyl group is restored for addition of the next nucleotide.
However, the current 9 ° N DNA polymerase still remains to be improved.
Disclosure of Invention
The present invention aims to solve at least to some extent at least one of the technical problems of the prior art. Therefore, the 9-degree N DNA polymerase mutant provided by the invention has higher polymerization activity, and in the sequencing process, the enzyme reaction speed is higher, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
It should be noted that the present invention has been completed based on the following findings of the inventors:
currently, SBS sequencing has many technical problems, such as: shorter read length for sequencing, slower rate of reaction, etc. Therefore, the inventors tried to study the 9 ° N DNA polymerase. Removing 3'-5' exonuclease activity of wild 9 degree N DNA polymerase, computer simulation and prediction of DNA binding region, dNTP catalytic site and other protein structure domain of the polymerase, screening out a certain amount of optimized mutation sites, and performing experimental screening on the mutated 9 degree N DNA polymerase to obtain a batch of available mutation site information. Compared with wild type, the 9-degree N DNA polymerase mutant has higher polymerization activity, and in the sequencing process, the enzyme reaction speed is higher, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
To this end, in one aspect of the invention, the invention features an isolated protein. According to embodiments of the invention, the sequence of SEQ ID NO:1, the isolated protein has a mutation at least one site selected from the group consisting of: 349 th bit, 384 th bit, 389 th bit, 496 th bit, 589 th bit, 674 th bit, 676 th bit, 680 th bit and 709 th bit. The inventor finds that the polymerization activity of the wild type 9-degree N DNA polymerase can be improved by mutating the site of the wild type 9-degree N DNA polymerase, the speed of enzyme reaction is higher in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
According to an embodiment of the present invention, the isolated protein may further have the following additional technical features:
according to an embodiment of the invention, the mutation is an amino acid substitution.
According to embodiments of the invention, the sequence of SEQ ID NO:1, the isolated protein has a mutation selected from at least one of: p.T349F/I, p.Y384F/W, p.V389I/M, p.Y496I/L, p.V589H/Q, p.K674L/C, p.T676K/Y, p.V680M/E and p.R709S/H.
According to an embodiment of the invention, the isolated protein has a mutation selected from one of: (1) p.T676K and p.V680M; or (2) p.T676K, p.V589H and p.V680M; or (3) p.T676K, p.V589H, p.V680M, p.Y384F and p.R709S; or (4) p.T676K, p.V589H, p.V680M, p.Y384F, p.R709S and p.V389I; or (5) p.T676K, p.V589H, p.V680M, p.Y384F, p.Y496I and p.V389I; or (6) p.T676K, p.V589H, p.V680M, p.Y384F and p.Y496I; or (7) p.T676K, p.V589H, p.V680M, p.K674L, p.Y384F and p.V389I; or (8) p.T676K, p.V589H, p.K674L, p.Y496I and p.Y384F.
According to an embodiment of the invention, the SEQ ID NO:1 is further connected with 4-8 histidines and/or SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.
In yet another aspect, the invention features an isolated nucleic acid molecule. According to an embodiment of the invention, the isolated nucleic acid molecule encodes the isolated protein described above. The 9-degree N DNA polymerase coded by the separated nucleic acid molecule has higher polymerization activity, and the speed of enzyme reaction is higher in the sequencing process, so that the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
According to embodiments of the invention, the sequence of SEQ ID NO:3, and a mutation at least one site selected from the group consisting of: c.1045A > T, c.1046C > T, c.1151A > G, c.1152T > G, c.1165G > A, c.1167T > C, c.1167T > G, c.1486T > A, c.1486T > C, c.1487A > T, c.1488C > G, c.1765G > C, c.1766T > A, c.1767T > G, c.2020A > C, C. c.2020A > T, c.2021A > G, c.2022A > C, c.2026A > T, c.2027C > A, c.2028C > T, c.2038G > A, c.2039T > A, c.2040T > G, c.2040T > A, c.2125C > A, c.2126G > A and c.2127T > C.
In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid molecule described above. The 9-degree N DNA polymerase expressed by the construct has high polymerization activity, and the enzyme reaction speed is high in the sequencing process, so that the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
In yet another aspect of the invention, the invention features a recombinant cell or a recombinant microorganism. According to an embodiment of the invention, the recombinant cell or recombinant microorganism contains the isolated nucleic acid molecule described above. Therefore, the 9-degree N DNA polymerase expressed by the recombinant cell or the recombinant microorganism has high polymerization activity, the enzyme reaction speed is high in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
In yet another aspect of the invention, the invention provides a method of obtaining the isolated protein described above. According to an embodiment of the invention, the method comprises: culturing the recombinant cell or recombinant microorganism described above under conditions suitable for expression of the isolated protein, so as to obtain the isolated protein. Therefore, 9-degree N DNA polymerase with high polymerization activity can be obtained, the speed of enzyme reaction is high in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
In yet another aspect of the invention, the invention features a kit. According to an embodiment of the invention, the kit comprises the isolated protein as described above or the isolated nucleic acid molecule as described above or the construct as described above or the recombinant cell or the recombinant microorganism as described above. Therefore, the kit provided by the embodiment of the invention can accelerate the reaction speed of enzyme reaction in the sequencing process, shorten the sequencing reaction time and integrally improve the enzyme catalysis efficiency.
In a further aspect of the invention, the invention provides the use of an isolated protein as defined above or an isolated nucleic acid molecule as defined above or a construct as defined above or a recombinant cell as defined above or a recombinant microorganism as defined above or a kit as defined above for DNA replication. Therefore, the DNA replication efficiency is high, the sequencing reaction time can be shortened in the sequencing process, and the sequencing efficiency is improved.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
FIG. 1 shows a schematic diagram of a wild-type recombinant 9N DNA polymerase according to one embodiment of the present invention;
FIG. 2 shows an electropherogram of a purification assay for wild-type recombinant 9N DNA polymerase fusion protein, according to one embodiment of the invention.
Detailed Description
The following describes in detail embodiments of the present invention. The following examples are illustrative only and are not to be construed as limiting the invention.
The invention provides isolated proteins, isolated nucleic acid molecules, constructs, recombinant cells, recombinant microorganisms, kits and uses thereof in DNA replication and methods of obtaining isolated proteins, each of which is described in detail below.
Isolated proteins
To this end, in one aspect of the invention, the invention features an isolated protein. According to embodiments of the invention, the sequence of SEQ ID NO:1 (wild-type 9 ° N DNA polymerase), the isolated protein having a mutation at least one site selected from the group consisting of: 349 th bit, 384 th bit, 389 th bit, 496 th bit, 589 th bit, 674 th bit, 676 th bit, 680 th bit and 709 th bit. The inventor finds that the polymerization activity of the wild type 9-degree N DNA polymerase can be improved by mutating the site of the wild type 9-degree N DNA polymerase, the speed of enzyme reaction is higher in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
SEQ ID NO:1 (N-terminal → C-terminal) as follows:
according to an embodiment of the invention, the mutation is an amino acid substitution. Thus, the polymerization activity of the 9 ℃ N DNA polymerase was improved by substituting amino acids at specific sites by site-directed mutagenesis.
According to embodiments of the invention, the sequence of SEQ ID NO:1, the isolated protein has a mutation selected from at least one of: p.T349F/I, p.Y384F/W, p.V389I/M, p.Y496I/L, p.V589H/Q, p.K674L/C, p.T676K/Y, p.V680M/E and p.R709S/H. The inventor carries out computer simulation and prediction on a DNA binding region, dNTP catalytic sites and other structures of wild type 9-degree N DNA polymerase, screens out a certain amount of optimized mutation sites, and further screens the sites to obtain the better mutation sites.
According to an embodiment of the invention, the isolated protein has a mutation selected from one of the following: (1) p.T676K and p.V680M; or (2) p.T676K, p.V589H and p.V680M; or (3) p.T676K, p.V589H, p.V680M, p.Y384F and p.R709S; or (4) p.T676K, p.V589H, p.V680M, p.Y384F, p.R709S and p.V389I; or (5) p.T676K, p.V589H, p.V680M, p.Y384F, p.Y496I and p.V389I; or (6) p.T676K, p.V589H, p.V680M, p.Y384F and p.Y496I; or (7) p.T676K, p.V589H, p.V680M, p.K674L, p.Y384F and p.V389I; or (8) p.T676K, p.V589H, p.K674L, p.Y496I and p.Y384F. The polymerization activity of the 9 ℃ N DNA polymerase can be improved by carrying out any one or more of the above 8 modes on the wild-type 9 ℃ N DNA polymerase.
According to an embodiment of the invention, SEQ ID NO:1 is further connected with 4-8 histidines and/or SEQ ID NO:2, or a pharmaceutically acceptable salt thereof. SEQ ID NO:2 is signal peptide pelB, and mainly has the functions of guiding the expression of the target protein in periplasm of cells and improving the solubility of the target protein. A set of histidine His tags can be used to efficiently achieve protein isolation and purification, for example, using a Ni column.
It should be noted that, the invention does not strictly limit the positional relationship of the N ends of the signal peptide pelB and the His tag and the 9 ° N DNA polymerase mutant, and may be that one end of the signal peptide pelB is connected to the N end of the enzyme and the other end is connected to the His tag, or that one end of the His tag is connected to the N end of the enzyme and the other end is connected to one end of the signal peptide pelB. Preferably, the specific amino acid sequence of the 9 ° N DNA polymerase mutant linked to pelB and His tag is as shown in SEQ ID NO:4, respectively. Wherein, SEQ ID NO:1 is methionine encoded by initiation codon, and in order to allow efficient expression of the amino acid sequence, pelB and His tag are inserted after methionine M.
pel B：KYLLPTAAAGLLLAAQPAMA(SEQ ID NO：2)
MHHHHHHKYLLPTAAAGLLLAAQPAMAILDTDYITENGKPVIRVFKKENGEFKIEYDRTFEPYFYALLKDDSAIEDVKKVTAKRHGTVVKVKRAEKVQKKFLGRPIEVWKLYFNHPQDVPAIRDRIRAHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELTMLAFAIATLYHEGEEFGTGPILMISYADGSEARVITWKKIDLPYVDVVSTEKEMIKRFLRVVREKDPDVLITYNGDNFDFAYLKKRCEELGIKFTLGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGKPKEKVYAEEIAQAWESGEGLERVARYSMEDAKVTYELGREFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYKRNELAPNKPDERELARRRGGYAGGYVKEPERGLWDNIVYLDFRSAAISIIITHNVSPDTLNREGCKEYDVAPEVGHKFCKDFPGFIPSLLGDLLEERQKIKRKMKATVDPLEKKLLDYRQRLIKILANSFYGYYGYAKARWYCKECAESVTAWGREYIEMVIRELEEKFGFKVLYADTDGLHATIPGADAETVKKKAKEFLKYINPKLPGLLELEYEGFYVRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLRDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPADEFDPTKHRYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTKQVGLGAWLKVKGKK(SEQ ID NO：4)
Isolated nucleic acid molecules
In yet another aspect, the invention features an isolated nucleic acid molecule. According to embodiments of the invention, the isolated nucleic acid molecule encodes the isolated protein described above. Therefore, the protein coded by the separated nucleic acid molecule has higher polymerization activity, and in the sequencing process, the speed of enzyme reaction is higher, so that the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
According to embodiments of the invention, the sequence of SEQ ID NO:3, has a mutation at least one site selected from the group consisting of: c.1045A > T, c.1046C > T, c.1151A > G, c.1152T > G, c.1165G > A, c.1167T > C, c.1167T > G, c.1486T > A, c.1486T > C, c.1487A > T, c.1488C > G, c.1765G > C, c.1766T > A, c.1767T > G, c.2020A > C, C c.2020A > T, c.2021A > G, c.2022A > C, c.2026A > T, c.2027C > A, c.2028C > T, c.2038G > A, c.2039T > A, c.2040T > G, c.2040T > A, c.2125C > A, c.2126G > A and c.2127T > C.
The sequence of SEQ ID NO:3 may encode the nucleotide sequence shown in SEQ ID NO:1, and the mutation sites of both have the positional relationship shown in the following table.
TABLE 1 mutation sites of nucleotide and amino acid sequences
The amino acid sequence of SEQ ID NO:3 as follows:
construct
In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid molecule described above. The 9-degree N DNA polymerase expressed by the construct has higher polymerization activity, and the enzyme reaction speed is higher in the sequencing process, so that the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
It will be appreciated by those skilled in the art that the features and advantages described above for isolated nucleic acid molecules apply equally to this construct and will not be described in detail here.
Recombinant cell or recombinant microorganism
In yet another aspect of the invention, the invention features a recombinant cell or a recombinant microorganism. According to an embodiment of the invention, the recombinant cell or recombinant microorganism contains the isolated nucleic acid molecule described above. Therefore, the 9-degree N DNA polymerase expressed by the recombinant cell or the recombinant microorganism has higher polymerization activity, the enzyme reaction speed is higher in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
It will be appreciated by those skilled in the art that the features and advantages described above for isolated nucleic acid molecules apply equally to the recombinant cell or recombinant microorganism and will not be described in further detail herein.
Method for obtaining isolated proteins
In yet another aspect of the invention, the invention provides a method of obtaining the isolated protein described above. According to an embodiment of the invention, the method comprises: culturing the recombinant cell or recombinant microorganism as described above under conditions suitable for expression of the isolated protein, so as to obtain the isolated protein. Therefore, 9-degree N DNA polymerase with high polymerization activity can be obtained, the speed of enzyme reaction is high in the sequencing process, the sequencing reaction time is shortened, and the enzyme catalysis efficiency is integrally improved.
It will be appreciated by those skilled in the art that the features and advantages described above for the isolated protein apply equally to the method of obtaining the isolated protein and will not be described in detail here.
Reagent kit
In yet another aspect of the invention, the invention features a kit. According to an embodiment of the invention, the kit comprises the isolated protein or the isolated nucleic acid molecule or the construct or the recombinant cell or the recombinant microorganism. Therefore, the kit provided by the embodiment of the invention can accelerate the reaction speed of enzyme reaction in the sequencing process, shorten the sequencing reaction time and integrally improve the enzyme catalysis efficiency.
It will be appreciated by those skilled in the art that the features and advantages described above for isolated proteins, isolated nucleic acid molecules, constructs, recombinant cells or recombinant microorganisms apply equally to the kit and will not be described in further detail herein.
Use of
In a further aspect of the invention, the invention provides the use of an isolated protein as defined above or an isolated nucleic acid molecule as defined above or a construct as defined above or a recombinant cell as defined above or a recombinant microorganism as defined above or a kit as defined above for DNA replication. Therefore, the DNA replication efficiency is high, the sequencing reaction time can be shortened in the sequencing process, and the sequencing efficiency is improved.
It will be appreciated by those skilled in the art that the features and advantages described above for isolated proteins, isolated nucleic acid molecules, constructs, recombinant cells or recombinant microorganisms apply equally to this use and will not be described in further detail herein.
The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
EXAMPLE 1 preparation of 9 ℃ N DNA polymerase mutants
In the present invention, 9 ° N DNA polymerase and its mutant were used for the construction of expression vector using DNA2.0 electroramcloning Reagents Kit, and Ni column affinity purification was performed using His tag.
1. Preparation of wild-type 9 ℃ N DNA polymerase
The amino acid sequence of the wild-type 9 ° N DNA polymerase is SEQ ID NO:1, and the coding gene sequence of the amino acid is SEQ ID NO: 3.
1. Construction of wild-type expression vector pD441-WT
The wild type recombinant expression vector pD441-WT is obtained by fusing his-tag-fused wild type 9-degree N DNA polymerase encoding gene according to electrora TM The Cloning Reagents Kit (DNA 2.0, EKT-02) Kit instructions were recombined onto the vector pD441-pelB (DNA 2.0, pD 441-pelB) to obtain a vector, which fused with the wild-type 9 ℃ N DNA polymerase encoding gene of His tag, and the expression was guided by the signal peptide on the vector pD441-pelB.
The nucleotide sequence of the fused His-tagged 9-degree-N DNA polymerase encoding gene is shown in SEQ ID NO:3 is connected with a sequence obtained by connecting 6 His label codons at the 3' end of the nucleotide sequence shown in the 3.
The amino acid sequence of the wild type 9-degree N DNA polymerase fusion protein is obtained by connecting the N end of the amino acid shown in the sequence 1 with 6 His tags, as shown in figure 1, wherein 1 is a fusion protein purification tag His;2 is a signal peptide pelB;3 is wild type 9 ° N DNA polymerase.
2. Construction of recombinant bacterium
The wild-type recombinant expression vector pD441-WT was introduced into E.coli BL21 competent cells (purchased from holo-gold Biotech Co., ltd.) and smeared on a plate containing 50. Mu.g/ml kanamycin to screen a positive colony. 3-5 positive colonies were selected, and PCR was performed on the selected positive colonies using the primers Cloning-F and Cloning-R. The 2800bp fragment which is basically consistent with the expected theoretical value is obtained, and the fragment is judged to be a positive clone by comparing the sequencing results, and is named as BL21/pD441-WT/9 ℃ N.
Cloning-F：5’GGTTTTTTTATGGGGGGAGTTTAGG 3’(SEQ ID NO：5)
Cloning-R：5’CATCTCATCTGTAACATCATTGGCA 3’(SEQ ID NO：6)
3. Expression and purification of 9 ℃ N DNA polymerase fusion protein
Single colonies of BL21/pD441-WT/9 ℃ N were picked and cultured overnight at 37 ℃ and 220rpm/min in 50ml of LB liquid medium (containing Kan 50. Mu.g/ml). The following day, the cells were diluted at 1 600 And (3) adding IPTG with the final concentration of 0.5mM to 0.5-0.8, inducing and expressing the fusion protein at 25 ℃ overnight to obtain BL21/pD 441-WT/9-degree N bacterial liquid after induction, wherein the IPTG is not added in the blank control group bacterial liquid.
Centrifuging the BL21/pD441-WT/9 ℃ N bacterial solution at 8000rpm/min for 10min, discarding the supernatant, collecting the precipitated bacteria, and resuspending the cells in buffer A (50 mM K) 2 HPO4，50mM KH 2 PO4, 500Mm NaCl,10mM imidazole,5% Glycerol, pH 7.6), and PMSF (final concentration, 0.5 mM) was further added. And (3) breaking the cells by using an ultrasonic breaker, and carrying out ultrasonic treatment at the power of about 350W for 2s and stopping for 3s for 30-40min until the thallus solution is clear. The crushed thallus is centrifuged at 12000rpm at 4 ℃ for 30min, and the supernatant is taken. And keeping the supernatant obtained after centrifugation in 80 ℃ water bath for 20min, and regularly and uniformly mixing the supernatant so as to ensure that the supernatant is uniformly heated. The crude enzyme solution obtained above was centrifuged at 12000rpm at 4 ℃ for 30min. Filtering the supernatant with 0.22 μm filter membrane, and storing at 4 deg.C to obtain crude cell extract.
Crude cell extracts were loaded at appropriate flow rates and subjected to affinity chromatography on Ni columns (affinity chromatography pre-packed columns HisTrap FF,5ml,17-5255-01, GE healthcare), 5CV on Ni columns washed with water, 5CV on Buffer B (50mM K2HPO4,50mM KH2PO4, 500Mm NaCl,500mM imidazole,5% Glycerol, pH 7.6), and 8CV on Buffer A. After the protein loading is finished, washing 15CV by using Buffer A for impurity washing; linear elution was carried out using Buffer B (0-50% Buffer B, 20CV), and the target protein was collected when the UV value was more than 100 Mau.
Loading the eluate corresponding to a peak value of 100mAU or more at a predetermined flow rate to perform ion exchange chromatography (ion exchange prepacked column HiTrap Q HP,5ml,17-1154-01, GE healthcare), diluting the protein collected on the Ni column by about 8-10 times with Buffer (25mM KPO4,5% Glycerol, pH 6.5), checking the loaded protein with pH agent and conductivity meter before loading, controlling pH between 7.0-7.1, balancing 5CV with conductivity below 11mS/cm, buffer (50mM KH2PO4, 50mM K2HPO4,50mM NaCl,5 Glycerol, pH 7.6), loading the protein sample, and collecting the protein sample when the UV value rises.
Subjecting the protein sample collected in the previous step to cation exchange chromatography, subjecting the eluate to gel chromatography (ion exchange prepacked column HiTrap SP HP,5ml,17-1194-01, GE healthcare), equilibrating 5CV with Buffer C, loading the protein sample, after loading, eluting 15CV with equilibration Buffer C, and then subjecting to linear elution (0-50% Buffer D, 20CV) with elution Buffer Buffer D (50mM OKP4, 1M NaCl,5% Glycerol, pH 7.0). After protein collection was complete, the column was washed with 10CV of 1M NaOH, 10CV of double distilled water, and finally 20% ethanol, and the column was removed and stored at 4 ℃.
The collected recombinant 9 ℃ N DNA polymerase fusion protein was dialyzed overnight against 2 Xstorage Buffer (1M Tris,2M KCl,0.5M EDTA,5% Glycerol, pH 7.4). The following day, protein concentration was measured and diluted with sterile glycerol to a final protein concentration of 1mg/ml and a glycerol concentration of 50%. The purified wild-type 9 ℃ N DNA polymerase fusion protein is subjected to SDS-PAGE (5% separation gel is 12% concentration gel), and a protein sample is mixed with an SDS-PAGE protein loading buffer (5X), and is treated at 95 ℃ for 5min for loading. As shown in FIG. 2, 1 is Protein Marker (Page Ruler Pertained Protein Ladder,26616, thermo Scientific), 2 is 10. Mu.l of 1mg/ml purified wild-type 9 ℃ N DNA polymerase fusion Protein, and 3 is 10. Mu.l of 20-fold diluted 0.05mg/ml purified wild-type 9 ℃ N DNA polymerase fusion Protein. From the results of protein electrophoresis, it can be seen that the protein size in lanes 2 and 3 is about 91.5kDa, consistent with the reported molecular weight in the literature.
And analyzing the protein purity of the protein gel after electrophoresis by using Quantity one software, wherein the purity of the purified 9-degree N DNA polymerase fusion protein can reach 95% or more.
No target protein with the size of about 91.5KDa is obtained from the uninduced BL21/pD441-WT/9 ℃ N bacterial solution.
As a control group, the empty vector pD441-pelB was introduced into E.coli BL21 to give BL21/pD441-pelB. The protein expression and purification by the above method also did not yield a target protein of about 91.5kDa in size.
2. Preparation of 9 ℃ N DNA polymerase mutant fusion protein
The 9 ° N DNA polymerase mutant is a protein obtained by substituting at least one amino acid of 349, 384, 389, 496, 589, 674, 676, 680, and 709 of the amino acid sequence of the wild-type 9 ° N DNA polymerase with an amino acid.
The 9 degree N DNA polymerase mutant can be obtained by using wild type 9 degree N DNA polymerase through site-directed mutagenesis, and can also be obtained by other existing methods.
1. Preparation of recombinant vector expressing 9-degree N DNA polymerase point mutant
The recombinant vector for expressing different 9-degree N DNA polymerase point mutants is obtained by recombining different 9-degree N DNA polymerase point mutant protein coding genes fused with His labels onto a vector pD441-pelB, and the different point mutant protein coding genes fused with the His labels are guided to express through signal peptides on the vector pD441-pelB.
The single-point mutants are shown in Table 2 below.
Table 2 shows the mutation positions and mutation information of 9 ℃ N DNA polymerase single-site mutants
2. Construction of recombinant bacterium
The recombinant vector for expressing different 9-degree N DNA polymerase point mutant prepared in the step 1 is introduced into BL21 to obtain a recombinant bacterium for expressing different 9-degree N DNA polymerase point mutant fusion proteins in the same way as the method I and the method 2.
3. Expression and purification of mutants
The same method as the expression and purification method of the 9-degree N DNA polymerase fusion protein, the recombinant bacteria which are prepared in the step 2 and express different 9-degree N DNA polymerase point mutant fusion proteins are expressed and purified to obtain different 9-degree N DNA polymerase point mutant fusion proteins.
The fusion protein of different 9-degree N DNA polymerase point mutants is detected by SDS-PAGE (concentration gel is 5% separation gel is 12%) to obtain the target protein. Protein purity of the protein gel after electrophoresis is analyzed by using Quantity one software, and the purity of fusion proteins of different 9-degree N DNA polymerase point mutant can reach 95% or more.
Example 2 Performance testing of recombinant 9 ℃ N DNA polymerase mutant fusion proteins
1. Detection of polymerization activity of recombinant 9-degree N DNA polymerase mutant fusion protein
10X Buffer composition: 20mM Tris-HCl (pH 7.5), 8mM MgSO4, 10mM (NH 4) 2SO4, 50. Mu.g/ml BSA,1mM KCl,1% Triton X100.
TABLE 3 reaction System
| Composition (I) | Mutants | Positive control | Negative control |
| 10xbuffer | 5μL | 5μL | 5μL |
| dATP-Cy3-N3 | 0.25μM | 0.25μM | 0.25μM |
| dC+T+GTP | 0.25μM | 0.25μM | 0.25μM |
| P/T-Cy5 | 0.1μM | 0.1μM | 0.1μM |
| Enzymes | 20μL | 20μL | - |
| H 2 O | Make up to 50 mu L | Make up to 50 μ L | Make up to 50 μ L |
The P/T-CY5 sequence is as follows:
P1A：CGTGTATGCGTAATAGGATCCCGACTCACTAT4GGACG(SEQ ID NO：7)
P2A：CGTGTATCGTCCATAGTGAGTCGGGATCCTATTACGC(SEQ ID NO：8)
note: the sequence 5 (the 5 'end is connected with the fluorescence CY 5) and the sequence 6 (the 5' end is connected with the fluorescence CY 5) are mutually linked after annealing, and are used as a template and a primer for enzyme activity test.
The reaction solution was reacted at 40 ℃ while detecting Cy3 (extension 530 nm/extension 568 nm) and FRET Cy5 (extension 530 nm/extension 676 nm) signals, and the activity of dATP-Cy3-N3, which is an unnatural amino acid added at 0.1 μm per unit time, was defined as 1U.
Taking the wild-type 9 ° N DNA polymerase fusion protein and the 9 ° N DNA polymerase site mutant fusion protein as examples, the polymerization activity results obtained by performing the above polymerization reactions are shown in table 4, and it can be seen from the polymerization activity of the 9 ° N DNA polymerase mutant fusion protein that the mutant has higher polymerization activity than the wild-type. In the sequencing process, the faster the reaction speed of the enzyme reaction is, the more the reaction can be accelerated to a certain extent, and the sequencing reaction time is shortened. From the experimental results, it can be seen that the 9 ° N DNA polymerase mutant has a better improvement than the 9 ° N wild type in terms of enzyme catalytic efficiency.
TABLE 49 ℃ N DNA polymerase multipoint mutants
| Name(s) | Polymerization Activity (U/uL) |
| WT (wild type 9 ℃ N DNA polymerase) | 1.0 |
| BG9-60 | 1.7 |
| BG9-61 | 2.6 |
| BG9-64 | 2.1 |
| BG9-65 | 1.9 |
| BG9-66 | 1.5 |
| BG9-67 | 1.9 |
| BG9-68 | 2.3 |
| BG9-70 | 1.9 |
Note:
the amino acid sequence of the BG9-60 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 680 th valine is mutated into methionine;
the amino acid sequence of the BG9-61 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated to methionine;
the amino acid sequence of the BG9-64 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated into methionine; arginine at position 709 was mutated to serine; tyrosine 384 is mutated to phenylalanine;
the amino acid sequence of the BG9-65 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated into methionine; arginine at position 709 is mutated into serine; mutation of tyrosine 384 to phenylalanine; valine at position 389 is mutated into isoleucine;
the amino acid sequence of the BG9-66 mutant is represented by SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated into methionine; the 496 th tyrosine is mutated into isoleucine; mutation of tyrosine 384 to phenylalanine; valine at position 389 is mutated into isoleucine;
the amino acid sequence of the BG9-67 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated to methionine; the 496 th tyrosine is mutated into isoleucine; tyrosine 384 is mutated to phenylalanine;
the amino acid sequence of the BG9-68 mutant is shown in SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; valine at position 680 is mutated into methionine; 674 lysine is mutated to leucine; tyrosine 384 is mutated to phenylalanine; valine at position 389 is mutated into isoleucine;
the amino acid sequence of the BG9-70 mutant is represented by SEQ ID NO:1, the 676 th threonine of the amino acid sequence shown in the figure is mutated into lysine, and the 589 th valine is mutated into histidine; 674 lysine is mutated to leucine; the 496 th tyrosine is mutated into isoleucine; tyrosine 384 was mutated to phenylalanine.
In the description of the specification, reference to the description of "one embodiment," "some embodiments," "an example," "a specific example," or "some examples" or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.
Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and that changes, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
SEQUENCE LISTING
<110> Shenzhen Huashengshengsciences institute
<120> 9 ℃ N DNA polymerase mutant
<130> PIDC3185321
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 775
<212> PRT
<213> Artificial Sequence
<220>
<223> 1
<400> 1
Met Ile Leu Asp Thr Asp Tyr Ile Thr Glu Asn Gly Lys Pro Val Ile
1 5 10 15
Arg Val Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg
20 25 30
Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile
35 40 45
Glu Asp Val Lys Lys Val Thr Ala Lys Arg His Gly Thr Val Val Lys
50 55 60
Val Lys Arg Ala Glu Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Ile
65 70 75 80
Glu Val Trp Lys Leu Tyr Phe Asn His Pro Gln Asp Val Pro Ala Ile
85 90 95
Arg Asp Arg Ile Arg Ala His Pro Ala Val Val Asp Ile Tyr Glu Tyr
100 105 110
Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro
115 120 125
Met Glu Gly Asp Glu Glu Leu Thr Met Leu Ala Phe Ala Ile Ala Thr
130 135 140
Leu Tyr His Glu Gly Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile
145 150 155 160
Ser Tyr Ala Asp Gly Ser Glu Ala Arg Val Ile Thr Trp Lys Lys Ile
165 170 175
Asp Leu Pro Tyr Val Asp Val Val Ser Thr Glu Lys Glu Met Ile Lys
180 185 190
Arg Phe Leu Arg Val Val Arg Glu Lys Asp Pro Asp Val Leu Ile Thr
195 200 205
Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu
210 215 220
Glu Leu Gly Ile Lys Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys
225 230 235 240
Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile
245 250 255
His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr
260 265 270
Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu
275 280 285
Lys Val Tyr Ala Glu Glu Ile Ala Gln Ala Trp Glu Ser Gly Glu Gly
290 295 300
Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr
305 310 315 320
Glu Leu Gly Arg Glu Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu
325 330 335
Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu
340 345 350
Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Lys Arg Asn Glu Leu Ala
355 360 365
Pro Asn Lys Pro Asp Glu Arg Glu Leu Ala Arg Arg Arg Gly Gly Tyr
370 375 380
Ala Gly Gly Tyr Val Lys Glu Pro Glu Arg Gly Leu Trp Asp Asn Ile
385 390 395 400
Val Tyr Leu Asp Phe Arg Ser Ala Ala Ile Ser Ile Ile Ile Thr His
405 410 415
Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp
420 425 430
Val Ala Pro Glu Val Gly His Lys Phe Cys Lys Asp Phe Pro Gly Phe
435 440 445
Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys
450 455 460
Arg Lys Met Lys Ala Thr Val Asp Pro Leu Glu Lys Lys Leu Leu Asp
465 470 475 480
Tyr Arg Gln Arg Leu Ile Lys Ile Leu Ala Asn Ser Phe Tyr Gly Tyr
485 490 495
Tyr Gly Tyr Ala Lys Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser
500 505 510
Val Thr Ala Trp Gly Arg Glu Tyr Ile Glu Met Val Ile Arg Glu Leu
515 520 525
Glu Glu Lys Phe Gly Phe Lys Val Leu Tyr Ala Asp Thr Asp Gly Leu
530 535 540
His Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala
545 550 555 560
Lys Glu Phe Leu Lys Tyr Ile Asn Pro Lys Leu Pro Gly Leu Leu Glu
565 570 575
Leu Glu Tyr Glu Gly Phe Tyr Val Arg Gly Phe Phe Val Thr Lys Lys
580 585 590
Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu
595 600 605
Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala
610 615 620
Arg Val Leu Glu Ala Ile Leu Lys His Gly Asp Val Glu Glu Ala Val
625 630 635 640
Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro
645 650 655
Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Arg Asp
660 665 670
Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala
675 680 685
Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu
690 695 700
Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Ala Asp Glu Phe
705 710 715 720
Asp Pro Thr Lys His Arg Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln
725 730 735
Val Leu Pro Ala Val Glu Arg Ile Leu Lys Ala Phe Gly Tyr Arg Lys
740 745 750
Glu Asp Leu Arg Tyr Gln Lys Thr Lys Gln Val Gly Leu Gly Ala Trp
755 760 765
Leu Lys Val Lys Gly Lys Lys
770 775
<210> 2
<211> 20
<212> PRT
<213> Artificial Sequence
<220>
<223> 2
<400> 2
Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Ala Ala Gln
1 5 10 15
Pro Ala Met Ala
20
<210> 3
<211> 2328
<212> DNA
<213> Artificial Sequence
<220>
<223> 3
<400> 3
atgattctgg acactgatta cattaccgaa aacggtaaac cggttatccg cgtgttcaag 60
aaagagaatg gtgagttcaa aatcgagtac gatcgcacgt ttgaaccgta cttctatgct 120
ctgctgaaag acgattctgc gattgaagat gtgaaaaaag tgacggcgaa acgtcacggc 180
accgtggtta aggtgaaacg tgcggagaaa gtgcaaaaga aattcctggg ccgtccgatc 240
gaagtttgga agctgtactt taaccaccca caagacgtcc cggcgattcg tgaccgcatc 300
cgtgcgcacc cggctgtggt tgacatctat gagtacgata ttccgttcgc taagagatac 360
ttgattgaca agggtctgat ccctatggaa ggcgacgaag aactgaccat gctggccttc 420
gctatcgcga cgttgtatca cgagggcgaa gagtttggca ccggcccaat cctgatgatt 480
agctatgccg acggttccga agcgcgtgtg atcacctgga agaaaattga tctgccgtac 540
gtcgatgtgg tgagcacgga aaaagaaatg atcaaacgtt ttctgcgtgt ggtccgtgag 600
aaagatccgg atgtcctgat tacgtataac ggtgacaatt ttgattttgc gtacctgaaa 660
aagcgctgcg aggaactggg tatcaagttc acgctgggtc gtgatggtag cgagccgaag 720
attcagcgta tgggtgaccg ttttgcagtt gaggtgaagg gtcgcattca cttcgacctg 780
tacccggtta ttcgccgcac catcaacttg cctacctaca ccctggaagc ggtctatgaa 840
gctgtctttg gcaaaccgaa agagaaagtt tacgcggaag agatcgcgca ggcgtgggag 900
agcggtgagg gtctggaacg tgttgcccgc tacagcatgg aagatgcgaa ggtgacttat 960
gagttgggtc gcgagttttt cccgatggaa gcacagctga gccgtctgat cggccaaagc 1020
ctgtgggacg tcagccgttc gtccaccggc aacttggttg aatggttcct gctgcgtaag 1080
gcatacaagc gtaacgaact ggcgccgaat aagccggacg agcgtgagct ggcccgtcgc 1140
cgtggtggtt atgccggtgg ctatgttaaa gagccggagc gcggtctgtg ggacaatatc 1200
gtgtatctgg acttccgctc cgcagcaatc agcatcatta tcacccacaa tgttagcccg 1260
gatactttaa accgcgaggg ttgtaaagag tacgacgtgg cgcctgaggt cggccacaag 1320
ttttgcaaag atttcccggg cttcatccca agcctgctgg gcgatctgct ggaggaacgt 1380
cagaagatca aacgcaaaat gaaagcaacg gttgatccgc tggagaaaaa gctgctggat 1440
tatcgtcagc gcctgattaa gatcctggcg aatagctttt atggttacta cggttatgcc 1500
aaagcgcgtt ggtactgtaa agaatgcgct gagtctgtca ccgcgtgggg ccgtgagtac 1560
atcgaaatgg ttatccgtga gctcgaagag aaattcggtt ttaaggttct gtatgccgac 1620
accgacggtc tgcacgcgac catcccgggt gcagacgccg aaaccgtcaa gaagaaagca 1680
aaagaatttc tgaaatacat taatccgaaa ttgccgggtc tgttggagtt ggagtatgag 1740
ggtttctacg ttcgtggctt ctttgttacc aagaagaagt acgcggtcat tgacgaagag 1800
ggcaagatta cgacccgtgg tctggaaatt gttcgccgtg actggtccga gattgcgaaa 1860
gaaacccagg cgagagtgct ggaagcgatt ctgaagcatg gtgatgtcga ggaagccgtg 1920
cgtatcgtta aagaagtgac ggagaagttg agcaagtacg aagtcccacc ggagaaactg 1980
gtgattcatg agcagatcac gcgcgattta cgtgactata aagcaaccgg tccgcatgtt 2040
gccgtggcaa agcgtctggc tgcgcgtggc gttaagatcc gtccgggcac ggttattagc 2100
tacattgtgt tgaaaggtag cggtcgtatt ggcgaccgcg ccattccggc cgacgagttc 2160
gatccgacca agcaccgcta cgatgcagag tattacatcg agaaccaagt gctgccggct 2220
gtagagcgta ttctgaaggc attcggttat cgtaaagaag atctgcgcta tcaaaagacg 2280
aaacaagttg gcctgggtgc gtggctgaag gtcaagggca agaaataa 2328
<210> 4
<211> 801
<212> PRT
<213> Artificial Sequence
<220>
<223> 4
<400> 4
Met His His His His His His Lys Tyr Leu Leu Pro Thr Ala Ala Ala
1 5 10 15
Gly Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Ile Leu Asp Thr Asp
20 25 30
Tyr Ile Thr Glu Asn Gly Lys Pro Val Ile Arg Val Phe Lys Lys Glu
35 40 45
Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg Thr Phe Glu Pro Tyr Phe
50 55 60
Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile Glu Asp Val Lys Lys Val
65 70 75 80
Thr Ala Lys Arg His Gly Thr Val Val Lys Val Lys Arg Ala Glu Lys
85 90 95
Val Gln Lys Lys Phe Leu Gly Arg Pro Ile Glu Val Trp Lys Leu Tyr
100 105 110
Phe Asn His Pro Gln Asp Val Pro Ala Ile Arg Asp Arg Ile Arg Ala
115 120 125
His Pro Ala Val Val Asp Ile Tyr Glu Tyr Asp Ile Pro Phe Ala Lys
130 135 140
Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro Met Glu Gly Asp Glu Glu
145 150 155 160
Leu Thr Met Leu Ala Phe Ala Ile Ala Thr Leu Tyr His Glu Gly Glu
165 170 175
Glu Phe Gly Thr Gly Pro Ile Leu Met Ile Ser Tyr Ala Asp Gly Ser
180 185 190
Glu Ala Arg Val Ile Thr Trp Lys Lys Ile Asp Leu Pro Tyr Val Asp
195 200 205
Val Val Ser Thr Glu Lys Glu Met Ile Lys Arg Phe Leu Arg Val Val
210 215 220
Arg Glu Lys Asp Pro Asp Val Leu Ile Thr Tyr Asn Gly Asp Asn Phe
225 230 235 240
Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu Glu Leu Gly Ile Lys Phe
245 250 255
Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys Ile Gln Arg Met Gly Asp
260 265 270
Arg Phe Ala Val Glu Val Lys Gly Arg Ile His Phe Asp Leu Tyr Pro
275 280 285
Val Ile Arg Arg Thr Ile Asn Leu Pro Thr Tyr Thr Leu Glu Ala Val
290 295 300
Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu Lys Val Tyr Ala Glu Glu
305 310 315 320
Ile Ala Gln Ala Trp Glu Ser Gly Glu Gly Leu Glu Arg Val Ala Arg
325 330 335
Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr Glu Leu Gly Arg Glu Phe
340 345 350
Phe Pro Met Glu Ala Gln Leu Ser Arg Leu Ile Gly Gln Ser Leu Trp
355 360 365
Asp Val Ser Arg Ser Ser Thr Gly Asn Leu Val Glu Trp Phe Leu Leu
370 375 380
Arg Lys Ala Tyr Lys Arg Asn Glu Leu Ala Pro Asn Lys Pro Asp Glu
385 390 395 400
Arg Glu Leu Ala Arg Arg Arg Gly Gly Tyr Ala Gly Gly Tyr Val Lys
405 410 415
Glu Pro Glu Arg Gly Leu Trp Asp Asn Ile Val Tyr Leu Asp Phe Arg
420 425 430
Ser Ala Ala Ile Ser Ile Ile Ile Thr His Asn Val Ser Pro Asp Thr
435 440 445
Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp Val Ala Pro Glu Val Gly
450 455 460
His Lys Phe Cys Lys Asp Phe Pro Gly Phe Ile Pro Ser Leu Leu Gly
465 470 475 480
Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys Arg Lys Met Lys Ala Thr
485 490 495
Val Asp Pro Leu Glu Lys Lys Leu Leu Asp Tyr Arg Gln Arg Leu Ile
500 505 510
Lys Ile Leu Ala Asn Ser Phe Tyr Gly Tyr Tyr Gly Tyr Ala Lys Ala
515 520 525
Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser Val Thr Ala Trp Gly Arg
530 535 540
Glu Tyr Ile Glu Met Val Ile Arg Glu Leu Glu Glu Lys Phe Gly Phe
545 550 555 560
Lys Val Leu Tyr Ala Asp Thr Asp Gly Leu His Ala Thr Ile Pro Gly
565 570 575
Ala Asp Ala Glu Thr Val Lys Lys Lys Ala Lys Glu Phe Leu Lys Tyr
580 585 590
Ile Asn Pro Lys Leu Pro Gly Leu Leu Glu Leu Glu Tyr Glu Gly Phe
595 600 605
Tyr Val Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile Asp
610 615 620
Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg Asp
625 630 635 640
Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala Ile
645 650 655
Leu Lys His Gly Asp Val Glu Glu Ala Val Arg Ile Val Lys Glu Val
660 665 670
Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val Ile
675 680 685
His Glu Gln Ile Thr Arg Asp Leu Arg Asp Tyr Lys Ala Thr Gly Pro
690 695 700
His Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile Arg
705 710 715 720
Pro Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg Ile
725 730 735
Gly Asp Arg Ala Ile Pro Ala Asp Glu Phe Asp Pro Thr Lys His Arg
740 745 750
Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val Glu
755 760 765
Arg Ile Leu Lys Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr Gln
770 775 780
Lys Thr Lys Gln Val Gly Leu Gly Ala Trp Leu Lys Val Lys Gly Lys
785 790 795 800
Lys
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> 5
<400> 5
ggttttttta tggggggagt ttagg 25
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> 6
<400> 6
catctcatct gtaacatcat tggca 25
<210> 7
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> 7
<400> 7
cgtgtatgcg taataggatc ccgactcact atggacg 37
<210> 8
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> 8
<400> 8
cgtgtatcgt ccatagtgag tcgggatcct attacgc 37
Claims (9)
1. An isolated protein, wherein the amino acid sequence of said isolated protein is identical to the amino acid sequence of SEQ ID NO:1 is mutated into one of (1) to (8):
(1) p.T676K and p.V680M; or
(2) p.T676K, p.V589H and p.V680M; or alternatively
(3) p.T676K, p.V589H, p.V680M, p.Y384F and p.R709S; or
(4) p.T676K, p.V589H, p.V680M, p.Y384F, p.R709S and p.V389I; or alternatively
(5) p.T676K, p.V589H, p.V680M, p.Y384F, p.Y496I and p.V389I; or
(6) p.T676K, p.V589H, p.V680M, p.Y384F and p.Y496I; or
(7) p.T676K, p.V589H, p.V680M, p.K674L, p.Y384F and p.V389I; or
(8) p.T676K, p.V589H, p.K674L, p.Y496I and p.Y384F.
2. The isolated protein of claim 1, wherein the N-terminus of the isolated protein is further linked to 4 to 8 histidines and/or SEQ ID NOs: 2, or a pharmaceutically acceptable salt thereof.
3. An isolated nucleic acid molecule encoding the isolated protein of claim 1 or 2.
4. The isolated nucleic acid molecule of claim 3, which is identical to SEQ ID NO:3, has a mutation at least one site selected from the group consisting of:
c.1151A>T、c.1151A>G、c.1152T>G、c.1165G>A、c.1167T>C、c.1167T>G、c.1486T>A、c.1486T>C、c.1487A>T、c.1488C>G、c.1765G>C、c.1766T>A、c.1767T>G、c.2020A>C、c.2020A>T、c.2021A>T、c.2021A>G、c.2022A>C、c.2026A>T、c.2027C>A、c.2028C>A、c.2028C>T、c.2038G>A、c.2039T>A、c.2040T>G、c.2040T>A、c.2125C >A、c.2126G>A、c.2127T>C。
5. a construct comprising the isolated nucleic acid molecule of claim 3 or 4.
6. A recombinant cell or recombinant microorganism comprising the isolated nucleic acid molecule of claim 3 or 4.
7. A method of obtaining the isolated protein of claim 1 or 2, comprising:
culturing the recombinant cell or recombinant microorganism of claim 6 under conditions suitable for expression of the isolated protein so as to obtain the isolated protein.
8. A kit comprising the isolated protein of claim 1 or 2 or the isolated nucleic acid molecule of claim 3 or 4 or the construct of claim 5 or the recombinant cell or recombinant microorganism of claim 6.
9. Use of the isolated protein of claim 1 or 2 or the isolated nucleic acid molecule of claim 3 or 4 or the construct of claim 5 or the recombinant cell or the recombinant microorganism of claim 6 or the kit of claim 8 for DNA replication.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811581182.0A CN111349623B (en) | 2018-12-24 | 2018-12-24 | 9 ℃ N DNA polymerase mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811581182.0A CN111349623B (en) | 2018-12-24 | 2018-12-24 | 9 ℃ N DNA polymerase mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111349623A CN111349623A (en) | 2020-06-30 |
| CN111349623B true CN111349623B (en) | 2023-02-24 |
Family
ID=71190289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811581182.0A Active CN111349623B (en) | 2018-12-24 | 2018-12-24 | 9 ℃ N DNA polymerase mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111349623B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018148727A1 (en) * | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from 9°n |
| CN108795900A (en) * | 2017-04-27 | 2018-11-13 | 深圳华大智造科技有限公司 | Archaeal dna polymerase and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10421996B2 (en) * | 2013-03-14 | 2019-09-24 | Illumina, Inc. | Modified polymerases for improved incorporation of nucleotide analogues |
-
2018
- 2018-12-24 CN CN201811581182.0A patent/CN111349623B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018148727A1 (en) * | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from 9°n |
| CN108795900A (en) * | 2017-04-27 | 2018-11-13 | 深圳华大智造科技有限公司 | Archaeal dna polymerase and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111349623A (en) | 2020-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112639089B (en) | Recombinant KOD polymerase | |
| CN109022387B (en) | Mutant Pfu DNA polymerase and preparation method and application thereof | |
| CN109937252B (en) | Recombinant DNA polymerase | |
| CN109679932A (en) | A kind of archaeal dna polymerase, recombinant vector and their preparation method and application | |
| CN113195521A (en) | Mtu Delta I-CM intein variants and uses thereof | |
| WO2017090684A1 (en) | Dna polymerase mutant | |
| JP4486009B2 (en) | DNA ligase mutant | |
| CN114957415B (en) | Streptavidin mutant and application and product thereof, gene, recombinant plasmid and genetically engineered bacterium | |
| CN113316636B (en) | DNA polymerase with improved enzymatic activity and use thereof | |
| CN114107252A (en) | CL7 protein, high-activity recombinant TET enzyme CL7-NgTET1, prokaryotic expression vector and application thereof | |
| CN111349623B (en) | 9 ℃ N DNA polymerase mutant | |
| CN113774039B (en) | Recombinant DNA polymerase and application thereof | |
| CN108795900B (en) | DNA polymerase and preparation method thereof | |
| EP1981978B1 (en) | Affinity polypeptide for purification of recombinant proteins | |
| CN109943549B (en) | Ultra-high-speed amplification type Taq DNA polymerase | |
| CN114381442B (en) | High-fidelity DNA polymerase capable of being rapidly extended and preparation method and application thereof | |
| CN110938611A (en) | DNA polymerase and preparation method and application thereof | |
| CN115011578B (en) | Enhanced M-MLV reverse transcriptase mutant and application thereof | |
| WO2022082482A1 (en) | Recombinant kod polymerase | |
| CN113913413B (en) | Salt-tolerant RPK mutant and application thereof | |
| CN116200362A (en) | Taq enzyme mutant and preparation method and application thereof | |
| CN116426545A (en) | Recombinant pyranose oxidase, and preparation method and application thereof | |
| CN116200363A (en) | Taq enzyme mutant, preparation method and application thereof | |
| CN115925830A (en) | Intein variant and application thereof in biological method for preparing snake venom-like peptide precursor | |
| CN116926034A (en) | Recombinant creatine kinase isozyme, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |