JPH02100681A - Beta-endorphin - Google Patents

Abstract

PURPOSE:To obtain a recombinant plasmid pENDB 15 capable of producing beta-endorphin stably replicated in Escherichia coli and having strong analgesic activity and having DNA sequence of 4718 base pair. CONSTITUTION:The novel recombinant plasmid pENDB15 has size of 4718 base pair and provides trimethoprim resistance and ampicillin resistance to Escherichia coli which is a host. The above-mentioned plasmid is obtained by replacing sequence of 26 base pair containing sequence coding MEK between BamHI site of pMEK2 (patent application No.63-79680) and XhoI site with chemically synthesized DNA of 104 base pair containing sequence coding beta- endorphin. Escherichia coli transformed by the pENDB15 is deposited as FERM BP-2029 to Fermentation Research Institute.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention provides a novel production method for β-endorphin by genetic recombination, a recombinant plasmid related thereto,
Transformed strains and fusion proteins.

β-endorphin is a peptide having morphine-like physiological activity composed of 31 amino acids and has the following amino acid sequence.

β-Endorphin: Tyr-Gly-Gly-Ph
c-Met-Thr-5er-G Iu-Lys-5
er -G l n -Thr -Pro-Leu-V
a I -Thr-Leu-Phe-Lys-Asn-
Ala-11e-l 1e-Lys-Asn-Ala-
Tyr-Lys-Lys-Gly-Glu The novel recombinant plasmid pENDB 15 of the present invention has the DNA sequence shown in FIG.

The present invention is suitable for fields such as 2-fermentation industry and pharmaceutical industry.

[Prior Art] β-endorphin is a peptide belonging to the endorphin family that exhibits morphine-like physiological activity.

It is an interesting bioactive peptide that exhibits analgesic activity approximately 2340 times greater than that of leucine enkephalin and approximately 1560 times greater than methionine enkephalin.

The technical background of the present invention is so-called genetic manipulation technology. A β-ene method using genetic manipulation is publicly available (K, Nagahari et at, Agric
.

Biol, Chem, vol. 5], p. 84
5-851 (1987)). Their method is to fuse it with about 62% of the amine end of E. coli anthranilate synthase and form a Tt product as an insolubilized substance within the 9-sided structure. According to their method, a fusion protein containing β-endorphin can be efficiently produced.

Since the produced fusion protein is insoluble, there may be problems with solubilization of the fusion protein, high purification of the target fusion protein, etc.

As a result of altering the E. coli-derived dihydrofolate reductase (hereinafter abbreviated as DHFR) gene, the present inventors have already created a plasmid vector pTP70-1 for expressing a heterologous gene (Patent Application No. 1983). -312836) and
A method for creating a fusion gene using this (patent application 1986-
302153). In addition, pTP70-1
Methionine enkephalin (hereinafter abbreviated as 1IEK).

) is developing an efficient production method for MEK by incorporating chemical DNA that encodes the
0). The recombinant plasmid pMEK2, which was obtained when developing an efficient MEK production method, was created using the restriction enzyme BamH.
A fusion gene with DHFR can be easily created by simply replacing the sequence between the I and X h o I sites with heterologous DNA. Furthermore, when a fusion gene is created using pMEK2, the fusion protein produced as a result of the expression of the fusion gene is as follows.

2 and Z of E. coli cells without becoming insolubilized! , ift
It is expected to account for approximately 20% of the total bacterial protein.

However, there is no example of using the above expression vector for the production of β-endorphin.

[Object of the invention] The object of the present invention is to create a fusion gene with DHFR,
- Our objective is to produce a fusion protein with endorphin in Escherichia coli, efficiently separate and purify the fusion protein using the properties of the fusion protein, and develop a β-endorphin9 method that utilizes the highly purified fusion protein.

-k,'FJHヮ112oh 8. . ■B, use. ,
By designing and chemically synthesizing Eiryu Kenkyu and incorporating it into pMEK2, we created a fusion gene between the β-endorphin gene and the DHFR gene, and by expressing the fusion gene in Escherichia coli, we created the DHFR-β-endorphin fusion protein (hereinafter referred to as , abbreviated as fusion protein trade).

Furthermore, by using a fusion protein, β
- It was revealed that endorphins can be produced, and the present invention was completed.

[Configuration of the Invention] The present invention provides (1) a novel recombinant plasmid pENDB15° that enables expression of the 8-conjugated protein pENDB15°; (2) pEN
E. coli cells containing DB 15, (3) pENDB1
A fusion protein produced by E. coli containing 5, (
4) A method for separating and purifying a fusion protein from E. coli containing pENDB15.

and (5) a method for producing β-endorphin using a fusion protein.

(1) New recombinant plasmid pENDB15 Figure 1 is 2
The entire base sequence of pENDB 15 of the present invention is shown.

The figure shows the DNA strand sequence of one of the two-stranded circular DNA using the restriction enzyme (CLaI) (cleavage recognition site near the indlII site, 5'-ATCGAT- 3', first 1j
All is counted as number 1 and written in the direction from the 5' end to the 3' end. pENDB 15 of the present invention is a novel recombinant plasmid. pENDBl5 is 471
It has a size of 8 base pairs and can confer trimethoprim and ampicillin resistance to the host E. coli. pENDBl 5 is pMEK2 (patent application 1986-7)
Described in 9680. ), a 26 base pair sequence containing the sequence encoding MEK between the BamHI and Xho I sites of
This is a 104 base pair chemically synthesized NA and replacement sequence containing a sequence encoding β-endorphin, and the remaining sequences are pMEK2-derived sequences.

The arrangement from 577th to 632nd in Figure 1 is as follows.

It encodes a fusion protein in which β-endorphin is bound to the carboxy terminal side of DHFR via arginine (Arg).

Upstream of the sequence encoding the fusion protein.

There are sequences that allow efficient gene expression (Japanese Patent Application No. 61-312836). That is, from 43rd to 500
The sequence at the 4675th to 4704S is called the SD sequence, which is useful for efficient translation.
It is a consensus transcription promoter and contributes to efficient transcription. From this, when pENDBl5 is introduced into E. coli, it is possible to make a large amount of fusion protein. The produced fusion protein accumulates in a soluble state within the bacterial body, approximately 20% of the dihedral protein.

This makes E. coli containing pENDBl5 resistant to trimethoprim. Also, pEND
Bl5 has an ampicillin resistance gene derived from pMEK1. From this, E. coli into which pENDBl5 has been introduced also exhibits resistance to ampicillin. pENDB
15 was introduced into E. coli and kept in a stable state, pE
Escherichia coli containing NDBl5 was obtained from Tetsukoken by FERMBP.
-2029.

pENDBl5 having such features can be constructed according to Example 1, but the present invention is not limited by the method for constructing the silk recombinant plasmid.

using a liquid medium (containing thorium).

When cultured at 37°C until stationary phase, the accumulated fusion protein reaches about 20% of the bacterial protein. When cultured hedrons are suspended in an appropriate buffer such as phosphate buffer, disrupted by French press or sonication, and separated into supernatant and precipitate by centrifugation, all of the fusion protein is removed from the supernatant. It is recovered in the clear water. Escherichia coli containing pENDB 15 was purchased from Y & Koken as FERM BP-2029.
It has been deposited as.

(2) E. coli pENDB 1 containing pENDBl5
E. coli containing 5 is resistant to trimethoprim and ampicillin. As a result of efficient expression of the fusion protein gene, E. coli containing pENDBl5
The fusion protein accumulates in large quantities in a soluble state within the bacterial body. E. coli containing pENDBl5 was grown in YT+Ap medium (+5 g NaCl, 8 g tryptone, 5'' yeast extract, and 50 mg A(3) in medium In).
Fusion protein Figure 2 shows the DNA sequence of the portion encoding the fusion protein and the amino acid sequence of the protein predicted to be made from it. The fusion protein is a novel protein consisting of 192 amino acids. The sequence from positions 1 to 159, counting from the amino terminus, has a single amino acid substitution in E. coli wild-type DHFR (C
ys-152 (wild type) -* Glu-
152) sequence, and the sequence from +162@th to 192nd is the β-endorphin sequence. The amino acid immediately preceding the β-endorphin sequence is arginine (A r g). β-endorphin does not contain arginine. From this.

The fusion protein was treated with arginyl endopeptidase (Ar
It can be specifically excised by treatment with ginylendopeptidase (which can be manually obtained as a commercially available product). 160th and 161st isoleucine ([1e
)-Leucine (L eu) sequence is B of pMEK2.
DNA encoding β-endorphin at amHI site
This sequence was created to match the reading frame of the genetic code when introducing pMEK2 (pTP, which is the origin of pMEK2)
DHFR produced by 70-1 consists of 162 amino acids, and is the sequence from 1 to 160, counting from the amino terminal side, of the amino acid sequence of the fusion protein shown in Figure 2.

It has a sequence in which two amino acid sequences of Gln-11e are combined. ). The molecular weights of the fusion protein and β-endorphin q are 21,741 and the fusion protein is at the carboxy-terminal side of DHFR, respectively.

Although it has a structure in which β-endorphin is fused, it has DHFR enzyme activity. For this reason, E. coli is responsible for producing fusion proteins.

They become resistant to trimethoprim, a DHFR inhibitor and antibacterial agent.

(4) Separation and purification of fusion protein The method for purifying the fusion protein of the present invention includes: (1) bacterial culture, (2) disruption of bacterial cells, (2) DEAE-) Jobal porgy treatment, and (2) mesotrixate (MTX) binding affinity. chromatography, and ■DEAE-) Yopal force chromatography process.

■Culture of bacterial cells Culture of Escherichia coli containing pENDB 15 is carried out using YT+A
p medium (5 g NaCl in 1 ml of medium.

8g tryptone, 5g yeast extract and 50m
A liquid medium containing g of ampicillin sodium. ) can be cultured. As a medium.

In this pond, ST+Ap medium (in medium 11, 2 g glucose, 1 g dipotassium phosphate, 5 g polypeptone,
Liquid medium containing 5 g yeast extract and 50 mg ampicillin sodium. ), any medium can be used as long as it allows the bacterial cells to grow, but as far as I have investigated.

YT+Ap medium was optimal.

Inoculating E. coli containing pENDB 15 into a medium,
Culture at 37°C until late logarithmic growth phase or stationary phase. The cultured bacterial cells are collected by centrifugation at 5,000 rpm. From the medium 11, bacterial cells with a wet weight of 2 to 5 g are obtained.

Bacterial collection and subsequent operations are performed at low temperatures (between 0 and 10°C, preferably 4°C) unless otherwise specified.

■The face piece obtained by disrupting the culture of bacterial cells was added to 3 times the wet weight of buffer 1 (0
, 1mM Sodium Ethylenediaminetetraacetate D
Crush the hedrons using 10 mM phosphoric acid containing TA). The crushed facepiece liquid is ultracentrifuged at 35°,000 rotations for 1 hour to obtain a supernatant (cell-free extract).

■ DEAE-1 Jobar ram treatment The cell-free extract was applied to a DEAE-1 Jobar ram, which had been equilibrated in advance with buffer 1 containing 50mM KCI.
Wash the column with the column volume of buffer l containing 50 mM KCI. I capacity of the enzyme is slowly (ifri night 1 using 5
A linear concentration gradient of KCI from 0mM to 0.3M is used, and the eluate is fractionated in fixed amounts using a fraction collector. The DHFR activity of the fractionated eluate is measured, and both fractions containing enzyme activity are collected.

(2) MTX-bound affinity chromatography The enzyme solution obtained by the above procedure is adsorbed onto an MTX-bound agarose-7 affinity column equilibrated with buffer 1 in advance. After adsorption, buffer solution 2 (0
, 10mM potassium phosphate buffer containing 1mM EDTA, I) H8°5). For washing, the absorbance at 280 nm of the eluate from the column is measured, and the same buffer solution is continued to flow until the absorbance becomes 0.1 or less. Enzyme elution.

Elution was performed using buffer 2 containing IM KCI and 3mM folic acid. ? ! Fractionate a certain amount of 2 using a fraction collector. Measure the DHFR activity of the fractionated eluate and collect the fractions containing enzyme activity. The obtained enzyme solution is dialyzed against buffer solution 1 three times. At this stage, a fusion protein with a purity of 95% or higher is obtained.

■DEAE-) Jobal Lamb chromatography The dialyzed enzyme solution was equilibrated with 1 buffer solution in advance.
−) Adsorb it to the Yopal power ram.

After adsorption, wash with buffer 1 containing 50mM KCl.

Enzyme elution was performed from 50mM to 0°3M using buffer 1.
The fusion protein can be highly purified and homogenized with good reproducibility by performing the above operations using a linear concentration gradient of KCI and using a fraction collector to collect a fixed amount of the eluate.

According to the present invention, the purification of the fusion protein can be carried out within one week, including culturing, with a recovery rate of 40% or more,
A homogeneous enzyme preparation can be obtained.

DHFR enzyme activity was determined using 2 reaction mixtures (0.05mM dihydrofol fj, 0.06mM NADPH, 12mM 2-
Mercaptoethanol, 50mM phosphate buffer (pH
7,0)) is carried out by taking a 1 ml cuvette, adding the enzyme solution thereto, and measuring the change in absorbance at 340 nm over time. One unit of enzyme is defined as the amount of enzyme required to reduce 1 micromole of dihydrofolate per minute under the above reaction conditions. This measurement can be easily performed using a 9 spectrophotometer.

(5) Production of β-endorphin using fusion protein The cleavage and separation of β-endorphin from the purified fusion protein is performed using arginyl endopeptidase (Arginyl endopeptidase).
This is carried out by treatment with nylendopeptidase (which can be manually prepared as a commercially available product). 0 arginyl endopeptidase per 1 weight of purified fusion protein
．． 011fi and 50mM Tr at 37°C.
in is-HCI buffer, pH 8.5.

Process for 24 hours. Add an equal amount of 50% acetic acid to the reaction solution. This sample was processed using an HPLC apparatus (Shimadzu LC-4A, 1
nertsi l-005 column), 0.1%
Elute and separate using a concentration gradient of 15% to 50% acetonitrile in trifluoroacetic acid. The eluate was 22
It can be detected by i11 constant of absorbance at 0 nm. FIG. 3 shows a high performance liquid chromatogram of an endorphin fusion protein sample treated with arginyl endopeptidase. The peak approximately 26 minutes after sample injection is β-endorphin. Separate this peak fraction. After drying the separated eluate using an evaporator, a small amount of water is added and the mixture is dried to remove the solvent, allowing the β-endorph amino acid composition to be confirmed.

In an example of the present invention, about 1 wet melon from 31 media
0g of bacterial cells was obtained, and this face piece (calculated).

Approximately 122 mg of fusion protein, approximately 19.4 mg of β-
Contains endorphins. ), approximately 53 mg of the fusion protein (yield: 43%, calculated to contain approximately 8.4 mg of β-endorphin) can be purified and obtained, of which 20 mg of the fusion protein was purified using arginyl endopeptidase. After the treatment, approximately 0.6 mg of β-endorphin could be obtained by separating and purifying it by HPLC.

[Effects of the Invention] By using the E. bacterium containing the novel plasmid pENDB15 of the present invention, the fusion protein can be easily separated and purified in high yield, and the fusion protein can be easily separated and purified by treatment with a proteolytic enzyme. This makes it possible to efficiently excise β-endorphin from the fusion protein, which is effective in producing β-endorphin, which is known to have morphine-like physiological activity. The method of the present invention has superior properties compared to the method previously reported by Nagahari et al., such as that the fusion protein is soluble and has DHFR enzyme activity. Excellent.

Next, examples of the present invention will be shown.

Creation of pENDBT5 As the DNA that encodes β-endorphin.

1,5'-GATCCGCTACGGCGGTTTCA
TGACCTCAG-3゜2,5'-AAAAATCA
CAGACCCCGCTG-3'3,5'-GTGAC
TCTGTTCAAAAAACGCAATCATC-3'
4,5'-AAAAAACGCATACAAAAAAGG
TGAATAAC-3'5.5'-TCGAGTTAT
TCACCTTTTTTTG-3'6,5'-TATGC
GTTTTTGATGATTG-3'? , 5. '-C
GTTTTTGAACAGAGTCACCAGCGGG
G-3'8, 5'-TCTGTGATTTTTCTGA
Eight DNAs of GGTCATGAAACCGCCGTAGCG-3' were chemically synthesized according to the phosphoramidite method, and after purification, each DNA was purified using polynucleotide kinase.
The 5' end of A was phosphorylated. Approximately 0.1 ml of phosphorylated DNA (contains approximately 0.01 gg of DNA).
Both DNAs were annealed by incubating with 6060 (this is called DNA-1).

Approximately 1 μg of pMEK2 was added to Bam) (I and Xhor
After cutting with , it was treated with alkaline phosphatase. The alkaline phosphatase-treated DNA was treated with phenol to denature and remove coexisting enzyme proteins, and then the DNA was precipitated with ethanol. Precipitated D
After washing the NA with 70% ethanol, the ethanol was removed and the precipitate was dried under reduced pressure. BamHI and Xh.

DNA cleavage by ■, alkaline phosphatase treatment,
Each operation of phenol treatment and ethanol precipitation is performed by "Molecular CloningA".
Laboratory Manual” (T, M
aniatis, E, F, Frltsch.

J, Sambrook, eds, cold Sprin.
g) Iarbor Laboratory (+982
), hereinafter referred to as 2 References 1. ) according to the method described. The dried DNA was mixed with a 50μm ligase reaction solution (10mM Tris-HCI, p)I 7.4°5mM MgCl2, 10mM dithiothreitol,
After dissolving in 5 mM ATP), 5 μl of DNA-1 was added, 1 unit of T4-DNA ligase was added, and the solution was dissolved at 10°C with mg/ml acipicillin sodium and 1
Nutrient agar medium containing 0 mg/ml trimethoprim (in 1 ml of medium, 2 g glucose, 1 g dipotassium phosphate + 5 g yeast extract, 5 g polypeptone, 1 g
Contains 5g of agar. ) on top.

Six colonies were obtained by culturing at 37°C for 24 hours. These colonies were spread over 1.5 m.
1 of YT+Ap medium (in 1 liter of medium.

5g NaC1, 5g yeast extract, 8g tryptone,! Contains 50 mg ampicillin sodium. )
The bacterial cells were cultured at 37°C overnight.

Transfer the culture solution to each Eppendorf centrifuge tube and incubate at 12.0
The mixture was centrifuged at 00 rpm for 10 minutes, and the bacterial cells were collected as a precipitate. To this, 0.1 ml of electrophoresis sample preparation solution (0,0625M Tris-HCI, pH 6,8
, $2 Sodium Lauryl Sulfate (SDS).

10x glycerin, 5x 2-mercaptoethanol.

Contains bromophenol blue of 0, OO1$. ), suspend the bacterial cells, and keep this in boiling water for 5 minutes.

The bacterial cells were lysed. The treated samples were subjected to 5DS-polyacrylamide gel electrophoresis (U, K).

Lammli; Nature, vol, 227.
p., 680 (1970)). As a standard sample, E. coli containing pMEK2 was treated in the same way, and as molecular weight markers, lactalbumin (molecular weight 114,200), ribsin inhibitor (molecular weight 20,100), and trypsinogen (molecular weight
f124,000), carbonic anhydrase (
Molecule ff12,000), glyceraldehyde 3-
Samples containing phosphate dehydrogenase (1i36,000 molecules), ovalbumin (45,000 molecular weight), and bovine serum albumin (66,000 molecular weight) were run on a 10 to 20% polyacrylamide gradient gel. As a result, in all colonies, pME
The K2 DHF R-ME K fusion protein band disappeared, and the protein with a clearly larger molecular weight (26,0- strain in terms of molecular weight was selected, and this was transferred to YT+A
Cultured in p medium.

Tanaka and Weist) IIm method (T, Tan
aka, 8. Weisblum; J, Bacter
iology, vol, 121. p, 354 (197
According to 5)).

A plasmid was prepared. The obtained plasmid was pEND
It was named B15. pENDB 15 has a sequence between BamHI and XhoI of pMEK2.

It should have a structure that is replaced by the chemically synthesized DNA sequence. EcoRI of pENDB 15 (sequence 471-4768 in Figure 1) and 5all (sequence 93 in Figure 1)
Regarding the approximately 400 nucleotide length DNA obtained by cleavage according to the sequence (positions 5 to 940).

Dideoxy method using M13 phage (J, Mess
i ng;Mehtods in Er+zymo
logy, vol, 101. p. 20 (1983))
The base sequence was determined according to the following. As a result, the sequence from number 471 to approximately number 940 of the sequence shown in FIG. 1 was confirmed. By examining the base sequence, pENDB1
! 5 was found to encode a fusion protein.

The nucleotide sequence of pMEK2 has been revealed by the present inventors (Japanese Patent Application No. 79679/1983). Also, pE
The approximately 4.2 kilobase pair DNA obtained by EcoRI-3alI digestion of NDB15 is Pstf, Hind
[Results of restriction enzyme cleavage experiments using HpaI, AatU, PvulI, BglII, and C1aI,
It was shown to be completely identical to the approximately 4.2 kilobase pair DNA obtained by EcoRI-3al 1 cleavage of pMEK2.

From the above results, it was determined that the entire base sequence of pENDB15 was the sequence shown in FIG.

Example 2 Fusion protein produced by E. coli containing pENDB 15 The amino acid sequence of the fusion protein produced by E. coli containing pENDB 15 was estimated to be the nucleotide sequence or amino acid sequence of the gene. As a result, the amino acid sequence shown in FIG. 2 was obtained.

A fusion protein was isolated and purified from E. coli containing pENDB 15, and the properties of the purified protein were investigated.

Purification of fusion protein A, Amount of bacterial cells used: 10 g B, Enzyme purification table The purification process in the table is ■Cell-free extract, ■DEAE-)
Represents Yopal ram treatment, ■ Mesotrixate-linked affinity chromatography, and ■ DEAE-) Yobal ram chromatography.

Purification Enzyme solution Recovered protein Recovered enzyme Yield process f
fi (ml) lithium (mg) activity (unit) (χ
) ■ 4, 171 ■ 61 230 3.125
74.9 ■ 31 64 2
,014 48.3■ 32 5
3 1,805 43.3 The obtained enzyme protein was analyzed by SDS electrophoresis (method described in the above example).

A single protein band with a molecular weight of 26,000 was observed, indicating that the resulting fermentation product was homogeneous.

Properties of the isolated and purified fusion protein When the purified protein exhibiting DHPR activity was examined by enzyme immunoassay, it was shown to react with an antibody against β-endorphin. In other words, it has become clear that the purified protein contains a structure immunologically equivalent to β-endorphin.

Method for determining the carboxy-terminal amino acid sequence of the purified protein using the carboxypeptidase method). the result.

It was expected to be Gly-Glu (carboxy terminal). Furthermore, when the purified protein was subjected to acid hydrolysis and then subjected to amino acid analysis, results were obtained that matched the expected amino acid composition based on the base sequence.

Example 3 Separation of β-endorphin from the purified and isolated fusion protein 2 ml of the purified homogenized fusion protein solution obtained in Example 2 (approximately 20 rn g + approximately 92
containing 0 nmo 1 e of the fusion protein).

Add 0.2 mg of arginyl endopeptidase,
React at 7°C for 24 hours. After the reaction, add 1 ml of acetic acid. Of that, 0.5ml (approximately 153nmole
(which should contain the fusion protein of
Separation was performed using an il-00S 5 μm column. Elution is 0.1
% trifluoroacetic acid.

This was done by applying a concentration gradient (15% to 50%) of acetonitrile. From 0 to 2 minutes.

From 2 minutes to 32 minutes using 15% acenitrile,
A linear gradient of acetonitrile from 15% to 50% was applied. As a result, an elution curve as shown in FIG. 3 was obtained. The peak fraction approximately 26 minutes after sample injection was separated, and the two separated eluates were dried in an evaporator, and a small amount of water was added and lyophilized to remove the solvent to obtain a peptide. After acid hydrolysis of the obtained peptide, one-fifth of the peptide was used for amino acid analysis. As a result, aspartic acid, threonine, serine, glutamic acid, proline, glycine, alanine, valine 2 methionine, isoleucine, leucine, tyrosine,
Phenylalanine and lysine are each 11.4
,16.3,11.0゜1B,2,5.8,17.6,
11.6, 5.7°5.7. Ll, 7, 12.1, 11
．． 1,11°4, and 16.5 nmole of τT were detected.

I did it. In addition, the specimen used for amino acid analysis was approximately 5.7
This means that it contained μmol e (about 19.7 μg) of β-endorphin. These results revealed that β-endorphin could be recovered with a yield of 19% by separating the arginyl endopeptidase-treated specimen using HPLC using the purified homogenized fusion protein. Since the yield of purification of the fusion protein is approximately 43% and the yield of separation of β-endorphin from the fusion protein is approximately 19%, the isolation yield of β-endorphin produced by E. coli is approximately 8%. It is calculated that

[Brief explanation of the drawing]

Figure 1 is a diagram showing the entire base sequence of pENDB15, and the DNA strand sequence of one of the double-stranded DNA is
It is written in the direction from the ° end to the 3' end. The symbols in the figure represent nucleic acid bases, A is adenine, C is cytosine,
G represents guanine and T represents thymine. The national number is 5'-ATCGAT of the C1al cleavage recognition site that is closer to the restriction enzyme HindllI cleavage recognition site among the two restriction enzyme C1al cleavage recognition sites that exist in pENDB15.
-3', the first °'A pa is counted as number 1. FIG. 2 is a diagram showing the base sequence of the portion encoding the fusion protein and the amino acid sequence of the protein present in pENDB1!5. National symbols represent nucleobases and amino acids, with A representing adenine, C representing cytosine, and G.
stands for guanine, T stands for thymine, Ala stands for alanine, A
rg stands for arginine, Asn stands for asparagine, As
p is aspartic acid, Cys is cysteine, Gln
is glutamine, Glu is glutamic acid, Gly is glycine,) (is is histidine, Ile is isoleucine + Leu is leucine, Lys is lysine, M
et represents methionine and Phe represents phenine. The numbers in the figure indicate the numbers counted from A'' of the ATG codon that encodes the first amino acid, methionine. The chromatogram is shown. The horizontal axis is the time after sample injection in minutes, and the vertical axis is 220 minutes.
Absorbance in nm is expressed in arbitrary units. The peak indicated by the arrow is the elution peak of β-endorphin.

Claims (1)

[Scope of Claims] 1. A DNA sequence that is stably replicated in Escherichia coli, can confer trimethoprim resistance and ampicillin resistance to the host large intestine, has a size of 4718 base pairs, and is shown in FIG. A novel recombinant plasmid pENDB15 with. 2. E. coli containing pENDB15. 3. A dihydrofolate reductase-β-endorphin fusion protein produced by E. coli containing pENDB15 and having the amino acid sequence shown in FIG. 4. Cultivate E. coli containing pENDB15, and use dihydrofolate reductase activity as a guideline to determine dihydrofolate reductase-
Dihydrofolate reductase-β-endorphin fusion, characterized in that the β-endorphin fusion protein is purified from a cell-free extract of cultured bacterial cells using mesotrixate-coupled affinity column chromatography and anion exchange column chromatography. Protein separation and purification method. 5. Separate and purify the dihydrofolate reductase-β-endorphin fusion protein produced by Escherichia coli containing pENDB15, digest the isolated dihydrofolate reductase-β-endorphin fusion protein with a protease, and then extract β-endorphin. 1. A method for producing β-endorphin, which comprises separating and purifying the β-endorphin.