JPH01252290A - Leucine enkephalin - Google Patents

Abstract

PURPOSE:To obtain a large amount of dihydrofolic acid reductaseleucine enkephalin fused protein, by manifesting a fused gene in which a leucine enkephalin gene is included in a plasmid vector pTP 104-4 with a colon bacillus. CONSTITUTION:A newly recombined plasmid pLEK 1, which is replicated in stable with a colon bacillus, imparting resistance to trimethoprim and resistance to ampicillin to a colon bacillus as a host, having a size of 4207 basic pairs and having a bonded structure of chemically synthesized DNA of 34 basic pairs containing conformations coding BamHI of pTP 104-4, 4173 basic pairs DNA fragments of large side obtained by Sa I abscission and a leucine enkephalin, is produced. A colon bacillus introduced of the plasmid pLEK 1 (FERM BP-1818) produces a large amount of dihydrofolic acid reductase-leucine enkephalin fused protein.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to leucine enkephalin (Tyr)-glycine (Gly)-glycine (Gly)-phenylalanine (P h e) - A peptide consisting of a 5 amino acid sequence of leucine (L eu), as follows.

It is abbreviated as LEK. ) A novel recombinant plasmid pLEK1゜pLEKl that enables mass production of fusion proteins containing
E. coli containing dihydrofolate reductase-LEK fusion protein, which has LEK on the carboxy-terminal side of the enzyme (
Hereinafter, it will be abbreviated as DHFR-LEK. ), DHFR-
Method for separating and purifying LEK.

and a method for manufacturing LEK. The novel recombinant plasmid pLEK1 of the present invention has the DNA sequence shown in FIG. The present invention is suitable for fields such as 2-fermentation industry and pharmaceutical industry.

BACKGROUND OF THE INVENTION LEK is known as an endogenous peptide that exhibits 2-morphine-like analgesic action, and is an interesting bioactive peptide that is expected to be used as a non-addictive analgesic or anesthetic.

The technical background of the present invention is so-called genetic manipulation technology. There are two efficient methods for producing LEK using genetic engineering: a method using the Bacillus subtilis dihydrofolate reductase (DHFR) gene developed by the present inventors (patent application); To increase the expression efficiency of the fungal-derived DHFR gene in E. coli, we introduced a chemically synthesized LEK gene into the EcoRI cleavage site in the DHFR gene.
DHFR derived from Bacillus subtilis (hereinafter abbreviated as DHFRb-)
A fusion protein in which LEK is fused to the carboxy terminal side of the
3.6l-249260), after separating and purifying the fusion protein, the main point is to specifically cleave LEK on the carboxy-terminal side and separate and purify it using high performance liquid chromatography (hereinafter abbreviated as HPLC). This is the way to do it. The problem with this method is that DHFRb9 produced by E. coli
- The amount of LEK accumulated in the bacterial cells is at most a few percent of the bacterial protein, and there are points that need to be improved in terms of production efficiency.

On the other hand, the present inventors have already reported that the DHFR gene derived from the Bacterium Bacteria is the result of modification of that gene.

Plasmid vector pTP70-1 for heterologous gene expression (
Patent application Sho 6l-312836) and pTP104-4 (
Patent application 1986-302157).

Methods for creating fusion genes using these expression vectors (
The company has developed a patent application (patent application 1986-302153). When these methods are used, the amount of the fusion protein obtained as a result of the expression of the fusion gene accumulated in E. coli cells is expected to be about 20% of the total cell protein. However, L.E.K.
There is no example of using the above expression vector for the production of.

Purpose of the Invention The purpose of the present invention is to solve the problem of DHFR, which had problems in terms of production efficiency.
The purpose of this project is to improve the LEK production method using the b5 gene and develop an efficient LEK production method using genetic manipulation.

The present inventors have already demonstrated that (1) even if the carboxy-terminal sequence of E. coli DHFR is changed, the enzymatic activity is not lost, similar to Bacillus subtilis DHFR;

(2) The modified DHFR gene on PlusP104, which enables the fusion of a heterologous peptide to the carboxy-terminal side of E. coli DHFR, is efficiently expressed in E. coli;
is made clear.

The present inventors utilized the above knowledge and as a result of intensive research,
By expressing the LEK gene in fusion with DHFR using pTP104-4.

It was revealed that DHFR-LEK can be produced efficiently, and based on the results, the present invention was completed.

Structure of the Invention The present invention provides: (1) a novel recombinant plasmid pLEK1° (2) pL that enables large-scale expression of DHFR-LEK;
E. coli cells containing EKl, (3) DHFR-LEK produced by E. coli containing pLEKl, (4)
DHF RL from E. coli containing pLEKl
The present invention is comprised of the following inventions: EK separation and purification, and (5) a method for producing LEK using DHFR-LEK.

(1) New recombinant plasmid pLEK1 Figure 1 shows the entire base sequence of pLEK1 of the present invention. The figure shows only one DNA strand sequence of a double-stranded circular DNA.
The numbers are counted and written in the direction from the 5' end to the 3' end. pLEKI of the present invention is a novel recombinant plasmid. pLEKl has a size of 4207 base pairs and can confer trimethoprim and ampicillin resistance to the host E. coli. pLEKl is.

It has a structure in which the larger 4173 base pair DNA fragment obtained by BamHI and 5alI digestion of pTP104''-4 is bound to a 34 base pair chemically synthesized RNA containing a sequence encoding LEK. 1st In the figure,
The sequence from positions 533 to 566 was chemically synthesized and was derived from NA. The other sequences are derived from pTP104-4.

60th to 565th array). There is no MluI site in the part derived from pTP104-4. BamH1 site of pLEKl (53 in Figure 1)
2nd to 537th array) to M l u I
By replacing the sequence up to the site with another sequence, foreign DNA can be introduced in a determined direction, and a fusion gene with the DHFR gene can be easily created.

The arrangement from 57th to 557th in Figure 1 is as follows.

DHFR-LEK, in which LEK is bound to the carboxy terminal side of DHFR via methionine, is encoded.

Upstream of the sequence encoding DHFR-LEK.

There is a sequence that allows efficient expression of the DHFR-LEK gene (Patent Application No. 61-312836). That is, 4
The sequence from 3rd to 50th is called the SD sequence, and is useful for efficient translation.

4165165th and 193193rd are consensus transcription promoters and contribute to efficient transcription. From this, when pLEKl is introduced into E. coli,
Make a large amount of DHFR-LEK. Made DHFR-L
EK accumulates in a soluble state within the bacterial body, accounting for about 20% of the bacterial protein. As a result, E. coli harboring pLEKl becomes resistant to trimethoprim.

Furthermore, pLEKl has a gene derived from pTP104-4 that confers resistance to ampicillin. From this, E. coli into which pLEKl has been introduced also exhibits resistance to ampicillin. pLEKl is introduced into E. coli and kept in a stable state, and E. coli containing pLEKl is
FERM p-1818 & IrT in the Microtechnology Laboratory? r□wa, I say.

pLEKl having such features can be constructed according to Example 1, but the present invention is not limited by the method for constructing the two recombinant plasmids.

(2) In E. coli containing pLEKl, E. coli containing 1 contains DHFR-LE on pLEK.
As a result of efficient expression of the K gene, a large amount of DHFR-LEK is accumulated in the bacterial body in a soluble state. E. coli containing pLEKl was added to YT+Ap medium (5 g in medium 11).
When cultured to a steady state at 37°C using a liquid medium containing NaCl, 8g of tryptone, 5g of yeast extract, and 50mg of ampicillin sodium, the accumulated DHFR-LEK accounts for approximately 20% of the bacterial protein. reach. If cultured hedrons are suspended in an appropriate buffer such as phosphate buffer, disrupted using the French press method or sonication method, and then separated into supernatant and precipitate using centrifugation, almost all of the DHFR-LEK is recovered in the supernatant. Escherichia coli containing pLEKl was sent to FERM
It has been deposited as BP-1818.

(3) DHFR-LEK Figure 2 shows the part D that encrypts DHFR-LEK.
The NA sequence and the amino acid sequence of the protein predicted to be produced from it are shown. DHFR-LEK is 16
It is a novel protein consisting of 7 amino acids. The sequence from positions 1 to 159, counting from the amino terminus, has one amino acid substitution (Cys-152 (wild type) → Gl) in the wild type I) HFR of E. coli.
u-152) array, and the 162nd to 167th are LEK arrays. The amino acid immediately preceding the LEK sequence is methionine (Met). Due to this, D
By subjecting HFR-LEK to Bromcyan treatment, L
EK can be specifically excised. Isoleucine at position 160 (lle) and arginine at position 161 (Ar
g) is a sequence created to match the reading frame of the genetic code when introducing DNA encoding LEK into the BamHI site of +p'rP 104-4. pTP
DHFR produced by 104-4 consists of 162 amino acids, and amino acid 6 of DHF R-L E K in Figure 2.
It has a sequence in which two amino acid 1 sequences of Gln-11e are interposed in the 0th strand sequence. The molecular weight of DHFR-LEK is 18,963.

DHFR-LEK has the carboxy terminal side of DHFR,
Despite having a structure that combines LEK, DH
Has FR enzyme activity. For this reason.

When E. coli produces large amounts of DHFR-LEK, DHFR
becomes resistant to trimethoprim, an antibacterial inhibitor and antibacterial agent.

(4) Separation and purification of DHFR-LEK The separation and purification method of DHFR-LEK of the present invention includes: 1) culture of hedrons, 2) crushing of microbial cells, 2) DEAE-) Yopal hygroma treatment, and 2) mesotrixate (MTX) binding affinity chromatography. It consists of the process of chromatography, and DEAE-) Jobar force chromatography.

■Culture of bacterial cells Culture of Escherichia coli containing pLEKl is carried out in YT+Ap medium (5 g of NaCl, 8 g of tryptone +
Liquid medium containing 5 g yeast extract and 50 mg ampicillin sodium. ) can be cultured.

Other examples of the medium include ST+Ap medium (a liquid medium containing 2 g of glucose + 1 g of dipotassium phosphate, 5 g of polypeptone, 5 g of yeast extract, and 50 mg of ampicillin sodium in medium 11).

Any medium can be used as long as it allows bacterial cells to grow, but as far as we have investigated, YT+Ap medium is optimal for producing DHFR-LEK.

E. coli containing pLEKI was inoculated into the medium.

Culture at 37°C until late logarithmic growth phase or stationary phase. The amount of DHFR-LEK accumulated in the bacterial cells varies depending on the culture temperature, and as far as we have investigated, the higher the culture temperature, the greater the amount accumulated. The cultured bacterial cells.

Collect by centrifugation at 5,000 revolutions/min. Medium 11
From this, bacterial cells with a wet weight of 2 to 4 g can be obtained.

Bacterial collection and subsequent operations are performed at low temperatures (between 0 and 10°C, preferably 4°C) unless otherwise specified.

■ Disruption of bacterial cells - Cultured bacterial cells were mixed with 3 times the wet weight of buffer 1 (
0.1mM Sodium Ethylenediaminetetraacetate (E
DTA) in 10mM potassium phosphate buffer, pH 7
, 0) and disrupt the bacterial cells using a French strainer. Centrifuge the cell suspension at 5,000 rpm for 10 minutes to obtain a supernatant. Furthermore, the supernatant is subjected to ultracentrifugation at 35,000 rpm for 1 hour to obtain a supernatant (cell-free extract).

(DEAE-) Yopal force ram treatment This operation is performed for the purpose of pretreatment for the secondary purification process. The cell-free extract was applied to a DEAE) Yopal force ram equilibrated in advance with a buffer containing 0.1M KCl, and
Wash the column with buffer 1 containing IM KCI. Elution of the enzyme is performed using buffer 1 containing 0.3M KCl.

Fractionate a certain amount of the eluate using a fraction collector.

DHFR activity was measured for the fractionated eluate.

Collect fractions containing enzyme activity.

(2) MTX-binding affinity chromatography The enzyme solution obtained by the above procedure is adsorbed onto an MTX-binding 5epharOse affinity column equilibrated with buffer solution 1 in advance. After adsorption, buffer 2 containing IM KCl
(10mM potassium phosphate buffer containing 0.1mM EDTA, pH 8.5). For washing, measure the absorbance of the eluate from the column at 280 nm, and if the absorbance is 0.
Continue to flow the same buffer solution until it becomes 1 or less. Enzyme elution is performed using Buffer 2 containing IM KCI and 3mM folic acid, and a fixed amount of the eluate is fractionated using a fraction collector. The DHFR activity of the fractionated eluate is measured, and both fractions containing enzyme activity are collected. The obtained enzyme solution was added to buffer solution 1.

Dialyze 3 times. At this stage, DHFR with a purity of 90% or more
-LEK is obtained.

■DEAE-) Yopal force chromatography DEAE which equilibrated the dialyzed enzyme solution with 1 buffer solution in advance.
-) Adsorb it to the jobar force ram.

Measure the absorbance and continue to flow the same buffer until the absorbance becomes 0.01 or less. Elution of the enzyme was performed using buffer 1 at 0.1
Performed using linear concentration localization of KCI from M to 0.3M,
Fractionate a certain amount of the eluate using a fraction collector. The absorbance at 280 nm and DHFR activity of the fractionated eluate are measured. Enzyme activity/280 nm
The absorbance value of .

Collect fixed fractions.

Through the above operations, DHFR-LEK can be highly purified and homogenized with good reproducibility.

According to the present invention, the purification of DHFR-LEK.

Can be carried out within one week including culturing and has a recovery rate of 50%.
% or more, a uniform enzyme preparation can be obtained.

DHFR enzyme activity was determined using two reaction solutions (0.05mM dihydrofolic acid, 0.06mM NADPH, 12mM 2-mercaptoethanol, 50mM phosphate buffer (pH 7).
. One unit of enzyme is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. This measurement can be easily performed using a 2 spectrophotometer.

(5) Production of LEK using DHFR-LEK The purified DHFR-LEK is freeze-dried, and 1 to 10 mg
Add 70% formic acid to protein/m mass, dissolve, add about 20 times the amount of protein as crystalline bromic acid, seal tightly, and stir at room temperature under nitrogen atmosphere for 24 hours.
Allow time to react. After diluting the reaction solution 10 times with water, it is lyophilized to remove excess reagent. 1 to 10 mg of dry sample
Insoluble in 30% acetic acid as protein/m mass. The dissolved sample was passed through an HPLC device (LC-4A, i
nerts i 1-ODS column) using 0.1
It can be eluted and separated using a concentration gradient of 15% to 50% acetonitrile in % trifluoroacetic acid = 16%.
- shows a high performance liquid chromatogram of a DHFR-LEK sample treated with bromocyanide. The peak 17 minutes after sample injection is LEK. Separate this peak fraction. After drying the separated eluate using an evaporator, LEK can be obtained by adding a small amount of water and freeze-drying to remove the solvent.

Furthermore, the amino acid composition can be confirmed by acid hydrolyzing the obtained peptide and then performing amino acid analysis.

In an example of the present invention, 8% wet weight was obtained from 31 media.
g facepiece is obtained, and this bacterial cell (calculated).

Approximately 87.3mg DHFR-LEK, approximately 2.6mg L
Including EK. ), approximately 43 mg of DHFR-LE
K (yield, 50.6%, calculated line 1.26 mg L
Including EK. ) can be obtained by purifying 10 mg of DHFR-LEK by decomposing bromocyanide and then separating and purifying it by HPLC.

Approximately 0.16 mg of LEK could be obtained.

Next, examples and reference examples of the present invention will be shown.

Example 1 Creation of pLEKl As for the DNA that encodes LEK.

1,5'-GATCCGTATGTACGGTGGTT
TCCTGTAACGCGTG-3'2, 5'-TC
GACACGCGTTACAGGAAACCACCGT
DNA consisting of two 34 nucleotides of ACATACG-3' was chemically synthesized according to the phosphoramidite method, and after purification, the 59-terminus of each DNA was phosphorylated using polynucleotide kinase. Contains approximately 0.1 ml of phosphorylated DNA (approximately 0.0111 g of DNA).

) was taken and incubated at 60°C to anneal both DNAs (this is called DNAI).

Approximately 1 μg of pTp 104-4 was mixed with BamHI and 5a
After cutting with 1I, it was treated with alkaline phosphatase. The alkaline phosphatase-treated DNA was treated with phenol to denature and remove coexisting enzyme proteins, and then the precipitate was dried under ethanol pressure. Bam
The operations of DNA cleavage with HI and Sal, alkaline phosphatase treatment, phenol treatment, and ethanol precipitation were all carried out using the “Molecular Clo
ning A Laboratory Manual”
(T, Maniatis, E, F, Fr1tsch
, J.

Sambrook, eds, Co1d Spring
Harbor Laboratory (1982),
Hereinafter, it will be referred to as 2 documents 1. ) according to the method described. The dried DNA was mixed with 50μl of ligase reaction solution (10mM Tris-HCI, pH 7, 4.5mM
MgCl2.10mM dithiothreitol, 5mM
ATP), add 5 μl of DNAI, add 1 unit of T4-DNA ligase, and incubate at 10°C.
The DNA ligation reaction was carried out for 14 hours. This reaction product was transformed using a transformation method.
thod, described in the above-mentioned document 1).

A nutrient agar medium containing 50 mg/ml ampicillin sodium and 10 mg/ml trimethoprim (in medium II, 2 g glucose, 1
Contains g dipotassium phosphate, 5 g yeast extract, 5 g polypeptone, and 15 g agar. ) on top, 3
Approximately 15 colonies were obtained by culturing at 7°C for 24 hours. Select 8 colonies from these colonies and add 1.5 ml of YT/Ap medium (5 g of NaCl, 5 g of yeast extract in medium 11).

Contains 8g tryptone, 50mg ampicillin sodium. ), the bacterial cells were cultured overnight at 37°C. The culture solution was placed in each Eppendorf centrifuge tube, and 12,000
The cells were centrifuged at rotation/min for 10 minutes and collected as a precipitate. To this, add O, 1 ml of electrophoresis sample preparation solution (0
,0625M Tris-HCI, pH 6,8,2χ
Sodium lauryl sulfate (SDS), 10x glycerin, 5x 2-mercaptoethanol, 0.001
Contains % bromophenol blue.

) and keep the bacterial suspension in boiling water for 5 minutes.
The bacterial cells were lysed. This treated sample was subjected to 5DS-polyacrylamide gel electrophoresis (U, Lamm1).
i; Nature, vol, 227. p, 680
(1970)) and as molecular weight markers lactalbumin (molecular weight 114,200),) lipsin inhibitor (molecular weight fi 20,100),) ribsinogen (molecular weight 24,000).

Carbonic anhydrase (molecular weight 29,000)
.

Glyceraldehyde 3-phosphate dehydrogenase (molecular weight 36,000), egg albumin (molecular weight 45,0
00), and bovine serum albumin (molecular weight 66.000
) was run on a 10 to 20% polyacrylamide gradient gel. As a result, in 7 of the 8 colonies, the DHFR band of pTP104-4 disappeared and a new protein with a clearly larger molecular weight (estimated to have a molecular weight of about 22,000) was produced. The remaining colony is pT
It was revealed that a protein with approximately the same size as DHFR of pTP104-4 was produced, and that DHFR of pTP104-4 (molecular weight 18,379) migrated as a protein with a molecular weight of about 21,000 under these conditions. Select one appropriately from among the colonies that produce a new protein with a large molecular weight, culture it in YT+Ap medium,
Tanaka and Weisblum's method (T, Tan
aka, B, Weis-blum; J, Bacte
riology, vol, 121. p, 354 (19
Plasmids were prepared according to 75)). The obtained plasmid was named pLEKl. pLEKl is pT
It should have a structure in which the sequence between the BamHI and 5aII sites of P104-4 is synthesized and replaced with NA. The synthetic NA contains a sequence 5'-ACGCGT-3' that is recognized by restriction enzyme Mlu■, so when we tried to cleave pLEKl with MluI,
Definitely cut off. In addition, EcoRI of pLEKl (
Sequences 471-476 in Figure 1) and PvuIr (
The dideoxy method using 5M13 phage (J, Me
ssing;Mehtods in Enzymol
ogy.

vol, 101. p. 20 (1983), Ec
The base sequence was determined in the direction from oRI to PvuI. the result.

This is revealed by number 471 of the entire base sequence of pLEKl shown in Figure 1 (Patent application 1986-302157).
. The sequence of BamHI-3all of pLEKl is p'T
The 294 nucleotide long sequence between BamHI and 3aII of P104-4 was replaced with a 34 nucleotide long sequence designed and synthesized as a sequence encoding LEK.

In addition, about 4.2 kilobase pair DNA obtained by BamHI-5alI digestion of pLEKl is EcoRl,
Ps t I, Hindm, Hpal, Aa t n,
P v u n, B g I U, and C1a
As a result of a restriction enzyme cleavage experiment using pTP10
It was shown to be completely identical to the approximately 4.2 kilobase pair DNA obtained by BamHl-5alI cleavage of 4-4.

From the above results, it was determined that the entire base sequence of pLEKl was the sequence shown in FIG.

Example 2-23= DHFR-LEK produced by E. coli containing pLEKl The amino acid sequence of DHFR-LEK produced by E. coli containing pLEKl can be predicted from the base sequence of the DHFR-LEK gene. 557 from 57th in Figure 1
Since the sequence encodes DHFR-LEK, the amino acid sequence was deduced using a triplet code table. As a result, the amino acid sequence shown in FIG. 2 was obtained.

DHFR-LEK was separated and purified from Escherichia coli containing pLEKl, and the purified protein was used to confirm as follows.

Purification of DHFR-LEK A, Amount of bacterial cells used: Wet weight 8g B, Enzyme purification table (Purification process in the table is ■Cell-free extract, ■DEAE-) Jobar storage treatment, ■Mesotrixate-conjugated Affinity chromatography graphics, and ■D
EAE-)Yopal Kalamku 24 1 step Amount (ml) Lithium (mg) Activity (unit) (2) ■ 45 550 4.417
100 ■ 33 240 3,425
7? , 5 ■ 56 58 2,864
64.8 ■ 28 43 2,23
6 50.6DHFR enzyme activity is 2 reaction mixtures (0,0
5mM dihydrofolic acid, 0.06mM NADPIi,
The test was carried out by placing 1 ml of 2-mercaptoethanol (12 mM 2-mercaptoethanol, 50 mM phosphate buffer (pH 7,0)) in a cuvette, adding the enzyme solution thereto, and measuring the change in absorbance at 340 nm over time.

One unit of enzyme reacts at 1 unit per minute under the above reaction conditions.
It was defined as the amount of enzyme required to reduce micromoles of dihydrofolate.

The obtained enzyme protein was analyzed by SDS electrophoresis (method described in the above example).

Approximately 22,000 single protein bands were displayed, indicating that the resulting enzyme preparation was homogeneous.

Properties of isolated and purified DHFR-LEK When the purified protein exhibiting DHFR activity was examined by enzyme immunoassay, it was shown to react with an antibody against LEK. That is, it was revealed that the purified protein had a structure immunologically equivalent to LEK.

In order to clarify the amino acid sequence of the carboxy-terminal side of the purified protein, carboxypeptidase Y was applied to the purified protein at varying times.
To quantify the released amino acids, we decided to use the carboxypeptidase method to determine the carboxy-terminal amino acid sequence. the result.

-Gly-Gly-Leu (carboxy terminal). Furthermore, after acid hydrolysis of the purified protein, amino acid analysis revealed that the amino acid composition was consistent with the expected amino acid composition as a result of the base sequence. E
Purified protein obtained in Separation Example 2 of K (approximately 10 mg, approximately 5
30 nmoles of DHFR-LEK) was freeze-dried, dissolved in 2 ml of 70% formic acid, and about 2
After adding 00 mg of bromic cyanide and sealing the flask under an atmosphere of dissolved nitrogen, the mixture was reacted with stirring at room temperature for 24 hours. After the reaction, 20ml of water was added and then freeze-dried.

The standard product obtained by freeze-drying was dissolved in 10 ml of 30% acetic acid. Of these, o, 5ml (approximately 26nmo
1ne DHFR-LEK) using a high performance liquid chromatography device (quality LC-4A).
Separation was performed using an rtsil-ODS 5 μm column. As for elution.

This was done by applying a concentration gradient (15% to 50%) of acetonitrile in 0.1% trifluoroacetic acid. 0
From 2 minutes to 2 minutes, 15% acetonitrile was used, and from 2 minutes to 32 minutes, a linear concentration gradient of 15% to 50% acetonitrile was applied.

As a result, an elution curve as shown in FIG. 3 was obtained. The peak fraction 17 minutes after sample injection was separated, and the separated eluate was dried in an evaporator, and a small amount of water was added and lyophilized to remove the solvent to obtain a peptide.

After acid hydrolysis of the obtained peptide, 1/2 of the volume was used for amino acid analysis. As a result, tyrosine.

7.2, 14.6, 7.1 and 7°6 nmole of glycine, phenylalanine, and leucine, respectively.
detected. What is the amino acid composition?

This value was consistent with that of LEK, and the heptite analyzed was approximately 7.4 nmol I e (approximately 4.1 μg).
It was revealed that it contained EK. Using this result, 0.5 m of sample obtained by bromcyan treatment
By separating 1 using HPLC, a yield of about 57
LEK in % (7゜4x2nmole/26nmole)
can be recovered.

Also, by repeating this operation 20 times, approximately 164μg (4゜1x2μgx
It is shown that the LEK of 20) is obtained.

In addition, the yield of purification of DHFR-LEK was approximately 50%.
%, and since the yield of separation of LEK from DHFR-LEK is about 57%, it is calculated that the isolation yield of the LEK peptide moiety produced by E. coli is about 29%.

Effects of the Invention As mentioned above, the new recombinant plasmid pLEK1
Escherichia coli which encodes HFR-LEK and has pLEKl accumulates and produces large amounts of DHFR-'LEK in a soluble state. moreover.

The produced DHF R-LEK retains DHFR enzyme activity and can be easily purified.

By following the purification method of the present invention, DHFR-LEK can be purified quickly and efficiently.

In addition, DHFR-LEK was treated with brom cyan.

LEK can be easily isolated by HPLC separation. Because of these properties, the present invention provides DHFR-LEK and L E K using the same.
It is beneficial for the production of

Furthermore, a MluI site has been newly added to pLEKl, which is considered to be useful as a hector for expressing a heterologous gene.

[Brief explanation of the drawing]

FIG. 1 is a diagram showing the entire base sequence of pLEKl,
The DNA strand sequence of only one of the double-stranded DNA is written in the direction from the 5' end to the 3'' end. The symbols in the figure represent the nucleobases, A is adenine, C is cytosine, G is indicates guanine and T indicates thymine.The numbers in the figure indicate p
The first “A I
The numbers are shown with + as number 1. Figure 2 shows the DHFR-LE present in pLEKl.
FIG. 2 is a diagram showing the base sequence of the portion encoding K and the amino acid sequence of the protein. The code in the figure is. Represents a nucleobase and an amino acid; A represents adenine. C stands for cytosine, G stands for guanine, and T stands for thymine. 3l-Ala is arani, ';, subArg is arginine,
Asn stands for asparagine, Asp stands for aspartic acid,
Cys stands for cysteine, Gin stands for glutamine, Glu
represents glutamic acid, cty represents glycine, His represents histidine, He represents isoleucine, Leu represents leucine, and Lys represents lysine. Met is methionine, Phe is phenylalanine,
Pro stands for proline and Ser stands for serine. Thr is threonine, Trp is tryptophan, T
yr represents tyrosine, and Val represents valine. The numbers in the figure indicate the numbers counted starting from "A11" of the ATG codon that encodes the first amino acid, methionine. Figure 3 shows the high performance liquid chromatogram of the DHFR-LEK sample treated with bromide cyanide. The horizontal axis represents the time after sample injection in minutes, and the vertical axis represents the absorbance at 220 nm in arbitrary units. The peak indicated by the arrow is the elution peak of LEK. = 32- aa<aa Ol+ ahth l
Shi TAAGCTT Ku no 6

Claims (1)

[Claims] 1. A DNA that is stably replicated in E. coli, can confer trimethoprim resistance and ampicillin resistance to the host E. coli, has a size of 4207 base pairs, and has the DNA sequence shown in FIG. A novel recombinant plasmid pLEK1. 2. E. coli containing pLEK1. 3. A dihydrofolate reductase-leucine enkephalin fusion protein produced by E. coli containing pLEK1 and having the amino acid sequence shown in FIG. 4. E. coli containing pLEK1 was cultured, and dihydrofolate reductase-leucine enkephalin fusion protein was extracted from the cell-free extract of the cultured cells using dihydrofolate reductase activity as a guideline. 1. A method for separating and purifying a dihydrofolate reductase-leucine enkephalin fusion protein, the method comprising purifying it using chromatography and anion exchange column chromatography. 5. A method for producing leucine enkephalin, which comprises decomposing a dihydrofolate reductase-leucine enkephalin fusion protein produced by Escherichia coli containing pLEK1 by a bromcyanic degradation method, and then separating and purifying leucine enkephalin. .