JP6050033B2 - Differentiation inducer from stem cells to ectoderm cells - Google Patents

Description

  The present invention relates to an agent for inducing differentiation from stem cells to ectoderm cells, pharmaceuticals containing the agent, quasi-drugs, foods and drinks, and methods for producing ectoderm cells.

  A stem cell is a cell having both multipotency capable of differentiating into various cells and self-proliferation ability capable of maintaining multipotency (undifferentiated state) even after cell division. Among them, somatic stem cells exist in each tissue in the living body, and when the cells of the tissue are lost due to a disorder or disease or aging, the tissue homeostasis is supplied by supplying new cells. Is maintained. In addition, pluripotent stem cells such as ES cells (embryonic stem cells) and iPS cells (artificial pluripotent stem cells) are artificially created stem cells and have the ability to differentiate into all cell types that constitute the living body. (Multipotency) and unlimited proliferation.

  In recent years, in the field of advanced medicine including regenerative medicine, research on applying the properties of these stem cells to regeneration of organs and tissues has been actively carried out (Non-patent Document 1). For example, the mammalian eye, especially the retina, does not regenerate naturally once damaged. For this reason, there is no treatment method for retinal degeneration such as retinitis pigmentosa, and blindness results, and regenerative medicine using stem cells is expected. Against this background, recent advances in stem cell technology have made it possible to induce eye tissues and cells such as the retina (retinal pigment epithelium, nerve retina) and lens from mouse and human ES cells and iPS cells. In the future, it is expected that transplantation of these induced ocular tissues / cells will enable treatment of eye diseases for which there has been no effective therapeutic method (Non-Patent Documents 2 and 3).

  In Japan, there are about 100,000 people with spinal cord injury, and it is said that about 5,000 people are injured every year. In severe cases, the limbs hardly move, and people are forced to live on a bedridden or wheelchair. At present, no effective treatment has been established to restore the function lost by spinal cord injury. The reason is that nerve regeneration after injury is very unlikely in the central nervous system. For this reason, regenerative medicine using stem cells is also expected for spinal cord injury, and various differentiation induction techniques from stem cells to the central nervous system have already been established (Non-Patent Document 4). On the other hand, in order to realize regenerative medicine using the stem cells, it is essential to develop substances and techniques that efficiently control the differentiation of stem cells into target cells.

  In the development process of vertebrate early embryos, cell lineage differentiation called germ layer formation occurs, and three types of cell populations are formed: ectoderm, mesoderm, and endoderm. Of these, the ectoderm produces nervous system cells, sensory system cells, and epidermis. Therefore, if differentiation can be induced from stem cells to ectoderm, and further, cells and tissues derived from ectoderm, the potential for application to the treatment of the above-mentioned eye diseases and spinal cord injury is expanded.

  On the other hand, fucoidan is a kind of sulfate polysaccharide, and is a dietary fiber that is contained in a large amount of mucus in brown algae such as kombu, wakame and mozuku. Fucoidan is a compound in which dozens to hundreds of thousands of L-fucose are mainly linked by α1-2 and α1-4 bonds. So far, various bioactive functions have been found in this fucoidan. For example, Patent Document 1 describes that fucoidan exhibits type I pro-collagen production enhancing action and TGF-β1 production enhancing action in human skin fibroblasts. Patent Document 2 describes that fucoidan exhibits an IL-6 production-suppressing action in colonic epithelial cells and an effect of improving colitis lesions in in vivo and in vitro tests. However, so far, the effect of fucoidan on undifferentiated stem cells has been hardly studied.

JP 2003-313131 A JP2003-146888

Shinichi Nishikawa et al., Experimental Medicine Extra Number, 2008, Vol. 26, No. 5, pp. 74-80 Eiraku M, Takata N, Ishibashi H, Kawada M, Sakuraka E, Okuda S, Sekiguchi K, Adachi T, Sasai Y. (2011) Nature 7; 472 (7341): 51-6 Osaka F, Jin ZB, Hirami Y, Ikeda H, Danjo T, Watanabe K, Sasay Y, Takahashi M. et al. (2009) J Cell Sci. 122 (Pt 17): 3169-79 Ueno M, Matsumura M, Watanabe K, Nakamura T, Osakaka F, Takahashi M, Kawasaki H, Kinoshita S, Sasai Y. (2006) Proc Natl Acad Sci USA. 20: 9554-9

  The object of the present invention is to find a substance having differentiation-inducing activity from stem cells to ectoderm cells, and to prevent or improve or treat eye diseases and neurological diseases that have been difficult to treat so far. It is in providing compositions, such as food-drinks.

  As a result of intensive studies to solve the above problems, the present inventors have found that the addition of fucoidan to a stem cell culture system enhances the expression of ectodermal cell-specific marker genes in stem cells. The inventors have confirmed that differentiation into nerve cells or eye-like structures is promoted, and have completed the present invention.

That is, the present invention includes the following inventions.
(1) An agent for inducing differentiation from stem cells to ectoderm cells, comprising fucoidan as an active ingredient.
(2) The differentiation inducer according to (1), wherein the ectoderm cells are sensory organ cells or nervous cells.
(3) The differentiation-inducing agent according to (2), wherein the sensory organ cells are constituent cells of the eye.
(4) The differentiation inducer according to (3), wherein the constituent cells of the eye are retina, lens, corneal epithelium or iris cells.
(5) A pharmaceutical product or food or drink comprising the differentiation inducer according to any one of (1) to (4).
(6) The pharmaceutical or food / beverage product according to (5) for the treatment or prevention of eye diseases or neurological diseases.
(7) A method for inducing differentiation from stem cells to ectoderm cells, comprising culturing stem cells in the presence of fucoidan and inducing differentiation into ectoderm cells.
(8) A method for producing ectoderm cells, comprising a step of culturing stem cells in the presence of fucoidan to induce differentiation into ectoderm cells.
(9) An ectoderm cell produced by the method according to (8).

  According to the present invention, an agent for inducing differentiation from stem cells to ectoderm cells is provided. The differentiation inducer of the present invention can induce differentiation from stem cells to ectodermal cells, for example, eye constituent cells such as the lens and retina, and nerve cells, so that cataracts, glaucoma, retinal detachment and other eye diseases It can be used as a pharmaceutical or a food or drink for fundamentally preventing, improving or treating neurological disorders such as spinal cord injury. In addition, ectoderm cells produced by inducing differentiation from stem cells using the differentiation-inducing agent of the present invention can be applied to regenerative medicine in which the function is restored by transplantation to an eye or nerve injury site. Become. Furthermore, the differentiation-inducing agent of the present invention can also be used as a reagent for basic research of differentiation of eye constituent cells such as lens and retina and nerve cells.

The present invention is described in detail below.
The differentiation-inducing agent (hereinafter sometimes referred to as “ectodermal cell differentiation-inducing agent”) that induces differentiation from stem cells to ectoderm cells of the present invention contains fucoidan as an active ingredient.

  In the present invention, “differentiation induction from stem cells to ectoderm cells” refers to inducing and promoting differentiation of ectoderm cells from stem cells at a living body level or a culture level to increase ectoderm cells.

  In the present invention, “stem cells” refer to various stem cells that can differentiate into ectoderm cells, such as embryonic stem cells (ES cells), bone marrow, skin, subcutaneous fat, brain, retina, nasal odor bulb, and other tissues. It includes cells in an undifferentiated state (collectively referred to as “somatic stem cells”), induced pluripotent stem cells (iPS cells), and the like. Examples of ES cells include ES cells established by culturing early embryos before implantation, ES cells established by culturing early embryos produced by nuclear transfer of somatic cell nuclei, And ES cells obtained by modifying genes on the chromosomes of those ES cells using genetic engineering techniques. Such ES cells can be prepared by, for example, a known method, but can be obtained from a predetermined institution, and further commercially available products can be purchased. In addition, these stem cells may be primary cultured cells, subcultured cells, or frozen cells.

  The ectoderm cell differentiation-inducing agent of the present invention can be applied to all mammals as long as they have equivalent characteristics regarding the direction of differentiation of stem cells and the process of differentiation. For example, the effect can be exerted on stem cells of mammals such as human, monkey, mouse, rat, guinea pig, hamster, rabbit, cat, dog, horse, cow, sheep, goat and pig.

  The ectoderm is mainly divided into superficial ectoderm and neuroectoderm. In the present invention, “ectodermal cell” refers to both superficial ectodermal cells and neuroectodermal cells. Ectodermal cells (such as nerve and skin common progenitor cells) formed in the early stages of differentiation from pluripotent cells such as cells and ES cells, as well as cells that make up nerves and sensory organs that differentiate and develop from ectoderm It is a concept that includes skin cells and the like. The ectoderm-derived cells include sensory organ cells (retina, inner ear cells, etc.), nervous system cells (neural stem cells, neurons (eg, forebrain neurons, midbrain neurons, cerebellar neurons, hindbrain neurons, spinal cord) Nerve cells, etc.), neural tube cells, neural crest cells, etc.), epidermal cells (epidermal cells, lens epithelial cells, etc.) and the like.

  Whether the cells induced to differentiate by the differentiation-inducing agent of the present invention are the above-mentioned ectoderm cells can be confirmed by, for example, expression of various neural cell markers and sensory organ cell markers. Examples of neuronal cell markers and sensory organ cell markers that can be used in the present invention include Otx2 (ectodermal / neural cell / eye differentiation marker: W02005 / 123902, Nature 1992 Aug 20; 358 (6388): 687. -90. Nested expression domains of four homeobox genes in developing rostral brain. Simeone A, Acampora D, Gulisano M, Stornaiuolo A, Boncinelli E. SourceInternational Institute of Genetics and Biophysics, CNR, Naples, Italy.), Sox (Neuronal cell / eye differentiation marker: W02005 / 123902), Six3 (Forebrain region / eye differentiation marker: Cereb Cortex. 2008 Mar; 18 (3): 553-62. Epub 2007 Jun 18. Six3 controls the neural progenitor. status in the murine CNS. Applolloni I, Calzolari F, Corte G, Perris R, Malatesta P., Pax6 (neural progenitor cells, ocular differentiation marker: W02005 / 123902), Tuj-1 (neural cell marker: Mod Path. Mod Path. 2007 Jul; 20 (7): 742-8.Epub 2007 Apr 27. Expression of Sox 2 in texture and imperfect teratomas of central nervous system.Phi JH, Park SH, Paek SH, Kim SK, Lee YJ, Park CK, Cho. J Neurosci Res.2002 Nov 1; 70 (3): 327-34. Expression patterns of impulse neuronal markers PSA-NCAM, CRMP-4 and NeuroD in the hippocampus of young adult and edented rodents. Seki T. ), Crystallin (crystal, lens marker) and the like.

  Fucoidan used in the present invention is a kind of sulfate polysaccharide. More specifically, examples of fucoidan that can be used in the present invention include U-fucoidan, F-fucoidan, and G-fucoidan, but are not limited thereto. Moreover, these fucoidans may use commercially available products.

  The fucoidan used in the present invention may be the above-mentioned fucoidan separated from a plant or a fucoidan-containing material. Examples of the fucoidan-containing material include algae belonging to kelp, scabbard, nagaromomo, etc. such as mozuku, kurome, kajime, and arame. Further, fucoidans derived from echinoderms, for example, fucoidans derived from sea urchin, starfish, sea cucumber and the like may be used.

  Fucoidan has an effect of inducing differentiation from stem cells to ectoderm cells at the culture level or the living body level. Therefore, the ectodermal cell differentiation inducing agent of the present invention can be obtained by culturing stem cells in a stem cell differentiation inducing medium to which an effective amount thereof has been added, or by administering them to mammals including humans. Differentiation into lineage cells can be induced.

  When differentiation induction from stem cells to ectoderm cells is performed by culturing stem cells, the conditions and operations of the culture method are the conditions that are conventional in the art, except that the ectoderm cell differentiation inducer is added to the medium. And according to the operation. The amount of the ectoderm cell differentiation inducer added to the medium is 1 to 1000 μg / L, preferably 50 to 200 μg / L, as the concentration of fucoidan.

  For the culture of stem cells, a medium having a composition suitable for the purpose of stem cell maintenance or differentiation induction is used. As the stem cell differentiation induction medium, specifically, a basic medium (for example, Dulbecco's modified Eagle ') containing components (inorganic salts, carbohydrates, hormones, essential amino acids, non-essential amino acids, vitamins) necessary for viable growth of cells. s medium (D-MEM), Minimum Essential Medium (MEM), RPMI 1640, Basal Medium Eagle (BME), Dulbecco's modified Eagle-s medium-N Essential Meidum (Glasgow MEM), Hank's balanced salt solution, MC In B15 medium), basic fibroblast growth factor (bFGF), epidermal growth factor (EGF), at least one added medium was growth factors such as leukocyte growth factor (LIF) is used. In addition, in order to increase the cell growth rate, the medium contains tumor necrosis factor (TNF), vitamins, interleukins, insulin, transferrin, heparin, heparan sulfate, collagen, bovine serum albumin as necessary. (BSA), fibronectin, progesterone, selenite, B27-supplement, N2-supplement, ITS-supplement, etc. may be added, and antibiotics may be added. Each component of the medium is used after being sterilized by a suitable method.

  In addition to the above, it is preferable that serum is contained at a content of 1 to 20%. However, since serum has different components depending on the lot and there are variations in the effects, it is preferable to use the serum after a lot check.

  In order to maintain the undifferentiated state, stem cells are cultured in a stem cell maintenance medium (medium supplemented with LIF, L-glutamic acid or the like in a basic medium) using MEF cells or the like treated with mitomachine C as feeder cells, Stem cells can be differentiated into ectodermal cells by inoculating stem cells that have been cultured in an undifferentiated state on another feeder cell and adding various factors that promote differentiation to culture. Do. Although it does not specifically limit as a feeder cell, The ST2 cell and PA6 cell which are mouse | mouth stromal cells are preferable. Examples of various factors that promote differentiation include, but are not limited to, DEX (DEXAMETHASON), bFGF (basic Fibroblast Growth Factor), CT (Cholera toxin), and EDN3 (Endothelin-3).

  A disposable petri dish is preferable as a container used for culture of stem cells and differentiation induction from stem cells to ectoderm cells. In addition, it is preferable to perform culture medium exchange once every 2 to 3 days, but it is more preferable to perform it daily. In addition, differentiation induction from stem cells into eye tissues including the cornea, lens (lens) and retina is preferably performed for 12 days or more.

  The ectodermal cell differentiation inducing agent of the present invention can be administered as it is in the living body, but within a range that does not impair the effects of the present invention, it is suitable for drugs, quasi drugs, foods and beverages, etc. It can mix | blend and use for a composition.

  When providing the ectodermal cell differentiation inducing agent of the present invention as a pharmaceutical product, fucoidan is acceptable in terms of pharmaceutical formulation and appropriately selected according to the dosage form, carrier, excipient, diluent for formulation , Binders, lubricants, coating agents, disintegrants or disintegration aids, stabilizers, preservatives, preservatives, extenders, dispersants, wetting agents, buffers, solubilizers or solubilizers, isotonic Add various agents, pH adjusters, propellants, coloring agents, sweeteners, flavoring agents, fragrances, etc. as appropriate, and make various preparations that can be systemically or locally administered by various known methods, orally or parenterally. What is necessary is just to prepare.

  For preparations for oral administration, for example, excipients such as starch, glucose, sucrose, fructose, lactose, sorbitol, mannitol, crystalline cellulose, magnesium carbonate, magnesium oxide, calcium phosphate, dextrin; carboxymethylcellulose, carboxymethylcellulose calcium, starch Disintegrants or disintegration aids such as hydroxypropylcellulose; binders such as hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, gum arabic, and gelatin; lubricants such as magnesium stearate, calcium stearate, and talc; hydroxypropylmethylcellulose Coating agents such as white sugar, polyethylene glycol, titanium oxide; petrolatum, liquid paraffin, polyethylene glycol, gelatin, Olin, glycerin, purified water, but may be made of a hard fat base such as such as, but not limited to.

  For preparations for parenteral administration, solvents such as distilled water, physiological saline, ethanol, glycerin, propylene glycol, macrogol, alum water, vegetable oil; isotonic agents such as glucose, sodium chloride, D-mannitol; inorganic acids , PH adjusters such as organic acids, inorganic bases or organic bases can be used, but are not limited thereto.

  The form of the pharmaceutical of the present invention is not particularly limited. For example, tablets, sugar-coated tablets, capsules, troches, granules, powders, liquids, pills, emulsions, syrups, suspensions, elixirs Oral preparations, eye drops, injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drops, suppositories, ointments, lotions, sprays, transdermal Non-oral agents such as skin absorbents, transmucosal absorbents, patches and the like can be mentioned. Moreover, you may make it the dry product re-dissolved when using. The pharmaceutical of the present invention includes drugs used for animals, that is, veterinary medicine.

The content of fucoidan in the preparation is not particularly limited, but is preferably in the range of 0.001 to 30% by weight, more preferably 0.01 to 10% by weight in terms of fucoidan solid content, based on the total weight of the preparation.
If it is less than 0.001% by weight, it is difficult to obtain the effect, and even if it exceeds 30% by weight, the effect is hardly increased. In addition, the method for adding the active ingredient in the formulation may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  Among the above-mentioned pharmaceutical forms, it is preferable to use eye drops. The content of fucoidan can be appropriately changed according to the indication disease and the like. In the eye drops, various additives that can be usually blended in eye drops can be appropriately blended. Examples of additives include buffers (borate buffer, citrate buffer, tartrate buffer, etc.), isotonic agents (sugars such as glucose, mannitol, sorbitol, glycerin, polyethylene glycol, propylene glycol) Polyhydric alcohols such as sodium chloride, salts such as sodium chloride), preservatives (benzalkonium chloride, chlorhexidine gluconate, methyl paraoxybenzoate, etc.), thickeners (hydroxyethylcellulose, hydroxypropylcellulose, methylcellulose, carboxymethylcellulose, etc.) ), Stabilizers, antioxidants, pH adjusters, chelating agents and the like.

  The eye drops can be prepared according to a known aqueous solution preparation method. For example, after adding the above-mentioned various additives to a solvent acceptable for pharmaceutical preparation (eg, aqueous solvent such as sterilized purified water and sterilized buffer), fucoidan is dissolved to obtain a homogeneous aqueous solution. The eye drops are prepared by aseptic operation or by sterilization by an appropriate manufacturing process.

  The ectodermal cell differentiation inducer of the present invention is effective as a pharmaceutical for improving and preventing eye diseases or neurological diseases because fucoidan as an active ingredient has an action of promoting differentiation from stem cells to ectoderm cells. It is.

  The eye disease is not particularly limited as long as it is a disease caused by degeneration or damage of the lens, cornea, retina, and optic nerve. For example, retinal diseases (retinal detachment, retina choroiditis, retinal artery occlusion, retinal vein occlusion, diabetes mellitus) Retinopathy, hypertensive retinopathy, age-related macular degeneration, retinitis pigmentosa, central serous chorioretinopathy, etc.), optic nerve diseases (glaucoma, papilledema, optic neuritis, optic atrophy, etc.), corneal diseases (bacterial) Corneal ulcer, corneal mycosis, corneal herpes, etc.), cataract (senile, diabetic, concomitant, traumatic cataract, etc.) and the like.

  The neurological disorder is not particularly limited as long as it is a disorder caused by nervous system cells. For example, spinal cord injury, Alzheimer's disease, spinocerebellar degeneration, Huntington's chorea, amyotrophic lateral sclerosis, spinal muscular atrophy Parkinson's disease, multiple sclerosis, cerebrovascular disorder (cerebral infarction, stroke, cerebral aneurysm), dementia and movement disorder due to cerebrovascular disorder, epilepsy, brain injury and the like.

  The pharmaceutical of the present invention functions as a prophylactic agent that suppresses the onset of the above diseases and / or a therapeutic agent that improves to a normal state.

  When the pharmaceutical of the present invention is used as a pharmaceutical for the prevention and / or treatment of the above-mentioned diseases, it is orally or parenterally administered over a wide range of doses to mammals such as humans, mice, rats, rabbits, dogs and cats. Can be administered.

  The dosage of the pharmaceutical product of the present invention can be appropriately determined according to the type of disease, the age, sex, weight, and symptom of the subject of administration. For example, when orally administered to an adult, the daily dose is 1 to 1000 mg, preferably 5 to 200 mg as fucoidan.

  Moreover, the ectoderm cell differentiation-inducing agent of the present invention can be added to food and drink. In the present invention, the food and drink includes health food, functional food, nutritional supplement, or food for specified health use. Furthermore, the food / beverage products of this invention include the pet food and feed used for mammals other than a human being. In particular, it is advantageous in that it can be taken on a daily basis when it is necessary for long-term use such as prevention of Alzheimer's disease or the like or treatment of nerve damage.

  The form of the food or drink may be any form suitable for edible use, for example, solid, liquid, granular, granular, powder, capsule, cream, or paste.

  Specific types of food and drink include breads such as bread and confectionery bread; noodles such as buckwheat, udon, pasta, Chinese noodles and instant noodles; baked confectionery such as candy, chewing gum, chocolate, biscuits and cookies, jelly Confectionery such as ice cream, ice sherbet, shaved ice; dairy products such as processed milk, fermented milk, yogurt, butter, cheese; fishery and livestock processed foods such as kamaboko, chikuwa, ham, sausage; margarine, mayonnaise , Shortening, whipped cream, dressing and other fats and oils processed foods; seasonings such as soy sauce, sauce, vinegar, mirin; soft drinks, carbonated drinks, beauty drinks, nutrition drinks, fruit drinks, milk drinks, etc. (these Including, but not limited to, beverage concentrate concentrates and powders for preparation).

  The food and drink of the present invention may be appropriately mixed with additives that are usually used depending on the type. Any additive that is acceptable in food hygiene can be used as the additive. For example, sweeteners such as glucose, sucrose, fructose, isomerized liquid sugar, aspartame, stevia; citric acid, malic acid, Acidic agents such as tartaric acid; excipients such as dextrin and starch; binders, diluents, fragrances, colorants, buffers, thickeners, gelling agents, stabilizers, preservatives, emulsifiers, dispersants, suspensions Agents, preservatives and the like.

  The amount of fucoidan in the food and drink of the present invention may be an amount that can exert differentiation promoting action from stem cells to ectoderm cells, but the general intake of the target food and drink, the form of the food and drink, efficacy What is necessary is just to set suitably in consideration of an effect, taste, palatability, cost, etc.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.

(Example 1) Induction of differentiation of stem cells (mouse ES cells) into ectodermal cells by fucoidan (1) Preparation of ES cells MEF cells (Mouse embronic fibroblast) treated with MMC (mitomycin C) in a gelatin-coated 35 mm dish ) Was cultured in a confluent state, and 10 to 20 × 10 ⁴ mouse ES cells were seeded thereon, and precultured at 37 ° C. in a 5% CO ₂ incubator. The medium was supplemented with chemicon ES cell additive factor (L-glutamine solution, 2-mercaptoethanol solution, nucleoside solution, non-essential amino acid solution, ESGRO) in DMEM at the recommended concentration, and then LIF (leukemia inhibitory factor) was added. An ES cell undifferentiated maintenance medium (hereinafter referred to as “ES cell medium”) supplemented with 1000 units / mL and 15% FBS (Fetal Bovine Serum) was used.

  The ES cells and MEF cells cultured by the above method were detached from the petri dish by trypsin treatment, and seeded again in a 35 mm petri dish treated with gelatin. After seeding, the mixture was allowed to stand for 30 minutes, and then the medium was collected in another tube. At this time, MEF cells with strong adhesiveness remain in the petri dish, and only ES cells are collected. The following experiment was performed using the undifferentiated ES cells collected in this manner.

(2) Induction of differentiation of stem cells into ectoderm cells by fucoidan in a culture system using feeder cells ES cells separated from MEFs were seeded again on MMC-treated MEF cells cultured on 24 well plates (5 × 10 ⁴ cells / well), a medium obtained by removing LIF from the medium for ES cells was cultured. At that time, commercially available fucoidan (manufactured by Yaizu Suisan Chemical Co., Ltd., fucoidan YSK (NB)) was added at a concentration of 25, 50, and 100 μg / mL.

  After 4 days of culture, only ES cells were collected, the cells were washed twice with PBS (−), and RNA was extracted from the cells with Trizol Reagent (Invitrogen). 2-STEP real-time PCR kit (Applied Biosystems) was used to reverse-transcribe RNA into cDNA and then ABI7300 (Applied Biosystems) was used for real-time PCR (95 ° C .: 15 seconds, 60 ° C.:30) 40 cycles per second), and Nanog (undifferentiated marker: Cell Res. 2007 Jan; 17 (1): 42-9. Revue. Nanog and transcribion of the tropics in the tropics of T cells. (Ectoderm / nerve cell marker), Sox1 (nerve cell marker), Six3 (forebrain region, eye differentiation) The expression of each marker gene of (marker) was confirmed. Other operations were performed in accordance with a prescribed method.

Primer set for Nanog (undifferentiation marker):
ATGCCTGCAGGTTTTTCATCC (SEQ ID NO: 1)
GAGGCAGGTCTTCAGAGGAA (SEQ ID NO: 2)
Primer set for Otx2 (ectoderm, nerve cell marker):
GAAAATCAACTTGCCAGAATCCA (SEQ ID NO: 3)
GCGGCACTTAGCGCTTCTGAT (SEQ ID NO: 4)
Sox1 (nerve cell marker) primer set:
GCCGAGTGGAAGGTCATGT (SEQ ID NO: 5)
TGTAATCCGGGTGTTCCTTCAT (SEQ ID NO: 6)
Sixx (Forebrain region) primer set:
CCCTAGATCTCTATTTCCTCCCACTTC (SEQ ID NO: 7)
GAAGTAGGGAGCAGTGGTGAGAA (SEQ ID NO: 8)
GAPDH (internal standard) primer set:
CCGTGTTCTCACCCCCAAT (SEQ ID NO: 9)
TGCCTGCCTTCACCACCTTCT (SEQ ID NO: 10)

  Regarding the expression of the marker gene in each cell, the relative expression level (expression level of each gene) was calculated as a ratio of the expression level of each gene mRNA in cells cultured without adding fucoidan to the expression level of GAPDH mRNA as an internal standard. / GAPDH expression level) was set to 1.0. On the other hand, the value of the relative expression level of each gene in each cell induced by addition of fucoidan was calculated and evaluated. The results are shown in Table 1.

  As shown in Table 1, the expression of Nanog, an undifferentiated marker, was suppressed depending on the concentration of fucoidan. On the other hand, it has been clarified that the expression of ectodermal and neuronal markers Otx2 and Sox1 is promoted. In addition, the expression of Six3, a gene whose expression is promoted in the forebrain region, was also promoted during the development of the early embryo among the ectoderm.

(3) Induction of differentiation of stem cells into ectoderm cells by fucoidan in a culture system that does not use feeder cells Seed directly (without MEF cells) on gelatin-coated 24-well plates of undifferentiated ES cells separated from MEFs (5 × 10 ⁴ cells / well) In the same manner as above, the cells were cultured using a medium obtained by removing LIF from the ES cell medium, and fucoidan at each concentration was added. After 4 days of culture, RNA was collected, and expression of each marker gene of Nanog (undifferentiation marker), Otx2 (ectodermal / neural cell marker), Sox1 (neural cell marker), and Six3 (forebrain region marker) was confirmed. The expression of each marker gene was analyzed by real-time PCR. The results are shown in Table 2.

  As shown in Table 2, as in the case of (2), Nanog expression suppression and Otx2, Sox1 and Six3 expression promotion were confirmed.

(4) Induction of differentiation of stem cells into ectoderm cells by fucoidan in a culture system for forming EBs Undifferentiated mouse ES cells separated from MEFs were suspended in a medium for ES cells excluding LIF, and 2000 cells / 20 μL A hanging drop was formed at a cell concentration to prepare an EB (embryoid body). At that time, fucoidan at each concentration was added, and RNA was collected after 4 days of culture. Nanog (undifferentiation marker), Otx2 (ectodermal / neural cell marker), Sox1 (neural cell marker), Six3 (forebrain region marker) The expression of each marker gene was analyzed by real-time PCR. The results are shown in Table 3.

  As shown in Table 3, as in the case of (2), Nanog expression suppression and Otx2, Sox1 and Six3 expression promotion were confirmed.

  As described above (Tables 1 to 3), in any culture system (culture system using feeder cells, culture system not using feeder cells, culture system forming EB), fucoidan maintains undifferentiated mouse ES cells. While promoting differentiation into ectoderm cells.

(Example 2) Induction of differentiation of stem cells (mouse ES cells) into neurons by fucoidan There is a technique for inducing differentiation of mature neural cells by co-culturing ES cells with various stromal cells in serum-free culture. Established (Patent No. 4294482; Kawasaki H, Mizuseki K, Nishikawa S, Kaneko S, Kuwana Y, Nakanishi S, Nishikawa SI, O. d .; Nc. dopaminergic neuros from ES cells by strategic cell-derived inducing activity). When fucoidan was added to this neural differentiation induction system, induction into mature neurons was promoted.

  Mouse undifferentiated ES cells isolated from MEF were seeded at a concentration of 500 cells / well on ST2 cells (mouse bone marrow-derived stromal cells) cultured to confluence on a 24-well plate, and 10% KSR (KnockOut. Serum Replacement) was added to G-MEM. The cells were cultured in a neuronal differentiation induction medium supplemented with 2 mM L-glutamine, 1 mM pyruvate, 0.1 mM 2-mercaptoethanol solution, and 0.1 mM non-essential amino acid solution. At that time, 100 μg / mL fucoidan was added.

  12 days after differentiation induction, ST2 cells and ES cells were collected, and each marker gene of Pax6 (neural progenitor cell marker), Tuj-1 (neural cell marker), and Map2 (mature neuronal cell marker), which are neuronal differentiation marker genes, was collected. Expression was analyzed by real-time PCR using the following primer sets.

Primer set for Pax6 (neural progenitor cell marker):
GCACCAAAGGGTCCATGC (SEQ ID NO: 11)
TGGGGGGTGGATGGAAG (SEQ ID NO: 12)
Tuj-1 (nerve cell marker) primer set:
CTCAAAATGTCATCCACCTT (SEQ ID NO: 13)
GTGAACTCCATCTCATCCAT (SEQ ID NO: 14)
Primer set for Map2 (mature neural cell marker):
ACTCAGCAACGTCTCCATTT (SEQ ID NO: 15)
GTATTCACAAGCCCTGCCTTA (SEQ ID NO: 16)

  Table 4 shows the analysis results of the expression of each marker gene by real-time PCR.

  As shown in Table 4, it was confirmed that the addition of fucoidan significantly promotes the expression of each neuronal differentiation marker. As described above, fucoidan significantly promoted differentiation from ES cells to neurons.

(Example 3) Induction of differentiation of stem cells (mouse ES cells) into eye-like structures by fucoidan A system for inducing differentiation of melanocytes has been established by co-culturing ES cells with ST2 cells which are stromal cells ( Yamane T, Hayashi S, Mizuguchi M, Yamazaki H, Kunisada T., Dev Dyn. 1999 Dec; 216 (4-5): 450-8.Delivery of melocyticles. In this differentiation induction system, it is known that various cells such as cardiomyocytes and blood cells are differentiated in addition to melanocytes. Fucoidan was added to such a system in which various cells differentiated, and the following differentiation induction test was performed.

  Mouse undifferentiated ES cells separated from MEFs were seeded at a concentration of 500 cells / well on ST2 cells cultured to confluence in 24 well plates, and 10% FBS, 100 nM dexamethasone, 20 pMb FGF, 10 pM cholera toxin, 100 ng / 100% in α-MEM. Differentiation was promoted with a differentiation induction medium containing mL endothelin-3. At that time, 100 μg / mL fucoidan was added.

  FIG. 1 shows the results of the differentiation induction test. In the fucoidan-free group, cells having various morphologies began to appear on the 12th day of induction. On the other hand, in the fucoidan addition group, a large number of structures having pigments began to appear around the colony at the 12th day of induction.

  A system for inducing eye-like structures including retinal pigment epithelial cells and lens (lens) from ES cells has been established (Hirano M, Yamamoto A, Yoshimura N, Tokunaga T, Motoshima T, Ishizaki K, Hoshik K, Yoshik K, Yamazaki H, Hayashi S, Kunisada T., Dev Dyn., 2003 Dec; 228 (4): 664-71. Generation of structures and circulators and retincells. When the morphology of the colony was observed with a microscope, the structure formed by adding fucoidan was very similar to the eye-like structure reported in the above literature.

  On the 12th day of induction of differentiation, cells were collected, and Otx2 (forebrain region, ocular differentiation marker), Six3 (forebrain region, ocular differentiation marker), Pax6 (eye differentiation marker), which are eye differentiation marker genes. The expression of each marker gene of marker) and crystallin (lens marker) was analyzed by real-time PCR using the following primer sets.

Primer set for Otx2 (forebrain region, eye differentiation marker):
GAAAATCAACTTGCCAGAATCCA (SEQ ID NO: 3)
GCGGCACTTAGCGCTTCTGAT (SEQ ID NO: 4)
Primer set for Six3 (forebrain region, eye differentiation marker):
CCCTAGATCTCTATTTCCTCCCACTTC (SEQ ID NO: 7)
GAAGTAGGGAGCAGTGGTGAGAA (SEQ ID NO: 8)
Pax6 (eye differentiation marker) primer set:
GCACCAAAGGGTCCATGC (SEQ ID NO: 11)
TGGGGGGTGGATGGAAG (SEQ ID NO: 12)
Crystalline (lens marker) primer set:
TGGCTGCTGGATGCTCTTAG (SEQ ID NO: 17)
CCGCGACGCAGGGAAGTA (SEQ ID NO: 18)

Table 5 shows the analysis results of the expression of each marker gene by real-time PCR.

  As shown in Table 5, it was confirmed that addition of fucoidan promotes the expression of ocular developmental markers (Otx2, Six3, Pax6, Crystallin).

  As described above, fucoidan promotes the induction of ES cells to eye-like structures including retinal pigment epithelium and lens.

(Example 4) Induction of differentiation of stem cells (human iPS cells) into ectodermal cells by fucoidan (1) Preparation of human iPS cells MEF cells treated with MMC (mitomycin C) were confluent in a gelatin-coated 60 mm petri dish. A cell mass of human iPS cells which had been cultured in a state and thawed thereon was seeded, and precultured at 37 ° C. in a 5% CO ₂ incubator. As the medium, an iPS cell undifferentiated maintenance medium (hereinafter referred to as “iPS cell medium”) obtained by adding bFGF at a concentration of 5 ng / mL to iPSellon manufactured by Cardio Inc. was used.

  The iPS cells cultured by the above method were cut and recovered using invitrogen EZPassage, and then seeded again on MMC-treated MEF cells cultured on a 24-well plate, and bFGF was transferred from the iPS cell culture medium. Culture was performed using the removed medium. At that time, fucoidan was added at a concentration of 100 μg / mL.

  RNA was collected after 4 days of culture, and expression of each marker gene of Nanog (undifferentiation marker), Otx2 (ectodermal / neural cell marker), and Sox1 (neural cell marker) was performed by real-time PCR using the following primer sets. Analyzed. The results are shown in Table 6.

Nanog (undifferentiated marker) primer set:
CCCTCCTCCATGGATCTGCTT (SEQ ID NO: 19)
AAGTGGGTTGTTTGCCCTTTG (SEQ ID NO: 20)
Primer set for Otx2 (ectoderm, nerve cell marker):
TTCACTCGGGCGCAGCTAG (SEQ ID NO: 21)
CCATACCTGCACCCTCGACTC (SEQ ID NO: 22)
Sox1 (nerve cell marker) primer set:
GGTCAAACGGCCCATGAAC (SEQ ID NO: 23)
TGATCTCCGAGTTGTGCATCTTT (SEQ ID NO: 24)
Sixx (Forebrain region) primer set:
GTATTCCGCTCCCCCCTAGA (SEQ ID NO: 25)
TGGTGAGAATCGGCGAAGTT (SEQ ID NO: 26)
GAPDH (internal standard) primer set:
TGCACCACCAACTGCCTTAGC (SEQ ID NO: 27)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 28)

  As shown in Table 6, as in the case of using mouse ES cells, Nanog expression suppression and Otx2, Sox1 and Six3 expression promotion were confirmed.

  As described above, fucoidan also has an effect of promoting ectodermal differentiation induction on human iPS cells.

(Example 5)
A system for inducing differentiation of neural cells from human or mouse somatic stem cells has been established (Stem Cells Dev. 2008 Oct; 17 (5): 909-16. Neuronal differentiation potential human sensitization. E, Marconi S, Pignatelli A, Ciffelli P, Galie M, Sbarbati A, Krapera M, Belluzzi O, Bonetti B. Source Department of Neurological. When fucoidan is added to these differentiation induction systems, differentiation into neurons is significantly promoted, and fucoidan also differentiates into somatic stem cells as well as ectoderm, as in the case of using ES cells and iPS cells. Significantly promoted.

  In addition, when the differentiation induction test described in Examples 1 to 5 was performed using an extract of a plant known to contain fucoidan instead of fucoidan, similarly, stem cells to ectodermal cells, ocular constituent cells , Showed the effect of promoting differentiation into nerve cells.

  The ectodermal cell differentiation inducer of the present invention can efficiently induce differentiation of ectodermal cells such as ocular constituent cells and nerve cells from stem cells. Differentiated eye-like tissues and nerve cells can be used in the field of regenerative medicine such as transplantation to a damaged site, use as an artificial nerve / artificial retina. It can also be used in the field of manufacturing foods and drinks such as pharmaceuticals, quasi drugs, functional foods and supplements for the fundamental treatment of eye diseases and neurological diseases such as cataracts, glaucoma, and retinal detachment.

FIG. 1 shows the results of a test for inducing differentiation from an ES cell into an eye-like structure using fucoidan (top row: stereomicroscopic image of a culture petri dish after 12 days of culture in the fucoidan-free group, second row from the top: fucoidan-free. Optical microscope image (phase difference (left) and bright field (right)) of the culture dish after 12 days of culture of the group, third from the top: stereomicroscopic image of the culture dish after 12 days of culture in the fucoidan addition group, bottom: An optical microscope image (phase difference (left) and bright field (right)) of a culture dish after 12 days of culture in the fucoidan addition group.

Claims (7)

An agent for inducing differentiation from pluripotent stem cells to ectoderm cells, comprising fucoidan as an active ingredient. The differentiation inducer according to claim 1, wherein the ectoderm cells are sensory organ cells or nervous system cells. The differentiation-inducing agent according to claim 2, wherein the sensory organ cells are constituent cells of the eye. The differentiation-inducing agent according to claim 3, wherein the constituent cells of the eye are cells of the retina, lens, corneal epithelium or iris. A pharmaceutical product for treating or preventing ophthalmic diseases, comprising the differentiation inducer according to any one of claims 1 to 4. A method for inducing differentiation from stem cells to ectoderm cells, comprising culturing pluripotent stem cells in the presence of fucoidan and inducing differentiation into ectoderm cells. A method for producing ectoderm cells, comprising a step of culturing pluripotent stem cells in the presence of fucoidan and inducing differentiation into ectoderm cells.