JP6615589B2 - Stem cell undifferentiated state maintenance agent and growth promoter - Google Patents

Description

  The present invention relates to an agent for maintaining an undifferentiated state of a stem cell and an agent for promoting proliferation, and a method for maintaining an undifferentiated state of a stem cell and a method for promoting proliferation.

  When tissue of vertebrates (especially mammals) is damaged due to injury or disease, or with aging, etc., the regeneration system works and tries to recover the damage of cells / organs. Stem cells (tissue stem cells, somatic stem cells) provided in the tissue play a major role in this action. Stem cells have the pluripotency to differentiate into all cells and organs, and this property is thought to lead to recovery by compensating for damaged parts of cells and organs. Expectations are gathered for regenerative medicine, which is the next generation of medicine using such stem cells.

  The most advanced tissue in stem cell research in mammals is the bone marrow. The bone marrow contains living hematopoietic stem cells, which have been shown to be the source of all blood cell regeneration. Furthermore, it has been reported that the bone marrow contains stem cells that can be differentiated into organs and tissues (for example, bone, cartilage, muscle, fat, etc.) in addition to hematopoietic stem cells (see Non-Patent Document 1).

  Furthermore, in recent years, it has been clarified that stem cells exist in all organs and tissues other than bone marrow, such as skin, liver, pancreas, fat, etc., and is responsible for the regeneration and homeostasis of each organ and tissue. It has been understood (see Non-Patent Documents 2 to 5). In addition, stem cells present in each organ or tissue are excellent in plasticity, and may be used for regeneration of organs and tissues that have been impossible to self-replicate until now.

  On the other hand, some of these stem cells are known to decrease with aging, and research on techniques to prevent the decrease of stem cells is actively conducted to maintain the homeostasis of each tissue ( Non-patent document 6). In recent years, stem cells have been isolated from living tissues in the field of cell transplantation and tissue engineering (regenerative medicine and regenerative beauty) in order to apply the ability (pluripotency) of stem cells to regeneration of organs and tissues. Development of techniques for propagation is in progress (Non-Patent Documents 7 and 8).

  In particular, when culturing stem cells in vitro, it is extremely important to proliferate while maintaining the pluripotency that is the ability of stem cells, that is, maintaining an undifferentiated state. If the undifferentiated state of the stem cells cannot be maintained during this culture and differentiation induction has progressed, the ability (pluripotency) of the finally prepared stem cells has been lost, and the desired effect ( Can not reproduce organs and tissues.

  As described above, when stem cells are used for cell transplantation treatment or tissue engineering (regenerative medicine or regenerative beauty) and regeneration of organs or tissues is desired, the stem cells must be able to be cultured while maintaining an undifferentiated state.

  To date, there have been several reports on techniques for proliferating stem cells while maintaining an undifferentiated state, but they are still under development. For example, embryonic stem cells (ES cells) and hematopoietic stem cells can be maintained undifferentiated by co-culturing with feeder cells (stromal cells or feeder cells) (see Patent Document 1 and Non-Patent Documents 9 to 11). ). However, recently, there have been reports of cases of infection between different animals caused by feeder cells-derived endogenous viruses (see Non-Patent Document 12), and stem cell culture using feeder cells is a stem cell for medical purposes. It is not suitable for culturing.

  As another method, there is a method of maintaining an undifferentiated state of a stem cell by complexly combining cytokines. For example, mouse ES cells are maintained undifferentiated by adding LIF (Leukemia Inhibitory Factor) to the medium (see Patent Document 2 and Non-Patent Document 13). In addition, maintaining embryonic stem cells in the presence of early-acting cytokines thrombopoietin (TPO), interleukin 6 (IL-6), FLT-3 ligand, and stem cell factor (SCF) It has been reported for somatic stem cells (see Patent Literature 3 and Non-Patent Literature 14).

  However, cytokines are expensive and have problems such as collection raw materials and storage stability, and easy use is difficult. In addition, the effect of LIF is limited to a very specific cell lineage. In particular, in primate ES cells and somatic stem cells, it has been clarified that the addition of LIF alone cannot maintain an undifferentiated state. (See Non-Patent Document 10).

  As described above, all of the currently reported methods for maintaining the undifferentiated state of stem cells require complicated operations and have a low effect of maintaining the undifferentiated state. Therefore, in order to use stem cells for regenerative medicine, a technique for proliferating stem cells while maintaining an undifferentiated state has been demanded. That is, there has been a demand for a technique that can proliferate stem cells while maintaining an undifferentiated state in a safe, simple and efficient manner.

  Ginger (scientific name: Zingiber officinale) is a ginger family perennial, and the ginger rhizome contains pungency ingredients such as gingerol and gingerol, so it is used as a spice and spice ingredient, as well as ginger rhizome. Ginger is a typical herbal medicine with various effects such as healthy stomach, increased appetite, detoxification, anti-inflammatory, antibacterial, cough, and blood circulation. For this reason, it is included in traditional Chinese medicine for promoting gastrointestinal function and alleviating symptoms of colds. In addition to the above-mentioned action, ginger (ginger) alone or in combination with other plant extracts improves swallowing function (Patent Document 4), suppresses chronic inflammation of adipose tissue (Patent Document 5), macrophage peroxy It has been known so far that it has a nitrite production inhibitory action (Patent Document 6), a platelet aggregation inhibitory action (Patent Document 7), a plasminogen activator inhibitor I (PAI-1) inhibitory action (Patent Document 8), and the like. Yes. However, nothing has been known about the effect of promoting the proliferation of stem cells and the effect of maintaining the undifferentiated state.

JP 2004-24089 A JP-T-2002-525042 Japanese Patent No. 3573354 JP 2014-80410 A JP 2014-193816 A JP 2014-47154 A JP 2012-153671 A JP 2007-230882 A

Pittenger M.M. F. Et al., Science, 1999, Vol. 284, pp. 143-147 Goodell M.M. A. Et al., Nat. Med. , 1997, Vol. 3, pp. 1337-1345 Zulewski H. Et al., Diabetes, 2001, Vol. 50, pp. 521-533 Suzuki A. Et al., Hepatology, 2000, Vol. 32, pp. 1230-1239 Zuk P.M. A. Et al., Tissue Engineering, 2001, Vol. 7, pp. 211-228 Koji Hasegawa, Aesthetic Dermatology, 2013, Vol. 23, pp. 1-11 Hiroshi Mabuchi et al., Journal of Japanese Society for Regenerative Medicine, 2007, Vol. 6, pp. 263-268 All Kitagawa et al., Journal of Japanese Society for Regenerative Medicine, 2008, Vol. 7, pp. 14-18 Thomson J.M. A. Et al., Proc. Natl. Acad. Sci. USA, 1995, Vol. 92, pp. 7844-7848 Thomson J.M. A. Et al., Science, 1998, Vol. 282, pp. 1145-1147 Reubinoff B.E. E. Et al., Nature Biotech. , 2000, Vol. 18, pp. 399-404 van der Laan L.L. J. et al. Et al., Nature, 2000, Vol. 407, pp. 90-94 Smith A. G. Et al., Dev. Biol. , 1987, Vol. 121, pp. 1-9 Madlambayan G.M. J. et al. J. et al. Hematother. Stem Cell Res. , 2001, Vol. 10, pp. 481-492

  In view of the above-described circumstances, the present invention finds a new substance capable of efficiently proliferating a stem cell while maintaining an undifferentiated state, and provides it as an agent for maintaining an undifferentiated state of a stem cell or a growth promoter. Is an issue.

  As a result of intensive studies to solve the above problems, the present inventors have found that ginger extract has an excellent undifferentiated state maintaining effect and proliferation promoting effect on stem cells that have not been known so far. The present invention has been completed.

That is, the present invention includes the following.
(1) Stem cell undifferentiated state maintaining agent containing ginger extract as an active ingredient.
(2) A stem cell proliferation promoter containing ginger extract as an active ingredient.
(3) The agent according to (1) or (2), wherein the stem cells are hematopoietic stem cells.
(4) A method for producing stem cells, comprising a step of culturing stem cells in a medium containing a ginger extract.
(5) A method for maintaining an undifferentiated state of a stem cell, comprising a step of culturing the stem cell in a medium containing a ginger extract.
(6) A method for promoting the proliferation of stem cells, comprising a step of culturing stem cells in a medium containing a ginger extract.
(7) The method according to any one of (4) to (6), wherein the stem cell is a hematopoietic stem cell.

  According to the present invention, stem cells can be efficiently proliferated while maintaining an undifferentiated state. Therefore, the present invention can greatly contribute to the fields of regenerative medicine and regenerative beauty.

Hereinafter, the present invention will be described in detail.
The stem cell undifferentiated state maintenance agent or growth promoter according to the present invention contains a ginger extract as an active ingredient.

  The ginger extract used in the present invention is a part of the plant body and / or the whole plant body of Ginger family ginger genus [scientific name: Zingiber officinale, Japanese name: ginger, ginger name: ginger] Say things. Ginger is composed of rhizomes, stems, and leaves, but the extract material is preferably rhizomes. There are no particular restrictions on the ginger's locality and variety. In addition, these plants may be used as they are for extraction, or may be subjected to treatments such as drying, pulverization and shredding.

  The extraction method of the extract from ginger is not particularly limited, and for example, a heating extraction method or a normal temperature or cold extraction method may be used. Examples of the solvent used for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, Propyl ether, etc.). Preferably, water, lower alcohol and liquid polyhydric alcohol are preferable, and water and ethanol are particularly preferable. These solvents may be used alone or in combination of two or more. For example, an ethanol aqueous solution of 30 to 70 v / v% can also be used. Moreover, the acid which adjusted the pH by adding an acid or an alkali to the said extraction solvent can also be used.

  Ginger is subjected to solvent extraction using the solvent described above. The ratio of the ginger to the solvent is, for example, 1 to 50% (w / w), preferably 5 to 25% (w / w). For example, ginger extract can be obtained by adding water to the dried ginger rhizome and performing hot water extraction at 95-100 ° C. Alternatively, a lower alcohol (eg, ethanol) or a liquid polyhydric alcohol (eg, propylene glycol, 1,3-butylene glycol, etc.) is added to the dried ginger and extracted at room temperature (eg, 5-35 ° C.). Thus, a ginger extract can be obtained.

  After solvent extraction, the resulting solvent phase itself can be used as a ginger extract. Alternatively, the obtained solvent phase was obtained by subjecting it to concentration (vacuum concentration, concentration by membrane concentration, etc.), dilution, filtration, drying, etc., and decoloration, deodorization treatment, etc. using activated carbon, etc. The product can be a ginger extract. In particular, the extracted solution is preferably subjected to a treatment such as concentration to dryness, spray drying, freeze drying and the like, and the obtained dried product is preferably used as a ginger extract.

  The ginger extract thus obtained has an action of efficiently proliferating stem cells while maintaining an undifferentiated state at a biological level or at a culture level. Therefore, an undifferentiated state maintaining agent or a growth promoting agent for stem cells Can be used as Furthermore, the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention can be used as an additive for cell culture or a research reagent for efficiently proliferating stem cells while maintaining the undifferentiated state. Can do.

  By applying the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention to stem cells of mammals including humans, the undifferentiated state of stem cells can be maintained and the proliferation of stem cells can be promoted. . Stem cells to which the stem cell undifferentiated state maintaining agent or growth promoting agent according to the present invention is applied are not particularly limited as long as they meet the object of the present invention. For example, embryonic stem cells (ES cells); bone marrow, blood , Somatic stem cells present in the skin (epidermis, dermis, subcutaneous tissue), fat, hair follicle, brain, nerve, liver, pancreas, kidney, muscle and other tissues; stem cells artificially prepared by gene transfer etc. (Artificial pluripotent stem cells: iPS cells). Preferably, the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is more effective for stem cells derived from bone marrow, blood, skin, or adipose tissue. Examples of bone marrow-derived stem cells include hematopoietic stem cells. In the present invention, “hematopoietic stem cells” include pluripotent myeloid stem cells and pluripotent lymphoid stem cells, and myeloid cells (erythrocytes, platelets, eosinophils). , Basophils, neutrophils, monocytes, etc.) and cells capable of differentiating into lymphoid cells (B cells, T cells, NK cells, etc.). Hematopoietic stem cells are characterized by being positive for CD34 antigen and negative for CD38 antigen (CD34 + CD38−). Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells established by culturing early embryos produced by nuclear transfer of somatic cell nuclei, And ES cells obtained by modifying genes on the chromosomes of those ES cells using genetic engineering techniques. Such ES cells can be prepared, for example, by a method known per se, but can be obtained from a predetermined institution, and further commercially available products can be purchased. In addition, these stem cells may be primary cultured cells, subcultured cells, or frozen cells.

  Furthermore, the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention can be applied to stem cells derived from all mammals as long as it has equivalent characteristics with respect to the direction of differentiation of the stem cells and the process of differentiation. Is possible. For example, the stem cell undifferentiated state maintaining agent or the growth promoting agent according to the present invention is a stem cell of a mammal such as a human, monkey, mouse, rat, guinea pig, rabbit, cat, dog, horse, cow, sheep, goat or pig. Can be effective.

  The application of the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention to the stem cell may be in vitro or in vivo, and in any case, the action can be exerted. Therefore, the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is obtained by culturing stem cells in a medium for culturing stem cells to which an effective amount thereof has been added, or by administration to mammals including humans. , Can maintain the undifferentiated state of stem cells and promote proliferation.

  Stem cell undifferentiated state maintenance agent or growth promoter according to the present invention, the ginger extract as an active ingredient has an excellent stem cell undifferentiated state maintenance action and growth promotion action, skin, osteoblast, cartilage, It is effective for treating, ameliorating, and preventing damage or damage to tissues or organs by acting on stem cells of tissues or organs in vivo such as muscle, nerve, fat, liver and the like. In addition, since stem cells decrease or decrease in function with aging and the like, the stem cell undifferentiated state maintaining agent or growth promoting agent according to the present invention reduces the stem cells or functions of organs or organs in the living body. It is effective in treating, ameliorating and preventing related diseases. Here, as diseases related to tissue or organ damage or damage, stem cell decrease or functional decline, for example, in the case of skin, wrinkles, tarmi, spots, dullness, rough skin, thickened skin, open pores, acne scars , Wounds, scars, keloids and the like, and also includes scalp and hair damage such as thinning and hair loss. For bone-related, osteoporosis, fractures (vertebral compression fracture, femoral neck fracture, etc.), for cartilage diseases, osteoarthritis, rheumatoid arthritis, disc herniation, etc. For nerve-related, spinal cord injury, facial nerve palsy , Alzheimer's disease, amyotrophic lateral sclerosis, Parkinson's disease, memory decline with age, blood related, aplastic anemia, leukemia, cardiovascular related myocardial infarction, obstructive arteriosclerosis, etc. Related to periodontal disease, alveolar bone damage due to alveolar pyorrhea, ophthalmology related, retinitis pigmentosa, age-related macular degeneration, glaucoma, etc. liver / pancreas related include hepatitis, cirrhosis, diabetes, etc. It is not limited to.

  In addition, the extract of ginger has the effect of promoting the growth of hematopoietic stem cells and maintaining the undifferentiated state, and therefore treats, improves, and prevents blood and hematopoietic diseases or pathologies associated with the decrease or decreased function of hematopoietic stem cells. It is effective as a pharmaceutical product. Here, as diseases and pathologies of blood and hematopoietic organs related to the decrease or decrease in function of hematopoietic stem cells, for example, iron deficiency anemia, giant erythroblastic anemia, hemolytic anemia, erythroblastosis, aplasticity Anemia, congenital anemia (eg sickle cell disease), paroxysmal nocturnal pigmenturia, secondary anemia (anemia associated with infection, malignant tumor, chronic disease, kidney disease, liver disease, endocrine disease, etc.), Leukemia, myelodysplastic syndrome, malignant lymphoma, multiple myeloma, myeloproliferative disorders (eg polycythemia vera, essential thrombocythemia, myelofibrosis), idiopathic thrombocytopenic purpura, autoimmune hemolysis In addition to anemia, general anemia conditions (palpitations, shortness of breath, dizziness, dizziness, addictiveness, fatigue, malaise, loss of appetite, nausea, headache, facial pallor, dark skin, tinnitus, stiff shoulders, But not limited thereto. Further, “decrease in hematopoietic stem cells or decreased function” includes not only those caused by the above-mentioned diseases but also those caused by administration of anticancer agents and immunosuppressive agents and radiation therapy for cancer.

  The content of the ginger extract in the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is not particularly limited, but may be, for example, 0 depending on the nature of the extract (extract, concentrate, or dried product). It can be set appropriately in the range of 0.0001 to 100% by weight, preferably 0.0001 to 10% by weight, and more preferably 0.001 to 1% by weight.

  The present invention also relates to a method of promoting stem cell proliferation while culturing stem cells in a medium containing a ginger extract while maintaining the undifferentiated state of the stem cells. In other words, the method according to the present invention is a method for producing a stem cell, a method for maintaining an undifferentiated state of a stem cell, or a method for promoting the proliferation of a stem cell, comprising a step of culturing the stem cell in a medium containing a ginger extract. Can do.

  In the method according to the present invention, a culture medium generally used for maintaining and proliferating the undifferentiated state of stem cells may be used for culturing stem cells. For example, a basic medium containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, fatty acids) necessary for stem cell survival and proliferation, specifically, Dulbecco's Modified Eagle Medium (D-MEM) ), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's Modified Eagle Medium (Nentient Mixture F-12 (D-MEM / F-M / F). Hanks' solution (Hank's balanced salt solution) etc. are mentioned. In addition, basic fibroblast growth factor (bFGF) and / or leukocyte migration inhibitory factor (LIF) may be added to the medium as growth factors. Further, if necessary, the medium may be epidermal growth factor (EGF), tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27. -It may contain supplements, N2-supplements, ITS-supplements, antibiotics and the like.

  In addition to the above components, it is preferable that serum is contained in the medium at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in its effects, it is preferably used after lot check.

  Commercially available media include Mesenchymal stem cell basal medium manufactured by Invitrogen, Mesenchymal stem cell basal medium manufactured by Sanko Junyaku Co., Ltd., MF medium manufactured by TOYOBO, Hanks' solution manufactured by Sigma (Hank's balanced salt solution) ) Etc. can be used.

  The incubator used for stem cell culture is not particularly limited as long as stem cells can be cultured. Examples thereof include flasks, petri dishes, dishes, plates, chamber slides, tubes, trays, culture bags, and roller bottles. .

  The incubator may be non-cell-adhesive or adhesive, and is appropriately selected according to the purpose. As the cell-adhesive incubator, for the purpose of improving the adhesion with cells, a cell-treated culture vessel treated with a cell support substrate using an extracellular matrix or the like may be used. Examples of the cell support substrate include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, fibronectin and the like.

  The concentration of ginger extract added to the medium used for stem cell culture may be appropriately determined according to the content of ginger extract in the above-described stem cell undifferentiated state maintenance agent or growth promoter. However, in terms of ginger extract dry matter, for example, a concentration of 10 to 10000 μg / mL, preferably 100 to 5000 μg / mL can be mentioned. In addition, ginger extract may be periodically added to the medium during the stem cell culture period.

Stem cell culture conditions may be in accordance with normal conditions used for stem cell culture, and no special control is required. For example, the culture temperature is not particularly limited, but is about 30 to 40 ° C, preferably 36 to 37 ° C. The CO ₂ gas concentration is, for example, about 1 to 10%, preferably about 2 to 5%. In addition, it is preferable to perform culture | cultivation replacement | exchange once every 2-3 days, and it is more preferable to carry out every day. The culture conditions can also be set by varying as appropriate within the range in which the stem cells can survive and proliferate.

  Stem cell undifferentiated state maintenance is performed, for example, in the presence of the stem cell undifferentiated state maintaining agent according to the present invention as compared to the stem cell cultured in the absence of the stem cell undifferentiated state maintaining agent according to the present invention. The stem cell undifferentiated marker gene expression level in the stem cells can be evaluated by whether or not it is maintained at the mRNA level or the protein level at the same level as the expression level at the start of culture. Examples of the stem cell undifferentiation marker gene include Nanog gene (Cell Res. 2007 Jan; 17 (1): 42-9. Review. Nanog and transitional networks in Jemantic in Pamp. .

  Examples of the method for measuring the level of expression of stem cell undifferentiated marker gene include, for example, RT-PCR using primers and probes specific to stem cell undifferentiated marker gene, quantitative PCR, Northern blotting and the like at the mRNA level. On the protein level, for example, immunological methods such as ELISA using an antibody specific for a protein encoded by a stem cell undifferentiation marker gene, flow cytometry, Western blotting and the like can be mentioned.

  As a result of measuring the expression level, the expression level of the stem cell undifferentiation marker gene in the stem cell at the start of culture (100% undifferentiated state) and the stem cell after culturing for a predetermined time in the presence of the stem cell undifferentiated state maintaining agent of the present invention When the relative ratio of the expression level of the stem cell undifferentiation marker gene is greater than the same relative ratio (control) when cultured in the absence of the stem cell undifferentiated state maintenance agent of the present invention, the stem cell undifferentiated state It can be determined that it was maintained.

  In addition, the proliferation promotion of the stem cell is achieved by, for example, the stem cell cultured in the presence of the stem cell proliferation promoter according to the present invention, as compared with the stem cell cultured in the absence of the stem cell proliferation promoter according to the present invention. It can be evaluated by whether or not the number of cells is significantly increased. The number of cells can be measured using a commercially available cell number measurement kit by, for example, the MTT method or the WST method. As a result of the measurement, the relative ratio between the number of stem cells at the start of culture and the number of stem cells cultured for a predetermined time in the presence of the stem cell proliferation promoter of the present invention is the non-existence of the stem cell proliferation promoter of the present invention. It can be determined that the proliferation of stem cells could be promoted when the relative ratio (control) was greater when cultured in the presence.

  Stem cells prepared by the above-described method according to the present invention can be used as a transplant material (cell transplant agent), and can be performed by the same method as conventional bone marrow transplantation or umbilical cord blood transplantation.

  According to the stem cell undifferentiated state maintenance agent or growth promoter or the method according to the present invention, the ginger extract alone or separately from the medium or mixed with the medium, It can also be provided as a reagent kit for maintaining the differentiation state or promoting proliferation. The kit can include an instruction manual or the like as necessary. Alternatively, the extract of ginger can be mixed with a medium and provided as a medium for maintaining the undifferentiated state of stem cells or promoting growth.

  When the above-mentioned stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is administered in vivo, it can be administered as it is, but with an appropriate additive within a range not impairing the effects of the present invention. It can be provided by blending with various compositions such as cosmetics, quasi drugs, pharmaceuticals, foods and drinks and the like. The pharmaceutical of the present invention includes drugs used for animals, that is, veterinary medicine.

  In the case where the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is added to cosmetics or quasi drugs, the dosage form is an aqueous solution, a solubilization system, an emulsion system, a powder system, a powder dispersion system, Any of an oil liquid system, a gel system, an ointment system, an aerosol system, a water-oil two-layer system, or a water-oil-powder three-layer system may be used. In addition, the cosmetics and quasi-drugs are selected according to the type of various components, additives, bases, etc. that are usually used in the composition for external use of skin, together with an undifferentiated state maintenance agent or growth promoter for stem cells. And it mix | blends suitably and can manufacture according to a well-known method in this field | area. The form may be liquid, emulsion, cream, gel, paste, spray or the like. Examples of the ingredients for the external composition for skin include oils and fats (olive oil, palm oil, evening primrose oil, jojoba oil, castor oil, hardened castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons ( Liquid paraffin, squalene, squalane, petrolatum, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol, etc.) , Esters (isopropyl myristate, isopropyl palmitate, cetyl octanoate, glyceryl trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), organic acids (citric acid, lactic acid, α-hydroxyacetic acid) Pyrrolidone carboxylic acid, etc.), sugars (maltitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and protein hydrolysates, amino acids and salts thereof, vitamins, plant / animal extracts, various Surfactants, humectants, ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, fragrances and the like can be mentioned.

  As types of cosmetics and quasi-drugs, for example, lotion, milky lotion, gel, beauty essence, general cream, sunscreen cream, pack, mask, face wash, cosmetic soap, foundation, funny, bath preparation, body lotion, Examples include body shampoos, hair shampoos, hair conditioners, hair restorers and the like.

  When the stem cell undifferentiated state maintenance agent or growth promoter according to the present invention is added to a pharmaceutical, it is mixed with a pharmacologically and pharmaceutically acceptable additive and is suitable for application to an affected area. Can be formulated into various preparations. The pharmacologically and pharmaceutically acceptable additives include pharmaceutical bases and carriers, excipients, diluents, binders, lubricants, and coatings that are appropriately selected according to the dosage form and application. Agents, disintegrants or disintegration aids, stabilizers, preservatives, preservatives, extenders, dispersants, wetting agents, buffers, solubilizers or solubilizers, isotonic agents, pH adjusters, propellants A coloring agent, a sweetening agent, a corrigent, a fragrance, and the like may be added as appropriate, and various preparations that can be administered systemically or locally orally or parenterally by various known methods may be used. When the pharmaceutical product of the present invention is provided in each of the above-described forms, it can be produced by a method usually used by those skilled in the art, for example, the method shown in the General Formulation [2] Formulation of the Japanese Pharmacopoeia.

  The form of the pharmaceutical product of the present invention is not particularly limited. For example, tablets, sugar-coated tablets, capsules, troches, granules, powders, liquids, pills, emulsions, syrups, suspensions, elixirs Oral preparations such as pills, injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drops, suppositories, ointments, lotions, eye drops, sprays, transdermal Examples include skin absorption agents, transmucosal absorption agents, and parenteral preparations such as patches. Moreover, it may be a dry product which is redissolved when used, and in the case of an injectable preparation, it is provided in the form of a unit dose ampoule or a multi-dose container.

  A form suitable for using the undifferentiated state maintenance agent or growth promoter for stem cells according to the present invention as a pharmaceutical product for treating, ameliorating, and preventing the skin-related damage or disease is an external preparation, for example, Examples include ointments, creams, gels, liquids, patches (paps, plasters), foams, sprays, sprays, and the like. The ointment refers to a homogeneous semi-solid external preparation, and includes an oily ointment, an emulsion ointment, and a water-soluble ointment. The gel is an external preparation in which a water-insoluble component hydrate compound is suspended in an aqueous liquid. The liquid preparation refers to a liquid external preparation and includes lotions, suspensions, emulsions, liniments and the like.

  The pharmaceutical agent of the present invention functions as a prophylactic agent that suppresses the onset of the above diseases and / or a therapeutic agent that improves the normal state. Since the active ingredient of the pharmaceutical of the present invention is derived from natural products, it is very safe and has no side effects. Therefore, when used as a medicament for the treatment, amelioration, and prevention of the aforementioned diseases, humans, mice, rats, rabbits It can be administered orally or parenterally in a wide range of doses to mammals such as dogs and cats.

  The content of the stem cell undifferentiated state maintaining agent or growth promoter in the cosmetics, pharmaceuticals, and quasi drugs of the present invention is not particularly limited, but the dried ginger extract is based on the total weight of the preparation (composition). 0.001 to 30% by weight is preferable, and 0.01 to 10% by weight is more preferable. The above amount is merely an example, and may be set and adjusted as appropriate in consideration of the type and form of the composition, the general amount used, the efficacy and the effect. Moreover, about the addition method of the active ingredient in formulation, it may add previously, may be added in the middle of manufacture, and should just select suitably in consideration of workability | operativity.

  Moreover, the undifferentiated state maintenance agent or growth promoter of stem cells according to the present invention can also be added to food and drink. In addition, in the present invention, the food and drink is a general food and drink, a food that can be ingested for the purpose of maintaining and promoting health other than pharmaceuticals, for example, health food, functional food, health functional food, or special use Used to include food. The health food includes foods provided under the names of nutritional supplements, health supplements, supplements, and the like. Functional health foods are defined by the Food Sanitation Law or Health Promotion Law, and are based on specific health foods, functional nutritional foods, and scientific evidence that can indicate the effects of specific health, function of nutritional components, reduction of disease risk, etc. Functional labeling foods that can display the contents reported to the Commissioner of the Consumer Affairs Agency regarding their functionality are included. Special-purpose foods include foods for the sick, foods for the elderly, foods for infants, foods for pregnant women, etc. that indicate that they are suitable for specific subjects and patients with specific diseases. When stem cells are hematopoietic stem cells, this drug is especially useful for elderly people, pregnant women, and symptoms associated with anemia and anemia during diseases associated with menstruation and bleeding tendency (gastric ulcer, duodenal ulcer, gastrointestinal polyp, cancer, epilepsy, etc.) It can be suitably used for health foods for improving and preventing the above. Here, indications of specific health effects and nutritional component functions attached to food and drink are displayed on product containers, packaging, instructions, package inserts, product flyers and brochures, newspapers, magazines, etc. Can be an advertisement of the product.

  The form of the food or drink may be any form suitable for edible use, for example, solid, liquid, granular, granular, powder, capsule, cream, or paste. In particular, the shape in the case of the above health foods, for example, tablets, rounds, capsules, powders, granules, fine granules, troches, liquids (including syrups, milks, suspensions) Etc. are preferred.

  The types of food and drink include bread, noodles, confectionery, dairy products, processed fishery and livestock products, processed oils and fats, processed foods, seasonings, various beverages (soft drinks, carbonated drinks, beauty drinks, nutritional drinks, fruit drinks) , Milk beverages, etc.) and concentrated beverages and powders for adjustment of the beverages, but are not limited thereto.

  The food / beverage products of the present invention may be appropriately blended with additives usually used depending on the type. Any additive that is acceptable under the Food Sanitation Law can be used as the additive. For example, sweeteners such as glucose, sucrose, fructose, isomerized liquid sugar, aspartame, stevia; citric acid, malic acid , Sour agents such as tartaric acid; excipients such as dextrin and starch; binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Examples include turbidizers and preservatives.

When the food / beverage products of this invention are general food / beverage products, it can manufacture by including the process of adding the extract of a ginger in the normal manufacturing process of the food / beverage products. In the case of health foods, it may be according to the above-mentioned pharmaceutical production method. For example, in tablet-like supplements, additives such as excipients are added to ginger extract, mixed, tableting machine etc. Can be produced by molding under pressure. Moreover, other materials (for example, vitamins such as vitamin C, vitamin B ₂ , vitamin B ₆ , minerals such as calcium, dietary fiber, etc.) can be added as necessary.

  The amount of ginger extract in the food / beverage product of the present invention may be any amount that can exhibit the effect of maintaining the undifferentiated state of stem cells and the effect of promoting proliferation, but the general intake amount of the target food / beverage product, the form of the food / beverage product It may be set as appropriate in consideration of efficacy / effect, taste, palatability and cost.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

[Example 1] Production Example of Ginger Extract A production example of a solvent extract using ginger is shown below.

(Production Example 1) Ginger hot water extract 800 g of purified water was added to 100 g of dried ginger rhizome, extracted at 95-100 ° C. for 2 hours, filtered, the filtrate was concentrated, freeze-dried and ginger 5.5 g of a hot water extract was obtained.

(Production Example 2) 50% ethanol extract of ginger 100 ml of dried ginger rhizome was added with 400 mL of 50 (v / v)% ethanol aqueous solution, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness Thus, 3.6 g of 50% ethanol extract of ginger was obtained.

(Production Example 3) Ginger Ethanol Extract 1 g of ethanol was added to 100 g of dried ginger rhizome, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to give 4 ginger ethanol extract. .8 g was obtained.

[Example 2] Evaluation of growth promoting effect and undifferentiated state maintaining effect on stem cells of ginger extract Using the ginger extract produced in Example 1 below, growth promoting effect on stem cells and maintaining undifferentiated state Experimental examples of the effects and the results are shown.

(Experimental Example 1) Evaluation of proliferation promoting effect on stem cells 3 somatic stem cells (DS Pharma Biomedical) cultured using a human stem cell culture medium (manufactured by TOYOBO) were seeded at 3 × 10 ^{5 in} a 6 cm dish and tested. Substances (ginger extracts from Production Examples 1 to 3) were added to final concentrations of 312 μg / mL, 625 μg / mL, and 1250 μg / mL, and the culture was continued for 3 days.

After culturing for 3 days, the cells were washed three times with PBS (−) and then collected by a rubber policeman, and the number of each cell was counted.
When the total number of cells when the test substance was not added was used as a control and the control was 100 (%), the increase / decrease (%) of the number of cells when the test substance was added was calculated, and the stem cell proliferation promoting effect was evaluated.
The test results are shown in Table 1 below.

  As shown in Table 1, a significant stem cell proliferation promoting effect was observed in the ginger extract. In addition, when the above-mentioned control value was 100%, the number of human somatic stem cells at the start of culture was 25%. From the above, the extremely excellent stem cell proliferation promoting effect of the ginger extract was clarified. In addition to the stem cells used in this experimental example, a similar test was performed on commercially available human hematopoietic stem cells and embryonic stem cells (ES cells).

(Experimental example 2) Evaluation of an undifferentiated state maintenance effect with respect to a stem cell In Dulbecco's Modified Eagle Medium culture solution (made by Gibco), fetal bovine serum (FBS, 15%, the product made by Sigma), nucleoside solution (100 times dilution, Dainippon Pharmaceutical Co., Ltd.), non-essential amino acid solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), β2-mercaptoethanol solution (100-fold dilution, Dainippon Pharmaceutical Co., Ltd.), L-glutamine solution (100-fold dilution, large Mouse embryonic stem cells (mouse ES cells: manufactured by Cosmo Bio) using a medium prepared by adding Nippon Pharma Co., Ltd., penicillin (100 units / mL, manufactured by Sigma) and streptomycin (100 μg / mL, manufactured by Sigma). ) were seeded 5x10 ⁵ cells in 6cm dish coated with gelatin (Sigma Co., Ltd.), the test The substance (ginger extract of Production Examples 1 to 3) was added to the medium so that the final concentration was 1250 μg / mL, and the culture was continued for 3 days.

  After 3 days of culture, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). 2-STEP real-time PCR kit (Applied Biosystems) was used to reverse-transcribe the extracted RNA into cDNA, and then ABI7300 (Applied Biosystems) was used for real-time PCR (95 ° C: 15 seconds, 60 ° C) using the following primer set: : 30 seconds, 40 cycles), and Nanog (undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Revie. Nanog and transcribable networks in emp. The gene expression of was confirmed. Other operations were carried out in accordance with established methods.

Primer set for Nanog (undifferentiation marker):
ATGCCTGCAGGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Gapdh (internal standard):
TGCACCACCAACTGCCTTAGC (SEQ ID NO: 3)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)

The effect of maintaining the undifferentiated state is that the expression level of Nanog mRNA in mouse ES cells at the start of culture was calculated as a ratio relative to the expression level of Gapdh mRNA as an internal standard (Nanog gene expression level / Gapdh gene expression). The value of the amount of relative expression of Nanog in ES cells after 3 days of culture was calculated and evaluated.
The test results are shown in Table 2 below.

  As shown in Table 2, the extract of ginger showed a remarkable effect of maintaining the undifferentiated state of stem cells. In addition to the stem cells used in this experimental example, a similar test was performed on commercially available human hematopoietic stem cells as somatic stem cells, and a remarkable effect of maintaining the undifferentiated state of stem cells was observed.

  As shown in each of the above experimental examples, by applying a ginger extract to stem cells, the proliferation of stem cells can be promoted while maintaining an undifferentiated state in a simpler and more efficient manner than conventional techniques. Became possible.

  As an application example of the present invention, application to regenerative medicine and regenerative beauty is expected. For example, by utilizing the present invention, it becomes possible to easily and efficiently prepare undifferentiated stem cells used for regenerative medicine and regenerative beauty. Furthermore, the stem cell present after transplantation of the stem cell or in the tissue, by directly injecting the ginger extract according to the present invention or by oral administration, application, sticking, etc. It is possible to proliferate while maintaining an undifferentiated state. That is, the present invention can be used as a stem cell production method and / or a stem cell undifferentiated state maintaining agent or growth promoter in regenerative medicine or regenerative beauty.

Claims (4)

An agent for maintaining an undifferentiated state of embryonic or somatic stem cells containing hot water or an aqueous extract of ginger rhizome, an aqueous ethanol extract , or an ethanol extract as an active ingredient. The agent according to claim 1 , wherein the somatic stem cells are hematopoietic stem cells. Maintaining undifferentiated state of embryonic or somatic stem cells, including culturing embryonic or somatic stem cells in hot water or water extract of ginger rhizome, aqueous ethanol extract , or ethanol extract Method. The method according to claim 3 , wherein the somatic stem cells are hematopoietic stem cells.