JP6159183B2 - Stem cell-derived growth factor production promoter - Google Patents

Description

  The present invention relates to a stem cell-derived growth factor production promoter and an external composition for skin containing the production promoter.

  In the case of vertebrate, particularly mammalian tissue, when cell or organ damage occurs due to injury or disease, or aging, the regeneration system works to try to recover the damage of the cell or organ. Stem cells provided in the tissue play a major role in this effect. Stem cells have the pluripotency to differentiate into all kinds of cells, and it is considered that this property leads to recovery by regenerating the cells and tissues in the damaged part. Expectations have been gathered for regenerative medicine, which is the next generation of medicine using such stem cells.

  On the other hand, in recent years, growth factors produced and secreted by stem cells have attracted attention. In stem cell transplantation, which is a basic strategy for regenerative medicine, growth factors produced and secreted by stem cells are actually important, and it has been considered that these may contribute to tissue reconstruction. In fact, it has been demonstrated in various tissues including bone, skin, spinal cord, and brain that stem cell-derived growth factors secreted from stem cells into the culture supernatant have a regeneration effect equivalent to or higher than that of stem cell transplantation. (Non-Patent Document 1). In addition, regenerative beauty that regenerates skin and hair by injecting stem cell-derived growth factor into affected areas to improve wrinkles and promote hair growth is also becoming popular.

  To date, as a technique for promoting growth factor production, an endogenous repair factor production promoter containing one or more selected from prostaglandin (PG) I2 agonist, EP2 agonist and EP4 agonist (Patent Literature) 1) Platelet-derived growth factor-BB (PDGF-BB) production enhancer (Patent Document 2), Shiitake, Echinashi, Prunes, Moyashi, Achacharu each containing at least one of Amla extract and Lingonberry extract A vascular endothelial growth factor production promoter (Patent Document 3) containing one or two or more selected from those has been reported. However, these growth factor production promoters all promote production of growth factors from cells such as fibroblasts and vascular endothelial cells, and do not promote production of growth factors from stem cells. As a technique to promote production of growth factors from stem cells, a method has been reported in which growth factors are produced in large quantities from adipose-derived stem cells by examining culture conditions such as physical stimulation of hypoxia and ultraviolet irradiation and addition of vitamins to the medium. However, it is not a simple method because the setting and adjustment of culture conditions are complicated (Patent Document 4).

  Mushrooms are a typical health food because they contain a lot of dietary fiber, vitamin B1, vitamin B2, vitamin D, minerals, etc., and are low in calories. On the other hand, mushrooms are known to have various physiological actions such as antitumor action, immunostimulatory action, antiallergic action, hematopoiesis action, blood pressure lowering action, lipid lowering action, and are widely used in health foods, supplements, cosmetics, etc. It is used. However, with regard to the action on stem cells, an extract of kinagasatake belonging to the genus Sphagnumaceae has been found to have an undifferentiated maintenance effect and a proliferation promoting effect specific to stem cells (Patent Document 5). Nothing has been known about the effect of promoting production of growth factors from stem cells.

JP2010-120964A JP2013-001669A JP 2004-035443 A Special table 2009-524425 JP2011-211959

Medical History Vol.239, No.8, November 19, 2011

  An object of the present invention is to search for a substance that promotes the production of growth factors by stem cells, and to provide the substance as a composition for external use for the prevention, amelioration, or treatment of skin damage or injury or obesity. is there.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that an extract of the oyster mushroom, which is a mushroom belonging to the genus Sphagnumaceae, has the effect of promoting growth factor production by stem cells, The present invention has been completed.

That is, the present invention includes the following inventions.
(1) A stem cell-derived growth factor production promoter containing, as an active ingredient, an extract of Kinugasatake, which belongs to the genus Kinupasatake.
(2) A composition for external use on skin, comprising the stem cell-derived growth factor production promoter according to (1).
(3) The external composition for skin according to (2), wherein the external composition for skin is a pharmaceutical product or a quasi-drug.
(4) The external composition for skin according to (2), wherein the external composition for skin is a cosmetic.
(5) A method for producing a stem cell culture, comprising a step of culturing a stem cell in the presence of an extract of Kinusagana, which belongs to the genus Kinupasatake.
(6) The method according to (5), further comprising the step of isolating a growth factor from the stem cell culture.
(7) A stem cell culture obtained by the method according to (5).

  Since the stem cell-derived growth factor production promoter of the present invention can promote the production and secretion of growth factors by stem cells, skin damage and deterioration such as wrinkles and sagging due to aging and UV exposure, stains, trauma, The composition can be used as an external composition for preventing, ameliorating or treating skin damage caused by burns or obesity. In addition, the stem cell culture obtained by culturing stem cells using the stem cell-derived growth factor production promoter of the present invention or a growth factor isolated from the culture is used for regenerative medicine and regeneration for the purpose of skin regeneration and repair. Can be used for beauty.

The present invention will be described in detail below.
The stem cell-derived growth factor production promoter of the present invention contains an extract of Kinugasatake belonging to the genus Kinugasatake as an active ingredient.

  The mushrooms used in the present invention are mushrooms belonging to the genus Mushrooms, and the scientific name is Dictyophora indusiaata. Kinugasatake has long been used as an edible mushroom for nourishment and fortune, and its fruiting body has been used as a soup ingredient in Chinese cuisine.

  The extract of Kinugasatake used in the present invention refers to the whole fruiting body of Kinugasatake, a part of the fruiting body such as a crust, a lace-like white cloak (fungus net), or a fungus body, and extracted by heating. It may be a thing, and what was extracted at normal temperature may be sufficient. In particular, the extract of Kinusagatake of the present invention is preferably extracted from fruiting bodies.

  The extraction method is not particularly limited, and can be performed by stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. As the organic solvent, alcohols, ethers, esters, and the like can be used, but water-soluble organic solvents such as ethanol, methanol, and acetone are preferable, and one or more of these may be used. Particularly preferred extraction solvents include water or water-ethanol mixed polar solvents. The amount of the solvent used is not particularly limited, and for example, it may be 10 times or more, preferably 20 times or more, compared to the above-mentioned Kinugasatake (dry weight). For convenience of operation, it is preferably 100 times or less. Moreover, although extraction temperature and time depend on the kind of solvent to be used, for example, it is 10-100 degreeC, Preferably it is 30-90 degreeC, 30 minutes-24 hours, Preferably it can illustrate 1 to 10 hours. In addition, the extract may be used as it is in the extracted solution, but if necessary, in a range that does not affect the effect, concentration (concentration by organic solvent, vacuum concentration, membrane concentration, etc.), dilution, filtration, You may use, after performing processing, such as decoloring by activated carbon, deodorizing, ethanol precipitation. Further, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

  “Promoting production of stem cell-derived growth factor” in the present invention refers to promoting production and secretion of growth factor by stem cells at the living body level or at the culture level.

  The “growth factor” in the present invention includes basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin-like growth factor. -1 (IGF-1), insulin-like growth factor-2 (IGF-2), transforming growth factor-β1 (TGF-β1), transforming growth factor-β2 (TGF-β2), keratinocyte growth factor (KGF) Vascular endothelial growth factor (VEGF), neurotrophic factor (NGF), hepatocyte growth factor (HGF), but are not limited thereto.

  These “growth factors” exert various effects in the living body. For example, bFGF is known to promote the regeneration of skin tissue (Japanese Patent Application Laid-Open No. 2007-068884). IGF-1 is also known to be involved in skin tissue regeneration (Endocr Rev. 2003 Dec; 24 (6): 737-64. Epidermal homeostasis: the role of the growth hormone and insulin-like growth factor systems. Edmondson SR, Thumiger SP, Werther GA, Wraight CJ.). In addition, it is known that IGF-1 exhibits a visceral fat reducing effect and the like in addition to a skin tissue regeneration effect (Tokuyo 2007-502834). Furthermore, TGF-β1 plays a very important role in the skin wound healing process (Journal of the Japanese Society for Skincare: 119 (10). 1971-1977. 2009).

  In the present invention, “stem cell” refers to various stem cells capable of producing the above growth factor, and bone marrow, blood, skin (epidermis, dermis, subcutaneous tissue), fat, hair follicle, muscle, brain, liver, and other tissues. And undifferentiated cells (collectively referred to as somatic stem cells), embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), and the like. Preferably, it is more effective against bone marrow, blood, skin, and adipose tissue-derived stem cells. Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells established by culturing early embryos produced by nuclear transfer of somatic cell nuclei, And ES cells obtained by modifying genes on the chromosomes of those ES cells using genetic engineering techniques. Such ES cells can be prepared, for example, by a method known per se, but can be obtained from a predetermined institution, and further commercially available products can be purchased. In addition, these stem cells may be primary cultured cells, subcultured cells, or frozen cells.

  Furthermore, the stem cell-derived growth factor production promoter of the present invention can be applied to all mammals as long as they have equivalent characteristics with respect to the growth factor production and secretion mechanism of stem cells. For example, the effect can be exerted on stem cells of mammals such as human, monkey, mouse, rat, guinea pig, hamster, rabbit, cat, dog, horse, cow, sheep, goat and pig.

  Kinugasatake, which is an active ingredient of the stem cell-derived growth factor production promoter of the present invention, has an action of promoting growth factor production by stem cells at the culture level or the living body level. Therefore, the stem cell-derived growth factor production promoter of the present invention grows from stem cells by culturing the stem cells in a medium for culturing stem cells to which an effective amount thereof has been added, or by administration to mammals including humans. Factor production can be promoted.

  When the stem cell-derived growth factor production promoter of the present invention is administered in vivo, it can be administered as it is, but it is formulated in a composition for external use with an appropriate additive as long as the effects of the present invention are not impaired. It is preferable to provide them. The skin external composition of the present invention includes pharmaceuticals, quasi drugs, cosmetics and the like.

  Since the stem cell-derived growth factor production promoter of the present invention can promote the production of growth factor by stem cells, an external composition for skin containing the agent prevents, improves, and improves skin damage or damage, or obesity, and It is effective to treat.

  Here, skin damage or damage is not limited, but wrinkles, tarmi, stains, dullness, rough skin, thickened skin, open pores, acne scars, wounds (cuts, lacerations, stab wounds, bites, wounds, Bruises, abrasions, etc.), pressure ulcers, burns, scars, keloids, etc., including scalp and hair damage such as thinning and hair loss. Obesity includes accumulation of subcutaneous fat in the face contour, neck, abdomen, buttocks, thighs, etc., as well as cellulite due to subcutaneous fat deposition.

  When the stem cell-derived growth factor production promoter of the present invention is added to a pharmaceutical product, it is mixed with a pharmacologically and pharmaceutically acceptable additive and formulated into various preparations suitable for application to the affected area. Can be Pharmacologically and pharmaceutically acceptable additives include excipients, thickeners, tonicity agents, pH regulators, stabilizers, preservatives, preservatives depending on the dosage form and application. , Dispersants, emulsifiers, gelling agents, pigments, fragrances and the like can be used. A form suitable for the pharmaceutical product of the present invention is an external preparation, and examples thereof include an ointment, a cream, a gel, a liquid, and a patch. The ointment refers to a homogeneous semi-solid external preparation, and includes an oily ointment, an emulsion ointment, and a water-soluble ointment. The gel is an external preparation in which a water-insoluble component hydrate compound is suspended in an aqueous liquid. The liquid preparation refers to a liquid external preparation and includes lotions, suspensions, emulsions, liniments and the like.

  When the stem cell-derived growth factor production promoter of the present invention is blended into a quasi-drug or cosmetic, the dosage form is an aqueous solution system, a solubilization system, an emulsification system, a powder system, a powder dispersion system, an oil liquid system, a gel. Any of a system, an ointment system, an aerosol system, a water-oil two-layer system, or a water-oil-powder three-layer system may be used. In addition, the quasi-drug and cosmetics, together with the stem cell-derived growth factor production promoter, select various ingredients, additives, bases, etc. that are usually used in the composition for external use of skin according to the type, and mix appropriately However, it can be produced according to a technique known in the art. The form may be liquid, emulsion, cream, gel, paste, spray or the like. Examples of the ingredients include oils and fats (olive oil, coconut oil, evening primrose oil, jojoba oil, castor oil, hydrogenated castor oil, etc.), waxes (lanolin, beeswax, carnauba wax, etc.), hydrocarbons (liquid paraffin, squalene, Squalane, petrolatum, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid etc.), higher alcohols (myristyl alcohol, cetanol, cetostearyl alcohol, stearyl alcohol, behenyl alcohol etc.), esters (myristin) Isopropyl acid, isopropyl palmitate, cetyl octanoate, glyceryl trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc., organic acids (citric acid, lactic acid, α-hydroxyacetic acid, pyrrolidone cal Acid, etc.), sugars (maltitol, sorbitol, xylobiose, N-acetyl-D-glucosamine, etc.), proteins and protein hydrolysates, amino acids and salts thereof, vitamins, plant / animal extracts, various interfaces Examples include activators, humectants, ultraviolet absorbers, antioxidants, stabilizers, preservatives, bactericides, and fragrances.

  The types of quasi-drugs and cosmetics include, for example, lotions, emulsions, gels, cosmetics, general creams, sun creams, packs, masks, facial cleansers, cosmetic soaps, foundations, funniers, bath preparations, body lotions, Examples include body shampoos, hair shampoos, hair conditioners, hair restorers and the like.

  The content of the stem cell-derived growth factor production promoter in the composition for external use of the present invention is not particularly limited as long as it is an amount capable of exerting the growth factor production promoting action from the stem cells. For example, the dry solid weight of the extract 0.00001 to 10% by weight is preferable, and 0.0001 to 1% by weight is more preferable. The above amounts are merely examples, and may be appropriately set and adjusted in consideration of the type and form of the composition, the general usage amount, efficacy / effect, cost, and the like.

  On the other hand, in the case where growth factor production from stem cells is performed by culturing stem cells, the conditions and operations of the culturing method are the conditions that are conventional in the art, except that the stem cell-derived growth factor production promoter of the present invention is added to the medium. And according to the operation. The amount of the stem cell-derived growth factor production promoter added to the medium is 0.1 to 1000 μg / mL, preferably 1 to 100 μg / mL, as the concentration of the extract of Kinusagatake.

  For the culture of stem cells, a medium generally used for maintaining and proliferating undifferentiated stem cells may be used. For example, a basic medium containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins, fatty acids) necessary for the survival and growth of stem cells, such as Dulbecco's Modified Eagle Medium (D-MEM), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's Modified Eagle Medium: Nutrient Mixed F-12 (D-MEM / F-12), Glasgow M 's balanced salt solution) as needed to increase cell growth rate Contains tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, fibronectin, progesterone, selenite, B27-supplement, N2-supplement, ITS-supplement, antibiotics, etc. Prepared medium can be used.

  In addition to the above, it is preferable that serum is contained at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in the effects, it is preferable to use the serum after a lot check.

  Commercially available products include Mesenchymal stem cell basal medium manufactured by Invitrogen, Mesenchymal stem cell basal medium manufactured by Sanko Junyaku, MF medium manufactured by TOYOBO, Hank's balanced salt solution manufactured by Sigma, etc. Can be used.

  The incubator used for stem cell culture is not particularly limited as long as stem cells can be cultured. Examples thereof include flasks, petri dishes, dishes, plates, chamber slides, tubes, trays, culture bags, and roller bottles. .

  The incubator may be non-cell-adhesive or adhesive, and is appropriately selected according to the purpose. As the cell-adhesive incubator, for the purpose of improving the adhesion with cells, a cell-treated culture vessel treated with a cell support substrate using an extracellular matrix or the like may be used. Examples of the extracellular matrix include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, fibronectin and the like.

Stem cell culture conditions may be in accordance with normal conditions used for stem cell culture, and no special control is required. For example, the culture temperature is not particularly limited, but is about 30 to 40 ° C, preferably about 37 ° C. The CO ₂ gas concentration is, for example, about 1 to 10%, preferably about 2 to 5%. In addition, it is preferable to perform culture medium exchange once every 2 to 3 days, and it is more preferable to perform it every day. The culture conditions can also be set by varying as appropriate within the range in which the stem cells can survive and proliferate.

  The growth factor in the stem cell culture obtained by the above culture can be confirmed, for example, by measuring the amount of the gene. The measurement may be performed by extracting the total RNA in the cultured stem cells and measuring the amount of mRNA encoding the growth factor by a real-time polymerase chain reaction (RT-PCR) method. Alternatively, an antibody specific for a growth factor may be used to perform an immunoassay such as an enzyme immunoassay (ELISA, EIA), a fluorescence immunoassay, a radioimmunoassay (RIA), or a Western blot. Good.

  According to the present invention, there is also provided a method for producing a stem cell culture comprising the step of culturing stem cells in the presence of an extract of Kinusaganatake. Moreover, the growth factor contained in the stem cell culture obtained by this method may be isolated and purified. For example, a general method used for protein purification such as gel chromatography, ion exchange chromatography, affinity chromatography, hydrophobic chromatography, etc., desalting method, HPLC, electrophoresis method etc. alone or By using a suitable combination, the growth factor can be isolated and purified from the culture.

  The stem cell culture obtained by the above production method contains various growth factors at high concentrations. Here, the stem cell culture means any of culture supernatant, cultured stem cells, and disrupted cultured stem cells. The stem cell culture of the present invention can be applied to regenerative medicine and regenerative beauty by the method of isolating a growth factor from the culture as it is or directly injecting it into skin tissue or the like.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.
(Production Example 1) Preparation of hot water extract of Kinugasatake fruit Addition of 800 mL of purified water to 20 g of dried fruit of Kinugasatake fruit body, followed by extraction at 95-100 ° C for 2 hours, filtration, concentration of the filtrate and lyophilization 5.5 g of hot water extract of Kinugasatake was obtained.

(Production Example 2) Preparation of 50% ethanol extract of Kinusaganatake To 400 g of 50% (v / v)% aqueous ethanol solution was added to 20 g of dried fruit of Kinugasatake fruit body, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated. After drying, 7.2 g of a 50% ethanol extract of Kinugasatake was obtained.

(Production Example 3) Preparation of Kinugasatake ethanol extract 1 L of ethanol was added to 100 g of a dried fruit of Kinugasatake fruit body, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain an ethanol extract of Kinugasatake. Of 9.0 g was obtained.

(Example 1) Evaluation of growth factor production promoting effect from stem cells Human adult stem cells (derived from subcutaneous fat cells) cultured using mesenchymal stem cell growth medium (MF medium) (manufactured by TOYOBO) (DS Pharma Biomedical) 1 × 10 ⁶ seeds were prepared in a ⁶ cm dish, and an extract of Kinusagatake (Production Examples 1 to 3) was added as an evaluation sample so that the final concentration was 0.001%, and the culture was continued for 3 days. After 3 days of culture, the cells were collected, washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). Thereafter, RNA was reversely transcribed into cDNA using a 2-STEP real-time PCR kit (Applied Biosystems) and then the following growth factors (bFGF, IGF-1, TGF-β1, PDGFA) by ABI7300 (Applied Biosystems). And VEGFA) Real-time PCR (95 ° C .: 15 seconds, 60 ° C .: 30 seconds, 40 cycles) was performed using the amplification primer set, and the gene expression of each gene was confirmed. Other operations were carried out in accordance with established methods.

Primer set for bFGF:
Forward primer: TGGTATGTGGCACTGAAACGAA (SEQ ID NO: 1)
Reverse primer: TTCTGCCCAGGTCCTGTTTT (SEQ ID NO: 2)
Primer set for IGF-1:
Forward primer: AAGGAGGCTGGAGATGTATTGC (SEQ ID NO: 3)
Reverse primer: CGGACAGAGCGAGCTGACTT (SEQ ID NO: 4)
Primer set for TGF-β1:
Forward primer: CGCGTGCTAATGGTGGAAA (SEQ ID NO: 5)
Reverse primer: ATGCTGTGTGTACTCTGCTTGAACTT (SEQ ID NO: 6)
PDGFA primer set:
Forward primer: TCAGGAAGAAGCCAAAATTAAAAGA (SEQ ID NO: 7)
Reverse primer: GCAGGCGCACTCCAAATG (SEQ ID NO: 8)
Primer set for VEGFA:
Forward primer: CTCTCTCCCTGATCGGTGACA (SEQ ID NO: 9)
Reverse primer: GGAGGGCAGAGCTGAGTGTT (SEQ ID NO: 10)
GAPDH primer set:
Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO: 11)
Reverse primer: TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 12)

  The growth factor production promoting effect is expressed by the relative expression level of each growth factor gene (each growth factor) calculated as a ratio of the expression level of each growth factor mRNA in cells cultured without adding a sample to the expression level of GAPDH mRNA as an internal standard. The value of the factor gene expression level / GAPDH gene expression level was set to 1.0, and the relative expression level of each gene in cells cultured with the sample added was calculated and evaluated. The results are shown in Table 1.

  As shown in the results of Table 1, all the extract of Kinusaganatake (Production Examples 1 to 3) showed a remarkable effect of promoting growth factor production from stem cells. In addition to the stem cells used in this experimental example, a similar test was performed on bone marrow-derived stem cells, hematopoietic stem cells, and embryonic stem cells (ES cells), and a remarkable effect of promoting growth factor production from stem cells was observed. It was. Moreover, each growth factor production and secretion promotion effect were confirmed also in ELISA method. Further, in addition to the above extract (Production Examples 1 to 3), the same effect was observed for the extract extracted from the mycelium of Kinusagatake.

(Example 2) Product formulation example According to the formulation example shown below, lotions and creams containing the extract of Kinusagama manufactured in Production Examples 1 to 3 were prepared by a conventional method.
Formulation Example 1 Lotion Formulation Ingredient Amount (parts)
1 Kinugasatake extract of Production Examples 1 to 3 0.05
2 1,3-Butylene glycol 8.0
3 Glycerin 2.0
4 Xanthan gum 0.02
5 Citric acid 0.01
6 Sodium citrate 0.1
7 Ethanol 5.0
8 Methyl paraoxybenzoate 0.1
9 Polyoxyethylene hydrogenated castor oil 0.1
(40E.0.)
10 Fragrance 0.1
11 Purified water 84.52

  Components 1 to 6 and 11 and components 7 to 10 were uniformly dissolved, then both were mixed and filtered to prepare a lotion.

Formulation Example 2 Cream Formulation Ingredients Amount (parts)
1 Kinugasatake extract of Production Examples 1 to 3 0.03
2 Squalane 5.5
3 Olive oil 3.0
4 Stearic acid 2.0
5 Beeswax 2.0
6 Octyldodecyl myristate 3.5
7 Polyoxyethylene cetyl ether 3.0
(20E.0.)
8 Behenyl alcohol 1.5
9 Glycerol monostearate 2.5
10 Fragrance 0.1
11 Methyl paraoxybenzoate 0.2
12 Ethyl paraoxybenzoate 0.05
13 1,3-Butylene glycol 8.5
14 Purified water 68.12

  Components 2 to 9 were dissolved by heating and mixed, and kept at 70 ° C. to obtain an oil phase. Moreover, the component 1 and the components 11-14 were heat-dissolved and mixed, and it maintained at 75 degreeC and was set as the water phase. Next, the aqueous phase was added to the oil phase to emulsify, and the mixture was cooled while stirring. The component 10 was added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

INDUSTRIAL APPLICABILITY The present invention can be used in the field of manufacturing pharmaceuticals, quasi drugs, and cosmetics for the purpose of preventing, recovering, or treating skin damage or damage or obesity.

Claims (1)

A stem cell-derived growth factor gene expression promoter comprising, as an active ingredient, an extract of Kinugasatake, which belongs to the genus Kinupasatake.