JPH02117694A - Desulfatohirudin mutant - Google Patents

Abstract

NEW MATERIAL: A desulfatohirudin variant (salt) having the formula (wherein Z₀ is Val, Gly-Val or the like; Z₁ is Lys, Gln or the like; Z₂ is Lys, Arg or the like; Z₃ is Lys, Arg, Asn or the like; Z₄ is Pro or Gly; Z₅ and Z₇ are each Gln, Asn or Met; and Z₆ is His, Gln or Asn).

USE: Prophylactics and therapeutics for thrombosis, embolic thrombosis, etc.

PREPARATION: A microbial host strain transformed by a hybridoma vector containing an expression cassette comprising the first DNA sequence which codes for a signal peptide bonded to a promoter, the second DNA sequence which does for desulfatohirudin variant and a DNA sequence containing transscription termination signal is cultured, the product is isolated, and optionally the polypeptide containing free carboxyl groups and/or amino groups is converted into a salt to obtain a compound of the formula.

COPYRIGHT: (C)1990,JPO

Description

DETAILED DESCRIPTION OF THE INVENTION Field of the Invention The present invention relates to modified proteins, processes for their production, pharmaceutical compositions containing them and their use for the inhibition of enzymes.

[Prior art and problems to be solved by the invention] Water leech Hirud medicinalis.

Hirudin, a naturally occurring anticoagulant component in medicinal lily, is a polypeptide consisting of 65 amino acids and having three disulfide bridges. This was the first study on leech saliva in 1884 and Markinardt (N
42.59
7 (1955): Methods Enzymo],
Although known for a long time since the pioneering work of 19924 (1970), the structure of hirudin has been proposed by Dod et al. (FEBS
Lett, 165.

180 (1984)) was recently elucidated. According to the most recent findings, hirudin exists as several variants described as hirudin variant 1 (HVI), hirudin variant 2 (HV2), hirudin PA, and other analogues.

Hirudin is the most potent thrombin inhibitor known and does not affect other enzymes in the coagulation cascade. In contrast to heparin, which is the preferred anticoagulant in conventional anticoagulant therapy, hirudin exerts its action on thrombin and not through antithrombin as heparin does. The interaction between hirudin and thrombin occurs with a very high potency, and this ability has a very high potential for binding to fibrinogen, to platelets, or to 77-
The binding of thrombin to f-thrombin ■ is on the order of magnitude. Therefore, even at low concentrations, hirudin
All interactions of thrombin and their biological consequences can be overcome.

Furthermore, hirudin has low toxicity and is non-antigenic,
and exhibits almost complete release in biologically active form via the kidneys.

Recently, cDNAs encoding hirudin or hirudin variants
The A and synthetic genes were cloned and introduced into Escherichia coli (E
scherichia coli) and Sankiromyces.

Celebishe - Fox-like spitting competition cerev is 1a
e) expressed in a microbial host such as (European Patent Application No. 158564 and No. 1683)
42).

The expression product lacks the sulfate monoester group in Tyrl'1 and is therefore "desulfatohirudin" (d
esulfatohirudin), but
They exhibit approximately the same biological activity as natural hirudin in which the tyrosine residue is present as a sulfate monoester.

Hirudin has been administered to humans by both intravenous and subcutaneous routes. Mean elimination half-life is 0 by intravenous route
．． 84 hours and approximately 50% of the dose administered was found to be excreted intact in the urine. After subcutaneous administration, inhibitory levels of hirudin were found in the plasma for at least 4 hours. Therefore, hirudin appears to have a very short IY use with a retention time similar to heparin. In view of this drawback, there is a strong need for polypeptides with longer half-lives in vivo and selective antithrombin activity. The corresponding polypeptides, if used in routine therapy, would have advantages over existing therapies in deep venous and arterial thrombosis. It is an object of the present invention to provide such antithrombin active polypeptides.

There is also a strong need for hirudin compounds with reduced antithrombin activity. The decrease in antithrombin activity is
This results in a decrease in the activity of the hirudin compound, which prevents thrombin from interacting with its strongest affinity ligands, particularly the platelet receptor.

However, with careful selection of hirudin's antithrombin activity, it retains its activity to inhibit fibrinogen clotting, a low affinity for thrombin. Such hirudin compounds have the advantage of having an inhibitory effect on thrombosis, which is a fibrin-dominated event, but have little effect on hemostasis, which is a platelet-dominated effect. It is a further object of the present invention to provide such hirudin compounds with reduced antithrombin activity.

[Means to solve the problem]

Surprisingly, basic amino acids in the core region (
Increased hydrophobicity of hirudin caused by site-directed mutagenesis of the nucleotide encoding the nucleotide (Lys) and/or other changes in the region leads to decreased antithrombin activity and/or increased half-life in vivo. It was discovered that

Therefore, the present invention provides the following amino acid sequence (I): H-Zo-
Val-Tyr-Thr-Asp-Cys-Thr-G
lu-Ser-GlyGIn-Asn-Leu-Cys
-Leu-Cys-Glu-Gly-Ser-Asn-
Val-Cys-Gly-Gln-Gly-Asn-Z
+-Cys-11e-Leu-Gly-5er-Asp
-Gly-Glu-2, -Asn-Gln-Cys-V
a1Thr-Gly-Glu-Gly-Thr-Pro
-Z+-Za-Zs-5erZ, -24-Asp-G
ly-Asp-Phe-Glu-Glu-I 1e-P
r.

Glu-Glu-Tyr-Leu-Gin-OH (in the sequence, Zo is Val or the dipeptide residue Gly-Val or Net-Vat, Zl is Lys, G
ln+Asn.

Leu, Arg or Val, Zl is Lys,
8rg, Asn.

Val, Leu or Gin, Z3 is Lys,
Arg+ ^3n+Val or Leu, Z4 is P
ro or Guy, and Z and z7 are mutually independently G.
ln, Asn or Met, and Z6 is old s,
Gin or Asn; provided that Zo is Val,
Zl is Lys or Gln, Zl is Lys or Gl
n, Z3 is Lys, Z4 is Pro,
Zs is Gin, Zh is Gin or old S, and Z7 is Asn), and salts thereof are provided.

[Specific explanation]

The variants of the invention contain 1 to 5 amino acid residues, especially 1 to 4 amino acid residues.
Natural desulfatohirudin (
20 is Val; 2. ．． 22 and Z3 are each L
ys, Z4 is Pro, Z5 is Gin, Z is old S, and Z7 is Asn).

The present invention particularly provides that Zo is Val or dipeptide residue Gly
-Val or Met-Val, and Z is Ly
s.

Gin, Asn or Arg, 22 is Lys,
Arg, 8th sn.

Val or Gln, Z is Lys or Arg, Z4 is Pro or Guy, Z is Gln or Met, Z6 is old S or Asn, and Z
.

is Asn or Met; provided that Zo is Val,
Z, is Lys or Gln, and Zl is Lys or Gl
n, Z3 is Lys, Z is Pro,
Z, is Gin, and Z6 is! The present invention relates to a desulfatohirudin variant of (I) and a salt thereof.

Examples of such desulfatohirudin mutants include (A
sn”)-desulfatohirudin, (Asn”)-
Desulfatohirudin, (Val”) Desulfatohirudin, (Gly”) -Desulfatohirudin, (
(Met”)-desulfatohirudin, (Met”)
-Desulfatohirudin, [85n51)-Desulfatohirudin Arg47)-Desulfatohirudin, [Gln"Gln", Arg")-Desulfatohirudin, [8rg3b, Arg41)-Desulfa Tohirudin [ArgZ'l, ^r g 4 j )-
Desulfatohirudin, glycyl-[Gln27+G1
n", Arg")-desulfatohirudin and methionyl-[Gln", Arg")-desulfatohirudin.

The compounds of the invention may exist in free form, but also in the form of their salts. Because they contain free amino groups in some amino acid residues, the compounds of the invention may exist as acid addition salts. Suitable acid addition salts are, in particular, pharmacologically acceptable salts with conventional pharmaceutically acceptable salts. Representative inorganic acids are hydrohalic acids (eg hydrochloric acid), and also sulfuric acid, phosphoric acid and pyrophosphoric acid. Typical organic compounds are inter alia arenesulfonic acids (e.g. benzenesulfonic acid or p-toluenesulfonic acid) or lower alkanesulfonic acids (e.g. methanesulfonic acid), and also carboxylic acids such as acetic acid,
These are lactic acid, palmitic acid, stearic acid, malic acid, tartaric acid, ascorbic acid, and citric acid. However, since the compounds of the invention also contain free carboxyl groups in some amino acid residues, which impart acidity to the whole peptide, they are also suitable for salts with inorganic or organic bases, e.g. sodium salt, potassium salt,
It can also be present in the form of calcium or magnesium salts, or ammonium salts derived from ammonia or pharmacologically acceptable nitrogen-containing organic bases. However, since the compounds of the invention likewise contain free carboxyl groups and free amino groups, they may also exist in the form of internal salts. Pharmaceutically acceptable salts are preferred.

The method for producing desulfatohirudin mutants of the present invention includes a first DNA encoding a promoter and a signal peptide.
a second DNA sequence encoding a desulfatohirudin variant (wherein the promoter is operably linked to the first DNA sequence), a second DNA sequence encoding the desulfatohirudin variant (the first DNA sequence and the second DNA sequence);
A microbial host strain that has been transformed with a hybrid vector comprising an expression cassette consisting of a DNA sequence containing A sequence (linked in appropriate reading frame) and a transcription termination signal is cultured, and the It comprises isolating the rufathirudin variant and optionally converting the resulting polypeptide with free carboxy and/or amino groups into a salt, or the resulting salt into a free compound.

Suitable microbial host strains include, for example, strains of Bacillus subtilis, strains of Escherichia coli and S. cerevisiae.
revisiae) strains.

The transformed microbial host strain is cultured in a liquid medium containing assimilable carbon sources, nitrogen sources, and inorganic salts using methods known in the art.

Various carbon sources can be used. Examples of preferred carbon sources include assimilable carbohydrates such as glucose, maltose, mannitol, fructose or lactose, or acetates such as sodium acetate, which can be used alone or in suitable mixtures. Suitable nitrogen sources include, for example, amino acids, such as casamino acids, peptides, and proteins and their breakdown products, such as tryptone, peptone or meat extracts, as well as yeast extracts, malt extracts, corn staplerica, and ammonium salts, such as ammonium chloride. , ammonium sulfate or ammonium nitrate, which can be used alone or in suitable mixtures. Inorganic salts that can be used include, for example, sodium, potassium, magnesium and calcium sulfates, chlorides, phosphates and carbonates. Furthermore, the nutrient medium can also contain growth-promoting substances. Growth-promoting substances include, for example, trace elements such as iron, zinc, manganese, etc., or individual amino acids.

Microbial host cells transformed with a hybrid vector have a tendency to lose the vector.

Such cells must be grown under selective conditions, ie, under conditions such that expression of the gene encoded by the hybrid vector is necessary for growth. Hybrid vectors currently in use and of the invention (
Most of the selection markers present in (described below) are genes encoding enzymes for aminochocolate biosynthesis or purine biosynthesis. This requires the use of synthetic minimal media lacking the corresponding amino acids or purine bases. However, genes conferring resistance to appropriate biocides (e.g. genes conferring resistance to amino-glycoside G418)
can also be used similarly. Hosts transformed with vectors containing antibiotic resistance genes are grown in complex media containing the corresponding antibiotic, thereby achieving faster growth rates and - higher cell densities.

A host cell containing a hybrid vector with a constitutive promoter expresses the mutant gene controlled by the promoter without the need for induction. However, if the desulfatohirudin mutant gene is under the control of a regulated promoter, the composition of the growth medium must be adapted to obtain maximum levels of mRNA transcripts. That is, in yeast P 1
When using the 105 promoter, low concentrations of inorganic salts must be included for derepression of this promoter.

Cultivation is performed by conventional methods. Culture conditions, e.g. p of the medium
H1 and fermentation time are selected to produce the highest level of desulfatohirudin. The selected yeast or E. coli strain is grown by submerged culture, preferably under aerobic conditions.
desulfatohirudin, preferably at a temperature of about 25°C to 35°C, preferably about 28°C, at a pH of 4 to 7, such as about pH 5, and for 12 hours to 3 days, with shaking or stirring. Cultivation is continued for a period of time that provides a satisfactory yield of mutants.

Regardless of the host strain, promoter and signal peptide used, most of the desulfatohirudin variant produced is secreted into the medium or periplasmic space, with only a small portion remaining bound inside the cell. The exact ratio of secreted to cell-bound compounds depends on the fermentation conditions.

Desulfatohirudin variants can be isolated by conventional means. For example, in the first step, cells are separated from the culture medium by centrifugation. The resulting supernatant can be enriched for secreted desulfatohirudin variants by removal of most non-proteinaceous materials by treatment with polyethylene amino and precipitation of proteins by saturating the solution with ammonium sulfate. . Host proteins, if present, are acidified with acetic acid (e.g. 0.1%
, p114-5). Further enrichment of desulfatohirudin variants can be achieved by extracting the acetic acid supernatant with n-butanol. Other purification steps include, for example, desalting, chromatographic methods such as ion exchange chromatography, gel filtration chromatography, partition chromatography (IPLC1 reverse phase) IPLC, etc. The components of the protein mixture can also be separated by dialysis, by gel electrophoresis or carrier-free electrophoresis according to charge, by suitable Sephadex columns according to molecular size, e.g. by coupling antibodies, especially monoclonal antibodies, or to suitable affinity chromatography carriers. It can also be carried out by affinity chromatography using purified thrombin or by other methods, in particular those known from the literature.

If it is desired to isolate desulfatohirudin variants that have accumulated in the periplasmic space, several complementary purification steps are necessary. That is, desulfatohirudin variants can be treated with chemical drugs such as thiol reagents or EDT by means of causing disruption of the cell wall allowing release of the product, i.e. by enzymatic removal of the cell wall.
A or by subjecting the cell wall to osmotic shock.

tests using anti-hirudin antibodies or anti-desulfatohirudin antibodies (e.g. monoclonal antibodies obtained from hybridoma cells) to detect desulfatohirudin variant activity in both fractions obtained in the purification step;
Thrombin reagent (M, U, Bergmeyer ('W collection), Methods in Enzymatic eight
To lysis Vol II, p314-316.
Verlag Chemie, Weinheim (F
RG) 1983) or blood coagulation test (F, Mar
Kwardt et al., Thromb, Haemost, 4
7, 226 (1982)) can be used.

Depending on the method used, the compounds of the invention may be in free form:
It is obtained in the form of acid addition salts, internal salts or salts with bases. The free compounds can be obtained from acid addition salts or salts with bases in known manner. Pharmaceutically acceptable acid addition salts are obtained from the free compounds by reaction with acids to form the salts mentioned above, and by evaporation or lyophilization. Internal salts are obtained by adjusting pu to a suitable neutral point.

The transformed microbial host of the present invention comprises a promoter, a first DNA sequence encoding a signal peptide (the promoter is operably linked to the first DNA sequence), and a desulfatohirudin variant encoding a desulfatohirudin variant. a second DNA sequence (the first DNA sequence and the second DNA sequence are linked in proper reading frame);
and a transcription termination signal; ◎ transforming a microbial host strain with the hybrid vector; and ◎ transforming a microbial host cell from an untransformed cell. can be prepared by recombinant DNA techniques comprising the steps of selecting;

The hybrid vector of the present invention comprises a first DNA sequence encoding a promoter signal peptide (the promoter is operably linked to the first DNA sequence);
a second DNA sequence encoding a desulfatohirudin variant (the first and second DNA sequences being linked in appropriate reading frame); and a DNA sequence containing a transcription termination signal. comprising an expression cassette.

The choice of an appropriate vector is determined by the microbial host cell to be transformed. Suitable hosts are those mentioned above, especially strains of Satucharomyces cerevisiae,
and bacterial strains, especially strains of E. coli and Bacillus subtilis.

Suitable vectors for the expression of desulfatohirudin mutant genes in strains of E. coli are, for example, bacteriophages, such as derivatives of bacteriophage λ, or plasmids, such as plasmid colE and its derivatives, such as pMB9. psF2124-.

pBR317 or pBR322. A suitable vector contains the complete replicon and marker gene;
This marker gene allows the isolation and identification of microorganisms transformed by the expression plasmid by their phenotypic properties. Suitable marker genes confer resistance on the microorganism to, for example, heavy metals, antibiotics, such as ampicillin or tetracycline.

Several promoters can be used to control expression cassettes in E. coli.

In particular, promoters of strongly expressed genes are used. A suitable promoter is the lac promoter ta
c promoter, trp promoter and IPP promoter, as well as phage N promoter or phage λpL promoter. In the present invention, preferred promoters for use in E. coli are the Ipp promoter or the lac promoter.

Vectors suitable for replication and expression in S. cerevisiae contain a yeast origin of replication and a selectable genetic marker for yeast. Hybrid vectors containing yeast origins of replication, such as chromosomal autonomously replicating segments (ars), are retained extrachromosomally within yeast cells after transformation and replicate autonomously during mitosis. Additionally, hybrid vectors containing sequences homologous to yeast 2μ plasmid DNA can be used. Such hybrid vectors may be recombinantly integrated into the 2μ plasmid already present within the cell, or may replicate autonomously. Marker genes for yeast are in particular genes that confer antibiotic resistance to the host or, in the case of auxotrophic yeast mutants, genes that complement host deficiencies. Corresponding genes are, for example, those that confer resistance to the antibiotic cycloheximide or provide prototrophy in auxotrophic yeast mutants, such as the yoken, u弗, analoku or engineering genes. .

Preferably, the yeast hybrid vector further contains an origin of replication and marker genes for a bacterial host, in particular E. coli, so that the production and cloning of the hybrid vector and its precursors can be carried out in E. coli. Suitable promoters for expression in yeast include, for example, AD
HI, ADllI [or PI (the promoter of the 05 gene, and also the promoter involved in glycolysis,
For example, the PGK promoter or the GAP promoter.

DNA sequences encoding signal peptides ("signal sequences") are derived from genes of the microbial host that encode normally secreted polypeptides.

ompA when E. coli is used as the host microorganism.

tpp, maltose binding protein, λ receptor, leucine binding protein or β-lactamase signal sequence can be selected. A hirudin signal sequence obtained from water leech genomic DNA can be selected for use in yeast. More preferred signal sequences for use in yeast include, for example, yeast invertase, β
-Factor Pheromone Peptidase (KEXI), "
Killer toxin J and inhibitory acid phosphatase (P
H05) signal and pre-pro sequence of each gene, and Aspergillus awamoridan ■ Ankodan awamo
glucoamylase signal sequence from ri). Alternatively, a fusion signal sequence can be created by ligating a portion of the hirudin signal sequence with a portion of the signal sequence (if present) that is naturally linked to the promoter used (eg, Ebong). Combinations that allow accurate cleavage between the signal sequence and the amino acid sequence of the desulfatohirudin variant are preferred. Precisely by including in the construct additional sequences, e.g. prosequences or spacer sequences carrying or not carrying specific processing signals, the precursor molecule contains appropriate signals for transcription termination. 3'-flanking sequences from selected microbial hosts. Suitable 3'-flanking sequences are, for example, those of the gene naturally linked to the promoter used.

The hybrid vector of the present invention can be prepared by methods known in the art, such as a first DNA sequence encoding a promoter signal peptide (the promoter is operably linked to the first DNA sequence), a desulfate An expression cassette consisting of a second DNA sequence encoding hirudin KN (the first DNA sequence and the second DNA sequence are linked in an appropriate reading frame) and a DNA sequence containing a transcription stop signal. or said components of said hybrid vector to a DNA fragment containing a selectable genetic marker and an origin of replication for a selected microbial host in a predetermined order. can do.

DN encoding the desulfatohirudin mutant of the present invention
A can be produced by methods known in the art. This DNA production method involves excising a portion of DNA containing a codon for an undesired amino acid residue from the mirror desulfatohirudin gene, and converting it into a deoxyribonucleotide in which the codon encodes the desired amino acid residue. including replacing the DNA segment with a triplet, or making the mutation by site-directed mutagenesis.

To prepare a DNA encoding a desulfatohirudin variant, a portion of the desulfatohirudin DNA can be excised using a restriction enzyme.

A prerequisite for this method is the availability of suitable restriction sites in the vicinity of the codon to be changed.

For example, small restriction fragments containing codons for undesired amino acids are removed by endonucleolytic cleavage.

Corresponding double-stranded DNA sequences are prepared, for example by chemical synthesis, using triplets encoding the desired amino acids. The DNA fragment is ligated to the remaining long fragment in the appropriate orientation to obtain a double-stranded DNA sequence encoding the variant. The resulting double-stranded DNA is, for convenience and ease of handling of the mutant gene, packaged into larger NA fragments with suitable linkers to allow insertion into cloning vectors and cloning. It is preferable that the

In a preferred embodiment of the invention, the preparation of DNA encoding desulfatohirudin variants is performed by site-directed mutagenesis. This method is an in vitro mutagenesis method, by which defined sites in a region of cloned DNA can be changed.
and M, Sm1th, MethodsEnzymol,
10 (shi, 468 (1983) HD, Botstei
n andri.

5hortle, 5science, 229.1193(
(1985)].

Mutagenesis can be performed on the complete desulfatohirudin gene or on functional parts of the gene that contain codons for undesired amino acids. After mutagenesis, the mutated functional part is linked to other parts of the desulfatohirudin gene to create the complete desulfatohirudin mutant D.
Get NA.

A method for mutating a desulfatohirudin gene or a functional part thereof is a method of mutating a single-stranded DNA or a single-stranded gene comprising the desulfatohirudin gene or a part thereof, excluding a mismatch that directs the mutation, or a hybrid to be mutated. Hybridizes with an oligodeoxyribonucleotide primer that is complementary to a region of a gene, and uses this hybridized oligodeoxyribonucleotide as a primer to initiate synthesis of a complementary DNA strand, resulting in (partially) double-stranded DNA. into a receptor microbial strain, culture this microorganism, and transform the modified (
Mutant) The method is characterized by selecting a transformant containing DNA having the desulfatohirudin gene.

No, per - The present invention further provides a promoter, a first DNA sequence encoding a signal peptide (the promoter is a first DNA sequence encoding a signal peptide);
A sequence), a second DNA sequence encoding a desulfatohirudin variant (operably linked to the first DNA sequence);
A microbial host strain transformed with a hybrid vector comprising an expression cassette consisting of a DNA sequence containing a transcription termination signal (A sequence and said second DNA sequence are linked in appropriate reading frame);
The present invention also relates to a method for producing the transformed microbial host strain, which comprises transforming a microbial host with the hybrid vector.

Microbial host strains are as described above. Transformation with the hybrid vector of the present invention can be carried out, for example, by methods described in the literature, such as S. cerevisiae, Proc, Natl, Acad, Sci.

USA, Anagno, 1929 (1978) for B. subtilis.
s topou Ios et al., J. BacLeriol,
, 81,741<1961) and for E. coli by M. Mandel et al., J.
, Mo1. Biol, 53.159 (1970). Isolation of transformed host cells is advantageously carried out, for example, from a selective nutrient medium supplemented with a biocide to which the marker gene contained in the expression plasmid confers resistance. For example, if the hybrid vector contains the amp'' gene, ampicillin is added to the nutrient medium. Cells that do not contain the hybrid vector are destroyed in such a medium.

The novel variant of desulfatohirudin obtained according to the present invention has valuable pharmacological properties and, like hirudin extracted from water leeches, can be used prophylactically or especially in therapeutic methods. can be used.

The desulfatohirudin variants of the present invention, like natural hirudin, are potent inhibitors of thrombin. for example,
These are 10-'M-10-'' M(7) Ki values (desulfatohirudin mutant-thrombin complex dissociation constant)
has. These desulfatohirudin variants are completely specific for thrombin and show no interaction with other proteinases of the blood coagulation system. Toxicity is extremely low. Similarly, no hypersensitivity or allergic reactions are observed. Furthermore, the variants of the invention have a duration of action in vivo comparable to or better than natural desulfatohirudin.

Therefore, the novel desulfatohirudin variants of the present invention, similar to natural hirudin, can be used for the treatment and prevention of thrombosis and thromboembolism, including the prevention of postoperative thrombosis, such as acute shock (e.g. septic shock or It can be used for the therapy of polytraumatic shock), for the therapy of consumptive coagulopathy, in hemodialysis, in blood separation and in extracorporeal blood circulation.

The invention also relates to pharmaceutical compositions comprising at least one compound of the invention or a salt thereof, optionally together with pharmaceutically acceptable carriers and/or auxiliaries.

These compositions may be used in particular in the above-mentioned conditions if they are administered, for example, parenterally, for example intravenously, subcutaneously or intramuscularly, or topically.

The present invention also provides for the prophylactic or therapeutic treatment of the human or animal body, in particular for the aforementioned clinical conditions, in particular for inhibiting the coagulation of blood within or outside the human or animal body. The present invention relates to the use of novel compounds and to pharmaceutical compositions containing said compounds.

The dosage depends, among other things, on the particular mode of administration and the therapeutic or prophylactic purpose. Individual dosage sizes and administration methods are best determined by individual judgment of the particular case of disease.

Methods for determining the relevant blood factors necessary for this purpose are well known to those skilled in the art. Typically, for injection, a therapeutically effective amount of a compound of the invention will be from about o,oos to about 0.1
mg/kg body weight. Approximately 0.01 to approximately 0.0
A range of 5 ■/kg body weight is preferred. Administration is by intravenous injection,
It is administered by intramuscular or subcutaneous injection. Thus, a unit form of a pharmaceutical composition for parenteral administration may contain approximately 0
．． It contains from 4 to about 7.5 inches of a compound of the invention. In addition to the active ingredient, these pharmaceutical compositions usually contain buffering agents, such as phosphate buffers intended to maintain a pH of about 3.5 to 7, and further chloride to adjust isotonicity. Contains sodium, mannitol or sorbitol.

These may be in lyophilized or dissolved form, the solution preferably containing an antibacterially active preservative, for example 0.2-0.3% 4
- May contain hydroxybenzoic acid methyl ester or ethyl ester.

Compositions for topical administration can be in the form of aqueous solutions, lotions or gels, oily solutions or suspensions, or oil-containing or emulsified ointments. A composition in the form of an aqueous solution may be prepared, for example, by dissolving the active ingredient of the invention or a pharmaceutically acceptable salt thereof in an aqueous buffer of pH 4 to 6.5 and optionally adding additional active ingredients, such as an anti-inflammatory agent and/or a pharmaceutically acceptable salt thereof. or by adding a polymeric binder, such as polyvinylpyrrolidone, and/or a preservative. The concentration of active ingredient is approximately 0.1 per 10 g of solution or gel.
~1.5 ■, preferably 0.25 to 1.0 ■.

Oily dosage forms for topical administration may, for example, contain the active ingredient of the invention or a pharmaceutically acceptable salt thereof in an oil, optionally with a humectant such as aluminum stearate and/or with an HLB value of less than 10. A surfactant having a "hydrophilic-lipophilic" balance, such as a fatty acid monoester of a polyhydric alcohol, such as glycerin monoester, sorbitan monolaurate, sorbitan monostearate or sorbitan monooleate, is added and suspended. It can be obtained by Fat-containing ointments are, for example, active ingredients according to the invention or salts thereof in an extensible fatty base, optionally with an HLB value of less than 10.
obtained by suspending while adding de). The concentration of active ingredient is about 0.1 to about 1.5 in about 10 g of base.
mg, preferably 0.25 to 1.0 mg.

In addition to the aforementioned compositions intended for direct medical use in the human or animal body, the present invention also relates to pharmaceutical compositions for ex vivo medical use in humans or animals. Such compositions are used in particular as anticoagulants to blood that is to be subjected to extracorporeal circulation or processing (for example extracorporeal circulation or dialysis in an artificial kidney), preservation or modification (for example blood separation). These compositions, such as stock solutions or unit dosage forms, are similar to the compositions of the injectable compositions described above.

However, the amount or concentration of active ingredient is advantageously based on the volume of blood to be treated, and more precisely on the thrombin content. In this regard, the active ingredient of the invention ('f1
) completely inactivates thrombin, which is about 5 times its weight,
It should be borne in mind that even relatively large amounts are physiologically harmless, and even at high concentrations they are rapidly cleared from the circulatory system, so that there is no risk of overdosing, even for example during infusions.

Depending on the specific purpose, the appropriate dosage is blood! Approximately 0 hits
．． 0.01 to about 1.0 cm of active ingredient, but there is no danger in exceeding the upper limit.

The invention particularly relates to the desulfatohirudin variants described in the Examples, hybrid vectors, microbial host strains transformed with said hybrid vectors, and methods for their production.

Various aspects of the invention will now be described with reference to the drawings.

-11 of Boothmid ML350 (see Figure 1)
a) Bootmid IIN-11 1st DNA of OA-2
0 g of plasmid plN-III-ompA-2 (J,
Ghrayeb et al., EMBO-J, 3.2437 (1
984)) to 100mM Tris-HC of 25111
g (pH 7,5), 50mM NaCl and 11
00u/relative gelatin and digested with restriction endonucleases EcoRI and BamH1. The solution is adjusted to TNE and extracted with phenol/chloroform. The DNA is precipitated with ethanol. Vector DNA plN-11 first osp^-
2/EcoRI/BamHI is isolated by gel elution after electrophoresis in agarose.

b) Plasmid pML310 containing 2'20 pg of DNA of Boosmid ML310 (Yoguchi Nnoma Patent Application N
o, see 168342) at 100mM of 504.
Tris-11CN (pl+7.5), 50m
Digest with controlled dragon endonucleases EcoRI and BamHI I in M NaCl and 100 μg/relative gelatin. The solution is adjusted to TNE and extracted with phenol/chloroform. The DNA is precipitated with ethanol. Fl-Fz-DNA (hirudin gene) was extracted by gel elution after gel electrophoresis in agarose.
isolate.

11! g F, -F, -DNA (hirudin gene)/E
coRI/BamH1 and 30 cod vector DNA p
lN-II[-ompA-2/EcoRI/Ba
mHI 50111 with 100mM Tris-11c4
(pitl-5), 50+++M NaCl and 100x/In1. Dissolve in gelatin and T HE
Adjust to. The solution is extracted with phenol/chloroform and the DNA is precipitated with ethanol. DNA precipitate was treated with 50mM Tris-HCI (pH 7,8)
, 10mM Mg (, ez , 10n+M DTT,
0゜5mMATP and 100n//! Of gelatin? To Yon & 20ttl? Dissolve and incubate at 15° with 25 units/al T, DNA ligase (Biolabs).
Treat at C for 3 hours. Thus, FI Fg D
Recombinant plasmid p into which NA (hirudin gene) is inserted
Form ML35Q.

d] II 8101 by Zubumi ML350
Mandel et al. (J, Mo1. Biol, 53;1
Calcium-treated E. coli 118101 is prepared as described by 59 (1970). Recombinant plasmid 'p? The solution obtained in C) containing IL350 was heated at 65 °C for 10 minutes to obtain T4DN.
A ligase was inactivated and then cooled to 37°C. 10 μl of the resulting reaction mixture was diluted with 10 mM MgC.
Q z and 10 mPI Tris-HCj! (pH
Add 150 μl of E. coli 11810111I cells in 7, 5) to make a total volume of 200 μl.

The mixture was then cooled for 30 minutes, heated for 2 minutes at 42°C, and then treated with 1 d of Shiichi's medium (Nomacletryptone 10g/A, Bacto yeast extract 5g/A, NaC
β5 g/i, glucose 5 g/l, ampicillin 0.1 g/l) for 50 minutes at 37°C.

This mixture is then plated in 0.2 mfl portions onto 5 agar plates (Ma, Nkonky Agar, Difco) containing 60 I4/m ampicillin (Celva).

The agar plate is then held at 37°C for 16-18 hours. 185 ampicillin-resistant colonies of transformed E. coli HBIOI cells are obtained.

e) Six transformed colonies (Example 1d) of the F-F-ONA colony were filtered on a nitrocellulose filter 885 (Schlecicher and 5
(chull). Grunstein and H.
ogness (Proc, Natl, 8cad, sci
Colonies are lysed and their denatured DNA is immobilized on filters according to the method of , UsA, 72, 396H1979). Next, prehybridization of the filters was performed using 20 compounds (per filter) of 4X5EP (30mM Tris-11C
j! (pH 8), 150n+M NaCl, 1mM E
DTA solution], 0.1% (-/su) Ficoll 400
(Pharmacia), 0.5% SDS, 50 cod/d modified calf thymus DNA at 64°C for 4 hours. The nitrocellulose filter was then filtered with 20d (per filter) of 5X5ET (w/v) 0.1% (w/v) Ficoll 400.
32p radiolabeled probe (approximately 103-10' per filter) for 16 hours at 64°C in denatured calf thymus DNA.
Cerencov cplI+). Oligonucleotide 46/64 complementary, 1158.96/6
A mixture consisting of 7 and 154/64 complementary (see European Patent No. 11iNtlL168342) is used as a probe.

Next, filter 2×5FF, 0.2% SDS
Wash twice (first for 30 minutes and then for 60 minutes) at room temperature. The filters were then dried between 3 drums of paper (Whatman) and placed on X-ray film (Fuji) with a reinforced screen (Ilford) at -80°C for 1-2 hours.
Leave it for a day.

The resulting autoradiogram shows 5 positive colonies (clones), which can be used for further processing, one of which is designated pML350.

-1+ plasmid p of BH109
ML350 is a multi-cloning linker (EcoRI
, former nd III, Ba5H1 site) containing the plasmid plN-I[[-ompA-2, so the mature hirudin gene is preceded by Ala, Gin, P
he, contains 12 additional base pairs encoding Met. To express mature desulfatohirudin, these 12 base pairs are looped out by in vitro mutagenesis using the 27mar oligonucleotide.

a) ML350 Xba I BamHI S
The 5n plasmid pML350 of I) is digested with endonucleases Xba I and BamFI I.

The larger of the two Xba first BamHI fragments (31) was isolated by gel elution after electrophoresis on agarose and 1 mM Tris-H (J (pH 7,5)
, dissolved in 0.1 mM EDTA.

b) 5 of ML350 Pvu T (SU)
Transducing the plasmid pML350 with endonuclease Pv
Digest with uI. Next, the linearized DNApM
L350/Pvu 1 is digested with 3 units of intestinal alkaline phosphatase (Boehringer) for 30 minutes at 37°C. The enzyme is inactivated by heating this solution at 65° C. for 60 minutes. Linear pML350/P
Vul (S II ) DNA was isolated by electrophoresis on agarose followed by gel elution and 1 mM Tr
is-HIJ! (pl+1.5), 0.1mM
To EDTA? Capacity.

C) Analogously to the method described in the European patent application Na168342 for the first nucleotide 27mer 2, the following DNA fragment (designated I27): 5'-GTA GCG CAG GCCGTT G
Synthesize TT TACACCGAC-3'.

Phosphorylation of the 5'-end was performed by (r-32P)-AT
P and T4 polynucleotide kinase (Herringer)
Molecular Cloning, A
Laboratory Manual (T, Maniat
is etc.), Co1d Spring tlarbo
rLab, (1982), p. 125.

d) Boosmid BH109 -+1 0, 3 ttg of 5I DNA and SI [DNA
Phosphorylated DNA fragment 127 of 0pmo I and 27m of 1 mM Tris-HCl (pH 7,5), 0.1
Mix in mM EDTA. 3Ill in this mixture
of 10x polymerase-ligase buffer (I M Na
C1,65mM Tris-IICj! (pH7,
5) , 80mM MgC1, and 10mM β-mercaptoethanol]. The mixture is heated in a boiling water bath for 3 minutes to denature the DNA fragments. The mixture is then gradually cooled to 30°C at approximately 1°C/min).
and incubate at this temperature for 30 minutes. Further, the mixture is incubated for 30 minutes at 4°C and then for 10 minutes in water.

4 types of deoxyribonucleotide phosphates (7 each
．． 5 LIIM) 1h=f, 10mM AT of 6p1
P, 6 pl of ↑4 DNA ligase (2,5 U/I
i) and 1.2ttl of Klenow DNA polymerase (Boehringer, 5U/μl) and this D
NA? ! u compound (total volume 55 μl) at 12.5°
Incubate for 16 hours at C.

The intact starting plasmid pML350 is destroyed by digesting this DNA mixture with 2 units of the endonuclease EcoRl for 1 hour at 37°C.

Plasmid pB8109 is formed by this method.

Plasmid pBH109 contains the lac promoter/operator and the Ipp promoter operably linked to the ompA-2 signal sequence and the gene encoding mature desulfatohirudin linked in frame with the signal sequence.

■ Transformation using E. coli HBIOI cells treated with Hirusi calcium and M13m 19 hirudin is carried out as described in Example 1, d). Total reaction mixture used was 55μ! It is.

100 transformed colonies are cultured and plasmid DNA is prepared from each colony and digested with EcoRI. All plasmid DNA that is not digested by EcoRI is potential plasmid pBl1109, which lacks the EcoR1 site. Two identical colonies were identified. select one of these, and p
It is called BH109.

01111) Following A-2 reader array <F+ Fz
The correct sequence of DNA is confirmed by sequence analysis.

mutated] 5' CAG GGT AACAAT
TGCATCCTG 3'-de chain
Gin Gly Asn Tii Cys
The summer ie Leu mutagen primer was synthesized using the phosphoramidite method (M, H, Garuthers, Che.
IIlical and Enzymatic Synt
hesis of Gene Fragments (H
, G, Ga55en and A.

Lang (ed.) Verlag Chemie, Weinh
eim, West Germany].

5IJ1 M13mp19 two-stranded DNA (ds-DN
A: 0.1, i/m; Rea of 2J11 in BRL)
ct2 (500mM Tris-HCf (pH 8)
,0), 100mM MgCl 2.500mM Na
C1) (BRL), 1 ul of Xba I (I
OU/jd), 0.5 ttl BamHI (1
0U/td), and 1211! Add water. 3
After 1.5 hours of incubation at 7°C, 0.
Ba1llHI of 51J1, React of 2.5111
3 (500mM Tris-HCj2 (pH 8,
0), 100mM MgCjl! z, 1000mM
NaC1) (BRL), and 2Jl! Add water,
Incubation is then continued for 1 hour at 37°C. The capacity is 100μ with water! Make it. ds-DNA was isolated by phenol extraction and ethanol precipitation and
ttl TE buffer (10mM Tris-It(J,
Dissolve in 1mM EDTA, pH 8.0).

B, 5/g of plasmid pB11109 was cut with Xba I and BamHI as described above, and the digest was run on a 3.5% polyacrylamide gel at 150 V for 3 h and IXTBE buffer. solution (IOXTBE buffer: 108 g Tris, 55 g boric acid, 9.3 g E
Electrophoresis is performed using DTA 21hO). Xba I-B containing the hirudin gene (250bp)
The amHI fragment was dissolved in 400d of 1XT containing 10Ill of ethidium bromide solution (101!g/rni, in water).
After soaking the gel in BE buffer, visualize under UV light. The gel portion containing the restriction fragment is excised from the gel;
And 500. Place in a dialysis bag with 0.5 ul of XTBE and in a BIO-R2O minigel electrophoresis apparatus using 0.5 XTBB as migration buffer.
Electrophorese the DNA at 70 μm for 30 minutes.

The DNA was transferred to a Schleicher & 5chu column equilibrated with 0.5 XTBH.
ll) Load on top. Column 21n1. 0.5XT
Wash with BB and dilute the DNA with 0.5 XTBE (1r
Elute with IM NaC4 in tdl). DNA
is precipitated with ethanol and redissolved in 10 ttl of TE buffer.

5IJI Xba I BamHI hirudin insert,
2p! XbaI-BamHI cleavage of M13mp19
．． 1 jll of IOX ligase buffer (50mM Tri
s-11cl (pl+7.5), 10mM MgCf
, , 10mM dithiothreitol], AT of ll11
P, and 1.54 T, DNA ligase (BRL
: I U/I) and incubate overnight at 14°C. Using a ligation mixture of 5I, J,M
essingl:Methods in Enzymo
Escherichia coli JMIOI is transformed according to the method of Physiology, 101.2l-78 (1983)). Pick up 12 clear plaques and from each plaque J, Mess.
Single-stranded DNA as described by iB (supra)
Prepare A (ss-DNA). M13mp19 /
50jl of DNA named Hirujin! redissolve in TE buffer (0.1-0.5 μlg/pa).

200 pmol (23p) of mutagenic primer 1 (see above) was added to 10x kinase buffer (IMT
ris-HC4, 0.1M Mgclz, 0.1
M dithiothreitol, pH 8,3), 3Ill of 10
mM ATP and I11! Phosphorylated by addition of T4 polynucleotide kinase CBRL, 100/m). After 1 hour incubation at 37°C, 65
The reaction is stopped by heating at 0C for 10 minutes.

6 μ7 (0,51 pg) of single-chain M13mp19/hirudin (section I-C) was added to 3 ti (20 pmol
) of the phosphorylated mutagenic oligodeoxyribonucleotide (
6.6 pmol/l! and 11 Buffer A (0,2
M Tris-HCl (pl+7.5), O, 1M
Mg(f!z, 0.5M NaCj!, 0.01
MDTT) for 5 minutes at 70°C and slowly cooled to room temperature over 30 minutes.

To the above annealed mixture, add 1 μl of buffer B [
0,2M Tris-H (l (pH 7,5), O, L
M MgCff1z, 0, OIM DTT), 1 p
l of 10mM ATP, 4ttl of 2mM dN
Add TP mixture, 5Ii of T4 DNA polymerase (Boehringa, IU/I), and 5 μl of T4 DNA ligase (BRL, IU/μl). This mixture is 16
Incubate for 3 hours at °C. 10 at 65°C
Stop the reaction by incubating for minutes.

D, and the DNA-controlled ligation mixture was diluted 1:20 with sterile water, and the dilution 1
jll and 5μ! , and 1 μl of the undiluted mixture was used to incubate competent E. coli BMII 71118l S cells [B, Kraner, W, Kramer and [+,
-J Fr1tz, Ce1l 38879-887 (1
984)). Cells were “M13clo
ning and 5equenciB l1andb
Pick 12 colorless plaques and prepare 5sDNA as described in Sections I-C.

Each of the 12 5s-DNA samples was analyzed using the dideoxynucleotide chain termination method (F.

Sanger, S., N1ckler and A.R., Co.
ulson+ Proc, Natl.

Acad, Sci, USA 74.5463-546
(1977)). First, only dideoxynucleotides complementary to the predicted mutated base are used in the reaction.

Next, 5s-DNA from several positive mutants was
bor and Richardson (Proc, Nat
l, Acad, Sci, USA 84+4767-4
77H1987)) to establish sufficient NA sequences of the mutants using 77 DNA polymerase (Sequenase, 115B). The expected base change encoding a Lys-+Asn mutation at position 27 of recombinant hirudin is observed in the DNA sequence.

Phage DNA with the expected sequence was transformed into M13mp1.
9/Hirudin is named 27N.

Competent E. coli JMIOI cells were transformed into 10-20 ng of single-chain hirudin with 27N mutant DNA,
And “M13 cloning and seque
ds-DNA is prepared as described in the ncing 1landbook' (published by Amersham). 40-50xy from a culture of 100mff1
ds-DNA is obtained.

G, hirudin Xba I-BamH [25p
Hirudin Xba l-B mutated from the ds-DNA of
Cut out am1l I insert and section IB
Purify as described. 20μ of DNA
Dissolve in 1 liter of sterile water.

6 μl React 2 buffer (BRL), 2JI
BamHI of XbaLllIf of I (20 unit 17 points)
(10 units), 1 μl EcoRI (10 units)
Prepare a digest of approximately 1.5 units of pTN-m-ompA-2 plasmid by adding 37 μl of water (1150 μl total volume) and incubating for 3 hours at 37°C. unit) B
an+HI, 1m (10 units) EcoRI, 5I
JI's React 3 (BRL) and 12μ! of water and continue incubation for 1 hour at 37°C.

Transform the patient cells. 2×YT/ampicillin (501!g ampicillin/ate2XYT) of 3-g ampicillin/ate2XYT was added to the sample and the cells were allowed to grow for 1 hour 8 hours at room temperature. Next, a sample of the culture was taken and L
B/Ampicillin C30nAmpicillin/dLB-Agar) plates and grown overnight at 37°C. This transformed plasmid DNA was transformed into plN-m-o
mpA-2/HIR- is designated as 27N.

27N Xba I-BamH to 9j11 hirudin
I insertion part DNA, 21! l's Xba I Bam1l
I-cut plN-III-ompA-2 vector DNA
, 3 μl of IOx ligation buffer (BRL) and 1 μZ (1
0/μZ) T4 DNA ligase (BRL) and incubate for 16-20 hours at 14°C.

5J1! J, Mess in
g According to the method described above, 0.3 ml of E. coli J
10 from MIOI Combite LB/Ampicillin Plate
Pick 5 bacterial colonies and add 50ml of LB/ampicillin (501tg77p'i'J 7lml LB
) for 5 hours separately at 37°C. A 1 ml sample is taken from each culture tube and cells are harvested by centrifugation (3000 x g for 5 minutes). Each sample of cells was diluted with 1004 10mM Tri
Osmotic shock is applied by treatment with s-H(J (pH 8,1) for 30 minutes at 0°C to release substances in the periplasmic space of the bacteria. Cells are isolated by centrifugation as described above. Collect and test the supernatant for hirudin activity as described in Section V-B.

The sample giving the highest inhibitory activity is selected for batch culture.

The remaining cells (4 ml) from the most active sample were
l of LB/ampicillin (50 pg ampicillin/m
ll LB). Cultures were grown overnight at 37°C and centrifuged (3000× g, 15
Harvest cells by 5 min). 10m of 50ml of cells
The cells are osmotic shocked by resuspension in M TrisHCf (pH 8,1) for 1 hour at 0°C. Cells are removed from the periplasmic fraction by centrifugation at 6000Xg for 10 minutes.

D. The pH of the periplasmic fraction of Asn”-Desulf hirudin is adjusted to 6.5 with 0.1 MH (j!) and filtered through a 0.45 filter (Nalgen). The protein is diluted with 50 mM bis-Tri
Mono-Q column FPLC system (Fast Prote
in Liquid Chromatography
.

Pharmacia LKB). The desulfatohirudin mutant was removed from the column using bis-Tris-HCI.
Elute with a linear salt gradient over 45 minutes from 0 to 3001 II M NaCl in 1 (pl+6.5).

Collect 0.8 d fractions of the column eluate and test for hirudin activity as described in section [[-B. Both aliquots containing the desulfatohirudin variant were pooled, filtered as above, and 0.0% in water.
09% (v/v)) chromatographed on a Millipore-Waters II PLC system using a Brownlee Labs C8 reverse phase 11PLc column equilibrated with lifluoroacetic acid. Elute the hirudin variants from the column with a linear gradient of 7-28% (v/v) acetonitrile in 0.09% (v/v) trifluoroacetic acid in water.

(Asn'')-desulfatohirudin with a purity of about 98% or greater elutes as a single peak at 28 minutes.

(2) Purified (Asn'')-desulfatohirudin was characterized by its amino acid composition, N-terminal sequence, and peptide mapping.

2~5I! g of protein is hydrolyzed in a glass tube at 110°C in 6NH (/!) (R, L, Henrik
son.

and S, C, Meredith, Anal, Bioch.
Em, 136 +65-74 (1984)). The amino acids are dried in vacuo, derivatized with phenylisothiocyanate, and separated on a reverse phase column [A, B,
Bidlingmeyer, S.A., Cohen and T.L., Taruin+J, Chromatogra.
phy+336 +93-104 (1984)). The molecule It6889D is used to calculate the amino acid composition.

Approximately 5 Qpmol of (Asn”)-desulfatohirudin was applied to Applied Biosys Lems 470.
Eight gas phase sequencer (M, W, Hunkapiller
Andri, E, 1load, Methods inEnz
ymology, 91, 486-494 (1983)
) to establish the N-terminal amino acid sequence through five cycles of automated Edman degradation. The resulting phenylthiohydantoin amino acid was
Systems type 120 online analyzer was used to analyze a reversed-phase II PLC system (R,M, Hewick, M
, W., Hunkapiller, L.E., Hood and -.

J, Dreyer, J, Biol, Chem, 256
．． 7990-7997 (1981)).

To obtain the peptide map of (Asn”)-7′ sulfatohirudin, 50 I!g of protein is vacuum dried and treated with performic acid for 1 hour at 37°C (C,H,1
1゜Hirs, Methods in Enzymol
ogy 11, 197-199 (1967)).

Add 45 m of cold water to the reaction mixture, freeze and vacuum dry (twice). 5 oxidized hirudin mutants
011! 50111M NH41 (dissolved in CO3,
and one scrap of thermolysin.
) (Boehringer) for 4 hours at 37°C. Prior to fractionation, the digest is vacuum dried and dissolved in 0.1% trifluoroacetic acid in water (v/v).

Vy equilibrated with 0.1% trifluoroacetic acid in water
Purify the peptide by reverse phase HPLC using a dac C1B column.

Peptides are eluted with a linear gradient of 0-28% acetonitrile over 90 minutes at a flow rate of 1 min.

The amino acid sequence of the peptide containing the mutation was determined as described above, and the amino acid substitution Lys27→85n27 was confirmed.

Mutagenic primer for Va136 of L s36 of Hirujin 2 3' CTG CCA CTT TTA
TTG GTCACG 5' mutated sequence GACGGT G^ AAT AACCAG
TGC3'8sp Gly Glu Asn
Asn Gin Cys Mutagenic Primer 2 and Example 3
Perform site-directed mutagenesis using old 3mp19/hirudin as described in (Sections I and ■). Transformation plasmid DNA was transformed into plN-m-ompA-2/HIR.
- is designated 36N, and the mutant protein is expressed in E. coli and purified as described in Example 3 (Section ■).

The substitution of Asn27 for Lys27 in this mutant protein was confirmed by amino acid composition and N-terminal sequence analysis (Example 3; Section ■), and its inhibitory properties were determined (Example 19). This mutant [As n
3b)-Desulfatohirudin.

The method described in Examples 3 and 4 is repeated using mutagen primer 3 to obtain and characterize the mutant protein of interest in which Lys36 is replaced by Va136.

Transformation plasmid DNA was transformed into plN-I [first ompA
-2/ It is called IIIRK36V. This mutant (V
an36)-desulfatohirudin.

The method described in Examples 3 and 4 is repeated using the mutagen Brimer 4 to obtain and characterize the mutant protein of interest in which Pro48 is replaced by G1y48.

Transformation plasmid DNA was transformed into pIN-III-ompA.
-2/HIRP48G. This mutant (Gly
)-Desulfatohirudin.

Mutagen Brimer 5 3' GGCTTT GGCTACAGA
Repeat the method described in Examples 3 and 4 using GTG TTG 5' mutagenic primer 5 and use the GIn49 force (Me
obtaining a mutant protein of interest substituted by t49;
and characterize. Transform the plasmid DNA into plN
-m-ompA-2/HIR-Q49N. This mutant protein is called (Met'']-dedesulfatohirdi.

Example 8. Gin Ser His Asn A of hirudin to Met52 of Asn52 of hirudin
sp Gly Asp coding strand 5' CAG
TCT CAC Cucumber G^CGGT GAC3' mutagen primer 6 3' GTCAGA GTG 'j^ko;, CTG CCA CTG 5' mutated copy 5'
CAG TCT CAC phantom'G GACGGT GA
C3'-g Gln Ser [lis
Met Asp Gly Asp Mutagenic Primer 6
Repeating the method described in Examples 3 and 4 using Asn
A mutagen protein in which 52 is replaced by Met52 is obtained and characterized.

Transformation plasmid DNA was transformed into plN-m-on+pA
-2/ It is called HIRN52M. This mutant (Ne
t”)-desulfatohirudin.

Hirujin's Pro Gin Ser His A
sn Asp Gly coding sequence 5' CCG CA
G TCTCAACGACGGT 3' mutagen primer 6 3' GGCGTCAGA TTG T
TG CTG CCA 5' mutated co 5' CC
G CAG TCT AACAACGACGGT 3'
-D Array Pro Gly Ser Tan1Asn
The method described in Examples 3 and 4 is repeated using the Asp Gly mutagen Brimer 6 to obtain and characterize the mutant protein of interest in which old s51 is replaced by Asn51.

Transformation DNA was transformed into plN-I [first ompA-2/HI
It is called R-H51N. The mutant is called (Asn'')-desulfatohirudin.

By repeating the methods described in 4 and 4, a mutant protein of interest in which Lys27 is replaced by G1n27 and Lys47 is replaced by Arg47 is obtained and characterized. Transformation plasmid DNA was transformed into plN-■-o
mpA-2/1llR427 (1, designated K47R. The mutant is designated as [Gln27, Arg'')-desulfatohirudin.

Hirujin's Gin Gly Asn Lye C
ys code 5' CAG GGT AACAA
A TGCrle Leu ATCCTG 3' Mutagenic Primer 8 A 3' GTCCCA TTGTCT
ACG TAG GAC5' mutated co5' CA
G GGT AACCAA TGCATCCTG 3'
-do chain Gin Gly Asn; C
ys lle LeuB, Ls47 to Ar47.

Hirujin Gly Thr Pro LLIAP
ro Gin Ser coding strand 5' GGT AC
CCCGCCGG CAG TCT 3' mutagenic primer 88 3' CCA TGG GGCTCT G
GCGTCAGA 5' mutated co 5' GGT
ACCCCG AGA CCG CAG TCT 3'
- code sequence Gly Thr Pro Ay, P
Mutation of Lys27 to G1n27 in Example 3 and Example 10 using ro Gin Ser mutagenic primers 8A and 8B
．． Perform as described in A.

C: Mutation of Ls47 to Ar47 and Lys47 to Arg47 is performed as described in Example 10.8.

Examples 3 and 4 using mutagen primers 8A, 8B and 9
By repeating the method described in , mutant proteins of interest in which Lys27 is replaced by G1n27, Lys36 is replaced by GIn36, and Lys47 is replaced by Arg47 are obtained and characterized. Transformation plasmid DNA is plN-m
-ompA-2/HIR- 27Q, K360
．． It is called 47R.

The mutant [Gln27, Gin”, ^r g 4?
) - called desulfatohirudin.

B: Mutation of Ls47 to Ar47 and Lys47 to Arg47 is carried out by the method described in Example 10.8.

Repeat the method described in Examples 3 and 4 using mutagen primers 8B and 10 to obtain the mutant protein of interest in which Lys36 has been replaced by Arg36 and Lys47 has been replaced by Arg47, and characterize. Transformation plasmid DNA was transformed into plN-11
[-ompA-2/old R- 36[? , is called K47R. The mutant [Arg'16, Arg4? ) - called desulfatohirudin.

Mutagen ply? -103' CGT CCA CTT TCT T
TG GTCACG 5' odd ILJ, :ko 5' GAC
GGT GAA AGA AACCAG TGC3'-
Doti Asp Gly Glu Illusion IA
sn Gln Cys mutagenic primer 11 3' GTCCCA TTG TCT
ACG TAG GAC5' mutated co5' CAG
GGT AACACCCATCCTG 3'-de chain
Gin Gly Asn Phantom: JI Cys
Ile LeuB: Mutation of Ls47 to Ar47 and Lys47 to rg47 is performed by the method described in Example 10.8.

The method described in Examples 3 and 4 is repeated using mutagenic primers 8B and 11 to obtain and characterize the mutant proteins of interest in which Lys27 is replaced by Arg27 and Lys47 is replaced by Arg47. Transformation plasmid DNA was transformed into plN-III.
-ompA-2/IIIR- is called 27R and K47R. The mutant is called [^rgZ1, Arg4T)-desulfatohirudin.

Long mutagenic primer 12 3' CGCGTCCGG C (through C
AA CA 8 TG TGG CTG A section 5' mutated coding strand 5' GCG CAG GCCGGT G
TT GTT TACACCGACTGC3'Jig Nano'L61JI GJq Val Val Tyr
Thr Asp Cys mutagenic primers 8A, 8B,
Repeating the method described in Examples 3 and 4 using 9 and 12, [Gln''.

Gln”, Arg”)-N- of desulfatohirudin
A mutagen protein of interest with terminal cty extensions is obtained and characterized. This protein is glycyl-[GIn
",G1n3&,Arg")-desulfatohirudin.

Mutagenic primer 13 3' CGCGTCCGG
T^CC88 Hehe A ATG TGG C
TG ACC5' mutated co5' GCG CA
G CGC top”G GTT GTT TACACCGA
CTGC3'-Do1 Sada Jignano L4c
VIJ Met Val Val Tyr Th
r 8sp Cys mutagenic primers 8A, 8B and 1
By repeating the method described in Examples 3 and 4 using [G
A mutagen protein of interest in which the N-terminus of lnt7°Ar,,4'l)-desulfatohirudin is extended by Met is obtained and characterized. This protein is called methionyl-[Gln'', Arg'')-desulfatohirudin.

Punishment, Asn” - Desulfathi (
Asn”)-desulfatohirudin is an amino acid change L
A mutant protein having ys27→^5n27,
This change has been achieved by site-directed mutagenesis (see Example 3). Cloning of the mutated polypeptide coding sequence in the pIN-m-ompA-2 vector is described in Example 3. II. For expression in yeast, the coding sequence with appropriate mutations is inserted into a suitable yeast expression vector equipped with a strong constitutive promoter, a yeast signal sequence, and a yeast transcription terminator to construct a functional expression cassette.

25 rhinoceros plasmid plN-III-ompA-2/
Digest HIR-27N (see Example 3.III) with Xba I and BamHI. 0.3 kb
The Xba I-BamHI fragment is isolated on a preparative 2% agarose gel. The DNA is electroeluted and ethanol precipitated. Xbar rBamHI fragment is 011
11) Comprising an A signal sequence and a mutated hirudin coding sequence. This fragment is further cut with old nfl. Old nfI is located at nucleotide position 22 within the hirudin sequence.
cause it to cleave. 176bp H4nf I-Bam
The HI fragment is isolated as described above.

This DNA sequence encodes (Asn'')-desulfatohirudin.

yeast plasmid pJDB207/GAPFL-HIR
(Figure 2; European patent application Nα225633)
Digest with atI. There are three Bal I sites;
One is in the PH05 signal sequence and two are in the vector.

p13R32 from Ba11 site to Bamf (1 site
2 sequences, Bam to short constitutive GAPFL promoter
1,5 kb B containing the 1l I/Bal I junction and the PH05 signal sequence up to the Ba11 site
Isolate the al I fragment.

The following equations (1) and (2): Ba1l Hinfl(1
) 5' CCAATGCAGTTGTTTACACC
GACTGCACCG 3'(2) 3'
GGTTACGTCAACAAATGTGGCTGAC
Two types of oligonucleotide double-stranded DNA linkers, denoted by GTGGCTTA 5', are constructed; ) provides 22 nucleotides of the hirudin coding sequence. Oligonucleotides (1) and (2) were each dissolved in 1 ottl of 60mM Tris-HCl (pH 7,
5), 10mM MgCj2z, 5mM DTT,
Kinase in 0.5mM ATP and 27U of T4 polynucleotide kinase (Peringer) for 45 minutes at 37°C. Oligonucleotides (1) and (2)
The reaction mixtures are combined, heated at 75°C for 10 minutes, and allowed to cool to room temperature.

Annealed oligonucleotide linker at 20°
Store at C.

Two picomoles of the 1.3 kb Bal I DNA fragment were kinased for 16 h at 15°C and added with 100 volumes of annealed oligonucleotide linkers in 10 m 60 mM Tris-HCl (pH 7,5).
, 10mM MgC1z, 5mM DTT, 3.5
mM ATP and 400 U of T4 DNA ligase (
Biolapse). 1 at 85℃
After inactivating T4 DNA ligase for 0 min, 10 m
M EDTA, 300mM sodium acetate (pH 6,0
) and DN in the presence of 0.54 volumes of isopropanol
Excess linker is removed by precipitation of A. The DNA is digested with 5ail. TB the resulting fragments
Separate on a 1% preparative agarose gel in EW street solution. 5
The 64 bp fragment is recovered from the gel by electroelution and ethanol precipitation. This DNA is resuspended at a concentration of 0.1 psol/pi. This 654bp 5a1 first Hlnf
I fragment is 276 bp Sal I-BamHI p
BR322ON^ fragment, GAPFL prokeyter, PI
+05 signal sequence and nucleotide position 22 (Il
inf 1 site).

Plasmid pJDB207/GAPFL-1(IR(
(see above) is digested with Sal I and BamHI and the 6.7 kb Sal I-BamHI vector fragment is isolated. The vector fragment also contains a hawk transcription terminator.

The three DNA fragments isolated as described above are ligated by the following reaction. i.e. 0.2 pmol of 56
4bp Sal I-old NFL fragment, Q, 2pmol
176 bp Hinf I BamHI fragment of 0.
1 pn+ol 6.7 kb Sal I-BamH
I vector fragment was added to 10J11 of 60mM Tris-H.
Cj! (pH 7,5), 10+aM MgCl
z, ligated for 6 hours at 15°C in 5mM RoTT, ldATP and 200U of T4 DNA ligase. 100 aliquots of II of each ligation mixture
4 into calcium-treated, transformation-competent E. coli HBIOI cells.

Twelve transformed ampicillin-resistant colonies were
Grow in LB medium containing 100 μ/2 ampicillin. Holmes to prepare plasmid DNA
etc., 8 na1. Biochem, 114 (1981
), 193) and analyzed by double digestion with BamHI and 5alI. The in-frame ligation of the linker to the signal sequence and hirudin coding sequence was performed by DNA sequencing (Sanger et al., Proc, Natl, Acad).
, Sci, USA, 74 (1977) 5463). One clone with the correct sequence was p
JDB20? /GAPPL-HIR- is called 27N.

Similarly, the following plasmid: plN-Ill-on+pA-2/HIR-
(Example 4), pTN-11 first ompA-2/)IIR-
36V (Example 5), plN-II[-ompA-2/
HIR-P48G (Example 6), plN-III-o+5
pA-2/HIR-049M (Example 7), plN-Il
l-ompA-2/HIR-N52M (Example 8), pl
N-Ill-o+wpA-2/HIR-H51N (Example 9), plN-m-ompA-2/HIR-27
Q, K47R (Example 10), plN-m-orap
270 for ^-2/HTR-. K36(1, K47R(
Example 11), 36R to plN-m-omp^-2/old R-
, K47R (Example 12) and pIN-1[-omp^-2
A yeast expression plasmid is obtained starting from /HIR-27R, K47R (Example 13). The resulting yeast expression plasmid was transformed into pJDB207/GAPFL-HIR-36N.

pJDB20? 36V to /GAPFL-1+1R-.

pJDB20? /GAPFL-HIR-P48G.

pJDB20? /GAPFL-old R-049M, p
J port 8207 /GAPFL-HIR-N52M, p
JDB20? /GAPFL-HIR-1151N.

pJDB207 9JDB207 pJDB20? pJDB207 It is called.

/GAPFL-HIR-27 (1, K47R.

/GAPFL-HIR- 27Q, 360, 47R.

/GAPFL-old R-, 36R, K47R and /GAP
FL-old R-, 27R, K47R Saccharomyces cerevis
iae) GFR18 strain (DSM 3665; a,
his 3-11°his 3-15.1eu2-3.
leu 2-112. can”), and HT24
6 strains (mouth SM 4084; a, leu 2
-3. Ieu 2-112. prb), 11
innen etc. (Proc, Natl, Acad, Sci
Example 16. Transform with the mother expression plasmid listed in B. Transformed yeast cells are selected on yeast minimal medium plates lacking leucine. A single transformed yeast colony is isolated and named as follows.

Satucharomyces cerevisiae GRP18/pJDB207 /GAPFL-HIR-
The cells were grown to a density of 27N, 3 x 10' cells/i.

For constitutive expression and secretion of the mutated desulfatohirudin species, cells were treated with peptone (5 g,
0g/j2, glucose (20g/j2), sucrose (40g/j2), ammonium sulfate (3g/f)
, KHzPO4 (2g/f), Mg5Oi (0.5g
/l), NaCf (0,1g/l), Ca(, ex
(0.1 g/l) and biotin (10x/I!) in a complex medium containing agar. After 48 hours of ink evacuation at 30'C 1200 times/min, approximately I
'Cells/d are obtained.

Cells of S. cerevisiae GRF18 and HT246 transformants were cultured in 10 d of yeast minimal medium (Difco Yeast Nitrogen Base containing no amino acids supplemented with 2% glucose and 20 μ/ff1 L-histidine). The culture was mixed with Amberlite χAD-7 for 24 h at 30 °C with shaking in a 50 d Erlenmeyer flask and incubated at 25 °C for ca.
Time adsorption. Separate the cells from the resin in a column. I M NaCj! After washing with Tris$
Elute the resin with 3[1 buffer (50 mM, pH 7.0-8.5). Main fraction (30f> pH2,
Prepared at 9 and then 2! S- with a bed volume of
Apply to a Sepharose column (Amicon PA equilibrated with 25% ammonium formate buffer (pH 2,9)). 40mM ammonium formate buffer (pH 3,6
) and then washed with 50mM ammonium formate (pH
Perform elution according to steps 3 and 8). The main elution fraction (101) is Ω
Filtron MiniseLle with membrane attached to 3
Concentrate using an ultrafiltration system. A 0.51 aliquot of the resulting clear protein solution was transferred to a Blo-Ge1 P-6 fine column (0,
Amicon GF) equilibrated with 5% acetic acid. Elution is carried out with 0.5% acetic acid. The main eluted fraction (1) was concentrated by ultrafiltration and then a Q-Sepharose Fast Flow column with a volume of 22 [Amicon PA equilibrated with 25 mM ammonium formate buffer (pH 2,9)] Elution is carried out with 50 mM ammonium formate buffer (pH 4,2). The main eluted fraction is concentrated by ultrafiltration and then diafiltered against water. The resulting clear aqueous solution This solid consists of pure desulfatohirudin mutant.

■ Hungry, Doukou 1JII Sodotsuji S, R, 5tone and J, Hofstenge (
Biochemistry Department, 4622-4628
Thrombin was purified and characterized as described by (1986) ). The concentration of active thrombin is determined by titration of the active site with 4-methylumbelliferyl p-guanidinobenzoate (Jameson, G.).

W', + Roberts, D, V,','Ad
ams, R, W, , yle, W, S, 8, and E
1more+D, T, +Biochem, J, +13
1 +10 117 (1973)).

Release of p-nitroaniline resulting from hydrolysis of the peptidyl p-nitroanilide substrate is followed by the increase in absorbance at 405 nm using a UV 240 spectrophotometer. 011% polyethylene glycol 6000, O,
0,05M Tris-HCA' buffer (pH 7,8) containing lM NaC4 and p-nitroanilide substrate.
) Measurements are carried out in polyethylene cuvettes at 37°C. The substrate D-Vat-Leu-Arg-p-di)roanilide (S-2266; Kabi Vitrum) was
At the concentration of group 0, the tight binding tight region (
(tight-binding titration) experiments. For each assay 1. A thrombin concentration of OnM is used. Substrate rho Ph at a concentration of 100 shores
e-pipecolyl Arg-p-nitroanilide (S-2
238; to abi Vitrum) and 20 to 50p?
A thrombin concentration of 1 is used in slowing-binding inhibition experiments to determine the kinetic properties of hirudin mutants (see below). Begin the assay by adding thrombin. The amount of product was calculated using the extinction coefficient of 9 + 920 M-'cm-' for p-nitroaniline at 405 nm, and the concentration of substrate was 8.270 M-'cm-'.
Determined spectrophotometrically at 342 nm using an extinction coefficient of 'cm-' (Lottenberg, R, &
Jackson c, M, IBtochem, Bio
phys, Acta 742.558-564 (19
83)).

Inhibition of the enzyme in the presence of a substrate can be achieved using the following configuration (Scheme 1
): I! ■ It can be expressed as. For the dissociation of inhibitors, Hani2/
Equal to kI. If the binding of inhibitor to the enzyme results in significant depletion of the concentration of free inhibitor, the total inhibitor concentration (
The change in steady-state velocity (V, ) with IL) will be described by the following equation (1):

In this formula, vo is the rate observed in the absence of inhibitor, E is the total enzyme concentration, and Kl' is the apparent inhibition constant. When an inhibitor and a substrate compete for the active site, Kl' is related to the inhibitor's dissociation constant (Kl ) by the following equation (2):

In this equation, S is the substrate concentration and 1 is the Michaelis constant. If the concentration of enzyme or inhibitor is not precisely known, additional factors can be introduced to accommodate this fact [William IIIs, J.
, W., & Morrison, J.F., , Method
sEnzymol, 63, 437-467 (1979)
), for the inhibition of thrombin by hirudin, the concentration of thrombin is known from the active site tight region, but the concentration of hirudin is known only by weight, and the data is expressed by the following equation (3): % formula % (3 ) can be analyzed by In this equation, ■
8 is the concentration of the inhibitor expressed in weight per volume, and is a constant that when multiplied by 8 yields the molar concentration of the inhibitor.

In a tight-binding titration experiment, the dissociation constant for hirudin and its concentration is such that the concentration of thrombin is kept constant and the concentration of hirudin is varied at several concentrations lower than that of thrombin and the concentration of thrombin. determined by varying the concentration of hirudin over a range, including several higher concentrations.

The total number of measurement points is usually 7-10. The steady state velocity obtained at each concentration is then fitted to equation (3) by weighted nonlinear regression. Because of regression,
Weight the observed values for steady state velocity according to the inverse of those values. It has been empirically found that this type of weighting gives the best results (
Stone, S., Ro., & Hofstenge, J.
, Iliochemistry 25.4622-46
28 (1986)).

Scheme (
The progress curve of product formation for 1) is expressed by the following equation (4
): may be described by the formula % (1979) ). In this equation, P is the amount of product produced at time t;
d is a function of E=, It and , and ′ is the observed quadratic association rate constant (k+′) for these parameters and the interaction between inhibitor and enzyme.
(Cha et al., supra). To obtain kinetic parameters for mutant hirudin, at least 6
Progress curve data obtained at different hirudin concentrations are fitted to equation (4) by non-linear regression. This analysis is K.

kl' and the observed dissociation rate constant (kZ'). The values of k,l are independent of the binding of substrate in the active site; however, in order to obtain a true value of 2 and +, the observed values of 2' and Kl' must be (1+
It has already been shown that (S)/to be divided by ) (S, R, 5tone and J, IlofsL
eenge, Biochemistry 25+462
2-4628 (1986); 5tone, S, R,
+ Br5un, P, J, and llofateen
ge.

The already obtained value for anilide is 3.6
- (Hof's Lenge+ J, ,
Tagucht, 11. , and 5tone, S,
R., Biochel, J., 243-251.
(1986) ).

Using these kinetic methods, the following values for K1 and , are obtained.

n, d, = undetermined, -゛Sulfatohirudin A solution containing the desulfatohirudin variant according to any of the previous examples is dialyzed against a 0.9% NaCl solution. Next, the concentration of the solution was adjusted to 0.2 /
Adjust by diluting to ml or 2 mg/d.

These solutions are sterilized by ultrafiltration (using a membrane with 0.22 I!m pores).

This sterilized solution can be used directly, for example for intravenous administration.

Microorganisms Jυγ
von Mikroorganismen;DSM),
Mascheroder Weg lb, D-3300
Braunschweig (West Germany).

Saccharomyces cerevisiae
e) GRF18 Deposit date: March 4, 1986 Deposit number: DSM 3665 Saccharomyces cerevisiae
e) HT246 Deposit date: April 15, 1987 Deposit number: DSM 4084

[Brief explanation of the drawing]

FIG. 1 schematically shows the production process of plasmid pML350. Figure 2 shows plasmid pJDB207/GAPFI;-
A plasmid map of HIR is schematically shown.

Claims (1)

[Claims] 1. The following amino acid sequence (I): [There is a gene sequence. ] (I) (In the sequence, Z_0 is Val or dipeptide residue Gly-
Val or Met-Val, and Z_1 is Lys
, Gln, Asn, Leu, Arg or Val,
Z_2 is Lys, Arg, Asn, Val, Leu or Gln; Z_3 is Lys, Arg, Asn, Va
Z_4 is Pro or Gly, Z_5 and Z_7 are mutually independently Gln, Asn or Met, and Z_6 is His, Gln or As
n; however, Z_0 is Val and Z_1 is Lys
or Gln, Z_2 is Lys or Gln,
Z_3 is Lys, Z_4 is Pro, Z_5
is Gln, Z_6 is Gln or His, and Z_7 is Asn), and a salt thereof. 2, Z_0 is Val or dipeptide residue Gly-Val
Or Het-Val, where Z_1 is Lys, Gl
n, Asn or Arg, and Z_2 is Lys, Arg
, Asn, Val or Gln, Z_3 is Lys or Arg, Z_4 is Pro or Gly, Z
_5 is Gln or Met, Z_6 is His or A
sn, and Z_7 is Asn or Met;
However, Z_0 is Val and Z_1 is Lys or Gln
, Z_2 is Lys or Gln, and Z_3 is L
ys, Z_4 is Pro, Z_5 is Gln, Z_6 is His and Z_7 is Asn, and the desulfatohirudin variant of formula (I) according to claim 1, That salt. 3. [Asn^2^7]-desulfatohirudin according to claim 1. 4. [Asn^3^6]-desulfatohirudin according to claim 1. 5. [Val^3^6]-desulfatohirudin according to claim 1. 6. [Gly^4^8]-desulfatohirudin according to claim 1. 7. [Met^4^9]-desulfatohirudin according to claim 1. 8. [Met^5^2]-desulfatohirudin according to claim 1. 9. [Asn^5^1]-desulfatohirudin according to claim 1. 10. [Gln^2^7, Arg^4 according to claim 1
＾7〕-Desulfatohirudin. 11. [Gln^2^7, Gln^3^6, Arg^4^7 according to claim 1]
] - Desulfatohirudin. 12. [Arg^3^6, Arg^4 according to claim 1]
＾7〕-Desulfatohirudin. 13. [Arg^2^7, Arg^4^7]-desulfatohirudin according to claim 1. 14, the glycyl-[Gln
^2^7, Gln^3^6, Arg^4^7] - Desulfatohirudin. 15, methionyl-[Gln^2^7 according to claim 1
, Arg^4^7]-desulfatohirudin. 16. A pharmaceutical composition comprising the desulfatohirudin variant according to claim 1. 17. A method for producing the desulfatohirudin mutant according to claim 1, comprising: a promoter, a first DNA sequence encoding a signal peptide (the promoter is
a second DNA sequence encoding a desulfatohirudin variant (the first D
a microbial host strain that has been transformed with a hybrid vector comprising an expression cassette consisting of a DNA sequence (NA sequence and said second DNA sequence linked in appropriate reading frame) and a DNA sequence containing a transcription termination signal. culturing, isolating the desulfatohirudin variant, and optionally converting the resulting polypeptide with free carboxy and/or amino groups into a salt, or the resulting salt into a free compound. A method comprising: 18, a promoter, a first DNA sequence encoding a signal peptide (the promoter is operably linked to the first DNA sequence), a second DNA encoding the desulfatohirudin variant according to claim 1; a hybrid vector comprising an expression cassette consisting of a DNA sequence containing a DNA sequence (the first DNA sequence and the second DNA sequence are linked in proper reading frame) and a transcription termination signal. 19. A method for producing a hybrid vector according to claim 18, comprising: a promoter, a first DNA sequence encoding a signal peptide (the promoter is operably linked to the first DNA sequence), a desulfate an expression cassette consisting of a second DNA sequence encoding a hirudin variant (the first and second DNA sequences being linked in appropriate reading frame) and a DNA sequence containing a transcription stop signal; or said components of said hybrid vector to a DNA fragment containing a selectable genetic marker and an origin of replication for a selected microbial host in a predetermined order. 20, a promoter, a first DNA sequence encoding a signal peptide (the promoter is operably linked to the first DNA sequence), a second DNA encoding the desulfatohirudin variant according to claim 1; (the first DNA sequence and the second DNA sequence being linked in proper reading frame) and an expression cassette comprising a DNA sequence containing a transcription termination signal. microbial host strain. 21. Claim 2 comprising transforming a microbial host strain with the hybrid vector of claim 18.
A method for producing the transformed microbial host according to 0.