JP6843425B2 - Stem cell undifferentiated state maintainer and growth promoter - Google Patents

Description

The present invention relates to an agent for maintaining an undifferentiated state of stem cells and an agent for promoting proliferation, and a method for maintaining an undifferentiated state of stem cells and a method for promoting proliferation.

In vertebrate (especially mammal) tissues, when cell / organ damage occurs due to injury or disease, aging, etc., the regenerative system works to recover the cell / organ damage. Stem cells (tissue stem cells, somatic stem cells, adult stem cells) provided in the tissue play a major role in this action. Stem cells have the pluripotency to differentiate into all cells and organs, and it is thought that this property leads to recovery by compensating for damaged parts of cells and organs. Expectations are high for regenerative medicine, which is a next-generation medical treatment that applies such stem cells.

The most advanced tissue in stem cell research in mammals is the bone marrow. It has been clarified that hematopoietic stem cells of the living body are present in the bone marrow and are the source of all blood cell regeneration. Further, it has been reported that bone marrow contains stem cells capable of differentiating into organs and tissues (for example, bone, cartilage, muscle, fat, etc.) in addition to hematopoietic stem cells (see Non-Patent Document 1).

Furthermore, in recent years, it has been clarified that stem cells exist in all organs and tissues such as skin, liver, pancreas, and fat in addition to bone marrow, and it is responsible for the regeneration and maintenance of homeostasis of each organ and tissue. It has become clear (see Non-Patent Documents 2 to 5). In addition, the stem cells existing in each organ or tissue have excellent plasticity, and may be used for regeneration of organs or tissues that could not be self-replicating until now.

On the other hand, some of these stem cells are known to decrease with age, and research is being actively conducted on techniques to prevent the decrease of stem cells in order to maintain homeostasis of each tissue (). Non-Patent Document 6). In recent years, in order to apply the ability (pluripotency) of stem cells to the regeneration of organs and tissues, stem cells are cultured after being separated from living tissues in the fields of cell transplantation therapy and tissue engineering (regenerative medicine and regenerative beauty). Development of a technique for breeding is underway (Non-Patent Documents 7 and 8).

In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency of the stem cells, that is, the undifferentiated state. If the undifferentiated state of the stem cells cannot be maintained during this culture and the differentiation induction progresses, the ability (pluripotency) of the finally prepared stem cells is lost, and the desired effect (the desired effect (pluripotency) is lost. Regeneration of organs and tissues, etc.) cannot be demonstrated.

From the above, when stem cells are used for cell transplantation therapy and tissue engineering (regenerative medicine and regenerative beauty) and the regeneration of organs and tissues is desired, the stem cells must be able to be cultured while maintaining an undifferentiated state.

To date, there have been several reports on techniques for growing stem cells while maintaining their undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culturing with supporting cells (stromal cells or feeder cells) (see Patent Document 1 and Non-Patent Documents 9 to 11). ). However, recently, cases of infection between heterologous animals by endogenous viruses derived from feeder cells have been reported (see Non-Patent Document 12), and culturing of stem cells using supporting cells is a stem cell for medical purposes. Not suitable for culturing.

Another method is to maintain the undifferentiated state of stem cells by combining cytokines in a complex manner. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 13). In addition, maintaining undifferentiated status in the presence of the early-acting cytokine thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF) is an embryonic stem cell. It has been reported in somatic stem cells and the like (see Patent Document 3 and Non-Patent Document 14).

However, cytokines are expensive, have problems such as raw materials for collection and storage stability, and are difficult to use easily. In addition, it was clarified that the effect of LIF is extremely limited to a specific cell lineage, and that the undifferentiated state cannot be maintained by adding LIF alone, especially in primatological ES cells and somatic stem cells. (See Non-Patent Document 10).

As described above, all of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations, and the effect of maintaining the undifferentiated state is low. Therefore, in order to utilize stem cells for regenerative medicine, there has been a demand for a technique for proliferating stem cells while maintaining an undifferentiated state. That is, there has been a demand for a technique capable of proliferating stem cells safely, easily and efficiently while maintaining an undifferentiated state.

Tribulus terrestris Linne (scientific name: Tribulus terrestris Linne) is a perennial plant belonging to the genus Puncture vine of the family Caltropaceae. It is used in Chinese herbal medicines that have detoxification, antihypertensive, and sedative effects. Tribulus terrestris (Tribulus terrestris) has also been reported to have an elastase activity inhibitory action (Patent Document 4), a periodontal tissue regeneration promoting action (Patent Document 5), and the like, alone or in combination with other plant extracts. .. Siler (scientific name: Saposhnikovia divaricata Schischkin) is a perennial plant belonging to the genus Siler of the Umbelliferae family. It is used in Chinese herbal medicines that have anti-inflammatory and analgesic effects. It has been reported that Siler (windproof) has an anti-obesity effect (Patent Document 6), a moisturizing effect (Patent Document 7), and the like, alone or in combination with other plant extracts. Rehmannia glutinosa Liboschitz var. Purpurea (scientific name: Rehmannia glutinosa Liboschitz var. Purpurea) is a perennial plant belonging to the genus Rehmannia glutinosa. It is used in Chinese herbal medicines that have actions such as blood supplementation, tonicity, and hemostasis. It has also been reported that Rehmannia glutinosa (Rehmannia glutinosa) has a type IV collagen production promoting action (Patent Document 8), a hair growth effect by promoting hair growth cytokine production (Patent Document 9), etc., alone or in combination with other plant extracts. Has been done. However, nothing has been known so far about the effect of promoting the proliferation of stem cells of Tribulus terrestris, Siler, and Rehmannia glutinosa and the effect of maintaining an undifferentiated state.

Japanese Unexamined Patent Publication No. 2004-24089 Special Table 2002-525402A Japanese Patent No. 35733554 Japanese Unexamined Patent Publication No. 2002-363088 International Publication No. 2008/099853 Japanese Unexamined Patent Publication No. 11-13586 Japanese Unexamined Patent Publication No. 2006-342067 Japanese Unexamined Patent Publication No. 2009-298723 Japanese Unexamined Patent Publication No. 2013-21039

Pittenger M. et al. F. Et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M. A. Et al., Nat. Med. , 1997, Vol. 3, pp. 1337-1345 Zulewski H. Et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. Et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P. A. Et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Yasushi Hasegawa, Aesthetic Dermatology, 2013, Vol. 23, pp. 1-11 Hiroshi Mabuchi et al., Journal of the Japanese Society of Regenerative Medicine, 2007, Vol. 6, pp. 263-268 Zen Kitagawa et al., Journal of the Japanese Society of Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomason J. A. Et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7884 Thomason J. A. Et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B. E. Et al., Nature Biotechnology. , 2000, Vol. 18, pp. 399-404 van der Laan L. J. Et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A. G. Et al., Dev. Biol. , 1987, Vol. 121, pp. 1-9 Madlambayan G.M. J. Et al., J. Hematother. Stem Cell Res. , 2001, Vol. 10, pp. 481-492

In view of the above-mentioned circumstances, the present invention finds a new substance capable of efficiently proliferating stem cells while maintaining the undifferentiated state, and provides the stem cells as an undifferentiated state maintaining agent or a growth promoting agent. Is the subject.

As a result of diligent research to solve the above problems, the present inventors have found that one or more plant extracts selected from Tribulus terrestris, Siler, and Rehmannia glutinosa are previously unknown stem cells. The present invention has been completed by finding that it has an excellent effect of maintaining an undifferentiated state and an effect of promoting proliferation.

That is, the present invention includes the following.
(1) An agent for maintaining an undifferentiated state of stem cells, which contains an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa as an active ingredient.
(2) A stem cell growth-promoting agent containing an extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa as an active ingredient.
(3) A method for producing stem cells, which comprises a step of culturing stem cells in a medium containing an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Akayaziou.
(4) A method for maintaining an undifferentiated state of stem cells, which comprises a step of culturing the stem cells in a medium containing an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Akayajiou.
(5) A method for promoting proliferation of stem cells, which comprises a step of culturing stem cells in a medium containing an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa.

According to the present invention, stem cells can be efficiently proliferated while maintaining an undifferentiated state. Therefore, the present invention can make a great contribution in the fields of regenerative medicine and regenerative cosmetology.

Hereinafter, the present invention will be described in detail.
The undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention contains an extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa as an active ingredient.

Tribulus terrestris Linne (scientific name: Tribulus terrestris Linne) used in the present invention is a perennial plant belonging to the genus Tribulus of the family Caltropaceae (Zygophyllaceae), and is the base plant of the crude drug "Siturishi" (Japanese name: Shuriko, scientific name: Tribuli Fructus). Is. The Tribulus terrestris used in the present invention may be a plant of the same genus or a closely related plant, and may be produced in any place. In the present invention, the extract of Hamabishi is an extract of a part of a plant such as leaves, stems, fruits, pericarp, flowers, flower buds, seeds, whole plants, roots, rhizomes, the whole plant, or a mixture thereof. However, in the present invention, the site used as an extraction raw material is preferably a fruit used as a crude drug "Rhizome", particularly an immature fruit.

Siler (scientific name: Saposhnikovia divaricata Schischkin) used in the present invention is a perennial plant belonging to the genus Saposhnikovia of the Umbelliferae family, and is the base plant of the crude drug "Siler" (Japanese name: windbreak, scientific name: Saposhnikoviae Radix). is there. The Siler used in the present invention may be a plant of the same genus or a closely related plant, and may be produced in any place. In the present invention, the extract of Siler is an extract of a part of a plant such as leaves, stems, fruits, peels, flowers, flower buds, seeds, whole plants, roots, rhizomes, the whole plant, or a mixture thereof. However, in the present invention, the part used as the extraction raw material is preferably the root used as the crude drug "Siler (windproof)".

Rehmannia glutinosa Liboschitz var. Purpurea (scientific name: Rehmannia glutinosa Liboschitz var. Purpurea) is a perennial plant belonging to the genus Rehmannia of the figwort family (Scrophulariaceae) It is a protozoan. The Rehmannia glutinosa used in the present invention may be a plant of the same genus or related plants (for example, Rehmannia glutinosa Liboschitz var. Hueichingensis), and may be produced in any place. In the present invention, the extract of Rehmannia glutinosa is an extract of a part of a plant such as leaves, stems, fruits, peels, flowers, flower buds, seeds, whole plants, roots, rhizomes, the whole plant, or a mixture thereof. However, in the present invention, the part used as the extraction raw material is preferably the root used as the crude drug "Gio".

For the extraction of Tribulus terrestris, Siler, and Rehmannia glutinosa, the above-mentioned extraction materials may be used as they are, or may be subjected to treatments such as drying, crushing, and shredding.

The extraction method of the extracts from Tribulus terrestris, Siler, and Rehmannia glutinosa is not particularly limited, and may be, for example, a heat extraction method or a normal temperature or cold temperature extraction method. Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol). , Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, etc.) , Propyl ether, etc.) and the like. Water, lower alcohols and liquid polyhydric alcohols are preferable, and water and ethanol are particularly preferable. These solvents may be used alone or in admixture of two or more, and for example, an aqueous ethanol solution of 30 to 70 v / v% can be used. It is also possible to use a solvent whose pH is adjusted by adding an acid or an alkali to the above extraction solvent.

Tribulus terrestris, Siler, and Rehmannia glutinosa are subjected to solvent extraction using the above-mentioned solvents. The ratio of Tribulus terrestris, Siler, and Rehmannia glutinosa to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, extracts of Tribulus terrestris, Siler, and Rehmannia glutinosa can be obtained by adding water to the unripe fruit of Tribulus terrestris, the root of Siler, and the dried product of the root of Rehmannia glutinosa and performing hot water extraction at 95 to 100 ° C. Alternatively, lower alcohol (eg, ethanol, etc.) or liquid polyhydric alcohol (eg, propylene glycol, 1,3-butylene glycol, etc.) is added to the dried fruits of Tribulus terrestris, Siler root, and Akayaziou root, and at room temperature. Extracts of Tribulus terrestris, Siler, and Akayaziou can be obtained by performing extraction at (for example, 5 to 35 ° C.).

After solvent extraction, the obtained solvent phase itself can be used as an extract of Tribulus terrestris, Siler, and Rehmannia glutinosa. Alternatively, if necessary, the obtained solvent phase was subjected to treatments such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, drying, etc., and decolorization, deodorization treatment, etc. with activated carbon, etc. The product can be an extract of Tribulus terrestris, Siler, and Akayajiou. In particular, it is preferable that the extracted solution is subjected to treatments such as concentrated drying, spray drying, freeze-drying, etc., and the obtained dried product is used as an extract of Tribulus terrestris, Siler, and Rehmannia glutinosa.

The extracts of Tribulus terrestris, Siler, and Rehmannia glutinosa thus obtained have the effect of efficiently proliferating stem cells while maintaining the undifferentiated state at the biological level or the culture level, and thus maintain the undifferentiated state of the stem cells. It can be used as an agent or a growth promoter. One type of extract of Tribulus terrestris, Siler, and Rehmannia glutinosa may be used, but it is preferable to use two or three types in combination because the effect of maintaining the undifferentiated state of stem cells and the effect of promoting proliferation are enhanced. When two or three kinds of extracts of Tribulus terrestris, Siler, and Rehmannia glutinosa are used in combination, the combination and mixing ratio are not limited. Furthermore, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is also used as a medium additive for stem cell culture and a research reagent for efficiently proliferating stem cells while maintaining the undifferentiated state. be able to.

By applying the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention to mammalian stem cells including humans, it is possible to maintain the undifferentiated state of stem cells and promote the growth of stem cells. .. The stem cells to which the undifferentiated state-maintaining agent or growth-promoting agent of the stem cells according to the present invention are applied are not particularly limited as long as they meet the object of the present invention, for example, embryonic stem cells (ES cells); bone marrow, blood. , Somatic stem cells present in skin (epidermal, dermal, subcutaneous tissue), fat, hair follicles, brain, nerves, liver, pancreas, kidneys, muscles and other tissues; stem cells artificially produced by gene transfer, etc. (Artificial pluripotent stem cells: iPS cells). Preferably, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention exerts more effect on stem cells derived from bone marrow, blood, skin or adipose tissue. For example, hematopoietic stem cells are mentioned as stem cells derived from bone marrow, and in the present invention, "hematopoietic stem cells" include pluripotent myeloid stem cells and pluripotent lymphoid stem cells, and myeloid cells (erythrocytes, platelets, eosinophils). , Stem cells, neutrophils, monospheres, etc.) and cells capable of differentiating into lymphoid cells (B cells, T cells, NK cells, etc.). Hematopoietic stem cells are characterized by being positive for the CD34 antigen and negative for the CD38 antigen (CD34 + CD38-). Examples of ES cells include ES cells established by culturing early embryos before implantation, and ES cells established by culturing early embryos prepared by nuclear transplantation of somatic cell nuclei. And ES cells in which genes on the chromosomes of those ES cells are modified by using genetic engineering techniques. Such ES cells can be produced, for example, by a method known per se, but can be obtained from a predetermined institution, and a commercially available product can also be purchased. In addition, these stem cells may be either primary cultured cells, subcultured cells, or frozen cells.

Furthermore, the undifferentiated state-maintaining agent or proliferation-promoting agent for stem cells according to the present invention can be applied to stem cells derived from all mammals as long as they have the same characteristics regarding the direction of stem cell differentiation and the process of differentiation. It is possible. For example, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is a mammalian stem cell such as human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat, or pig. Can be effective against.

The application of the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention to stem cells may be in vitro or in vivo, and in either case, the action can be exerted. Therefore, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention can be administered by culturing stem cells in a stem cell culture medium to which an effective amount thereof has been added, or by administering to mammals including humans. , Can maintain the undifferentiated state of stem cells and promote proliferation.

The undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is an undifferentiated state of stem cells in which one or more plant extracts selected from the active ingredients Hamabishi, Bowfu, and Akayajiou are excellent. Since it has a maintenance effect and a growth promoting effect, it acts on stem cells of tissues or organs in the living body such as skin, osteoblasts, cartilage, muscles, nerves, fats, and livers to treat and improve disorders or damages of the tissues or organs. , And is effective in preventing. In addition, since stem cells decrease or decrease in function with aging, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention causes the decrease or function of stem cells in the above-mentioned tissues or organs in the living body. It is effective in treating, ameliorating, and preventing related diseases. Here, as diseases related to tissue or organ damage or damage, reduction of stem cells or functional deterioration, for example, in the case of skin, wrinkles, tarmi, stains, dullness, rough skin, thickening of the skin, open pores, acne scars, etc. , Wounds, scars, keloids, etc., and also includes scalp and hair damage such as thinning hair and hair loss. In addition, osteoporosis and fractures (spine compression fractures, femoral neck fractures, etc.) are involved in bone-related diseases, and periodontal disease, rheumatoid arthritis, and disc hernia are involved in cartilage diseases. Spinal cord injury and facial nerve palsy are involved in nerve-related diseases. , Alzheimer's disease, muscular atrophic lateral sclerosis, Parkinson's disease, age-related memory loss, etc., blood-related, regenerative anemia, leukemia, etc., cardiovascular-related, myocardial infarction, obstructive arteriosclerosis, etc. Related items include periodontal disease and alveolar bone damage due to alveolar pyorrhea, ophthalmology-related items include retinal pigment degeneration, age-related yellow spot degeneration, and glaucoma, and liver / pancreas-related items include hepatitis, liver cirrhosis, and diabetes. Not limited to.

In addition, extracts of one or more species of plants selected from Tribulus terrestris, Bofu, and Akayajiou have hematopoietic stem cell proliferation promoting action and undifferentiated state maintaining action, and are therefore associated with a decrease or functional decline of hematopoietic stem cells. It is effective as a drug for treating, ameliorating, and preventing diseases or pathological conditions of blood and hematopoietic organs. Here, as the diseases or pathological conditions of blood and hematopoietic organs related to the decrease or functional deterioration of hematopoietic stem cells, for example, iron deficiency anemia, giant erythroblastic anemia, hemolytic anemia, erythroblastemia, aplastic anemia, etc. Anemia, congenital anemia (eg, sickle erythrocytosis), paroxysmal nocturnal pigmenturia, secondary anemia (anemia associated with infectious diseases, malignant tumors, chronic diseases, renal diseases, liver diseases, endocrine diseases, etc.), Leukemia, myelodysplastic syndrome, malignant lymphoma, multiple myeloma, myeloid proliferative disorders (true polyemia, essential thromboemia, myeloid fibrosis, etc.), idiopathic thrombocytopenic purpura, autoimmune hemolytic disease In addition to anemia, general anemia conditions (movement, shortness of breath, dizziness, dizziness, dizziness, aplastic anemia, easy fatigue, malaise, loss of appetite, nausea, headache, pale face, skin stains and bears, ringing in the ears, stiff shoulders, etc. (Mouth hornitis, etc.), but are not limited to these. In addition, "decrease or functional decline of hematopoietic stem cells" includes not only those caused by the above-mentioned diseases but also those caused by administration of anticancer agents and immunosuppressive agents, and radiotherapy for cancer.

The content of one or more plant extracts selected from Tribulus terrestris, Siler, and Rehmannia glutinosa in the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is not particularly limited, but the extract is not particularly limited. Depending on the properties (extract, concentrate, or dried product), for example, it can be appropriately set in the range of 0.00001 to 100% by weight, preferably 0.0001 to 10% by weight, preferably 0.001 to 1% by weight. Is more preferable.

The present invention also maintains the undifferentiated state of the stem cells by culturing the stem cells in a medium containing an extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa. It relates to a method for promoting stem cell proliferation. In other words, the method according to the present invention comprises a step of culturing stem cells in a medium containing an extract of one or more plants selected from Tribulus terrestris, Siler, and Akayaziou. , A method for maintaining an undifferentiated state of stem cells, or a method for promoting proliferation of stem cells.

In the method according to the present invention, for culturing stem cells, a medium generally used for maintaining and proliferating the undifferentiated state of stem cells may be used. For example, a basal medium containing components necessary for stem cell survival and proliferation (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, fatty acids), specifically Dulvecco's Modified Eagle Medium (D-MEM). ), Minimum Essential Medium (MEM), RPMI 1640, Basic Medium Eagle (BME), Dulvecco's Modern Eagle's Medium: Natural MinigemeMideMedium (D-MEM) Hank's balanced salt solution and the like can be mentioned. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. In addition, if desired, the medium is epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferase, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27. -Supplement, N2-supplement, ITS-supplement, antibiotics, etc. may be contained.

In addition to the above components, it is preferable that serum is contained in the medium at a content of 1 to 20%. However, since the components of serum differ depending on the lot and the effect varies, it is preferable to use the serum after performing a lot check.

Commercially available media include Invitrogen's mesenchymal stem cell basal medium, Sanko Pure Chemical's mesenchymal stem cell basal medium, TOYOBO's MF medium, and Sigma's Hanks solution (Hank's balanced salt solution). ) Etc. can be used.

The incubator used for culturing stem cells is not particularly limited as long as it can cultivate stem cells, and examples thereof include flasks, petri dishes, dishes, plates, chamber slides, tubes, trays, culture bags, and roller bottles. ..

The incubator may be cell non-adhesive or adhesive, and is appropriately selected depending on the intended purpose. As the cell adhesion incubator, one treated with a cell support substrate or the like using an extracellular matrix or the like may be used for the purpose of improving the adhesion to cells. Examples of the cell support substrate include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, fibronectin and the like.

The addition concentration of one or more plant extracts selected from Tribulus terrestris, Siler, and Rehmannia glutinosa to the medium used for stem cell culture is the above-mentioned undifferentiated state-maintaining agent or growth promoting of stem cells according to the present invention. It can be appropriately determined according to the content of the extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa in the agent, but one species or one selected from Tribulus terrestris, Siler, and Rehmannia glutinosa. In terms of a dried product of extracts of two or more kinds of plants, for example, a concentration of 10 to 10000 μg / mL, preferably 100 to 5000 μg / mL can be mentioned. In addition, these extracts may be added to the medium on a regular basis during the stem cell culture period.

The stem cell culture conditions may follow the usual conditions used for stem cell culture, and no special control is required. For example, the culture temperature is not particularly limited, but is about 30 to 40 ° C, preferably 36 to 37 ° C. The CO ₂ gas concentration is, for example, about 1-10%, preferably about 2-5%. The medium is preferably changed once every 2 to 3 days, and more preferably every day. The culture conditions can be appropriately varied and set within a range in which stem cells can survive and proliferate.

For maintaining the undifferentiated state of stem cells, for example, the stem cells are cultured in the presence of the undifferentiated state maintaining agent of the stem cells according to the present invention, as compared with the stem cells cultured in the absence of the undifferentiated state maintaining agent of the stem cells according to the present invention. It can be evaluated whether or not the expression level of the stem cell undifferentiated marker gene is significantly maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture in the stem cells. Examples of the stem cell undifferentiated marker gene include the Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transcriptional network, Embryonic stem Cell Group, etc. ..

Examples of the method for measuring the expression level of the stem cell undifferentiated marker gene include RT-PCR using primers and probes specific for the stem cell undifferentiated marker gene, quantitative PCR, Northern blotting, and the like at the mRNA level. At the protein level, examples thereof include immunological methods such as ELISA, flow cytometry, and Western blotting using an antibody specific for a protein encoded by a stem cell undifferentiated marker gene.

As a result of measuring the expression level, the expression level of the stem cell undifferentiated marker gene in the stem cell at the start of culturing (100% undifferentiated state) and the stem cell after culturing for a predetermined time in the presence of the undifferentiated state maintaining agent of the stem cell of the present invention. When the relative ratio to the expression level of the stem cell undifferentiated marker gene is larger than the relative ratio (control) when the stem cell of the present invention is cultured in the absence of the undifferentiated state maintaining agent, the undifferentiated state of the stem cell is defined. It can be determined that the maintenance was possible.

Further, the promotion of stem cell proliferation is carried out, for example, as compared with the stem cells cultured in the absence of the stem cell proliferation promoter according to the present invention, the stem cells cultured in the presence of the stem cell proliferation promoter according to the present invention. It can be evaluated by whether or not the number of cells is significantly increased. The cell number can be measured by using a commercially available cell number measurement kit by, for example, the MTT method or the WST method. As a result of the measurement, the relative ratio between the number of stem cells at the start of culturing and the number of stem cells after culturing for a predetermined time in the presence of the stem cell growth promoter of the present invention is not the stem cell growth promoter of the present invention. When it is larger than the same relative ratio (control) when cultured in the presence, it can be determined that the proliferation of stem cells could be promoted.

The stem cells prepared by the above method according to the present invention can be used as a transplant material (cell transplant agent), and can be carried out by the same method as conventional bone marrow transplantation or cord blood transplantation.

An extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa according to the above-mentioned undifferentiated state-maintaining agent or growth promoter of stem cells according to the present invention or the method according to the present invention. It can also be provided alone or separately from the medium or mixed with the medium as a reagent kit for maintaining the undifferentiated state of stem cells or promoting proliferation. The kit may include an instruction manual or the like, if necessary. Alternatively, an extract of one or more plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa can be mixed with a medium and provided as a medium for maintaining an undifferentiated state of stem cells or promoting proliferation.

When the above-mentioned undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is administered in vivo, it can be administered as it is, but together with an appropriate additive as long as the effect of the present invention is not impaired. It can be blended and provided in various compositions such as cosmetics, quasi-drugs, pharmaceuticals, and foods and drinks. The pharmaceutical product of the present invention also includes a drug used for animals, that is, a veterinary drug.

When the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is blended in cosmetics or non-pharmaceutical products, the dosage form is an aqueous solution system, a solubilization system, an emulsification system, a powder system, a powder dispersion system, It may be any of oil-liquid type, gel type, ointment type, aerosol type, water-oil two-layer system, water-oil-powder three-layer system and the like. In addition, for the cosmetics and quasi-drugs, various components, additives, bases and the like usually used in the external composition for skin are selected according to the type, together with the undifferentiated state maintaining agent or growth promoting agent for stem cells. However, it can be appropriately blended and produced according to a method known in the art. The form may be any of liquid, emulsion, cream, gel, paste, spray and the like. Examples of the components of the composition for external use on the skin include fats and oils (olive oil, palm oil, evening primrose oil, jojoba oil, castor oil, hardened castor oil, etc.), waxes (lanolin, honeybee, carnauba wax, etc.), and hydrocarbons (carnauba wax, etc.). Liquid paraffin, squalane, squalane, vaseline, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.) , Esters (isopropyl myristate, isopropyl palmitate, cetyl octanoate, glycerin trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citrate, lactic acid, α-hydroxyacetic acid, pyrrolidone carboxylic acid) Acids, etc.), sugars (martitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and hydrolyzates of proteins, amino acids and their salts, vitamins, plant / animal extracts, various surface activities Examples include agents, moisturizers, ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, fragrances and the like.

Types of cosmetics and non-pharmaceutical products include, for example, lotion, milky lotion, gel, beauty essence, general cream, sunscreen cream, facial mask, mask, face wash, cosmetic soap, foundation, face powder, bathing agent, body lotion, etc. Examples include body shampoos, hair shampoos, hair conditioners, and hair restorers.

When the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention is blended with a pharmaceutical product, it is mixed with a pharmacologically and pharmaceutically acceptable additive and is suitable for application to an affected area. Can be formulated into various formulations of. Pharmacologically and pharmaceutically acceptable additives include formulation substrates and carriers, excipients, diluents, binders, preservatives, and coatings that are appropriately selected according to the dosage form and application. Agents, disintegrants or disintegrants, stabilizers, preservatives, preservatives, bulking agents, dispersants, wetting agents, buffers, solubilizers or solubilizers, isotonic agents, pH regulators, propellants , Coloring agents, sweeteners, flavoring agents, fragrances and the like may be appropriately added to prepare various formulations that can be orally or parenterally administered systemically or topically by various known methods. When the pharmaceutical product of the present invention is provided in each of the above forms, it can be produced by a manufacturing method usually used by those skilled in the art, for example, the manufacturing method shown in each article of the general formulation [2] formulation of the Japanese Pharmacopoeia.

The form of the pharmaceutical product of the present invention is not particularly limited, but for example, tablets, sugar-coated tablets, capsules, troches, granules, powders, liquids, pills, emulsions, syrups, suspending agents, and elixirs. Oral agents such as drugs, injections (for example, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), infusions, suppositories, ointments, lotions, eye drops, sprays, trans. Examples include parenteral agents such as skin absorbents, transmucosal absorbents, and patches. It may also be a dry product that is redissolved upon use, and in the case of injectable formulations, it is provided in the form of unit dose ampoules or multidose containers.

A suitable form for using the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention as a pharmaceutical product for treating, ameliorating, or preventing the skin-related damage or disease is an external preparation, for example. Examples include ointments, creams, gels, liquids, patches (pups, plasters), foams, sprays, sprays and the like. The ointment refers to a homogeneous semi-solid external preparation, and includes an oily ointment, an emulsion ointment, and a water-soluble ointment. A gel agent refers to an external preparation in which a water-holding compound, which is a water-insoluble component, is suspended in an aqueous solution. The liquid agent refers to a liquid external preparation, and includes a lotion agent, a suspension agent, an emulsion, a liniment agent, and the like.

The pharmaceutical product of the present invention functions as a preventive agent for suppressing the onset of the above-mentioned diseases and / or as a therapeutic agent for improving a normal state. Since the active ingredient of the pharmaceutical product of the present invention is derived from a natural product, it is extremely safe and has no side effects. Therefore, when it is used as a therapeutic, ameliorating, or preventive drug for the above-mentioned diseases, humans, mice, rats, and rabbits. , Dogs, cats and other mammals can be administered orally or parenterally in a wide range of doses.

The content of the undifferentiated state-maintaining agent or growth-promoting agent for stem cells in the cosmetics, pharmaceuticals, and quasi-drugs of the present invention is not particularly limited, but from Tribulus terrestris, Siler, and Rehmannia glutinosa with respect to the total weight of the preparation (composition). In terms of a dried product of one or more selected plant extracts, 0.001 to 30% by weight is preferable, and 0.01 to 10% by weight is more preferable. The above amounts are merely examples, and may be appropriately set and adjusted in consideration of the type and form of the composition, general usage amount, efficacy / effect, and the like. Further, the method of adding the active ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

In addition, the undifferentiated state-maintaining agent or growth-promoting agent for stem cells according to the present invention can also be blended in foods and drinks. Further, in the present invention, the food and drink are not only general foods and drinks but also foods other than pharmaceuticals that can be ingested for the purpose of maintaining or improving health, such as health foods, functional foods, health functional foods, or special uses. It is used to include food. Health foods include foods provided under the names of dietary supplements, dietary supplements, supplements and the like. Health functional foods are defined by the Food Hygiene Law or the Health Promotion Law, and are based on specified health foods and nutritionally functional foods that can display specific health effects, functions of nutritional components, reduction of disease risk, etc., and scientific evidence. Includes foods with functional claims that can display the contents notified to the Commissioner of the Consumer Affairs Agency. In addition, special-purpose foods include foods for the sick, foods for the elderly, foods for babies, foods for pregnant women, etc. that indicate that they are suitable for a specific target person or a patient having a specific disease. If the stem cells are hematopoietic stem cells, this drug may cause anemia or symptoms associated with anemia, especially in elderly people, pregnant women, and diseases associated with menstruation and bleeding tendency (gastric ulcer, duodenal ulcer, gastrointestinal polyps and cancer, hemorrhoids, etc.). It can be suitably used for health foods and the like for improvement and prevention of. Here, the indications such as specific health effects and functions of nutritional components attached to foods and drinks are indications such as product containers, packaging, manuals, package inserts, product leaflets and pamphlets, newspapers and magazines, etc. It can be used as an advertisement for a product of.

The form of the food or drink may be any of edible forms such as solid, liquid, granular, granular, powdery, capsule-like, cream-like, and paste-like. In particular, in the case of the above-mentioned health foods, for example, tablets, rounds, capsules, powders, granules, fine granules, troches, and liquids (including syrup, milky, and suspension) Etc. are preferable.

The types of foods and drinks include breads, noodles, confectionery, dairy products, processed marine and livestock foods, fats and oils, processed fats and oils, seasonings, and various beverages (soft drinks, carbonated drinks, beauty drinks, nutritional drinks, fruit drinks). , Milk beverages, etc.), concentrated stock solutions of the beverages, preparation powders, etc., but are not limited thereto.

The food and drink of the present invention may appropriately contain additives that are usually used depending on the type of food and drink. As the additive, any additive that is acceptable under the Food Sanitation Law can be used, and for example, sweeteners such as starch, sucrose, fructose, isomerized liquid sugar, aspartame, and stevia; citric acid, malic acid, etc. , Acidulants such as citric acid; Excipients such as dextrin and starch; Binding agents, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Examples include turbidants and preservatives.

When the food or drink of the present invention is a general food or drink, a step of adding an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa in the normal manufacturing process of the food and drink is performed. It can be manufactured by including it. In the case of health foods, the above-mentioned method for manufacturing pharmaceutical products may be applied. For example, in the case of tablet-shaped supplements, one or more plant extracts selected from Tribulus terrestris, Siler, and Akayaziou may be used. It can be produced by adding and mixing additives such as excipients and applying pressure with a tableting machine or the like to form the product. Further, other materials (e.g., vitamin C, vitamin B _2, vitamin such as vitamin B _6, minerals such as calcium, fiber, etc.) optionally may be added.

The blending amount of the extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa in the food and drink of the present invention is an amount capable of exerting the undifferentiated state maintaining effect and the growth promoting effect of stem cells. However, it may be appropriately set in consideration of the general intake amount of the target food or drink, the form of the food or drink, the efficacy / effect, the taste, the palatability, the cost, and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the technical scope of the present invention is not limited to these Examples.

[Example 1] Production example of extract of Tribulus terrestris, Siler, and Rehmannia glutinosa The following shows an example of production of a solvent extract using Tribulus terrestris, Siler, and Rehmannia glutinosa.

(Production Example 1) Production of hot water extract of Hamabishi Add 800 mL of purified water to 100 g of dried unripe fruit of Hamabishi, extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, and freeze-dry. Then, 5.2 g of a hot water extract of Hamabishi was obtained.

(Production Example 2) Production of Ethanol Extract of Tribulus terrestris Add 1 L of ethanol to 100 g of dried immature fruit of Tribulus terrestris, extract at room temperature for 7 days, filter, concentrate and dry the filtrate, and extract ethanol of Tribulus terrestris. We obtained 5.3 g of the product.

(Production Example 3) Production of hot water extract of Boufu Add 800 mL of purified water to 100 g of dried Bofu root, extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, and freeze-dry. To obtain 5.5 g of a hot water extract of Bowfu.

(Production Example 4) Production of Ethanol Extract of Siler Add 1 L of ethanol to 100 g of dried Siler root, extract at room temperature for 7 days, filter, concentrate and dry the filtrate, and ethanol extract of Siler. Was obtained in an amount of 4.3 g.

(Production Example 5) Production of hot water extract of Akayaziou Add 800 mL of purified water to 100 g of dried Akayaziou root, extract at 95-100 ° C for 2 hours, filter, concentrate the filtrate, and freeze-dry. 5.5 g of a hot water extract of Akayaziou was obtained.

(Production Example 6) Production of Ethanol Extract of Rehmannia glutinosa Add 1 L of ethanol to 100 g of dried Rehmannia glutinosa root, extract at room temperature for 7 days, filter, concentrate and dry the filtrate, and ethanol extract of Rehmannia glutinosa. Was obtained in an amount of 4.3 g.

(Production Example 7) Production of hot water extract of a mixture of Hamabishi, Bowfu, and Akayajiou To 100 g of a mixture of equal amounts of dried hamanbishi fruit, dried bowhu root, and dried red sardine root. After adding 800 mL of purified water and extracting at 95 to 100 ° C. for 2 hours, the mixture was filtered, the filtrate was concentrated, and lyophilized to obtain 5.1 g of a hot water extract of a crude drug mixture.

(Production Example 8) Production of Ethanol Extract of Mixture of Hamabishi, Bowfu, and Akayaziou Ethanol in 100 g of a mixture of equal amounts of dried unripe fruit of Hamabishi, dried root of Bowfu, and dried root of Akayaziou. 1 L was added, and the mixture was extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness and freeze-dried to obtain 5.6 g of an ethanol extract of the crude drug mixture.

[Example 2] Evaluation of growth promoting effect and undifferentiated state maintaining effect of Tribulus terrestris, Siler, and Akayaziou extracts on stem cells The following is an evaluation of stem cells using the Tribulus terrestris, Siler, and Akayaziou extracts produced in Example 1. Experimental examples of growth promoting effect and undifferentiated state maintaining effect and their results are shown.

(Experimental Example 1) Evaluation of Proliferation-Promoting Effect on Stem Cells Adult adult stem cells (manufactured by DS Pharma Biomedical) cultured using a human stem cell culture medium (manufactured by TOYOBO) ^{were seeded in 3x10 5} pieces in a 6 cm dish, and the test substance was used. (Extract of Tribulus terrestris of Production Example 1, Extract of Boufu of Production Example 3, Extract of Tribulus terrestris of Production Example 5, Extract of mixture of Tribulus terrestris, Tribulus terrestris, and Stem cell of Production Example 7) with a final concentration of 1250 μg / Addition was made to mL, 2500 μg / mL, 5000 μg / mL, and the culture was continued for 3 days.

After culturing for 3 days, the cells were washed 3 times with PBS (−) and then collected with a rubber policeman, and the number of each cell was counted.

When the total number of cells when the test substance was not added was used as the control and the control was set to 100 (%), the increase / decrease (%) in the number of cells when the test substance was added was calculated, and the stem cell proliferation promoting effect was evaluated.
The results of these tests are shown in Table 1 below.

As shown in Table 1, the extract of Tribulus terrestris, the extract of Siler, the extract of Akayaziou, and the extract of the mixture of Tribulus terrestris, Siler, and Akayaziou all showed a remarkable effect of promoting stem cell proliferation. When the above-mentioned control value was set to 100%, the number of adult human stem cells at the start of culturing was 25%. From the above, it was clarified that the extracts of Tribulus terrestris, Siler, Rehmannia glutinosa and their mixtures have extremely excellent stem cell proliferation promoting effects. In addition to the stem cells used in this experimental example, a similar test was performed on embryonic stem cells (ES cells), and a remarkable effect of promoting stem cell proliferation was observed.

(Experimental Example 2) Evaluation of undifferentiated state-maintaining effect on stem cells Fetal bovine serum (FBS, 15%, manufactured by Sigma) and nucleoside solution (diluted 100-fold, 100-fold diluted) were added to Dulvecco's Modified Eagle Medium culture medium (manufactured by Gibco). Dainippon Pharmaceutical Co., Ltd.), non-essential amino acid solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), β2-mercaptoethanol solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), L-glutamine solution (100-fold dilution, large) Mouse embryonic stem cells (mouse ES cells: manufactured by Cosmobio) using a medium prepared by adding penicillin (100 unit / mL, manufactured by Sigma) and streptomycin (100 μg / mL, manufactured by Sigma). ^{) Was seeded in 5x10 5} pieces on a 6 cm dish coated with gelatin (manufactured by Sigma), and the test substances (extract of Hamabishi of Production Example 1, extract of Fetal Bovine Serum of Production Example 3, and extract of Akayaziou of Production Example 5) were seeded. , An extract of a mixture of Hamabishi, Fetal bovine serum, and Akayajiou of Production Example 7) was added to the medium so as to have a final concentration of 1250 μg / mL, and the culture was continued for 3 days.

After 3 days of culturing, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells by Trizol Reagent (Invitrogen). After reverse transcribing the extracted RNA into cDNA using the 2-STEP real-time PCR kit (Applied Biosystems), real-time PCR (95 ° C: 15 seconds, 60 ° C.) using the following primer set using ABI7300 (Applied Biosystems). : 40 cycles) was carried out for 30 seconds, and Nanog (undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Gene expression was confirmed. Other operations were performed according to the prescribed method.

Primer set for Nanog (undifferentiated marker):
ATGCCTGCAGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGTGCAGTGATG (SEQ ID NO: 4)

The undifferentiated state maintenance effect is the relative expression level of Nanog (Nanog gene expression level / Gapdh gene expression) calculated as the ratio of the expression level of Nanog mRNA in mouse ES cells at the start of culture to the expression level of Gapdh mRNA, which is an internal standard. The value of (amount) was set to 100% undifferentiated state, and the value of the gene relative expression level of Nanog in ES cells 3 days after culturing was calculated and evaluated.
The results of these tests are shown in Table 2 below.

As shown in Table 2, the extract of Tribulus terrestris, the extract of Siler, the extract of Akayaziou, and the extract of the mixture of Tribulus terrestris, Siler, and Akayaziou all showed a remarkable effect of maintaining the undifferentiated state of stem cells. Was done. In addition to the stem cells used in this experimental example, a similar test was performed on somatic stem cells, and a remarkable effect of maintaining the undifferentiated state of the stem cells was observed.

As shown in each of the above experimental examples, by applying an extract of one or more kinds of plants selected from Tribulus terrestris, Siler, and Rehmannia glutinosa to stem cells, it is simpler and more efficient than the conventional technique. In addition, it has become possible to promote the proliferation of stem cells while maintaining the undifferentiated state.

As an example of utilization of the present invention, application to regenerative medicine and regenerative beauty is expected. For example, by using the present invention, it becomes possible to easily and efficiently prepare undifferentiated stem cells used for regenerative medicine and regenerative cosmetology. Furthermore, after transplantation of stem cells or to the stem cells existing in the tissue, one or more plant extracts selected from Tribulus terrestris, Siler, and Rehmannia glutinosa according to the present invention are directly injected or injected. By applying by oral administration, application, application, etc., the stem cells can be proliferated while maintaining an undifferentiated state.
That is, the present invention can be used as a method for producing stem cells and / or as an undifferentiated state-maintaining agent or a growth-promoting agent for stem cells in regenerative medicine and cosmetology.

Claims (5)

An undifferentiated state-maintaining agent for stem cells containing a hot water extract of a mixture of Tribulus terrestris, Siler, and Rehmannia glutinosa as an active ingredient. A stem cell growth promoter containing a hot water extract of a mixture of Tribulus terrestris, Siler, and Rehmannia glutinosa as an active ingredient. A method for producing stem cells, which comprises a step of culturing stem cells in a medium containing a hot water extract of a mixture of Tribulus terrestris, Siler, and Akayaziou. A method for maintaining an undifferentiated state of stem cells, which comprises a step of culturing the stem cells in a medium containing a hot water extract of a mixture of Tribulus terrestris, Siler, and Akayajiou. A method for promoting proliferation of stem cells, which comprises a step of culturing stem cells in a medium containing a hot water extract of a mixture of Tribulus terrestris, Siler, and Rehmannia glutinosa.