JP6697252B2 - Stem cell undifferentiated state maintenance agent and growth promoter - Google Patents

Description

  The present invention relates to an agent for maintaining an undifferentiated state of stem cells and a growth promoter, and a method for maintaining an undifferentiated state of stem cells and a method for promoting growth.

  In vertebrate tissues (especially mammals), when cells or organs are damaged due to injury or disease, or aging, a regeneration system works to try to recover the damage to the cells or organs. Stem cells (tissue stem cells, somatic stem cells) provided in the tissue play a major role in this action. Stem cells have pluripotency to differentiate into all cells and organs, and it is believed that this property leads to recovery by compensating for damaged parts of cells and organs. Expectations are gathering for regenerative medicine, which is the next-generation medical treatment that applies such stem cells.

  The most advanced tissue for stem cell research in mammals is the bone marrow. It was revealed that living hematopoietic stem cells are present in the bone marrow and are the source of all blood cell regeneration. Furthermore, it has been reported that bone marrow contains, in addition to hematopoietic stem cells, stem cells capable of differentiating into organs or tissues (eg, bone, cartilage, muscle, fat, etc.) (see Non-Patent Document 1).

  Furthermore, in recent years, in addition to bone marrow, it has been clarified that stem cells are present in all organs and tissues such as skin, liver, pancreas, and fat, and it is responsible for the regeneration and homeostasis of each organ and tissue. It has become clear (see Non-Patent Documents 2 to 5). In addition, stem cells present in each organ or tissue have excellent plasticity, and may be used for regeneration of organs or tissues, which until now could not self-renew.

  On the other hand, some of these stem cells are known to decrease with aging, and research on techniques to prevent the decrease of stem cells is actively carried out in order to maintain homeostasis of each tissue ( Non-Patent Document 6). In addition, in recent years, in order to apply the ability (pluripotency) of stem cells to the regeneration of organs and tissues, in the fields of cell transplantation therapy and tissue engineering (regenerative medicine and regenerative beauty), stem cells are separated from living tissues and then cultured. Development of a technique for breeding is in progress (Non-Patent Documents 7 and 8).

  In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency, which is the ability of the stem cells, that is, the undifferentiated state. If the undifferentiated state of stem cells cannot be maintained during this culture and the induction of differentiation has progressed, the finally prepared stem cells will have lost their ability (pluripotency), and the desired effect ( Regeneration of organs and tissues) cannot be exerted.

  From the above, when stem cells are used for cell transplantation therapy or tissue engineering (regenerative medicine or regenerative beauty) and regeneration of organs or tissues is desired, the stem cells must be cultivated while maintaining an undifferentiated state.

  To date, there have been some reports on techniques for growing stem cells while maintaining an undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culturing with supporting cells (stromal cells or feeder cells) (see Patent Document 1 and Non-Patent Documents 9 to 11). ). However, recently, an example of infection between heterologous animals due to an endogenous virus derived from a feeder cell has been reported (see Non-Patent Document 12), and culture of stem cells using feeder cells is intended for medical purposes. Is not suitable for culturing.

  Another method is to maintain the undifferentiated state of stem cells by complexly combining cytokines. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 13). In addition, in the presence of the early acting cytokine thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF), it is possible to maintain the undifferentiated state of embryonic stem cells, It has been reported in somatic stem cells and the like (see Patent Document 3 and Non-Patent Document 14).

  However, cytokines are expensive and have problems such as raw materials to be collected and storability, so that easy use is difficult. In addition, the effect of LIF was extremely limited to a specific cell lineage, and it was revealed that addition of LIF alone cannot maintain an undifferentiated state in ES cells and somatic stem cells of primates. (See Non-Patent Document 10).

  As described above, all of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations and have a low effect of maintaining the undifferentiated state. Therefore, in order to utilize the stem cells for regenerative medicine, there has been a demand for a technique for proliferating the stem cells while maintaining an undifferentiated state. That is, there has been a demand for a technique capable of proliferating stem cells safely, simply and efficiently while maintaining an undifferentiated state.

  Fritillaria imperialis (scientific name: Fritilaria imperialis, Japanese name: Yorakuyuri) is a perennial plant belonging to the genus Fritillaria of the family Liliaceae, and is characterized by having large bulbs (bulbs). Fritillaria imperialis is a large species of the plant of the genus Fritillaria with a plant height of 20 cm to 1 m, and exhibits flower colors such as orange and yellow. It is mainly cultivated for gardening due to its elegant bell-shaped flower appearance at the time of flowering. ing. There are some species of genus Fritillaria, such as dried lilies (crude drug name: shell mother), in which dried products of bulbs are used as a herbal medicine for antitussive and expectorant purposes, but for fricilaria imperialis, it is used for purposes other than ornamental use. Has not been reported so far.

JP 2004-24089 A Special table 2002-525042 gazette Japanese Patent No. 3573354

Pittenger M.A. F. Et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M.D. A. Et al., Nat. Med. , 1997, Vol. 3, pp. 1337-1345 Zulewski H. et al. Et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. Et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P. A. Et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Hasegawa, Y., Aesthetic Dermatology, 2013, Vol. 23, pp. 1-11 Mabuchi, Y. et al., Japanese Society for Regenerative Medicine, 2007, Vol. 6, pp. 263-268 Kitagawa Zen et al., Japanese Society of Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomson J. A. Et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848 Thomson J. A. Et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B.A. E. Et al., Nature Biotech. , 2000, Vol. 18, pp. 399-404 van der Laan L.D. J. Et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A. G. Et al., Dev. Biol. , 1987, Vol. 121, pp. 1-9 Madlambayan G.M. J. Et al., J. Hematother. Stem Cell Res. , 2001, Vol. 10, pp. 481-492

  In view of the above-mentioned circumstances, the present invention finds a new substance that can efficiently proliferate stem cells while maintaining the undifferentiated state, and provides the stem cells as an undifferentiated state maintenance agent or a growth promoter. Is an issue.

  As a result of intensive studies to solve the above problems, the inventors of the present invention have found that an extract of Fritillaria imperialis has an excellent undifferentiated state-maintaining effect and a growth-promoting effect on stem cells, which have been unknown until now. This has led to the completion of the present invention.

That is, the present invention includes the following.
(1) An agent for maintaining an undifferentiated state of a stem cell, which contains an extract of Fritillaria imperialis as an active ingredient.
(2) A proliferative agent for stem cells, which contains an extract of Fritillaria imperialis as an active ingredient.
(3) A method for producing a stem cell, which comprises a step of culturing the stem cell in a medium containing an extract of Fritillaria imperialis.
(4) A method for maintaining an undifferentiated state of a stem cell, which comprises a step of culturing the stem cell in a medium containing an extract of Fritillaria imperialis.
(5) A method for promoting the proliferation of stem cells, which comprises a step of culturing the stem cells in a medium containing an extract of Fritillaria imperialis.
(6) A cosmetic, a drug, or a quasi drug, which comprises the agent according to (1) or (2).
(7) A food or drink containing the agent according to (1) or (2).

  According to the present invention, stem cells can be efficiently propagated while maintaining an undifferentiated state. Therefore, the present invention can greatly contribute to the fields of regenerative medicine and rejuvenating beauty.

Hereinafter, the present invention will be described in detail.
The agent for maintaining an undifferentiated state of stem cells or the agent for promoting proliferation according to the present invention contains an extract of Fritillaria imperialis as an active ingredient.

  Fritillaria imperialis (scientific name: Fritilaria imperialis) used in the present invention is a perennial plant belonging to the genus Fritillaria of the family Liliaceae, and is distributed in Europe and West Asia, but the production site is not limited. In addition, examples of the varieties of Fritillaria imperialis that are mainly distributed in Japan include "Lutea" and "Lubra", and these can be used. In the present invention, the extract of Fritillaria imperialis refers to an extract of a part of the plant such as flowers, stems, leaves, roots, bulbs or the whole plant, or a mixture thereof. The material is preferably a bulb. In addition, these plants may be used as they are for extraction, or may be subjected to treatments such as drying, crushing, and finely chopping.

  The method for extracting the extract from Fritillaria imperialis is not particularly limited, and may be, for example, a heat extraction method or a room temperature extraction method. Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol). , Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran) , Propyl ether, etc.) and the like. Water, lower alcohols and liquid polyhydric alcohols are preferable, and water and ethanol are particularly preferable. These solvents may be used alone or in combination of two or more, and for example, an aqueous ethanol solution of 30 to 70 v / v% may be used. It is also possible to use a solvent whose pH is adjusted by adding an acid or an alkali to the extraction solvent.

  Fritillaria imperialis is subjected to solvent extraction using the solvent described above. The ratio of Fritilaria imperialis to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, by adding water to a dried product of the bulb of Fritillaria imperialis and performing hot water extraction at 95 to 100 ° C., an extract of Fritillaria imperialis can be obtained. Alternatively, a lower alcohol (for example, ethanol) or a liquid polyhydric alcohol (for example, propylene glycol, 1,3-butylene glycol, etc.) is added to a dried product of Fritillaria imperialis, and the mixture is added at room temperature (for example, 5 to 35 ° C.). By performing the extraction, an extract of Fritillaria imperialis can be obtained.

  After solvent extraction, the solvent phase obtained can itself be an extract of Fritillaria imperialis. Alternatively, if necessary, the obtained solvent phase was subjected to treatments such as concentration (concentration by reduced pressure concentration, membrane concentration, etc.), dilution, filtration, drying, and decolorization and deodorization treatment with activated carbon, etc. The product can be an extract of Fritillaria imperialis. In particular, it is preferable that the extracted solution is subjected to treatments such as concentration dryness, spray drying, and freeze drying, and the resulting dried product is used as an extract of Fritillaria imperialis.

  The extract of Fritillaria imperialis thus obtained has the effect of efficiently proliferating stem cells while maintaining the undifferentiated state at the biological level or at the culture level, and therefore, an agent for maintaining the undifferentiated state of stem cells or It can be used as a growth promoter. Furthermore, the undifferentiated state-maintaining agent or growth promoting agent for stem cells according to the present invention may be used as a cell culture additive for efficiently growing stem cells while maintaining an undifferentiated state, or as a research reagent. You can

  By applying the undifferentiated state-maintaining agent or proliferation promoter for stem cells according to the present invention to stem cells of mammals including human, it is possible to maintain the undifferentiated state of stem cells and promote the proliferation of stem cells. .. The stem cells to which the agent for maintaining an undifferentiated state of a stem cell or the growth promoter according to the present invention is applied are not particularly limited as long as they meet the purpose of the present invention. For example, embryonic stem cells (ES cells); bone marrow, blood , Somatic stem cells present in skin (epidermis, dermis, subcutaneous tissue), fat, hair follicle, brain, nerve, liver, pancreas, kidney, muscle and other tissues; stem cells artificially produced by gene transfer or the like (Artificial pluripotent stem cells: iPS cells). Preferably, the agent for maintaining an undifferentiated state of stem cells or the agent for promoting proliferation according to the present invention exerts more effect on stem cells derived from bone marrow, blood, skin or adipose tissue. Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells established by culturing early embryos produced by nuclear transfer of nuclei of somatic cells, And ES cells obtained by modifying the genes on the chromosome of those ES cells using a genetic engineering technique. Such an ES cell can be produced, for example, by a method known per se, but it can be obtained from a predetermined institution, or a commercially available product can be purchased. Further, these stem cells may be any of primary culture cells, subculture cells or frozen cells.

  Further, the agent for maintaining an undifferentiated state of a stem cell or a growth promoter according to the present invention can be applied to all mammalian-derived stem cells as long as they have equivalent characteristics with respect to the direction of differentiation of stem cells and the process of differentiation. It is possible. For example, the agent for maintaining an undifferentiated state of stem cells or a growth promoter according to the present invention is a human stem cell of a mammal such as human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat, or pig. Can be effective against.

  The agent for maintaining an undifferentiated state of a stem cell or the growth promoter according to the present invention may be applied to a stem cell in vitro or in vivo, and in any case, the action can be exerted. Therefore, the agent for maintaining the undifferentiated state of stem cells or the growth promoter according to the present invention, by culturing the stem cells in a medium for stem cell culture added with an effective amount thereof, or by administering to mammals including humans , Can maintain the undifferentiated state of stem cells and promote proliferation.

    Stem cell undifferentiated state maintaining agent or growth promoting agent according to the present invention, since the extract of Fritillaria imperialis which is an active ingredient has excellent stem cell undifferentiated state maintaining action and growth promoting action, skin, osteoblast It is effective for treating, ameliorating, and preventing the damage or injury of the tissue or organ by acting on the stem cells of the tissue or organ in the body such as cartilage, muscle, nerve, fat and liver. Further, since stem cells decrease or function decline with age, the undifferentiated state maintenance agent or proliferation promoter of the stem cells according to the present invention is effective in reducing or reducing the function of stem cells in the above-mentioned tissues or organs in the living body. It is effective in treating, ameliorating and preventing related diseases. Here, damage or damage to tissues or organs, as diseases related to reduction or functional decline of stem cells, for example, in the skin-related, wrinkles, tarmi, spots, dullness, rough skin, thickening of skin, open pores, acne scars. , Wounds, scars, keloids and the like, and also includes damage to the scalp and hair such as thinning hair and hair loss. In bone-related cases, osteoporosis, fractures (vertebral compression fractures, femoral neck fractures, etc.), in cartilage diseases, osteoarthritis, rheumatoid arthritis, herniated discs, etc., in nerve-related areas, spinal cord injury, facial nerve paralysis. , Alzheimer's disease, amyotrophic lateral sclerosis, Parkinson's disease, memory loss with age, blood related aplastic anemia, leukemia, cardiovascular related myocardial infarction, arteriosclerosis obliterans, etc. In relation to periodontal disease, alveolar bone damage due to alveolar pyorrhea, in ophthalmology-related retinitis pigmentosa, age-related macular degeneration, glaucoma, etc., in liver-pancreas-related hepatitis, cirrhosis, diabetes, etc. Not limited to.

  The content of the extract of Fritillaria imperialis in the undifferentiated state maintenance agent or growth promoter of the stem cells according to the present invention is not particularly limited, depending on the properties of the extract (extract, concentrate, or dried product), For example, it can be appropriately set in the range of 0.00001 to 100% by weight, preferably 0.0001 to 10% by weight, and more preferably 0.001 to 1% by weight.

  The present invention also relates to a method for promoting stem cell growth while culturing stem cells in a medium containing an extract of Fritillaria imperialis, while maintaining the undifferentiated state of the stem cells. In other words, the method according to the present invention comprises a step of culturing stem cells in a medium containing an extract of Fritillaria imperialis, a method for producing stem cells, a method for maintaining an undifferentiated state of stem cells, or promotion of stem cell growth. It can be called a method.

  In the method according to the present invention, culture of stem cells may be carried out by using a medium generally used for maintaining and proliferating undifferentiated state of stem cells. For example, a basic medium containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, fatty acids) necessary for survival and proliferation of stem cells, specifically, Dulbecco's Modified Eagle Medium (D-MEM). ), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's Modified Medium Medium, Nut Medium Medium, Nutrient Medium Flute (12-D), D-Mem. Hank's balanced salt solution etc. are mentioned. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. Further, if necessary, the medium may be epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27. -Supplements, N2-supplements, ITS-supplements, antibiotics and the like may be contained.

  In addition to the above components, it is preferable that the medium contains serum at a content rate of 1 to 20%. However, since the components of serum differ depending on the lot, and the effect varies, it is preferable to use serum after lot checking.

  Commercially available media include mesenchymal stem cell basal medium made by Invitrogen, mesenchymal stem cell basal medium made by Sanko Junyaku, MF medium made by TOYOBO, and Hanks' solution made by Sigma (Hank's balanced salt solution). ) Etc. can be used.

  The incubator used for culturing the stem cells is not particularly limited as long as it can cultivate the stem cells, and examples thereof include a flask, a petri dish, a dish, a plate, a chamber slide, a tube, a tray, a culture bag, and a roller bottle. ..

  The incubator may be cell non-adhesive or adhesive and is appropriately selected according to the purpose. As the cell-adhesive incubator, one treated with a cell-supporting substrate such as an extracellular matrix may be used for the purpose of improving the adhesion to cells. Examples of the cell-supporting substrate include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, fibronectin and the like.

  The added concentration of the extract of Fritillaria imperialis to the medium used for stem cell culture is based on the content of the extract of Fritillaria imperialis in the undifferentiated state maintaining agent or growth promoter of the stem cells according to the present invention described above. Although it can be determined as appropriate, it may be, for example, a concentration of 10 to 10000 μg / mL, preferably 100 to 1000 μg / mL, in terms of the dry matter of the Fritillaria imperialis extract. Further, during the culture period of the stem cells, the extract of Fritilaria imperialis may be added to the medium on a regular basis.

The culture conditions of the stem cells may be the usual conditions used for culturing the stem cells, and no special control is required. For example, the culture temperature is not particularly limited, but is about 30 to 40 ° C, preferably 36 to 37 ° C. The CO ₂ gas concentration is, for example, about 1-10%, preferably about 2-5%. The medium is preferably exchanged once every 2 to 3 days, more preferably every day. The culturing conditions can be appropriately changed and set within a range in which the stem cells can survive and proliferate.

  The undifferentiated state maintenance of the stem cells is, for example, compared with the stem cells cultured in the absence of the undifferentiated state maintenance agent for the stem cells according to the present invention, cultured in the presence of the undifferentiated state maintenance agent for the stem cells according to the present invention. It can be evaluated whether the expression level of the stem cell undifferentiated marker gene is significantly maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture in the stem cells. Examples of the stem cell undifferentiated marker gene include Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embronic stem Jr. ..

  Examples of the method for measuring the expression level of the stem cell undifferentiated marker gene include, at the mRNA level, methods such as RT-PCR using primers and probes specific to the stem cell undifferentiated marker gene, quantitative PCR and Northern blotting. At the protein level, for example, immunological methods such as ELISA, flow cytometry, and Western blotting using an antibody specific to the protein encoded by the stem cell undifferentiation marker gene can be mentioned.

  As a result of the measurement of the expression level, the expression level of the stem cell undifferentiation marker gene in the stem cells at the start of culture (100% undifferentiated state) and the stem cells after culturing for a predetermined time in the presence of the agent for maintaining the undifferentiated state of the stem cells of the present invention When the relative ratio to the expression level of the stem cell undifferentiation marker gene is larger than the relative ratio (control) of the present invention when cultured in the absence of the agent for maintaining the undifferentiated state of the stem cell, the undifferentiated state of the stem cell is determined. It can be determined that it could be maintained.

  Further, the promotion of the proliferation of stem cells, for example, of the stem cells cultured in the presence of the growth promoting agent for stem cells of the present invention, as compared to the stem cells cultured in the absence of the growth promoting agent for stem cells of the present invention. It can be evaluated by whether or not the cell number is significantly increased. The cell number can be measured, for example, by the MTT method or the WST method using a commercially available cell number measurement kit. As a result of the measurement, the relative ratio between the number of stem cells at the start of culture and the number of stem cells after culturing for a predetermined period of time in the presence of the stem cell growth promoter of the present invention, is the non-proliferation factor of the stem cell growth promoter of the present invention. When the relative ratio (control) in the case of culturing in the presence is higher, it can be determined that the proliferation of stem cells could be promoted.

  The stem cells prepared by the method according to the present invention described above can be used as a transplant material (cell transplant) and can be carried out by the same method as conventional bone marrow transplant or cord blood transplant.

  According to the undifferentiated state maintenance agent or proliferation promoter of the stem cells according to the present invention or the method according to the present invention, an extract of Fritillaria imperialis, alone or separately from the medium or mixed with the medium, It can also be provided as a reagent kit for maintaining an undifferentiated state or promoting proliferation of stem cells. The kit can include an instruction manual and the like as necessary. Alternatively, the extract of Fritillaria imperialis can be mixed with a medium and provided as a medium for maintaining the undifferentiated state of stem cells or promoting proliferation.

  When the agent for maintaining the undifferentiated state of the stem cells or the growth promoter according to the present invention is administered in vivo, it is also possible to administer it as it is, together with appropriate additives within a range that does not impair the effects of the present invention. It can be provided by being mixed with various compositions such as cosmetics, quasi drugs, pharmaceuticals, foods and drinks. The drug of the present invention includes a drug used for animals, that is, a veterinary drug.

  When the undifferentiated state-maintaining agent for stem cells or the growth promoter according to the present invention is added to cosmetics or quasi drugs, the dosage form is an aqueous solution system, a solubilization system, an emulsion system, a powder system, a powder dispersion system, Any of an oil liquid system, a gel system, an ointment system, an aerosol system, a water-oil two-layer system, a water-oil-powder three-layer system and the like may be used. In addition, the cosmetics and quasi-drugs are selected from various components, additives, bases, etc., which are usually used in the composition for external use for skin, depending on the type thereof, together with the agent for maintaining the undifferentiated state of stem cells or the growth promoter. However, they can be appropriately compounded and produced according to a method known in the art. The form may be any of liquid, emulsion, cream, gel, paste, spray and the like. Examples of the components contained in the external composition for skin include fats and oils (olive oil, coconut oil, evening primrose oil, jojoba oil, castor oil, hydrogenated castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons ( Liquid paraffin, squalene, squalane, vaseline, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.) , Esters (isopropyl myristate, isopropyl palmitate, cetyl octanoate, glycerin trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citric acid, lactic acid, α-hydroxyacetic acid) Pyrrolidone carboxylic acid, etc.), sugars (maltitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and hydrolysates of proteins, amino acids and salts thereof, vitamins, plant / animal extract components, various Surfactants, humectants, ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, fragrances and the like can be mentioned.

  The types of cosmetics and quasi-drugs include, for example, lotion, milky lotion, gel, beauty essence, general cream, sunscreen cream, pack, mask, face wash, toilet soap, foundation, whitening agent, bath lotion, body lotion, Body shampoo, hair shampoo, hair conditioner, hair restorer and the like can be mentioned.

  When the agent for maintaining the undifferentiated state of stem cells or the growth promoter according to the present invention is added to a drug, it is mixed with a pharmacologically and pharmaceutically acceptable additive, and is suitable for application to the affected area. Can be formulated into various preparations. The pharmacologically and pharmaceutically acceptable additives include base materials for preparations, carriers, excipients, diluents, binders, lubricants, coatings, which are appropriately selected according to the dosage form and application. Agents, disintegrants or disintegration aids, stabilizers, preservatives, preservatives, extenders, dispersants, wetting agents, buffers, solubilizers or solubilizers, isotonic agents, pH adjusters, propellants , Coloring agents, sweeteners, corrigents, flavors and the like may be appropriately added to prepare various preparation forms that can be systemically or locally administered orally or parenterally by various known methods. When the pharmaceutical product of the present invention is provided in each of the above-mentioned forms, it can be produced by a production method usually used by those skilled in the art, for example, a production method shown in the general rules for formulation [2] formulation of the Japanese Pharmacopoeia.

  The form of the pharmaceutical composition of the present invention is not particularly limited, and examples thereof include tablets, sugar-coated tablets, capsules, troches, granules, powders, solutions, pills, emulsions, syrups, suspensions, and elixirs. Agents such as agents, injections (for example, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drops, suppositories, ointments, lotions, eye drops, sprays, A skin absorbent, a transmucosal absorbent, a parenteral agent such as a patch, and the like can be mentioned. Alternatively, it may be a dry product to be redissolved when used, and in the case of an injectable preparation, it is provided in a unit dose ampoule or a multi-dose container.

  An agent for maintaining an undifferentiated state of a stem cell according to the present invention or a growth promoter is a topical preparation suitable when used as a medicine for treating, ameliorating, and preventing the skin-related damages and diseases, for example, Examples include ointments, creams, gels, liquids, patches (patches, plasters), foams, sprays, sprays and the like. Ointment refers to a homogeneous semisolid external preparation, and includes oily and ointment, emulsion ointment and water-soluble ointment. The gel agent refers to an external preparation in which a water-insoluble component hydrate compound is suspended in an aqueous liquid. The liquid agent refers to a liquid external preparation, and includes lotions, suspensions, emulsions, liniments and the like.

  The pharmaceutical agent of the present invention functions as a prophylactic agent for suppressing the onset of the above-mentioned diseases and / or as a therapeutic agent for improving a normal condition. The active ingredient of the pharmaceutical agent of the present invention is derived from a natural product, and is highly safe and has no side effects. Therefore, when used as a pharmaceutical agent for treating, ameliorating, and preventing the above-mentioned diseases, human, mouse, rat, rabbit. It can be orally or parenterally administered in a wide range of doses to mammals such as dogs, cats and the like.

  The content of the agent for maintaining the undifferentiated state of stem cells or the growth promoter in the cosmetics, pharmaceuticals, and quasi-drugs of the present invention is not particularly limited, but the extract of Fritillaria imperialis relative to the total weight of the formulation (composition). It is preferably 0.001 to 30% by weight, more preferably 0.01 to 10% by weight in terms of the dried product. The above amount is merely an example, and may be appropriately set / adjusted in consideration of the type and form of the composition, a general amount used, efficacy, and the like. The method of adding the active ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

  Further, the agent for maintaining an undifferentiated state of stem cells or the agent for promoting proliferation according to the present invention can be incorporated into food and drink. Further, in the present invention, food and drink, in addition to general food and drink, foods that can be ingested for the purpose of maintaining or improving health other than pharmaceuticals, for example, health foods, functional foods, health functional foods, or special uses Used to include food. Healthy foods include foods provided under the names such as dietary supplements, dietary supplements, and supplements. Foods with health claims are defined by the Food Sanitation Act or Health Promotion Act, and can display the effects of specific health, the function of nutritional components, the reduction of disease risk, etc. based on scientific evidence Includes foods with functional claims that can show the contents notified to the Commissioner of Consumer Affairs Agency regarding the functionality. The special-purpose foods include foods for the sick, foods for the elderly, foods for infants, foods for pregnant women, and the like, which indicate that they are suitable for a specific target person or a patient having a specific disease. Here, indications such as specific health effects and functions of nutritional components attached to foods and beverages are displayed on products such as containers, packaging, instructions, attached documents, product leaflets and pamphlets, newspapers and magazines, etc. It can be an advertisement for the product.

  The form of the food or drink may be any form suitable for consumption such as solid, liquid, granular, granular, powder, capsule, cream or paste. In particular, the shape of the above-mentioned health food or the like includes, for example, tablets, rounds, capsules, powders, granules, fine granules, troches, liquids (including syrups, milks, and suspensions). Etc. are preferred.

  Types of food and drink include breads, noodles, confectionery, dairy products, processed fish and livestock products, oils and fats processed foods, seasonings, various beverages (soft drinks, carbonated drinks, beauty drinks, nutritional drinks, fruit drinks , Milk drinks, etc.), concentrated stock solutions of the drinks, adjustment powders, and the like, but are not limited thereto.

  The food or drink of the present invention may be appropriately blended with additives usually used depending on its type. As the additive, any additive that is acceptable under the Food Sanitation Law can be used, and for example, sweeteners such as glucose, sucrose, fructose, isomerized sugar, aspartame, stevia; citric acid, malic acid. Acidulants such as tartaric acid; excipients such as dextrin and starch; binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Examples include turbidity agents and preservatives.

When the food or drink of the present invention is a general food or drink, it can be manufactured by including a step of adding the extract of Fritillaria imperialis in the usual manufacturing process of the food or drink. Further, in the case of health food, it may be in accordance with the method for producing a pharmaceutical product described above.For example, in the case of a tablet-like supplement, additives such as an excipient are added to an extract of Fritilaria imperialis, mixed, and mixed. It can be manufactured by applying pressure with a tablet machine or the like and molding. In addition, other materials (for example, vitamins such as vitamin C, vitamin B ₂ , and vitamin B ₆ , minerals such as calcium, dietary fiber, etc.) can be added as necessary.

  The content of the extract of Fritillaria imperialis in the food and drink of the present invention may be an amount capable of exerting an undifferentiated state maintaining effect and a growth promoting effect of stem cells, but a general intake of the target food and drink, food and drink It may be appropriately set in consideration of the form of the product, efficacy / effect, taste, taste, cost, and the like.

  Hereinafter, the present invention will be described in more detail with reference to examples, but the technical scope of the present invention is not limited to these examples.

[Example 1] Example of production of extract of Fritillaria imperialis Hereinafter, an example of production of a solvent extract using Fritillaria imperialis will be shown.

(Production Example 1) Hot water extract of bulbs of Fritillaria imperialis To 30 g of dried bulbs of Fritillaria imperialis, 450 mL of purified water was added, and the mixture was extracted at 95 to 100 ° C for 1 hour, filtered, and the filtrate was concentrated. It was freeze-dried to obtain 3.2 g of a hot water extract of Fritillaria imperialis bulbs.

(Production Example 2) 50% ethanol extract of bulbs of Fritillaria imperialis To 30 g of dried bulbs of Fritillaria imperialis, 450 mL of 50 (v / v)% ethanol aqueous solution was added, and the mixture was extracted at room temperature for 7 days and then filtered. The filtrate was concentrated under reduced pressure and freeze-dried to obtain 3.3 g of a 50% ethanol extract of Fritillaria imperialis bulbs.

(Production Example 3) Ethanol extract of bulbs of Fritillaria imperialis To 30 g of dried bulbs of Fritillaria imperialis, 450 mL of ethanol was added, and the mixture was extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to give Fritillaria. -2.8 g of an ethanol extract of imperialis bulbs was obtained.

(Production Example 4) 50% 1,3-butylene glycol extract of Fritillaria imperialis To 400 g of 50 (v / v)% 1,3-butylene glycol aqueous solution was added to 20 g of dried bulbs of Fritillaria imperialis, and the mixture was kept at room temperature. After 7 days of extraction, the mixture was filtered to obtain 370 g of a 50% 1,3-butylene glycol extract of Fritilaria imperialis.

[Example 2] Evaluation of proliferation-promoting effect on stem cells and effect of maintaining undifferentiated state of an extract of Fritillaria imperialis [0115] Hereinafter, using the extract of Fritillaria imperialis produced in Example 1, promotion of proliferation on a stem cell was performed. An experimental example of the effect and an effect of maintaining an undifferentiated state and the result thereof are shown.

(Experimental Example 1) Evaluation of proliferation promoting effect on stem cells Human somatic stem cells (manufactured by DS Pharma Biomedical) cultivated using a human stem cell culture solution (manufactured by TOYOBO) were seeded on a 6 cm dish at 3 × 10 ⁵ cells and tested. A substance (Fritillaria imperialis extract of Production Examples 1 to 3) was added to a final concentration of 250 μg / mL, and the culture was continued for 3 days.

After culturing for 3 days, the cells were washed 3 times with PBS (-), collected with a rubber policeman, and the number of each cell was counted.
The increase / decrease (%) in the number of cells when the test substance was added was calculated by using the total number of cells when the test substance was not added as a control, and when the control was set to 100 (%), the stem cell proliferation promoting effect was evaluated.
The results of these tests are shown in Table 1 below.

  As shown in Table 1, the extract of Fritillaria imperialis showed a remarkable effect of promoting the proliferation of stem cells. The number of human somatic stem cells at the start of culture was 25% when the above control value was 100%. From the above, the extremely excellent stem cell growth promoting effect of the extract of Fritillaria imperialis was clarified. In addition to the stem cells used in this experimental example, when a similar test was performed on embryonic stem cells (ES cells), a remarkable stem cell growth promoting effect was observed.

(Experimental Example 2) Evaluation of effect of maintaining undifferentiated state on stem cells Dulbecco's Modified Eagle Medium medium (manufactured by Gibco), fetal bovine serum (FBS, 15%, manufactured by Sigma), nucleoside solution (100-fold diluted, Dainippon Pharmaceutical Co., Ltd., non-essential amino acid solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), β2-mercaptoethanol solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), L-glutamine solution (100-fold dilution, large) Mouse embryonic stem cells (mouse ES cells: manufactured by Cosmo Bio) using a medium prepared by adding Penicillin (100 unit / mL, manufactured by Sigma) and streptomycin (100 μg / mL, manufactured by Sigma), manufactured by Nippon Pharmaceutical Co., Ltd. ) Was seeded on a 6 cm dish coated with gelatin (manufactured by Sigma) at a concentration of 5 × 10 ⁵ and tested. The substance (Fritillaria imperialis extract of Production Examples 1 to 3) was added to the medium to a final concentration of 250 μg / mL, and the culture was continued for 3 days.

  After 3 days of culture, the cells were collected, washed twice with PBS (-), and RNA was extracted from the cells by Trizol Reagent (Invitrogen). After reverse transcribing the extracted RNA into cDNA using a 2-STEP real-time PCR kit (Applied Biosystems), ABI7300 (Applied Biosystems) was used to perform real-time PCR (95 ° C .: 15 seconds, 60 ° C.) using the following primer set. : 40 seconds for 30 seconds, and Nanog (undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional networks in embroidery technics. The gene expression was confirmed. Other operations were performed according to the prescribed method.

Primer set for Nanog (undifferentiated marker):
ATGCCTGCAGTTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)

The effect of maintaining the undifferentiated state was obtained by calculating the relative expression level of Nanog (Nanog gene expression level / Gapdh gene expression level) calculated as the ratio of the Nanog mRNA expression level in mouse ES cells at the start of culture to the expression level of Gapdh mRNA which is an internal standard. The value of (amount) was 100% in an undifferentiated state, and the value of the relative expression level of Nanog gene in ES cells after 3 days of culture was calculated and evaluated.
The results of these tests are shown in Table 2 below.

  As shown in Table 2, a remarkable effect of maintaining the undifferentiated state of the stem cells was observed in the extract of Fritillaria imperialis. In addition to the stem cells used in this experimental example, the same test was performed on somatic stem cells, and a remarkable effect of maintaining the undifferentiated state of the stem cells was observed.

  As shown in each of the above experimental examples, by applying the extract of Fritillaria imperialis to stem cells, compared to conventional techniques, the proliferation of stem cells can be performed easily and efficiently while maintaining an undifferentiated state. It became possible to promote.

[Example 3] Prescription example of product A prescription example of a product containing the extract of Fritilaria imperialis produced in Production Examples 1 to 4 is shown below.

(Prescription example 1) Lotion Prescription content (wt%)
1. Extract of Fritillaria imperialis 0.1
2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Perfume 0.1
11. Purified water Remaining amount

  Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, and then both are mixed and filtered to prepare a lotion.

(Prescription example 2) Cream Prescription content (wt%)
1. Extract of Fritillaria imperialis 0.1
2. Squalane 5.5
3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Perfume 0.1
11. Methyl paraoxybenzoate 0.2
12. Ethyl paraoxybenzoate 0.05
13.1,3-Butylene glycol 8.5
14. Purified water Remaining amount

  Ingredients 2 to 9 are melted by heating and mixed, and the mixture is kept at 70 ° C to form an oil phase. Ingredients 1 and 11 to 14 are heated to melt and mixed, and the mixture is kept at 75 ° C to form an aqueous phase. Next, the water phase is added to the oil phase to emulsify, and the mixture is cooled with stirring, component 10 is added at 45 ° C, and further cooled to 30 ° C to obtain a product.

(Prescription example 3) Emulsion
Prescription content (% by weight)
1. Extract of Fritillaria imperialis 0.1
2. Squalane 5.0
3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glycerin monostearate 2.0
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Polyoxyethylene sorbitan monooleate (20EO) 2.0
9. Perfume 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. Purified water Remaining amount

  Ingredients 2-8 are melted by heating and mixed, and the mixture is kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10 to 13 are dissolved by heating and mixed, and the mixture is kept at 75 ° C to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, the mixture is cooled with stirring, component 9 is added at 45 ° C, and the mixture is further cooled to 30 ° C to obtain a product.

(Prescription example 4) Gel formulation Prescription content (% by weight)
1. Extract of Fritillaria imperialis 0.1
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (20EO) 0.1
5. Fragrance suitable amount 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxy vinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Purified water Remaining amount

  Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and both are mixed to obtain a product.

(Prescription example 5) Ointment Prescription content (wt%)
1. Extract of Fritillaria imperialis 2.0
2. Polyoxyethylene cetyl ether (30EO) 2.0
3. Glycerin monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. Purified water Remaining amount

  Ingredients 2 to 5 are melted by heating and mixed, and the mixture is kept at 70 ° C to form an oil phase. Ingredients 1 and 6 to 8 are dissolved by heating and mixed, and the mixture is kept at 75 ° C to form an aqueous phase. The water phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C while stirring.

(Prescription example 6) Pack
Prescription content (% by weight)
1. Extract of Fritillaria imperialis 0.1
2. Polyvinyl alcohol 12.0
3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Fragrance suitable amount 10. Purified water Remaining amount

  Components 1 to 10 are uniformly dissolved to obtain a product.

(Prescription example 7) Tablet Prescription content (% by weight)
1. Extract of Fritillaria imperialis 1.0
2. Dried cornstarch 25.0
3. Carboxymethyl cellulose calcium 20.0
4. Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0

  Components 1 to 5 are mixed, then 10% water is added as a binder, extruded, granulated and dried. Ingredient 6 is added to the formed granules, mixed and compressed into tablets. One tablet is 0.52g.

(Prescription example 8) Beverage Prescription Content (% by weight)
1. Extract of Fritillaria imperialis 0.1
2. Stevia 0.05
3. Malic acid 5.0
4. Perfume 0.1
5. Purified water Remaining amount

  Components 1 to 4 are dissolved in a part of purified water of component 5 with stirring. Then, the remaining purified water of the component 5 is added and mixed, heated to 90 ° C. and filled in a 50 mL glass bottle.

As an application example of the present invention, application to regenerative medicine and rejuvenating beauty is expected. For example, by utilizing the present invention, it becomes possible to simply and efficiently prepare undifferentiated stem cells used for regenerative medicine and cosmetic treatment. Further, to stem cells present after transplantation of stem cells or in tissues, the extract of Fritillaria imperialis according to the present invention is directly infused or orally administered, applied, applied by application, etc. Stem cells can be proliferated while maintaining an undifferentiated state.
That is, the present invention can be used as a method for producing stem cells and / or an agent for maintaining an undifferentiated state of stem cells or a growth promoter in regenerative medicine and rejuvenation.

Claims (5)

  An agent for maintaining an undifferentiated state of embryonic stem cells, which contains an extract of bulbs of Fritillaria imperialis as an active ingredient.   An agent for promoting the growth of embryonic stem cells, which contains an extract of bulbs of Fritillaria imperialis as an active ingredient. A method for producing an embryonic stem cell, comprising the step of culturing the embryonic stem cell in a medium containing an extract of a bulb of Fritillaria imperialis.   A method for maintaining an undifferentiated state of embryonic stem cells, comprising the step of culturing the embryonic stem cells in a medium containing an extract of bulbs of Fritillaria imperialis. A method for promoting the growth of embryonic stem cells, comprising the step of culturing the embryonic stem cells in a medium containing an extract of bulbs of Fritillaria imperialis.