JP7075694B1 - Irisin's physiological effect enhancer - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an excellent physiological action enhancer of irisine capable of further enhancing the health maintenance action of irisine. SOLUTION: Mango ginger has an excellent effect of enhancing the physiological action of irisine and an effect of promoting the production of irisine, and thus can be used as a food, a quasi-drug, or a pharmaceutical product having the action. Furthermore, since the combination of mango ginger and acerola shows an extremely excellent physiological action enhancing effect of irisine and an irisine production promoting effect, it can be used as a food product, a quasi drug, or a pharmaceutical product having the effect. [Selection diagram] None

Description

The present invention relates to a physiological action enhancer of irisine, which is characterized by containing mango ginger. More specifically, the present invention relates to an irisine physiological action enhancer capable of further enhancing the health maintenance action of irisine by enhancing the physiological action of irisine and promoting the production of irisine.

Exercise reduces fat by increasing energy expenditure and is effective in improving symptoms caused by excessive fat accumulation such as obesity. In addition, large-scale epidemiological studies have shown that exercise has a variety of systemic health effects, and today exercise contributes to the prevention of not only obesity but also various metabolic and cardiovascular diseases. It is well known (Non-Patent Document 1).

Although the mechanism by which various health effects of exercise are brought about is still unclear, it has been suggested that skeletal muscle, which plays a central role in exercise, is deeply involved in health effects. In recent years, the existence of myokine, which is a physiologically active protein secreted from skeletal muscle, has been attracting attention as a mechanism for changes in physiological functions due to exercise and for promoting the health of exercise. A plurality of myokines have been reported so far, and one of them, irisine, has attracted particular attention as a myokine explaining the improvement of systemic metabolism by exercise (Non-Patent Documents 2 and 3). Ilycin is a peptide released into the blood by cleavage of Fibronectin Type III Domain Contining 5 (FNDC5), which is a membrane protein mainly produced in skeletal muscle, from the cell membrane of muscle cells, and is a peptide released into the blood by blood circulation. Will be transported to. Research on the physiological effects of irisine is being vigorously pursued at various research institutes, and as shown below, various usefulness in maintaining health has been found.

Adipose tissue is roughly classified into white adipose tissue and brown adipose tissue. White adipose tissue is composed of white adipocytes with a single large lipid droplet (triglyceride) inside the cell, and stores excess energy in the form of triglyceride. On the other hand, brown adipose tissue is composed of brown adipose cells having a large number of relatively small lipid droplets and a large number of mitochondria, and consumes fat as heat by the action of uncoupling protein-1 (UCP1) present in the inner mitochondrial membrane. Ilycin is known to promote energy metabolism in white adipocytes by acting on white adipocytes to increase UCP1 expression and promote fat browning. Due to this property, irisine is expected to be an option for prevention and treatment of obesity and diabetes (Non-Patent Document 3).

Irisin is a protein mainly secreted from skeletal muscle, but it not only acts on tissues around skeletal muscle such as white adipose tissue, but also acts on the muscle cells of skeletal muscle themselves in an autoclinic manner. So far, the expression of insulin-like growth factor-1 (IGF1), which is a muscle-building factor, has been increased, the expression of mitochondrial, which is a factor required for the differentiation of myoblasts, has been increased, and the muscle atrophy factors, myostatin, atrogin1, and Murf1. It has been reported that the expression of insulin is decreased and the expression of NF-E2-related factor 1 (Nrf1), which is a mitochondrial biosynthesis factor, is increased, and it is known that irisine contributes to the promotion of energy metabolism in muscle cells (non-). Patent Documents 4 and 5). Promotion of energy metabolism of muscle cells is effective in preventing locomotive syndrome and flail in the elderly.

Bone is constantly replaced by bone formation by osteoblasts and bone resorption by osteoblasts, and is maintained constant by maintaining a balance between bone formation and bone resorption. It is known that when this balance is lost and bone resorption becomes dominant, it causes a decrease in bone mass, and the increase in osteoporosis in postmenopausal women is due to a rapid decrease in female hormones required for bone formation. It is believed that. Conversely, exercise habits are thought to be a stimulus that promotes bone formation. Irisin secreted by exercise has a cell proliferation promoting action on osteoblasts, and this action is considered to be one of the mechanisms for promoting bone formation (Non-Patent Document 6). Since promotion of bone formation leads to an increase in bone mass, it is considered to contribute to the prevention of osteoporosis and the reduction of bedridden elderly people.

In addition to the above, irisine has been reported to have neurogenesis action in the brain, immune cell activation action, antioxidant action, apoptosis-inducing action on cancer cells, etc., and is involved in health maintenance such as brain function and immune function. It plays an important role in various functions (Non-Patent Documents 3 and 7). In other words, enhancing the physiological action of airisin and promoting the production of airisin lead to further enhancing the wide range of efficacy exerted by airisin, and are considered to be extremely beneficial in maintaining health.

Ilycin is a proteinaceous bioactive substance that exerts various physiological functions via receptors on the cell surface. The receptor for irisine was long unknown, but was identified in 2018 and found to be a dimer of integrin αV and integrin β5. From this finding, it was clarified that irisine acts on adipose tissue, bone tissue and the like via the irisine receptor (Non-Patent Document 8). In other words, it is considered that increasing the expression of the irisine receptor enhances the physiological action of irisine and effectively brings out the health-maintaining action of irisine.

In view of this situation, an effective physiological action enhancer for airisin is strongly desired, but a food-derived physiological action enhancer that is highly safe and can be continuously ingested has not been known until now. .. Therefore, as a result of screening tests using various foods, the present inventors have found that mango ginger of the family Zingiberaceae has an excellent effect of enhancing the physiological action of irisine and an effect of promoting the production of irisine. Furthermore, it was found that when mango ginger and acerola, a plant of the family Malpighiaceae, are combined, an extremely excellent physiological action enhancing effect of irisine and an irisine production promoting effect are exhibited.

The mango ginger used in the present invention is a spicy vegetable of the family Zingiberaceae, whose scientific name is Curcuma amada ROXB., And is an annual herb that is distributed or cultivated in the wild in India. The rhizome is thick and cylindrical, and its name is derived from its raw mango-like aroma and ginger flavor. The rhizome of mango ginger is known to have anti-inflammatory action, antipyretic action, stomachic action and the like, and has been used for traditional therapy for a long time. Prior patents include a collagen synthesis promoter containing an extract of mango-ginger (Patent Document 1), a tyrosine kinase with Ig and EGF homology domine-2 (Tie2) activator (Patent Document 2), and an antiplasmin agent (Patent Document 2). Document 3) and the like are disclosed.

The acerola used in the present invention is an evergreen shrub belonging to the family Malpighiaceae, and its scientific name is Malpighia emarginata DC. That is. Acerola, also known as barbados cherry, is thought to originate from the West Indies and is cultivated mainly in tropical climate areas such as Brazil and the Caribbean Sea. As prior patents, a blood glucose level increase inhibitor (Patent Document 4), a lipid absorption inhibitor (Patent Document 5), a collagenase activity inhibitor (Patent Document 6) and the like containing an extract of acerola are disclosed.

As mentioned above, mango ginger and acerola have been reported to have various effects on maintaining health. However, a physiological action enhancer of irisine characterized by containing mango ginger, mango ginger and acerola, more specifically, a physiological action enhancer of irisine capable of further enhancing the health maintenance action of irisine, and No known irisine production promoters or food compositions containing them are known.

Japanese Patent No. 40842726 Japanese Unexamined Patent Publication No. 2012-236795 Japanese Unexamined Patent Publication No. 2021-80173 Japanese Patent No. 4451627 Japanese Unexamined Patent Publication No. 2007-55980 Japanese Patent No. 4701211

Physical Fitness Science, Vol. 62,263-271 (2013) YAKUGAKU ZASSHI, Vol. 138, 1285-1290 (2018) Medicine, Vol. 55 485 (2019) Pflugers Archiv-Eur J Physiol, Vol. 472, 495-502 (2020) Vitamins, Vol. 93, 444-447 (2019) Scientific Reports, Jan 7, 18732 (2016) Int J Endocrinol, Oct 9, 7816806 (2018) Cell, Vol. 175, 1756-1768 (2018)

In view of the above-mentioned circumstances, the present invention is a highly safe and continuously ingestible physiological action enhancer of irisine, more specifically, enhancing the physiological action of irisine and promoting the production of irisine. By doing so, it is an object of the present invention to provide an agent for enhancing the physiological action of irisine, which can further enhance the health-maintaining action of irisine.

As a result of diligent research to solve the above problems, the present inventors have found an excellent effect of enhancing the physiological action of airisin and an effect of promoting the production of airisin in a mango ginger of the family Zingiberaceae. Furthermore, they have found that the combination of mango ginger and acerola of the family Malpighiaceae exhibits an extremely excellent physiological action enhancing effect of irisine and an irisine production promoting effect, and have completed the present invention.

As the mango ginger used in the present invention, a mango ginger of the family Zingiberaceae (Curcuma amada ROXB.) Can be used. The site of the mango ginger used in the present invention is not particularly limited, but rhizomes, whole plants, leaves, stems, flowers, seeds and the like can be mentioned, and it is particularly preferable to use the rhizome portion.

As the acerola used in the present invention, an acerola of the family Malpighiaceae (scientific name: Malpighia emarginata DC.) Can be used. The site of acerola used in the present invention is not particularly limited, but may include fruits, leaves, seeds, bark, etc., and it is particularly preferable to use fruits.

The mango ginger and acerola used in the present invention can be used as they are, and if necessary, those that have been subjected to treatments such as juice squeezing, drying, crushing, and shredding can also be used. Further, an extract obtained by extracting mango ginger or acerola as it is or by performing the above treatment can also be used. Examples of the solvent to be extracted include water, lower alcohols (ethanol, methanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene, etc.). Glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), ethers (ethyl ether, tetrahydrofuran, propyl, etc.) Ether, etc.). These solvents may be used alone or in admixture of two or more. In the mango ginger of the present invention, the extraction solvent is preferably a polar solvent such as water or a lower alcohol, particularly hydrous ethanol. Further, as the acerola of the present invention, it is preferable to use fruit juice obtained by squeezing the fruit.

Mango ginger and acerola may be used as they are after the above treatment or extraction, or may be used after being concentrated, diluted, filtered, decolorized with activated carbon, deodorized, ethanol precipitation or the like, if necessary. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying and freeze-drying, and used as a dried product.

The intake amount of mango ginger and acerola used in the present invention can be appropriately adjusted depending on the administration form, purpose of use, age, body weight and the like. The daily intake of mango ginger for adults is 0.05 to 500 mg, preferably 0.5 to 150 mg as an extract of the rhizome of mango ginger, which can be orally ingested once to several times a day. The daily intake of acerola for adults is 0.05 to 1000 mg, preferably 1 to 300 mg, which can be orally ingested once to several times a day as acerola fruit juice powder or acerola fruit extract. .. In some cases, a smaller amount than the above intake range may be sufficient, and in other cases, it may be necessary to take more than the above range. Further, the method of adding the medicinal ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

The physiological action enhancer of irisine of the present invention can be used as a food, a quasi-drug, or a pharmaceutical product. As food, it can be used as tablets, soft capsules, hard capsules, granules, tablets, gummies, beverages, jellies and the like. For quasi-drugs and pharmaceuticals, oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids, emulsions, and other parenteral injections and suppositories. , Can be used as a skin external preparation. In order to achieve the object of the present invention, ingestion by oral administration is preferable.

The irisine physiological action enhancer of the present invention is an excipient, stabilizer, preservative, preservative, as needed, which is used for ordinary foods, non-pharmaceutical products or pharmaceuticals, as long as the effect is not impaired. It can also contain components such as binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH regulators, preservatives and fragrances. Further, it can contain components such as plant materials, polyphenols, vitamins, sugars, proteins and fats and oils.

The agent for enhancing the physiological action of irisine, which is characterized by containing the mango ginger of the present invention, has an excellent effect of enhancing the physiological action of irisine and an effect of promoting the production of irisine. Further, the physiological action enhancing agent of irisine, which is characterized by containing mango ginger and acerola, has an extremely excellent physiological action enhancing effect of irisine and an irisine production promoting effect.

The following examples are provided for illustration purposes only, and the scope of claims of the present invention is not limited to these examples. The% of the content shown in the examples indicates the weight%.

Production Example 1 Mango Ginger 50% Ethanol Extract 1 L of purified water and 1 L of ethanol are added to 100 g of the rhizome of a mango ginger, extracted at room temperature for 5 days, filtered, and the filtrate is concentrated to dryness to make the mango ginger 50. 7.6 g of% ethanol extract was obtained.

Production Example 2 Mango Ginger Hot Water Extract Add 2 L of purified water to 100 g of the rhizome of mango ginger, extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, freeze-dry, and heat the mango ginger. 14.5 g of water extract was obtained.

Production Example 3 Mango Ginger Ethanol Extract 2 L of ethanol is added to 100 g of the rhizome of mango ginger, extracted at room temperature for 5 days, filtered, and the filtrate is concentrated to dryness to obtain 4.3 g of mango ginger ethanol extract. Obtained.

Production Example 4 Acerola fruit juice powder 1 kg of acerola fruit was squeezed to obtain 700 mL of fruit juice. The juice was filtered, the filtrate was concentrated, and lyophilized to obtain 10 g of acerola juice powder.

Production Example 5 Acerola Fruit Hot Water Extract Add 2 L of purified water to 100 g of acerola fruit, extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, freeze-dry, and acerola fruit hot water extract. 4.6 g was obtained.

Production Example 6 Acerola fruit 50% ethanol extract Add 1 L of purified water and 1 L of ethanol to 100 g of acerola fruit, extract at room temperature for 5 days, filter, concentrate and dry the filtrate, and extract 50% ethanol of acerola fruit. A product of 2.1 g was obtained.

Next, a prescription example using the mango ginger, mango ginger and acerola of the present invention will be given, but the present invention is not limited thereto.

Prescription example 1 Tablet <Prescription>
Ingredient content (%)
1. 1. Mango ginger 50% ethanol extract (Production Example 1) 1.0
2. 2. Add so that the total amount of maltitol is 100. Cellulose 5.0
4. Sucrose fatty acid ester 3.0
<Manufacturing method>
Ingredients 1 to 3 are mixed and 10% water is added as a binder to granulate the fluidized bed. Ingredient 4 was added to the molded granules, mixed, and tableted to obtain a tablet of 300 mg per tablet.
<Usage>
Take 3 tablets daily.

Prescription example 2 Tablets <Prescription>
Ingredient content (%)
1. 1. Mango ginger 50% ethanol extract (Production Example 1) 1.0
2. 2. Acerola juice powder (Production Example 4) 1.0
3. 3. Add so that the total amount of maltitol is 100. Cellulose 5.0
5. Sucrose fatty acid ester 3.0
<Manufacturing method>
Ingredients 1 to 4 are mixed and 10% water is added as a binder to granulate the fluidized bed. Ingredient 5 was added to the molded granules, mixed, and tableted to obtain a tablet of 300 mg per tablet.
<Usage>
Take 3 tablets daily.

Prescription example 3 Hard capsule <Prescription>
Ingredient content (%)
1. 1. Mango ginger 50% ethanol extract (Production Example 1) 8.5
2. 2. Acerola fruit hot water extract (Production Example 5) 8.5
3. 3. Add so that the total amount of cornstarch is 100. Sucrose fatty acid ester 3.0
<Manufacturing method>
Ingredients 1 to 4 were mixed and 250 mg was filled in No. 2 hard capsule to obtain a hard capsule.
<Usage>
Take 2 tablets per day.

Prescription example 4 Soft capsule <Prescription>
Ingredient content (%)
1. 1. Mango ginger ethanol extract (Production Example 3) 0.2
2. 2. Acerola fruit 50% ethanol extract (Production Example 6) 0.2
3. 3. Add so that the total amount of medium-chain fatty acid oil is 100. Beeswax 5.0
5. Glycerin fatty acid ester 5.0
6. Vitamin E 3.0
<Manufacturing method>
Ingredients 1 to 6 were mixed, and a film composed of starch, carrageenan, reduced starch syrup, and glycerin was filled with 250 mg, and dried to obtain a soft capsule.
<Usage>
Take 3 tablets per day.

Prescription example 5 Beverage <Prescription>
Ingredient content (%)
1. 1. Mango Ginger Hot Water Extract (Production Example 2) 0.25
2. 2. Acerola juice powder (Production Example 4) 0.25
3. 3. Citric acid 6.0
4. Sucrose 10.0
5. Fragrance 1.0
6. Water 82.5
<Manufacturing method>
Ingredients 1 to 5 are stirred and dissolved in a part of water of ingredient 6. Next, the remaining water of component 6 is added and mixed, and the sterilized product is used as a beverage.
<Usage>
Ingest 50 mL per day.

Test Example 1 Promotion of expression of irisine receptor Mouse adipose progenitor cells were cultured in DMEM containing 10% fetal bovine serum. Then, the cells were cultured in DMEM containing 10% fetal bovine serum, 1 μM dexamethasone, 0.5 mM isobutylmethylxanthine, and 10 μg / mL insulin, and differentiated into white adipocytes. After differentiation, the medium was switched to DMEM containing 10% fetal bovine serum and cultured for 3 days, and the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production Example 4) produced in Example 1 was used. The mixture was added so that the final concentration was 500 μg / mL, and the cells were cultured for 3 days. In addition, mango ginger extract (Production Examples 1 to 3) and acerola juice powder (Production Example 4) were added in combination so that the final concentration of each was 500 μg / mL, and the cells were cultured for 3 days. After culturing, cells were collected and the gene expression of integrin αV and integrin β5, which are irisine receptors, was evaluated by a real-time PCR method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard. The gene expression ratio was calculated by setting the gene expression level to which no sample was added to 1.

Primer set for integrin αV TGGTTGTGGATCGAGCTGTCTT (SEQ ID NO: 1)
CACTTCAAGGCCAGCATTACA (SEQ ID NO: 2)
Primer set for integrin β5 CGAATGCTTGCTACTTCACC (SEQ ID NO: 3)
CACTTCCACATTCTGGCTCC (SEQ ID NO: 4)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

The results of Test Example 1 are shown in Table 1. Both the gene expression of integrin αV and integrin β5, which are important for enhancing the physiological action of irisine, were effectively promoted by the addition of mango ginger extract (Production Examples 1 to 3). Although the acerola juice powder (Production Example 4) alone had almost no effect on the gene expression of the irisine receptor, the combination of the mango ginger extract and the acerola fruit juice powder markedly promoted the gene expression of the irisine receptor. did.

Test Example 2 UCP1 production promoting action on white adipocytes Mouse adipose progenitor cells were differentiated into white adipocytes by the same method as in Test Example 1. After differentiation, the medium was switched to DMEM containing 10% fetal bovine serum and cultured for 3 days, and in the presence of 5nM irisine, the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production) produced in Example 1 was produced. Example 4) was added so that the final concentration was 500 μg / mL, and the cells were cultured for 3 days. Further, in the presence of 5 nM irisine, mango ginger extract (Production Examples 1 to 3) and acerola fruit juice powder (Production Example 4) were added in combination so that the final concentration of each was 500 μg / mL, and cultured for 3 days. did. After culturing, cells were collected and the gene expression of UCP1 was evaluated by a real-time PCR method as an index of energy metabolism in white adipocytes. GAPDH was used as the internal standard. The gene expression ratio was calculated with the gene expression level of no sample added in the absence of irisin as 1.

Primer set for UCP1 CAGCCTACAGAGGTCGTGAA (SEQ ID NO: 7)
GGGTTTGATCCCATGCAGAT (array 8)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

The results of Test Example 2 are shown in Table 2. UCP1 gene expression in white adipocytes was promoted by irisin, but the addition of mango ginger extract (Production Examples 1 to 3) further promoted UCP1 gene expression, and the effect of enhancing the physiological action of irisin was observed. Although the acerola fruit juice powder (Production Example 4) alone did not show the effect of enhancing the physiological action of irisine, the combination of the mango ginger extract and the acerola fruit juice powder markedly promoted the gene expression of UCP1 by irisine and was excellent. The effect of enhancing the physiological action of airicin was observed.

Test Example 3 IGF1 production promoting action in muscle cells Mouse myoblasts were cultured in DMEM containing 10% fetal bovine serum. Then, the cells were cultured in DMEM containing 2% horse serum and differentiated into myotube cells. After differentiation, the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production Example 4) produced in Example 1 was added in the presence of 5 nM irisine so that the final concentration was 100 μg / mL. It was cultured for 1 day. Further, in the presence of 5 nM irisine, mango ginger extract (Production Examples 1 to 3) and acerola fruit juice powder (Production Example 4) were added in combination so that the final concentration of each was 100 μg / mL, and cultured for 1 day. did. After culturing, cells were collected and IGF1 gene expression was evaluated by real-time PCR as an index of energy metabolism in muscle cells. GAPDH was used as the internal standard. The gene expression ratio was calculated with the gene expression level of no sample added in the absence of irisin as 1.

Primer set for IGF1 GTTGCTTCCGGACGTGTGAT (SEQ ID NO: 9)
GATAGAGCGGGCTGCTTTTG (array 10)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

The results of Test Example 3 are shown in Table 3. Although ilysin promoted IGF1 gene expression in muscle cells, the addition of mango ginger extract (Production Examples 1 to 3) further promoted IGF1 gene expression, and the effect of enhancing the physiological action of ilycin was observed. Although the acerola fruit juice powder (Production Example 4) alone did not show the physiological action enhancing effect of irisine, the combination of the mango ginger extract and the acerola fruit juice powder markedly promoted the gene expression of IGF1 by irisine and was excellent. The effect of enhancing the physiological action of airicin was observed.

Test Example 4 Cell proliferation promoting action in osteoblasts Mouse osteoblasts were cultured in αMEM containing 10% fetal bovine serum to give 50% confluence. Next, in the presence of 5 nM irisine, the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production Example 4) produced in Example 1 was added so as to have a final concentration of 100 μg / mL. Cultured for days. Further, in the presence of 5 nM irisine, mango ginger extract (Production Examples 1 to 3) and acerola fruit juice powder (Production Example 4) were added in combination so that the final concentration of each was 100 μg / mL, and cultured for 3 days. did. After culturing, cell proliferation of osteoblasts was evaluated by MTT assay as an index of bone formation. The cell number ratio was calculated with the number of cells after culturing without sample added in the absence of irisin as 100.

The results of Test Example 4 are shown in Table 4. Although the cell proliferation of osteoblasts was promoted by irisine, the cell proliferation was further promoted by the addition of mango ginger extract (Production Examples 1 to 3), and the physiological action enhancing effect of irisine was observed. Although the acerola juice powder (Production Example 4) alone did not show the effect of enhancing the physiological action of irisine, the combination of the mango ginger extract and the acerola fruit juice powder significantly promoted the cell proliferation of osteoblasts by irisine. , An excellent effect of enhancing the physiological action of airicin was observed.

Test Example 5 Irisin production-promoting action Mouse myoblasts were cultured in DMEM containing 10% fetal bovine serum. Then, the cells were cultured in DMEM containing 2% horse serum and differentiated into myotube cells. After differentiation, the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production Example 4) produced in Example 1 was added so as to have a final concentration of 100 μg / mL, and the cells were cultured for 1 day. In addition, mango ginger extract (Production Examples 1 to 3) and acerola juice powder (Production Example 4) were added in combination so that the final concentration of each was 100 μg / mL, and the cells were cultured for 1 day. After culturing, cells were collected and the gene expression of FNDC5, which is a precursor of irisin, was evaluated by a real-time PCR method. GAPDH was used as the internal standard. The gene expression ratio was calculated by setting the gene expression level to which no sample was added to 1.

Primer set for FNDC5 CAAAGAACAAAGATGAGGGTGACCA (SEQ ID NO: 11)
TTCTCCTTGTTTGTGGGCT (SEQ ID NO: 12)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

The results of Test Example 5 are shown in Table 5. Gene expression of FNDC5 was promoted by the addition of mango ginger extract (Production Examples 1 to 3) and acerola juice powder (Production Example 4). Furthermore, the combination of mango ginger extract and acerola juice powder significantly promoted gene expression of FNDC5.

Test Example 6 UCP1 production promoting action in combination with exercise in white adipocytes Mouse adipose progenitor cells are seeded in a collagen-coated silicon extension chamber and differentiated into white adipocytes by the same method as in Test Example 1. I let you. After differentiation, the medium was switched to DMEM containing 10% fetal bovine serum and cultured for 3 days, and in the presence of 5nM irisine, the mango ginger extract (Production Examples 1 to 3) or acerola juice powder (Production) produced in Example 1 was produced. Example 4) was added so that the final concentration was 500 μg / mL, and the cells were cultured for 3 days. Further, in the presence of 5 nM irisine, mango ginger extract (Production Examples 1 to 3) and acerola fruit juice powder (Production Example 4) were added in combination so that the final concentration of each was 500 μg / mL, and cultured for 3 days. did. During the culture period of 3 days after sample addition, a biochemical stretching device ST-140 (Strex Co., Ltd.) was used to extend the elongation rate in the uniaxial direction with respect to the chamber by 10% and the extension rate by 0.5 Hz (10% extension). The exercise load was reproduced in the culture system by continuously stimulating the extension (the width of one reciprocation over 2 seconds) for 1 hour and 3 days every day. After culturing, cells were collected and the gene expression of UCP1 was evaluated by a real-time PCR method as an index of energy metabolism in white adipocytes. GAPDH was used as the internal standard. In the absence of irisine, the gene expression level without sample addition, which was not loaded with extension stimulus, was set to 1, and the gene expression level ratio was calculated.

Primer set for UCP1 CAGCCTACAGAGGTCGTGAA (SEQ ID NO: 7)
GGGTTTGATCCCATGCAGAT (array 8)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

The results of Test Example 6 are shown in Table 6. Under the condition of extension stimulation, UCP1 gene expression was promoted by irisine, but when mango ginger extract (Production Examples 1 to 3) was added, UCP1 gene expression was further promoted as compared with irisine alone. The effect of enhancing the physiological action of irisin was observed. In addition, an excellent physiological action enhancing effect of irisine was also observed in combination with acerola fruit juice powder (Production Example 4). The effect of enhancing the physiological action of irisine by the combination of mango ginger extract, mango ginger extract and acerola juice powder was confirmed even in combination with exercise. It was found that the gene expression of UCP1 in white fat was promoted by loading only the extension stimulus without adding the sample.

Test Example 7 UCP1 production promoting action in mouse subcutaneous fat
Twenty-four 7-week-old ICR mice (male) that had been preliminarily bred for one week were divided into 4 groups (test groups 1 to 4) with 6 animals each, and an oral administration test of mango ginger extract and acerola juice powder was conducted. gone. As a control group, the mice in Test Group 1 were intraperitoneally administered with physiological saline for 7 days and orally administered with water for 7 days. The mice in Test Group 2 were intraperitoneally administered 0.8 μg / kg of irisine dissolved in physiological saline for 7 days, and water was orally administered for 7 days. The mice in Test Group 3 were intraperitoneally administered with irisine 0.8 μg / kg for 7 days, and 0.5 g / kg of mango ginger 50% ethanol extract (Production Example 1) was orally administered for 7 days. For the mice of test group 4, 0.8 μg / kg of irisine was orally administered peritoneally for 7 days, and mango ginger 50% ethanol extract (Production Example 1) 0.5 g / kg and acerola juice powder (Production Example 4) 0. .5 g / kg was orally administered for 7 days. One hour after the sample administration on the 7th day, the subcutaneous fat in the right inguinal region was collected, and the gene expression of UCP1 was measured by the real-time PCR method. GAPDH was used as the internal standard. The gene expression level in test group 1 was set to 1, and the gene expression level ratio was calculated.

As a result of the test, the expression of the UCP1 gene in the inguinal subcutaneous fat was in the order of test group 4> test group 3> test group 2> test group 1. From this test result, it was confirmed that even in the test using mice, the effect of enhancing the physiological effect of irisine by the mango ginger extract and the excellent effect of enhancing the physiological effect of irisine by the combination of the mango ginger extract and acerola juice powder were confirmed. rice field. Similar results were obtained when a hot water extract of mango ginger (Production Example 2) and an ethanol extract of mango ginger (Production Example 3) were used as the mango ginger extract by the same method.

Primer set for UCP1 CAGCCTACAGAGGTCGTGAA (SEQ ID NO: 7)
GGGTTTGATCCCATGCAGAT (array 8)
Primer set for GAPDH TGGAGAAAACCTGCCAAAGTATG (SEQ ID NO: 5)
CCCTCAGATGCCTGCTTCA (array 6)

From the above, the present invention can be used as an agent for enhancing the physiological action of irisine containing mango ginger, an agent for promoting the production of irisine, an agent for enhancing the physiological action of irisine containing mango ginger and acerola, and an agent for promoting the production of irisine. , It is possible to further enhance the health maintenance effect of airicin. It can also be used for foods, quasi-drugs, and pharmaceuticals containing these.

Claims (10)

An irisine physiological action enhancer characterized by containing mango ginger, wherein the enhanced physiological action is an energy metabolism promoting action of muscle cells . A physiological action enhancer for irisine, which is characterized by containing mango ginger and whose physiological action for enhancing is a bone formation promoting action . An irisine receptor expression promoter (excluding fat burning promoters and fat accumulation inhibitors) characterized by containing mango ginger. An irisine production promoter characterized by containing mango ginger (excluding fat burning promoters and fat accumulation inhibitors) . An agent for enhancing the physiological action of irisine, which is characterized by containing mango ginger and acerola . It is a physiological action enhancer of irisine characterized by containing mango ginger and acerola, and the enhancing physiological action is an energy metabolism promoting action of white fat cells, an energy metabolism promoting action of muscle cells, and a bone formation promoting action. , Physiological enhancer of irisine . An irisine receptor expression promoter characterized by containing mango ginger and acerola . An irisine production promoter characterized by containing mango ginger and acerola . Uses for enhancing the physiological action of irisine and promoting the expression of irisine receptors (for promoting fat burning and suppressing fat accumulation, which are characterized by containing the mango ginger according to any one of claims 1 to 4. (Excluding), food composition for promoting the production of irisine (excluding applications for promoting fat burning and suppressing fat accumulation). For enhancing the physiological action of irisine, promoting the expression of the irisine receptor, promoting the production of irisine, and improving obesity, which comprises the mango ginger and acerola according to any one of claims 5 to 8. Food composition.