JP6076624B2 - Differentiation inducer from stem cells to mesoderm cells, endoderm cells or mesendoderm cells - Google Patents

Description

  The present invention relates to a differentiation inducer from stem cells to mesodermal cells, endoderm cells or mesendoderm cells, pharmaceuticals containing the differentiation inducers, quasi-drugs and foods and drinks, and mesodermal cells, endoderm The present invention relates to a method for producing cell lines or mesendoderm cells.

  A stem cell is a cell having both multipotency capable of differentiating into various cells and self-proliferation ability capable of maintaining multipotency (undifferentiated state) even after cell division. Among them, somatic stem cells exist in each tissue in the living body, and when the cells of the tissue are lost due to a disorder or disease or aging, the tissue homeostasis is supplied by supplying new cells. Is maintained. In addition, pluripotent stem cells such as ES cells (embryonic stem cells) and iPS cells (artificial pluripotent stem cells) are artificially created stem cells and have the ability to differentiate into all cell types that make up living organisms. (Multipotency) and unlimited proliferation.

  In recent years, in the field of advanced medicine including regenerative medicine, research on applying the properties of these stem cells to regeneration of organs and tissues has been actively carried out (Non-patent Document 1). For example, living body cardiomyocytes have little self-proliferating ability, and it is considered that transplantation with foreign cells is necessary for regeneration of damaged myocardium. Against this background, recent advances in stem cell technology have made it possible to induce myocardium from mouse and human ES cells and iPS cells. Currently, the effectiveness of transplantation of these induced cardiomyocytes is also effective. It has been reported that expectations for myocardial regeneration are increasing (Patent Document 1, Non-Patent Documents 2 and 3). However, since the prior art uses Noggin, TGFβ, BMP-2, PDGF, etc. as differentiation inducers, there is room for further improvement in terms of stability and safety.

In addition, liver transplantation is required for patients with end-stage liver failure, such as cholestatic liver disease, cirrhosis, metabolic liver disease, and fulminant hepatitis. There is an increasing expectation for the application of hepatocytes derived from iPS cells to regenerative medicine. Various differentiation induction techniques from stem cells to hepatocytes have already been reported (Non-Patent Documents 4 and 5). However, since the conventional technique uses BMP-4, Activin A, etc. as differentiation inducers, there is room for further improvement in terms of stability and safety. In addition, in order to realize regenerative medicine using the stem cells, it is essential to develop substances and techniques that more efficiently control the differentiation of stem cells into hepatocytes.

  In the development process of vertebrate early embryos, cell lineage differentiation called germ layer formation occurs, and three types of cell populations are formed: ectoderm, mesoderm, and endoderm. Among these, mesoderm and endoderm differentiate from a common precursor called mesendoderm. The mesoderm produces muscle cells, skeletal cells, circulatory cells, genitourinary cells, and connective tissue. Endoderm also produces organ tissues such as digestive cells, lungs, and thyroid gland. Therefore, if differentiation can be induced from stem cells to mesendoderm, and cells and tissues of mesoderm and endoderm derived therefrom, the possibility of application to the treatment of the above-mentioned heart disease, liver failure and the like is expanded.

  On the other hand, trans-4-hydroxy-L-proline is an amino acid found in the collagen of animal skin and is known to stabilize the collagen structure. It is used as a cosmetic because it has a collagen synthesis promoting action and a stratum corneum moisturizing action, and it is also used as a raw material for synthesizing various pharmaceuticals such as anti-inflammatory agents, carbapenem antibiotics, and blood pressure elevation inhibitors. So far, various bioactive functions have been found in trans-4-hydroxy-L-proline and its stereoisomers. For example, Patent Document 2 describes that trans-4-hydroxy-L-proline has a collagen synthesis promoting activity of fibroblasts and a growth promoting activity of epidermal cells. Patent Document 3 describes the use of cis-4-hydroxy-L-proline in treating cancer and similar tumors. However, until now, little has been studied on the effect of trans-4-hydroxy-L-proline on undifferentiated stem cells.

WO2005 / 033298 Table 00/51561 German Patent No. 3538619

Shinichi Nishikawa et al., Experimental Medicine Extra Number, 2008, Vol. 26, No. 5, pp. 74-80 Yuasa S, Itabashi Y, Koshimazu U, Tanaka T, Sugimura K, Kinoshita M, Hattori F, Fukami S, Shimazaki H, Ogawa K. (2005) Nat Biotechnol. 23 (5): 607-611 Klug MG, Soongpaa MH, Koh GY, Field LJ. (1996) J ClinInvest. 98 (1): 216-224 Hamazaki T, Iiboshi Y, Oka M, Papst PJ, Meacham AM, Zon LI, Terada N. (2001) FEBS lett. 497 (1): 15-19 Ishii T, Yaschika K, Fujii H, Hoppo T, Baba S, Naito M, Machimoto T, Kamo N, Sumori H, Nakatsuji N, Ikai I. (2005) Exp Cell Res. 309 (1): 68-77

  The object of the present invention is to find a safe substance having a highly efficient differentiation-inducing activity from stem cells to mesoderm cells, endoderm cells or mesendoderm cells, and heart disease and liver which have been difficult to treat until now. An object of the present invention is to provide compositions such as pharmaceuticals and foods and drinks for fundamentally preventing, improving or treating insufficiency and the like.

  As a result of intensive studies to solve the above-mentioned problems, the inventors of the present application have added messenger, endoderm or mesendoderm in stem cells by adding trans-4-hydroxy-L-proline to the stem cell culture system. While finding that the expression of a cell-specific marker gene is enhanced, it was confirmed that differentiation into cardiomyocytes or hepatocytes was promoted, and the present invention was completed.

That is, the present invention includes the following inventions.
(1) Differentiation from stem cells into one or more cells selected from the group consisting of mesodermal cells, endoderm cells and mesendoderm cells, characterized by containing trans-4-hydroxy-L-proline. Inducer.
(2) The differentiation inducer according to (1), wherein the mesodermal cells are cardiovascular cells.
(3) The differentiation inducer according to (2), wherein the circulatory system cells are cardiomyocytes.
(4) The differentiation inducer according to (1), wherein the endoderm cells are digestive cells.
(5) The differentiation inducer according to (4), wherein the digestive system cells are hepatic progenitor cells or hepatocytes.
(6) A pharmaceutical or a food or drink containing the differentiation inducer according to any one of (1) to (5).
(7) The pharmaceutical product or food or drink according to (6), which is used for treatment or prevention of heart disease or liver failure.
(8) Stem cells are cultured in the presence of trans-4-hydroxy-L-proline to induce differentiation into one or more cells selected from the group consisting of mesodermal cells, endoderm cells, and mesendoderm cells. A method for inducing differentiation from a stem cell to a mesoderm cell, an endoderm cell or a mesendoderm cell.
(9) Stem cells are cultured in the presence of trans-4-hydroxy-L-proline to induce differentiation into one or more cells selected from the group consisting of mesoderm cells, endoderm cells, and mesendoderm cells. A method for producing a mesoderm cell, endoderm cell or mesendoderm cell, comprising a step.
(10) A mesodermal cell, endoderm cell or mesendoderm cell produced by the method according to (9).

  According to the present invention, an agent for inducing differentiation from a stem cell to a mesoderm cell, an endoderm cell or a mesendoderm cell is provided. The differentiation inducer of the present invention can induce differentiation from stem cells into mesendoderm cells, which are common precursors of mesoderm cells and endoderm cells. Further, the differentiation-inducing agent of the present invention is obtained from stem cells to mesodermal cells, such as muscle cells, skeletal cells, circulatory cells, genitourinary cells, connective tissue, or endoderm cells, such as digestive cells. Because it can induce the differentiation of lung, thyroid, and other tissues into cells, it is a drug for fundamentally preventing, improving, or treating ischemic heart disease, circulatory system diseases such as heart failure, and liver / pancreatic diseases. And can be used as food and drink. In addition, mesoderm cells or endoderm cells produced by inducing differentiation from stem cells using the differentiation inducer of the present invention can be transplanted to damaged sites such as the heart and liver to regenerate their functions. Application to is possible. Furthermore, the differentiation-inducing agent of the present invention can also be used as a basic research reagent for differentiation of mesodermal cells such as cardiac muscle, endoderm cells such as hepatocytes, and mesendoderm cells.

Details of the present invention will be described below.
The present invention is a differentiation inducer that induces differentiation from stem cells to mesodermal cells, endoderm cells or mesendoderm cells (hereinafter sometimes referred to as “mesendoderm cell differentiation inducer”). , Trans-4-hydroxy-L-proline is an active ingredient.

  In the present invention, “differentiation induction from stem cells to mesodermal cells, endoderm cells or mesendoderm cells” refers to stem cells to mesodermal cells, endoderm cells, or mesendoderm at the biological level or culture level. This refers to inducing and promoting differentiation into cells and increasing mesoderm cells, endoderm cells or mesendoderm cells.

  In the present invention, “stem cell” refers to various stem cells that can be differentiated into mesodermal cells, endoderm cells, or mesendoderm cells, embryonic stem cells (ES cells), bone marrow, skin, hair follicles, and other tissues. And undifferentiated cells (collectively referred to as “somatic stem cells”), induced pluripotent stem cells (iPS cells), and the like. Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells prepared by nuclear transfer of somatic cell nuclei, and genes on the chromosomes of those ES cells. And ES cells modified by genetic engineering techniques. Such ES cells can be prepared by, for example, a known method, but can be obtained from a predetermined institution, and further commercially available products can be purchased. In addition, these stem cells may be primary cultured cells, subcultured cells, or frozen cells.

  The mesendoderm cell differentiation inducer of the present invention can be applied to all mammals as long as it has equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation. For example, the effect can be exerted on stem cells of mammals such as human, monkey, mouse, rat, guinea pig, hamster, rabbit, cat, dog, horse, cow, sheep, goat and pig.

Anatomical proximity and a common signaling network join the earliest mesoderm and endoderm cells to form a mesendoderm that is different from the ectoderm (Curr Opin Genet Dev. 2000; 10 (4): 350 -356. Vertebrate mesendoderm induction and patterning.Kimleman D, Griffin KJ. And Cell. 2001; 105 (2): 169-172.Mendoderm. Because mesendoderm has some degree of developmental plasticity, it can be used to segregate into mesoderm or endoderm cells in response to appropriate inducers.

By mesendoderm cell is meant a cell that has the ability to differentiate along a mesodermal or endoderm cell pathway during development. Such cells are bipotent cells.

  Whether or not the cell induced to differentiate by the differentiation-inducing agent of the present invention is the above-mentioned mesendoderm cell can be confirmed by, for example, expression of various mesendoderm markers. Examples of the mesendoderm marker that can be used in the present invention include T (mesendoderm cell marker: Trends in Genetics 1994; 10: 280. The T genes in embryogenesis. Herrmann BG, Kispart A.), Foxa2. endodermal cell markers: Development 1998; 125:... 3015-3025 the transcription factor HNF3beta is required in visceral endoderm for normal primitive streak morphogenesis Dufrort D, Schwartz L, Harpal K, include Rossant J.), etc.

  Mesodermal cells and endoderm cells are a concept that includes both terminally differentiated cells and cells established in the mesodermal and endoderm cell pathways. Mesodermal cells include muscle cells (myoblasts, muscle satellite cells, etc.), skeletal cells (osteoblasts, bone cells, chondrocytes, etc.), circulatory cells (cardiomyocytes, hematopoietic stem cells, erythrocytes, Platelets, macrophages, granulocytes, helper T cells, killer T cells, B lymphocytes, etc.), genitourinary cells (tubule cells, mesangial cells, paraglomerular cells, testis, ovary, etc.), connective tissues, etc. . Endoderm cells include gastrointestinal cells (hepatocytes, bile duct cells, pancreatic endocrine cells, acinar cells, duct cells, absorptive cells, goblet cells, panate cells, enteroendocrine cells, etc.), tissues such as lungs and thyroid gland Cell.

  Whether the cells induced to differentiate by the differentiation-inducing agent of the present invention are the above-mentioned mesodermal cells can be confirmed by, for example, expression of various mesodermal markers and cardiovascular cell markers. Examples of mesoderm cell markers and circulatory system cell markers that can be used in the present invention include Flk1 (mesoderm cell marker: Development. 1993; 118: 489-498. Flk-1, an flt-related receptor tyrosine kinase. is an early marker for endoceral cell precursors.Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, Rossant J.), α-MHC, 201, MLC-2v (Dr. of pluripotent embryonic stage m cells into cardiomyocytes.) and the like.

  Whether the cells induced to differentiate by the differentiation-inducing agent of the present invention are the above-mentioned endoderm cells can be confirmed by, for example, expression of various endoderm markers and digestive cell markers. Examples of the endoderm cell marker and digestive system cell marker that can be used in the present invention include Sox17 (endoderm cell marker: Development. 2002; 129 (10): 2367-2379. Depletion of definitive gut endoderm in Sox17- Null Mutant Mice, Kanai-Azuma M, Kanai Y, Gad JM, Tajima Y, Taiya C, Kurohmaru M, Sanai Y, Yonekawa H, Hazaki. 2002; 20: 338-346 AFP (+), ESC-derived cells ngraft and differentiated into hepatocytes in vivo.), Alb (hepatocyte marker: FEBS Lett. PJ, Meacham AM, Zon LI, Terada N.) and the like.

  Hydroxyproline is a cyclic imino acid having two optically active centers, and there are 8 isomers. Among these, trans-4-hydroxy-L-proline used in the present invention is not an amino acid serving as a substrate for protein synthesis, but is widely present in the animal and plant kingdoms as components such as glycoproteins and collagen. There are a method of producing from a mixture of amino acids obtained by hydrolyzing animal collagen, a method of producing proline produced by fermentation by stereospecific hydroxylation with an enzyme, etc., and trans- It can be used in the present invention as 4-hydroxy-L-proline.

  Trans-4-hydroxy-L-proline has an effect of inducing differentiation from stem cells to mesodermal cells, endoderm cells or mesendoderm cells at the culture level or the living body level. Accordingly, the mesendoderm cell differentiation inducer of the present invention is obtained by culturing stem cells in a stem cell differentiation induction medium to which an effective amount thereof has been added, or by administering them to mammals including humans. Differentiation into germ layer cells, endoderm cells or mesendoderm cells can be induced.

  When differentiation induction from stem cells to mesoderm cells, endoderm cells or mesendoderm cells is performed by culturing stem cells, the conditions of the culture method and the method except for adding the above-mentioned mesendoderm cell differentiation inducer to the medium The operation can be performed according to conditions and operations routine in the art. The amount of the mesendoderm cell differentiation inducer added to the medium is 0.5 to 25 mM, preferably 1 to 15 mM as the trans-4-hydroxy-L-proline concentration.

  For the culture of stem cells, a medium having a composition suitable for the purpose of stem cell maintenance or differentiation induction is used. As the stem cell differentiation induction medium, specifically, a basic medium (for example, Dulbecco's modified Eagle) containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, etc.) necessary for cell survival and proliferation is used. 's medium (D-MEM), Minimum Essential Medium (MEM), RPMI1640, Basal Medium Eagle (BME), Dulbecco's modified Eagle's medium: Nutrient Mix12G Minimum Essential Meidum (Glasgow MEM), Hank's balanced salt solution, M To DB15 medium), basic fibroblast growth factor (bFGF), epidermal growth factor (EGF), at least one added medium was growth factors such as leukocyte growth factor (LIF) is used. In addition, in order to increase the cell growth rate, the medium contains tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, bovine serum albumin as necessary. (BSA), fibronectin, progesterone, selenite, B27-supplement, N2-supplement, ITS-supplement, etc. may be added, and antibiotics may be added. Each component of the medium is used after being sterilized by a suitable method.

  In addition to the above, it is preferable that serum is contained at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in the effects, it is preferable to use the serum after a lot check.

  In order to maintain the undifferentiated state, stem cells are cultured in a stem cell maintenance medium (medium supplemented with LIF, L-glutamic acid, etc. in a basic medium) using MEF cells treated with mitomycin C as feeder cells. Inducing differentiation of stem cells into mesodermal cells, endoderm cells or mesendoderm cells, seeding cultured stem cells in an undifferentiated state on a low cell adhesion plate to form a cell mass Alternatively, it is carried out by seeding and culturing on a plate coated with a culture substrate such as gelatin.

  A disposable petri dish is preferable as a container used for culture of stem cells and differentiation induction from stem cells to mesodermal cells, endoderm cells or mesendoderm cells. In addition, it is preferable to perform culture medium exchange once every 2 to 3 days, but it is more preferable to perform it daily. Further, differentiation induction from stem cells to cardiovascular cells such as heart muscle and digestive cells such as hepatocytes is preferably performed for 12 days or more.

  The mesendoderm cell differentiation inducer of the present invention can be administered as it is in the living body, but within a range not impairing the effects of the present invention, drugs, quasi drugs, food and drink, etc. It can mix | blend and use for this composition.

  When the mesendoderm cell differentiation inducer of the present invention is provided as a pharmaceutical, the substrate for pharmaceutical preparations, which is acceptable in terms of pharmaceutical preparations and appropriately selected according to the dosage form, to trans-4-hydroxy-L-proline And carriers, excipients, diluents, binders, lubricants, coating agents, disintegrants or disintegration aids, stabilizers, preservatives, preservatives, extenders, dispersants, wetting agents, buffers, A solubilizer or solubilizer, isotonic agent, pH adjuster, propellant, colorant, sweetener, corrigent, fragrance, etc. are added as appropriate, and the whole body orally or parenterally by various known methods What is necessary is just to prepare in the various formulation which can be administered locally.

  For preparations for oral administration, for example, excipients such as starch, glucose, sucrose, fructose, lactose, sorbitol, mannitol, crystalline cellulose, magnesium carbonate, magnesium oxide, calcium phosphate, dextrin; carboxymethylcellulose, carboxymethylcellulose calcium, starch Disintegrants or disintegration aids such as hydroxypropylcellulose; binders such as hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, gum arabic, and gelatin; lubricants such as magnesium stearate, calcium stearate, and talc; hydroxypropylmethylcellulose Coating agents such as white sugar, polyethylene glycol, titanium oxide; petrolatum, liquid paraffin, polyethylene glycol, gelatin, Olin, glycerin, purified water, but may be made of a hard fat base such as such as, but not limited to.

  For preparations for parenteral administration, solvents such as distilled water, physiological saline, ethanol, glycerin, propylene glycol, macrogol, alum water, vegetable oil; isotonic agents such as glucose, sodium chloride, D-mannitol; inorganic acids , PH adjusters such as organic acids, inorganic bases or organic bases can be used, but are not limited thereto.

  The form of the pharmaceutical of the present invention is not particularly limited. For example, tablets, sugar-coated tablets, capsules, troches, granules, powders, liquids, pills, emulsions, syrups, suspensions, elixirs Oral preparations, eye drops, injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drops, suppositories, ointments, lotions, sprays, transdermal Non-oral agents such as skin absorbents, transmucosal absorbents, patches and the like. Moreover, you may make it the dry product re-dissolved when using. The pharmaceutical of the present invention includes drugs used for animals, that is, veterinary medicine.

  The content of trans-4-hydroxy-L-proline in the preparation is not particularly limited, but is preferably in the range of 0.001 to 30% by weight, more preferably 0.01 to 10% by weight based on the total weight of the preparation. preferable. If it is less than 0.001% by weight, it is difficult to obtain the effect, and even if it exceeds 30% by weight, the effect is hardly increased. In addition, the method for adding the active ingredient in the formulation may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  The agent for inducing differentiation of mesendoderm cells of the present invention is an action in which trans-4-hydroxy-L-proline, which is an active ingredient, promotes differentiation from stem cells to mesoderm cells, endoderm cells or mesendoderm cells. Therefore, it is effective as a medicament for improving and preventing diseases related to mesoderm-derived organs such as cardiovascular diseases and diseases related to endoderm-derived organs such as liver and pancreatic diseases.

  The diseases related to mesoderm-derived organs are not particularly limited as long as they are diseases caused by degeneration or damage of muscle cells, skeletal cells, circulatory cells, genitourinary cells, connective tissue, for example, osteoporosis, heart disease (Myocardial infarction, angina pectoris, arrhythmia, heart failure, valvular heart disease, aneurysm, cardiomyopathy, cardiac hypertrophy, etc.), blood diseases (anemia, erythrocytosis, leukemia, malignant lymphoma, multiple myeloma, etc.), renal disease (Nephritis, renal failure, nephrotic syndrome, IgA nephropathy, diabetic nephropathy, gout kidney, nephrosclerosis, etc.).

  The disease related to the endoderm-derived organ is not particularly limited as long as it is a disease caused by degeneration or damage of cells of tissues such as digestive cells, lungs, thyroid gland, etc., for example, liver diseases (hepatitis, cirrhosis, fatty liver, etc.), Examples include bile / pancreatic diseases (pancreatitis, cholecystitis, biliary stones, bile duct stones, etc.), thyroid diseases (hypothyroidism, hyperthyroidism, nodular goiter, etc.) and the like.

  The pharmaceutical of the present invention functions as a prophylactic agent that suppresses the onset of the above diseases and / or a therapeutic agent that improves the normal state.

  When the pharmaceutical of the present invention is used as a pharmaceutical for the prevention and / or treatment of the aforementioned diseases, it is orally or parenterally administered over a wide range of doses to mammals such as humans, mice, rats, rabbits, dogs and cats. Can be administered.

  The dosage of the pharmaceutical product of the present invention can be appropriately determined according to the type of disease, the age, sex, weight, and symptom of the subject of administration. For example, when orally administered to an adult, the daily dose is 0.1 to 20 g, preferably 1 to 10 g, as trans-4-hydroxy-L-proline.

  Moreover, the mesendoderm type | system | group cell differentiation inducer of this invention can be mix | blended with food-drinks. In the present invention, the food and drink includes health food, functional food, nutritional supplement, or food for specified health use. Furthermore, the food / beverage products of this invention include the pet food and feed used for mammals other than a human being. In particular, it is advantageous in that it can be taken on a daily basis when it is necessary for long-term use such as prevention or treatment of heart disease or liver failure.

  The form of the food or drink may be any form suitable for edible use, for example, solid, liquid, granular, granular, powder, capsule, cream, or paste.

  Specific types of food and drink include breads such as bread and confectionery bread; noodles such as buckwheat, udon, pasta, Chinese noodles and instant noodles; baked confectionery such as candy, chewing gum, chocolate, biscuits and cookies, jelly Confectionery such as ice cream, ice sherbet, shaved ice; dairy products such as processed milk, fermented milk, yogurt, butter, cheese; fishery and livestock processed foods such as kamaboko, chikuwa, ham, sausage; margarine, mayonnaise , Shortening, whipped cream, dressing and other fats and oils processed foods; seasonings such as soy sauce, sauce, vinegar, mirin; soft drinks, carbonated drinks, beauty drinks, nutrition drinks, fruit drinks, milk drinks, etc. (these Including, but not limited to, beverage concentrate concentrates and powders for preparation).

  The food and drink of the present invention may be appropriately mixed with additives that are usually used depending on the type. Any additive that is acceptable in food hygiene can be used as the additive. For example, sweeteners such as glucose, sucrose, fructose, isomerized liquid sugar, aspartame, stevia; citric acid, malic acid, Acidic agents such as tartaric acid; excipients such as dextrin and starch; binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Agents, preservatives and the like.

  The compounding amount of trans-4-hydroxy-L-proline in the food and drink of the present invention may be an amount that can exert differentiation promoting action from stem cells to mesodermal cells, endoderm cells or mesendoderm cells. The general intake of the target food and drink, the form of the food and drink, the efficacy / effect, the taste, the palatability, the cost, etc. may be set as appropriate.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.

(Example 1) Stem cells (mouse ES cells) induced by trans-4-hydroxy-L-proline to induce differentiation into mesoderm, endoderm or mesendoderm cells (1) Preparation of ES cells In a 35 mm petri dish treated with gelatin Mitomycin C-treated MEF cells (mouse embryonic fibroblast) were cultured in a confluent state, and 10-20 × 10 ⁴ mouse ES cells were seeded thereon, and precultured at 37 ° C. in a 5% CO ₂ incubator. The medium was added to DMEM with additional factors for ES cells (L-glutamine solution, 2-mercaptoethanol solution, nucleoside solution, non-essential amino acid solution) manufactured by Millipore at a recommended concentration, and then LIF (leukemia inhibitory factor) was added at 1000 units / An ES cell undifferentiated maintenance medium (hereinafter, referred to as “ES cell medium”) supplemented with 15 mL of mL and FBS (fetal bovine serum) was used.

  The ES cells and MEF cells cultured by the above method were detached from the petri dish by trypsin treatment, and seeded again in a 35 mm petri dish treated with gelatin. After seeding, the mixture was allowed to stand for 30 minutes, and then the medium was collected in another tube. At this time, MEF cells with strong adhesiveness remain in the petri dish, and only ES cells are collected. The following experiment was performed using the undifferentiated ES cells collected in this manner.

(2) Induction of differentiation of stem cells into mesoderm, endoderm, or mesendoderm cells by trans-4-hydroxy-L-proline in a culture system that forms EBs. The cells were suspended in the removed ES cell medium and seeded on a low-cell-adhesive 96-well plate at a cell concentration of 500 cells / 100 μL to prepare EB (Embryoid Body). At that time, commercially available trans-4-hydroxy-L-proline (Wako Pure Chemical Industries, Ltd., L-hydroxyproline) was added at a concentration of 2.5, 5, 10 mM.

After culturing for 6 days, EB was collected, washed with PBS (−), and RNA was extracted from EB by Trizol Reagent (Invitrogen). 2-STEP real-time PCR kit (Applied Biosystems) was used to reverse-transcribe RNA into cDNA and then ABI7300 (Applied Biosystems) was used for real-time PCR (95 ° C .: 15 seconds, 60 ° C.:30) 40 cycles), and Sox1 (ectoderm marker: Dvelopment. 1998; 125: 1967-1978. A role for SOX1 in neutral determination. Peveny LH, Sockanathan S, Placzek M, Lovell). (Mesendoderm marker), Foxa2 (mesendoderm marker), Flk1 (mesoderm marker), Sox17 (endoderm marker) It was analyzed the expression of each marker gene. Other operations were performed in accordance with a prescribed method.

Primer set for Sox1 (ectoderm marker):
GCCGAGTGGAAGGTCATGT (SEQ ID NO: 1)
TGTAATCCGGGTGTTCCTTTCAT (SEQ ID NO: 2)
Primer set for T (mesendoderm marker):
CAGCCCACCACTACTGCTCTA (SEQ ID NO: 3)
GAGCTCTCGAAAGAACTGAGC (SEQ ID NO: 4)
Primer set for Foxa2 (mesendoderm marker):
GGCCCAGTCACGAACAAAAGC (SEQ ID NO: 5)
CCCAAAGTCTCCCACTCAGCCCTC (SEQ ID NO: 6)
Primer set for Flk1 (mesoderm marker):
CTGTGGGCGTTTCTACTCCT (SEQ ID NO: 7)
AGGAGCAAGCTGCATCATTT (SEQ ID NO: 8)
Primer set for Sox17 (endoderm marker):
CAGAACCCAGATCTGCACAA (SEQ ID NO: 9)
GCTTCTCTGCCCAGAGTCAAC (SEQ ID NO: 10)
Gapdh (internal standard) primer set:
TGCACCACCAACTGCCTTAGC (SEQ ID NO: 11)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 12)

Regarding the expression of the marker gene in each cell, the expression level of each gene mRNA in cells cultured without adding trans-4-hydroxy-L-proline was calculated as a ratio relative to the expression level of Gapdh mRNA as an internal standard. The value of expression level (expression level of each gene / expression level of Gapdh) is set to 1, and the value of relative expression level of each gene in each cell to which trans-4-hydroxy-L-proline is added is calculated. evaluated. The results are shown in Table 1.

  As shown in Table 1, expression of Sox1, which is an ectoderm marker, was suppressed depending on the concentration of trans-4-hydroxy-L-proline. On the other hand, it was confirmed that the expression of mesoderm marker, endoderm marker and mesendoderm marker T, Foxa2, Flk1, and Sox17 was significantly promoted. Similar results were obtained in experiments using human iPS cells and somatic stem cells.

  In addition, EBs were collected after 6 days of culture, frozen sections were prepared, and expression of T, which is a mesendoderm marker, was analyzed by immunostaining. The result is shown in FIG. In the trans-4-hydroxy-L-proline 5 mM addition group, the number of T-positive cells significantly increased as compared to the trans-4-hydroxy-L-proline non-addition group. Similar results were obtained in experiments using human iPS cells and somatic stem cells.

As described above (Table 1 and FIG. 1), trans-4-hydroxy-L-proline suppresses differentiation from stem cells to ectoderm and significantly promotes differentiation into mesoderm, endoderm or mesendoderm cells. To do.

(Example 2) Differentiation induction of stem cells (mouse ES cells) into cardiomyocytes by trans-4-hydroxy-L-proline EBs prepared in the same manner as described above and cultured for 6 days were placed on a gelatin-coated 48-well plate. Each well was seeded one by one, cultured using ES cell medium excluding LIF, and 5 mM trans-4-hydroxy-L-proline was added. Every day after EB seeding, each well was observed for the presence or absence of a region that differentiated and pulsated into the myocardium of the cell population that had established and differentiated / proliferated.

FIG. 2 shows the results of the differentiation induction test. In the trans-4-hydroxy-L-proline added group, it was confirmed that the proportion of wells having a beating region increased. Similar results were obtained in experiments using human iPS cells and somatic stem cells.

Further, EBs on the 6th day after seeding (12th day of culture) were collected, and expression of myocardial differentiation marker genes α-MHC and MLC2v (cardiomyocyte marker) was determined by real-time PCR using the following primer sets. Analyzed.

Primer set for α-MHC (cardiomyocyte marker):
TAAAGGCAAAGGAGGCAGAAAG (SEQ ID NO: 13)
ACAAAGTGAGGGTGGGTGGT (SEQ ID NO: 14)
Primer set for MLC2v (cardiomyocyte marker):
CGACAAGAATGACCTAAGGGGACA (SEQ ID NO: 15)
CCCAAACATCGTGGAGACA (SEQ ID NO: 16)

  Table 2 shows the analysis results of the expression of each marker gene by real-time PCR.

As shown in Table 2, it was confirmed that expression of each myocardial differentiation marker (α-MHC, MLC2v) was promoted by addition of trans-4-hydroxy-L-proline. Similar results were obtained in experiments using human iPS cells and somatic stem cells.

As described above (FIG. 2 and Table 2), trans-4-hydroxy-L-proline promotes differentiation from stem cells to cardiomyocytes.

(Example 3) Differentiation induction of stem cells (mouse ES cells) into hepatocytes by trans-4-hydroxy-L-proline EBs prepared in the same manner as described above and cultured for 6 days were placed on a gelatin-coated 48-well plate. Each well was seeded one by one, cultured using ES cell medium excluding LIF, and 5 mM trans-4-hydroxy-L-proline was added. EBs on the 6th day after seeding (day 12 of culture) were collected, and expression of hepatocyte differentiation marker genes Afp (hepatic progenitor cell marker) and Alb (hepatocyte marker) was real-time using the following primer sets. Analyzed by PCR.

Afp (hepatic progenitor cell marker) primer set:
CACACCCGCTTCCCTCATCC (SEQ ID NO: 17)
TTCTCTCTCGTCACGCACTGG (SEQ ID NO: 18)
Primer set for Alb (hepatocyte marker):
GACGTGGTTGCCGATGGAGT (SEQ ID NO: 19)
TCACGGAGGTTTGGAATGG (SEQ ID NO: 20)

  Table 3 shows the analysis results of the expression of each marker gene by real-time PCR.

  As shown in Table 3, it was confirmed that the addition of trans-4-hydroxy-L-proline promotes the expression of hepatocyte differentiation markers (Afp, Alb). Similar results were obtained in experiments using human iPS cells and somatic stem cells. As described above, trans-4-hydroxy-L-proline promotes differentiation from stem cells to hepatocytes.

  The mesendoderm cell differentiation inducer of the present invention can efficiently induce differentiation from stem cells to mesodermal cells such as cardiac muscle, endoderm cells such as hepatocytes, or mesendoderm cells which are common progenitor cells. Differentiated cardiomyocytes and hepatocytes can be used in the field of regenerative medicine, such as transplantation to an injured site and use as an artificial heart / artificial liver. Further, it can be used in the field of manufacturing foods and drinks such as pharmaceuticals, quasi drugs, functional foods and supplements for the fundamental treatment of diseases such as heart disease and liver failure.

FIG. 1A shows the results of a differentiation induction test from ES cells to mesendoderm cells with trans-4-hydroxy-L-proline (upper left: T after 6 days of culture in the group without addition of trans-4-hydroxy-L-proline. Immunostaining image for (mesendoderm marker), upper right: DAPI-stained image after 6 days of culture in the group without addition of trans-4-hydroxy-L-proline, lower left: group with 5 mM trans-4-hydroxy-L-proline added An immunostaining image for T (mesendoderm marker) after 6 days of culture, lower right: DAPI-stained image after 6 days of culture in the trans-4-hydroxy-L-proline 5 mM addition group. FIG. 1B shows the ratio of T-positive cells after 6 days of culture in the group without addition of trans-4-hydroxy-L-proline and the group with addition of 5 mM of trans-4-hydroxy-L-proline from the immunostained image of FIG. 1A. FIG. 2 shows the results of a differentiation induction test from ES cells to cardiomyocytes by trans-4-hydroxy-L-proline. In the EBs of the trans-4-hydroxy-L-proline non-addition group and the trans-4-hydroxy-L-proline 5 mM addition group, the ratio of having a region that is differentiated into cardiac muscles and pulsates is shown.

Claims (5)

One or more cells selected from the group consisting of pluripotent stem cells, mesodermal cells, endoderm cells, and mesendoderm cells, characterized by containing trans-4-hydroxy-L-proline as an active ingredient Differentiation-inducing agent. The differentiation inducer according to claim 1, wherein the mesodermal cells are cardiovascular cells. The differentiation inducer according to claim 2, wherein the circulatory system cells are cardiomyocytes. The differentiation-inducing agent according to claim 1, wherein the endoderm cells are digestive cells. The differentiation inducer according to claim 4, wherein the digestive system cells are hepatic progenitor cells or hepatocytes.