JP7152001B2 - Myocardial Differentiation Promoting Agent and Method for Promoting Myocardial Differentiation - Google Patents

Description

TECHNICAL FIELD The present invention relates to agents for promoting differentiation of myocardium, methods for promoting differentiation of myocardium, and the like.

The number of patients with heart failure in Japan is about 300,000. Among heart failure patients, heart transplantation and artificial heart therapy are fundamental treatments for severe heart failure, but there are problems such as a shortage of donors and the durability of artificial hearts. Under such circumstances, development of myocardial regeneration therapy is eagerly awaited. Development of myocardial regenerative therapy requires techniques for inducing the differentiation of cells into myocardium.

Studies on the induction of differentiation from pluripotent stem cells to cardiomyocytes include, for example, administration of trichostatin A, a histone deacetylation inhibitor, to mouse ES cells, primate ES cells, and mouse iPS cells. It has been found that it can induce myocardial differentiation of pluripotent stem cells (Non-Patent Documents 1-3).

However, histone deacetylase is present in all cells, and its inhibitor, trichostatin A, promotes the differentiation of neural stem cells into neurons and suppresses the differentiation into astrocytes. It has also been reported that the effect of In addition, trichostatin A has been found to have an antitumor effect, and one of its mechanisms of action is that trichostatin A inhibits the cell cycle. It is also widely known to be toxic to healthy cells.

Kawamura T, Ono K, Morimoto T, Wada H, Hirai M, Hidaka K, Morisaki T, Heike T, Nakahata T, Kita T, Hasegawa K. Acetylation of GATA-4 is involved in the differentiation of embryonic stem cells into cardiac myocytes 2005; 280: 19682-19688. (https://www.ncbi.nlm.nih.gov/pubmed/15764815). Hosseinkhani M, Hasegawa K, Ono K, Kawamura T, Takaya T, Morimoto T, Wada H, Shimatsu A, Prat SG, Suemori H, Nakatsuji N, Kita T. Trichostatin A induces myocardial differentiation of monkey ES cells. Biochem Biophys Res Commun 2007; 356: 386-391. (https://www.ncbi.nlm.nih.gov/pubmed/17368572) Kaichi S, Hasegawa K, Takaya T, Yokoo N, Mima T, Kawamura T, Morimoto T, Ono K, Baba S, Doi H, Yamanaka S, Nakahata T, Heike T. Cell line-dependent differentiation of induced pluripotent stem cells into Cardiomyocytes in mice. Cardiovasc Res. 2010; 88: 314-323. (https://www.ncbi.nlm.nih.gov/pubmed/20547733) Balasubramanyan V, Boddeke E, Bakels R, Ku¨st B, Kooistra S, Veneman A, Copray S. Effects of histone deacetylation inhibition on neuronal differentiation of embryonic mouse neural stem cells. Neuroscience. 2006; 143: 939-951. http://www.ncbi.nlm.nih.gov/pubmed/17084985)

The problem to be solved by the present invention is to provide a new myocardial differentiation promoting agent.

The inventors of the present invention have made intensive studies to solve the above problems, and have found new findings.
Specifically, in an exemplary embodiment, the present invention provides the following clauses. It contains an oligo-DNA having an activity of promoting differentiation into myocardium by applying it to at least one selected from the group consisting of pluripotent stem cells, pluripotent stem cells, and stem cells derived from pluripotent stem cells. Myocardial differentiation promoter.

Section 2. Item 2. The agent for promoting myocardial differentiation according to Item 1, further comprising berberine, an analogue compound thereof, or a salt thereof.

Item 3. Item 3. The myocardial differentiation promoting agent according to Item 1 or 2, wherein the oligo DNA has two or more linked core nucleotide sequences represented by 5'TTAGGG3' or 5'TGAGGG3'.

Section 4. Item 4. The myocardial differentiation promoting agent according to Item 3, wherein the oligo DNA comprises a core nucleotide sequence represented by 5'TTAGGG3' linked to a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3'.

Item 5. Item 5. The agent for promoting myocardial differentiation according to item 4, wherein the oligo DNA comprises a base sequence 5'TTAGGGTGAGGG3'.

Item 6. Item 2. The agent for promoting myocardial differentiation according to item 1, wherein the oligo DNA comprises a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' and has a nucleotide sequence AGA or nucleotide sequence AAG on the 5' end side.

Item 7. 7. The myocardial differentiation promoting agent according to any one of Items 1 to 6, which is applied to cells derived from mammals.

Item 8. Item 3. The myocardial differentiation promoting agent according to Item 2, wherein the oligo DNA comprises a core nucleotide sequence represented by 5'TTAGGG3'.

Item 9. The agent for promoting myocardial differentiation according to Item 8, which has a nucleotide sequence AGA or AAG on the 5' end side.

Item 10. Item 3. The agent for promoting myocardial differentiation according to Item 2, wherein the molar ratio of said oligo-DNA and said berberine or its analog compound or salt thereof is 1:10 to 10:1.

Item 11. Item 11. A method for promoting myocardial differentiation using the agent for promoting myocardial differentiation according to any one of Items 1 to 10.

Item 12. An oligo DNA having a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' and having nucleotide sequence AGA or nucleotide sequence AAG on the 5'-end side and having the activity of promoting myocardial differentiation.

Item 13. The oligo DNA according to Item 14, wherein two or more core nucleotide sequences represented by 5'TTAGGG3' or 5'TGAGGG3' are linked.

Item 14. The oligo DNA according to Item 13, comprising a core nucleotide sequence represented by 5'TTAGGG3' linked to a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3'.

Item 15. Item 15. The oligo DNA according to Item 14, which contains the base sequence 5'TTAGGGTGAGGG3'.

Item 16. An oligo DNA having an activity of promoting myocardial differentiation when applied to a cell or individual, and having a base length of any one of 6 to 25 bases.

Item 17. 17. The oligo-DNA according to Item 16, wherein the base length is any one of 9 to 18.

Item 18. 17. The oligo DNA according to item 16, wherein the base length is 18.

Item 19. The oligo DNA according to Item 16, comprising a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' and having a nucleotide sequence AGA or AAG on the 5' end side.

Item 20. The oligo DNA according to Item 19, wherein two or more core nucleotide sequences represented by 5'TTAGGG3' or 5'TGAGGG3' are linked.

Item 21. from the group consisting of a pluripotent stem cell, a pluripotent stem cell, and a stem cell derived from the pluripotent stem cell, which comprises a core nucleotide sequence represented by the nucleotide sequence 5'TTAGGGTGAGGG3' and has a base length of 17 to 23 At least one selected oligo-DNA having an activity of promoting differentiation into myocardium.

Item 22. An enhancer for enhancing the promotion of myocardial differentiation by oligo-DNA, the enhancer comprising berberine, an analogous compound thereof, or a salt thereof.

Item 23. Item 23. The enhancing agent according to Item 22, wherein the oligo DNA comprises a core nucleotide sequence represented by 5'TTAGGG3'.

According to the present invention, it becomes possible to strongly promote myocardial differentiation.

Graph showing results of appearance of MHC-positive cells in Reference Example 1 Graph showing results of appearance of MHC-positive cells of oligo-DNA in Reference Example 1 Graph showing the relationship between oligo DNA concentration and appearance of MHC-positive cells in Reference Example 2 Graph showing the effect of thermal denaturation of oligo-DNA in Reference Example 2 Graph showing growth inhibitory effect on human rhabdomyosarcoma in Reference Example 3 Graph showing appearance of oligo-DNA mutant MHC-positive cells in Reference Example 4 Graph showing specific effect on mouse myoblasts in Reference Example 5 Graph showing effect of combined use of berberine or analogue compound in Reference Example 6 Graph showing the effect of enhancing muscle differentiation promoting action of oligo-DNA mutant by berberine in Reference Example 7 Graph showing the effect of enhancing muscle differentiation-promoting action of oligo-DNA by berberine or an analogue compound in chicken myoblasts in Reference Example 8 Graph showing differences in effects caused by types of human rhabdomyosarcoma cells in Reference Example 9 Graph showing human rhabdomyosarcoma cell growth inhibitory effects of oligo DNA and berberine in Reference Example 9 Drawing for explaining the difference between the reference example and the present embodiment Microscopic image of ES cells on day 8 of differentiation induction (day 3 of myoDN exposure) in Example 1 of the present invention Microscopic image of iPS cells on day 11 of differentiation induction (6 days after myoDN exposure) in Example 2 of the present invention Measurement results of autonomous beats in Example 2 of the present invention

A myocardial differentiation promoting agent according to one aspect of the present invention contains an oligo-DNA having an activity of promoting myocardial differentiation by applying it to cells or individuals. In the present invention, the phrase “having activity to promote myocardial differentiation” can be appropriately interpreted in consideration of the common general technical knowledge in the field to which the present invention belongs. A property that increases the number or ratio of cells that express genes specifically expressed in cardiomyocytes or cardiomyocyte progenitor cells, such as -5, or autonomously beating cardiomyocytes or clusters thereof, or accelerates the appearance time. Point.

In the myocardial differentiation promoting agent, the oligo DNA may contain a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3'. In the present invention, "comprising 5'XXXXXXX3' or 5'YYYYYY3'" includes cases where only one of 5'XXXXXXX3' and 5'YYYYYY3' is included, and cases where both of them are included. In an embodiment in which the oligo-DNA according to the present invention contains a core base sequence, the oligo-DNA has a base sequence GAA, a base sequence AGA, a base sequence AAG or a base sequence AAA at the 5′ end side; preferably a base sequence AGA, It may have the nucleotide sequence AAG or the nucleotide sequence AAA; more preferably the nucleotide sequence AGA or the nucleotide sequence AAG. In such an embodiment, "having a base sequence XXX on the 5' end side" means having a base sequence XXX on the 5' end side of the core base sequence, and the oligo DNA has a base sequence XXX on the 5' end side. Not only when having a base sequence XXX further at the 5' end of the base sequence (e.g., at least one selected from the group consisting of A and G (e.g., 1 to 5, preferably 1 to 3) from The case of having a base sequence consisting of In this embodiment, the base sequence (base sequence GAA, base sequence AGA, base sequence AAG or base sequence AAA; preferably base sequence AGA, base sequence AAG or base sequence AAA; more preferably base sequence AGA or base sequence AAG) is preferably linked to the core sequence, but another base sequence (e.g., at least one selected from the group consisting of A and G (e.g., preferably may be via a base sequence consisting of 1 to 3).

In the myocardial differentiation promoting agent, the oligo DNA may contain two or more (preferably 2 to 3, more preferably 2) linked core base sequences represented by 5'TTAGGG3' or 5'TGAGGG3'. That is, the oligo DNA may contain 5'TTAGGGTTAGGG3' (SEQ ID NO: 28); 5'TTAGGGTGAGGG3' (SEQ ID NO: 29); 5'TGAGGGTTAGGG3' (SEQ ID NO: 30); good. Among these core nucleotide sequences, 5'TTAGGGTTAGGG3', 5'TTAGGGTGAGGG3' and the like are preferable.

In the cardiomyocyte differentiation-promoting agent, the oligo-DNA may contain a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' linked to the core nucleotide sequence represented by 5'TTAGGG3'.

In the myocardial differentiation promoting agent, the oligo-DNA may contain a base sequence 5'TTAGGGTGAGGG3'.

The cells in the myocardial differentiation promoting agent may be cells derived from mouse, chicken or human.

A myocardial differentiation-promoting method according to one aspect of the present invention uses the myocardial differentiation-promoting agent.

The myocardial differentiation-promoting oligo-DNA according to one aspect of the present invention includes a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' and has a nucleotide sequence AGA or AAG on the 5' end side.

Two or more core nucleotide sequences represented by 5'TTAGGG3' or 5'TGAGGG3' may be linked in the myocardial differentiation-promoting oligo DNA.

The core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' may be linked to the core nucleotide sequence represented by 5'TTAGGG3' in the myocardial differentiation-promoting oligo-DNA.

The myocardial differentiation-promoting oligo-DNA may contain a base sequence 5'TTAGGGTGAGGG3'.

A myocardial differentiation-promoting agent according to one aspect of the present invention comprises an oligo-DNA having an activity of promoting myocardial differentiation when applied to a cell or individual, and berberine or an analogue compound thereof.

In the myocardial differentiation promoting agent, the oligo DNA contains a core nucleotide sequence represented by 5'TTAGGG3'.

In the myocardial differentiation promoting agent, the oligo DNA 5' may have a base sequence AGA or base sequence AAG on the terminal side.

The molar ratio of said oligo DNA and said berberine or analogue compound thereof may be equal.

A method for promoting myocardial differentiation according to one aspect of the present invention uses a myocardial differentiation promoting agent containing an oligo-DNA containing a core nucleotide sequence represented by 5'TTAGGG3' and berberine or an analogue thereof.

An enhancer according to one aspect of the present invention is an enhancer that promotes myocardial differentiation by being used in combination with oligo-DNA and applied to cells or individuals, and contains berberine or an analogue thereof.

The enhancer may be used in combination with an oligo DNA containing a core nucleotide sequence represented by 5'TTAGGG3'.

The oligo-DNA according to one aspect of the present invention has the activity of promoting myocardial differentiation when applied to cells or individuals, and has a base length of preferably 25 or less, more preferably 23 or less, and even more preferably 21 or less. 19 or less is even more preferred. In one aspect of the present invention, the base length of the oligo-DNA is preferably 6 or more, more preferably 9 or more, still more preferably 15 or more, and even more preferably 17 or more. In one aspect of the present invention, the oligo-DNA has a base length of, for example, 6 to 25, preferably 17 to 23 bases.

The oligo-DNA may have any one of 9 to 18 nucleotides.

The oligo DNA may have a base length of 13 to 23 bases, preferably 15 to 21 bases, more preferably 17 to 19 bases, still more preferably 18 bases.

The oligo DNA preferably contains a core nucleotide sequence represented by 5'TTAGGG3' or 5'TGAGGG3' and has a nucleotide sequence AGA or AAG on the 5' end side.

Preferably, two or more core nucleotide sequences represented by 5'TTAGGG3' or 5'TGAGGG3' are linked in the oligo DNA.

In addition, in the present invention, the oligo-DNA consists of the base sequence shown in any one of SEQ ID NOs: 1 to 7 and 16 described below; Preferably, it consists of a base sequence in which 1 to 3, more preferably 1) base is substituted, deleted, inserted or added. Further, in the present invention, the oligo DNA consists of the nucleotide sequence represented by 5'AAAAGATTAGGGTGAGGGTGA3' (SEQ ID NO: 32) or 5'AAAAGTTAGGGTGAGGGTGA3' (SEQ ID NO: 33), or the nucleotide sequence represented by SEQ ID NO: 32 or 33. Consisting of a base sequence represented by 15 to 21 (preferably 17 to 19, more preferably 18) consecutive bases among which, one or several (preferably 1 to Preferably, it consists of a base sequence in which 3, more preferably 1) bases are substituted, deleted, inserted or added.

In addition, in the present invention, as oligo DNA,
5' X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ TX ₇ AGGGTX ₈ AGGGTX ₉ A3' (SEQ ID NO: 34)
[wherein, X ₁ , X ₂ , X ₃ , X ₄ , X ₅ and X ₆ each independently represent A or G; _X7 , _X8 , and _X9 each independently represent T or G; ]
Among the base sequences represented by , those consisting of 15 to 21 consecutive bases (preferably 17 to 19 bases, more preferably 18 bases) are preferable. _In the above embodiment, the _{oligo DNA} preferably _{contains X4X5X6TX7AGGGTX8AGGG} . In addition, T is preferable as _X7 in SEQ ID NO:32. G is preferred as X8 _in SEQ ID NO:32. G is preferred as _X9 in SEQ ID NO:32.

In the present invention, the oligo-DNA can promote myocardial differentiation. Specifically, as described later, it was confirmed that the emergence of clusters of cells expressing the myocardial-specific transcription factor Nkx2-5 and beating autonomously was promoted. Moreover, since the oligo DNA group can be chemically synthesized and has a stable structure, it can be supplied and stored in large amounts in the future, and is expected to be highly safe because it is derived from the genome sequence of lactic acid bacteria. Therefore, the agent for promoting muscle differentiation of the present invention can be used to induce the differentiation of pluripotent stem cells, pluripotent stem cells, stem cells derived from pluripotent stem cells, or the like into cardiomyocytes, or Cardiac regenerative therapy using stem cells derived from pluripotent stem cells, cardiomyocytes differentiated from these stem cells, screening for drug discovery, and creation of cardiomyocyte progenitor cells or cardiomyocytes for treatment and research of heart disease It is possible.

In the present invention, the oligo-DNA may be used in combination with a known myocardial differentiation inducer (for example, trichostatin A described in Non-Patent Document 4, etc.). It is expected that myocardial differentiation can be induced with higher efficiency by using these in combination, which is preferable. In addition, administration of oligoDNA such as myoDN to cells cultured by a method specialized for inducing myocardial differentiation is highly likely to induce myocardial differentiation with high efficiency, which is preferable.

In the present invention, even if the oligo-DNA itself, which is the active ingredient of the present invention, is used as a myocardial differentiation-promoting agent, various pharmaceutically acceptable carriers (e.g., tonicity agents, stabilizers, pH adjusters, etc.) , antioxidants, solubilizers, thickeners, preservatives, etc.).
Examples of tonicity agents include sugars such as glucose, trehalose, lactose, fructose, mannitol, xylitol and sorbitol; polyhydric alcohols such as glycerin, polyethylene glycol and propylene glycol; sodium chloride, potassium chloride and calcium chloride; Inorganic salts etc. are mentioned.
Examples of pH adjusters include acids such as hydrochloric acid, carbonic acid, acetic acid, and citric acid, and alkali metal hydroxides such as sodium hydroxide and potassium hydroxide, alkali metal carbonates such as sodium carbonate, and hydrogen carbonate. salts, alkali metal acetates such as sodium acetate, alkali metal citrates such as sodium citrate, and bases such as trometamol;
Antioxidants include, for example, sodium hydrogen sulfite, dry sodium sulfite, sodium pyrosulfite and the like.
Examples of solubilizing agents include sodium benzoate, glycerin, D-sorbitol, glucose, propylene glycol, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, D-mannitol and the like.
Examples of thickening agents include polyethylene glycol, methylcellulose, ethylcellulose, carmellose sodium, xanthan gum, sodium chondroitin sulfate, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, polyvinyl alcohol and the like.
Preservatives include, for example, sorbic acid, potassium sorbate, methyl parahydroxybenzoate, ethyl parahydroxybenzoate, propyl parahydroxybenzoate, parahydroxybenzoic acid esters such as butyl parahydroxybenzoate, chlorhexidine gluconate, benzalkonium chloride, chloride quaternary ammonium salts such as benzethonium and cetylpyridinium chloride, alkylpolyaminoethylglycine, chlorobutanol, polyquad, polyhexamethylene biguanide, chlorhexidine and the like.
In addition to the oligo-DNA, the pharmaceutical composition may further contain a compound known to have a myocardial differentiation-promoting effect.
In the embodiment of the pharmaceutical composition, the content of the oligo-DNA in the composition is not particularly limited. It can be appropriately set from conditions such as 5% by mass or more and 1% by mass or more.
The content of the oligoDNA of the present invention in the preparation varies depending on the route of administration, patient age, body weight, symptoms, etc., and cannot be categorically defined. The amount may be about 1000 mg. In the case of administration once a day, this amount should be contained in one preparation, and in the case of administration three times a day, one third of this amount may be contained in one preparation.

The myocardial differentiation-promoting agent in this embodiment includes, for example, an oligo DNA having the following SEQ ID NO:
iSN01: 5'AAAAGATTAGGGTGAGGG3' (SEQ ID NO: 1)
iSN02: 5'AAAGATTAGGGTGAGGGT3' (SEQ ID NO: 2)
iSN03: 5'AAGATTAGGGTGAGGGTG3' (SEQ ID NO: 3)
iSN04: 5'AGATTAGGGTGAGGGTGA3' (SEQ ID NO: 4)
iSN05: 5'GATTAGGGTGAGGGTGAG3' (SEQ ID NO: 5)
iSN06: 5'ATTAGGGTGAGGGTGAGT3' (SEQ ID NO: 6)
iSN07: 5'TTAGGGTGAGGGTGAGTT3' (SEQ ID NO: 7)
iSN04': 5'AAGTTAGGGTGAGGGTGA3' (SEQ ID NO: 16)
All of the oligo DNAs of SEQ ID NOS: 1-7 and 16 contain the core sequence TTAGGGTGAGGG (SEQ ID NO: 29). The 2nd and 8th bases from the 5' end of the core sequence shown in SEQ ID NO: 28 may be T or G. It also has sequences GGG at positions 4-6 and 9-11 of the core sequence, and the latter sequences are more important for activating myocardial differentiation. The repeat sequence (TTAGGG)n of the sequence TTAGGG is called a telomere and is present at the end of eukaryotic chromosomes. It is believed that telomeres shorten with DNA replication prior to cell division, and cell senescence progresses (Patent Document 1).

The myocardial differentiation-promoting agent in the present embodiment more preferably contains an oligoDNA of SEQ ID NO: 4 and/or 51 (hereinafter iSN04, iSN04'). These oligo-DNAs contain the sequence AGA or AAG 5' to the core sequence. Hereinafter, iSN04 and iSN04' are collectively referred to as "myoDN".

The oligo DNA in this embodiment may be single-stranded. In addition, it may be one in which the oxygen atom of the phosphate group of an oligonucleotide having a phosphodiester bond is substituted with a sulfur atom (for example, a phosphorothioate bond) in order to increase resistance to a nucleolytic enzyme, but it is not limited to these. . Further, the oligo DNA may be DNA extracted and fragmented from organisms such as lactic acid bacteria and Escherichia coli, or may be prepared by chemical synthesis or gene recombination technology, but is not limited to these.

<Application target of myocardial differentiation promoter>
The cardiomyocyte differentiation-promoting agent in the present embodiment is applicable to pluripotent stem cells, pluripotent stem cells, stem cells derived from pluripotent stem cells, cardiac progenitor cells, and the like. As used herein, pluripotent stem cells have the ability to proliferate by self-renewal, and at the same time, can differentiate into any of endoderm, mesoderm, and ectoderm, and eventually develop into all cell types that make up an individual. Differentiable cells are shown. Pluripotent stem cells include iPS cells (induced pluripotent stem cells), ES cells (embryonic stem cells), and the like. As used herein, stem cells derived from pluripotent stem cells refer to stem cells that have been induced to differentiate from pluripotent stem cells and that have lost pluripotency but still have the ability to differentiate into multiple or specific cells. . In the present invention, the stem cells derived from pluripotent stem cells are preferably pluripotent stem cells that appear by inducing differentiation of pluripotent stem cells. As used herein, a pluripotent stem cell refers to a cell capable of differentiating into multiple cell types belonging to a certain germ layer lineage. In the present invention, the concept of "pluripotent stem cells" partially overlaps with "stem cells derived from pluripotent stem cells". Therefore, in the present invention, pluripotent stem cells include pluripotent stem cells derived from pluripotent stem cells, pluripotent stem cells not derived from pluripotent stem cells (existing in vivo or taken out from a living body). Also included are metapotent stem cells. Multipotent stem cells include, for example, mesenchymal stem cells, hematopoietic stem cells, bone marrow stem cells and the like. In addition, the myocardial differentiation promoting agent of the present invention may be applied to progenitor cells such as osteoblasts, adipose progenitor cells, and smooth muscle progenitor cells. In the present invention, for example, the oligo-DNA of the present invention can be applied to pluripotent stem cells existing in vivo. More specifically, the oligo-DNA of the present invention may be directly applied to pluripotent stem cells present in vivo, or the pluripotent stem cells present in vivo may be taken out of the body and Oligo DNAs of the invention may be applied. These cells include, but are not limited to, cells derived from mammals, including mice and humans, or cells derived from birds, including chickens.

<Usage form of myocardial differentiation promoting agent>
The myocardial differentiation-promoting agent of the present invention can be used, for example, by adding it to a culture medium when the above cells are cultured to induce myocardial differentiation. More specifically, for example, when the day on which the pluripotent stem cells are seeded in a medium (for example, a medium for inducing differentiation into myocardium) is day 1, the day is 3 to 7 days, preferably 4 to 6 days. Myocardial differentiation can be promoted by adding the myocardial differentiation promoting agent of the present invention to the medium. In the present invention, the myocardial differentiation promoting agent may be added to cells in vitro, but may also be used in vivo. For example, cells, cell sheets, or the like may be administered to a subject, and the agent for promoting myocardial differentiation of the present invention may be administered to myocardial progenitor cells, etc. in the regenerating tissue during the regeneration of myocardial tissue in the body of the subject. . The myocardial differentiation-promoting agent of the present embodiment is formulated with various commonly used carriers and excipient components, and is formulated into injections, ointments, tablets, capsules, syrups, suppositories, etc. according to known methods. can be, but are not limited to, In addition, the muscle differentiation promoting agent may be administered orally, intravenously, intramuscularly, intraarticularly, intraarterially, intramedullary, intrathecally, intraventricularly, percutaneously, subcutaneously, intraperitoneally, enterally, topically, sublingually or rectally. It can be administered by means of, but is not limited to.

(Second embodiment of the present invention)
A second embodiment of the present invention will be described below. The myocardial differentiation promoting agent of the second embodiment is a combination of berberine or analogue compounds thereof (eg, palmatine, yateoridin, colanbamine, etc.) or salts thereof in combination with oligo-DNA. Preferably, the molar ratio of oligo DNA and berberine or analogues thereof is 1:10 to 10:1, more preferably 1:5 to 5:1, even more preferably 1:2 to 2:1, even more preferably are used at a ratio of 1:1. Examples of oligo DNA include those described above. In this embodiment, the content of the oligo DNA in the myocardial differentiation promoting agent is not particularly limited. It can be appropriately set from conditions such as mass % or more and 1 mass % or more. The upper limit of the content of oligo DNA in the myocardial differentiation promoting agent is not particularly limited, and is, for example, 90% by mass or less, 70% by mass or less, 50% by mass or less, 30% by mass or less, 10% by mass or less, or 5% by mass or less. , 1% by mass or less. In this embodiment, the content of berberine in the myocardial differentiation promoting agent is not particularly limited. % or more, 1% by mass or more, and the like. The upper limit of the content of berberine in the myocardial differentiation promoting agent is not particularly limited, and is, for example, 90 mass% or less, 70 mass% or less, 50 mass% or less, 30 mass% or less, 10 mass% or less, 5 mass% or less, It can be appropriately set from conditions such as 1% by mass or less.

In this embodiment, it is possible to enhance the myocardial differentiation-promoting action of oligo-DNA by using berberine or its analogue compound, which is inexpensive and safe, in combination with oligo-DNA. Berberine analog compounds are not particularly limited, and both natural derivatives and artificial derivatives can be used.

<Berberine>
Berberine (Formula 1) is a component of crude drugs extracted from Phellodendron bark (Obaku), a kind of alkaloid, and is known as a basic natural organic compound containing nitrogen. It is mainly used as an antibacterial, anti-inflammatory, central depressant, or antihypertensive agent, as an antidiarrheal drug for diarrhea, and as an eye drop, and is safe for the human body.

Berberine by itself does not have a muscle differentiation promoting effect, but rather has a weak muscle differentiation inhibitory effect as shown in Reference Examples below. However, when berberine is applied to myoblasts together with iSN04 or certain mutants, the muscle differentiation-promoting effect is dramatically enhanced. The mutant may be iSN04' or an oligo DNA (SEQ ID NO: 26) in which G at position 11 from the 5' end of iSN04 is replaced with T. However, as shown in Examples below, when the fifth T of iSN04 is replaced with G, the remarkable enhancing effect of berberine is no longer observed.

<Palmatine>
Instead of berberine, palmatine may be used together with oligo DNA. Palmatine, like berberine, is a crude drug component extracted from Phellodendron bark, and is an analogue compound having a dimethoxy group instead of the methylenedioxy group of berberine, as shown in Formula 2. In this embodiment, the content of palmatin in the myocardial differentiation promoting agent is not particularly limited, and is, for example, 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass. % or more, 1% by mass or more, and the like. The upper limit of the content of palmatin in the myocardial differentiation promoting agent is not particularly limited either. It can be appropriately set from conditions such as 1% by mass or less.

Both berberine and palmatine are biosynthesized from (S)-reticuline (C ₁₉ H ₂₃ NO ₄ ) as a precursor via colanbamine (C ₂₀ H ₂₀ NO ₄ ). An enzyme called berberine sitase converts columbamine to berberine with a methylenedioxy group. Other enzymes also methylate columbamine to form palmatine.

<Other analogs>
In addition to palmatine, analogues of berberine include yateoridin, colanbamine, and the like:

In this embodiment, the content of berberine analogs such as yateorigin and colanbamine in the myocardial differentiation promoting agent is not particularly limited, and is, for example, 90% by mass or more, 70% by mass or more, 50% by mass or more, or 30% by mass. As mentioned above, conditions such as 10% by mass or more, 5% by mass or more, or 1% by mass or more can be appropriately set. The upper limit of the content of berberine analogues such as yateorigin and colanbamine in the myocardial differentiation promoter is not particularly limited, and is, for example, 90% by mass or less, 70% by mass or less, 50% by mass or less, 30% by mass or less, or 10% by mass. % or less, 5% by mass or less, or 1% by mass or less.

Methods for extracting and purifying analogues such as berberine and palmatine from plants that biosynthesize them have already been established and can be used at low cost. Furthermore, by using analogues such as berberine or palmatine, which are cheaper than oligo-DNA, it is possible to further reduce the utilization cost of oligo-DNA while enhancing the effect.

Berberine or a derivative thereof may be used in the form of a salt in the present invention. Moreover, a halide (chloride etc.) etc. are mentioned as a salt of berberine or its derivative(s). Salts of berberine or derivatives thereof also include acid addition salts and salts with bases. Specific examples of acid addition salts include inorganic acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate, perchlorate, and phosphate, oxalate, malonate, and succinic acid. salt, maleate, fumarate, lactate, malate, citrate, tartrate, benzoate, trifluoroacetate, acetate, methanesulfonate, p-toluenesulfonate, trifluoromethane Examples include organic acid salts such as sulfonates, and acidic amino acid salts such as glutamate and aspartate. Specific examples of salts with bases include alkali metal or alkaline earth metal salts such as sodium salts, potassium salts or calcium salts, salts with organic bases such as pyridine salts and triethylamine salts, and bases such as lysine and arginine. and salts with synthetic amino acids.

In the present invention, berberine, a derivative thereof, or a salt thereof can enhance the myocardial differentiation-promoting action of the aforementioned oligo-DNA. Accordingly, the present invention provides an enhancer for enhancing myocardial differentiation promotion by oligo-DNA, the enhancer comprising berberine, an analogue thereof, or a salt thereof. In this embodiment, with respect to the type and amount of berberine or its analogues or salts thereof, the type and amount of oligo-DNA used, and other components, the same conditions as described above for the myocardial differentiation promoting agent can be appropriately applied. .

Examples of the present invention will be described below.

(Reference example 1)
The present inventors have established a system for screening molecules that act on skeletal muscle differentiation using myoblasts obtained by primary culturing satellite cells collected from mouse skeletal muscle. Molecules such as oligo DNA are added to myoblasts cultured on a collagen-coated 96-well plate. After a predetermined period of time has passed, the expression of myosin heavy chain (MHC), a terminal differentiation marker for skeletal muscle, is quantified by immunostaining. At this time, the cell nuclei are visualized by DAPI staining. Furthermore, using an image analyzer, images are automatically captured and analyzed, and muscle differentiation efficiency and cell number are quantified with high throughput. In this way, the effects of a wide variety of molecules on myoblasts can be efficiently investigated.

FIG. 1 shows the results of screening using 50 types of oligo DNA groups (Table 1) of SEQ ID NOS: 1-3 and 5-51. Mouse myoblasts (10 ⁴ cells/well) were exposed to each oligo DNA at a concentration of 10 μM, and after 48 hours, the appearance ratio of MHC-positive cells was measured. In addition, the oligo DNA in the following reference examples is composed of a single strand, and in order to increase the resistance to nucleolytic enzymes, the oxygen atom of the phosphate group of the phosphodiester bond is substituted with a sulfur atom (S). is done in advance.

<Table 1>
iSN01: 5'AAAAGATTAGGGTGAGGG3' (SEQ ID NO: 1)
iSN02: 5'AAAGATTAGGGTGAGGGT3' (SEQ ID NO: 2)
iSN03: 5'AAGATTAGGGTGAGGGTG3' (SEQ ID NO: 3)
iSN04': 5'AAGTTAGGGTGAGGGTGA3' (SEQ ID NO: 16)
iSN05: 5'GATTAGGGTGAGGGTGAG3' (SEQ ID NO: 5)
iSN06: 5'ATTAGGGTGAGGGTGAGT3' (SEQ ID NO: 6)
iSN07: 5'TTAGGGTGAGGGTGAGTT3' (SEQ ID NO: 7)
iSN08: 5'AGTTCAACATTAGGGTGA3' (SEQ ID NO: 8)
iSN09: 5'GTTCAACATTAGGGTGAA3' (SEQ ID NO: 9)
iSN10: 5'TTCAACATTAGGGTGAAA3' (SEQ ID NO: 10)
iSN11 : 5'TCAACATTAGGGTGAAAA3' (SEQ ID NO: 11)
iSN12: 5'CAACATTAGGGTGAAAAT3' (SEQ ID NO: 12)
iSN13: 5'AACATTAGGGTGAAAATG3' (SEQ ID NO: 13)
iSN14: 5'ACATTAGGGTGAAAATGA3' (SEQ ID NO: 14)
iSN15: 5'CATTAGGGTGAAAATGAA3' (SEQ ID NO: 15)

In FIG. 1, the graph on the right side shows the percentage of myosin heavy chain (MHC)-positive cells, and the graph on the left side shows the number of cells. The uppermost white bar (Ctrl) is the control group (control) to which no oligo DNA was administered. The number of cells in the control group is normalized to 1 in the graph on the left. Clearly, there is a complementary relationship between the ratio of MHC-positive cells and the number of cells. This means that if myoblast differentiation is promoted, proliferation is suppressed. The proportion of MHC-positive cells in the control group is at most about 3%.

On the other hand, among myoblasts administered with oligo DNA, 6% or more of myoblasts administered with oligo DNA belonging to iSN01, 02, 03, 04′, 05, 06 and 07 groups were MHC positive. cells appeared. In particular, the proportion of MHC-positive cells in myoblasts to which the oligo DNA of iSN04' (SEQ ID NO: 16) was administered was extremely high, exceeding 40%.

Furthermore, a comparison experiment was performed under the same conditions using this iSN04' and an oligo DNA of iSN04 (Table 2, SEQ ID NO: 4) having a sequence that differs by two nucleotides. The results are shown in FIG.

<Table 2>
iSN04: 5'AGATTAGGGTGAGGGTGA3' (SEQ ID NO: 4)

As is clear from FIG. 2, the oligoDNA (iSN04) of SEQ ID NO: 4 exhibits muscle differentiation-promoting activity equal to or greater than that of the oligoDNA (iSN04') of SEQ ID NO: 16.

It should be noted here that the oligo DNAs belonging to the groups iSN01 to 07 and iSN04' have a base sequence of 5'TTAGGGTGAGGG3' (SEQ ID NO: 29) in common.

(Reference example 2)
Fig. 3 shows oligo DNAs of iSN01-03 (SEQ ID NOS: 1-3), iSN05-07 (SEQ ID NOS: 5-7), and iSN04' (SEQ ID NO: 16) at concentrations of 3 µM and 10 µM to myoblasts. , shows the results of measuring the percentage of myosin heavy chain (MHC)-positive cells after 48 hours. According to the figure, the ratio of MHC-positive cells is extremely increased at 10 μM oligo-DNA concentration compared to 3 μM, indicating that a certain amount or more of oligo-DNA concentration is necessary to promote muscle differentiation.

Furthermore, the ratio of MHC-positive cells when iSN02 (SEQ ID NO: 2) was denatured by heating and 10 μM oligo DNA (de-iSN02) was exposed to mouse myoblasts (10 ⁴ cells/well) for 48 hours. is shown in FIG. The heat denaturation treatment was carried out by heating the oligo DNA at 95°C for 5 minutes. It can be seen that heat denaturation clearly abolishes the muscle differentiation-promoting action of iSN02. This result suggests that the activity of oligo-DNA is conformationally dependent.

(Reference example 3)
FIG. 5 shows the inhibitory effect of myoDN iSN04 or iSN04′ (oligo DNA of SEQ ID NOs: 4 and 51) on proliferation of human rhabdomyosarcoma cell KYM1. As explained in FIG. 1, differentiation and proliferation of myoblasts are in a complementary relationship. In other words, if oligo-DNA promotes myoblast differentiation, it suppresses proliferation. By utilizing this property, the effect of suppressing the growth and metastasis of malignant tumors such as cancer by oligo-DNA can be expected.

In FIG. 5, (a) shows the expression level of the skeletal muscle differentiation marker gene (MYH2) when oligo DNA (iSN04′) was exposed to human rhabdomyosarcoma cells KYM1 (5×10 ⁴ cells/well); ) is the expression level of the cell proliferation marker gene (MKI67) quantified with the control (Ctrl) set to 1.0. As is clear from both figures, the promotion of muscle differentiation and the suppression of cell proliferation are inversely related to each other.

FIG. 5(c) shows the results of measuring the number of rhabdomyosarcoma cells over time. Compared to the control (Ctrl), exposure to iSN04 (oligo DNA of SEQ ID NO: 4) clearly inhibits the growth of human rhabdomyosarcoma cell KYM1.

(Reference example 4)
Oligo DNA variants (sequences 54 to 62) prepared by substituting or deleting some bases of iSN04 (SEQ ID NO: 4) shown in Table 3 were exposed to mouse myoblasts at a concentration of 10 μM each. After hours, the appearance ratio of MHC-positive cells was measured. In Table 3, "-" indicates that the base sequence is deleted and the bases at both ends are directly bound. For example, in iSN04 (del13-15), the 12th base A from the 5'-end and the 4th base T from the 3'-end are directly linked.

<Table 3>
iSN04:5'AGATTAGGGTGAGGGTGA3' (SEQ ID NO: 4)
iSN04(4-18): 5'---TTAGGGTGAGGGTGA3' (SEQ ID NO: 19)
iSN04(7-18):5'------GGGTGAGGGTGA3' (SEQ ID NO: 20)
iSN04(10-18):5'---------TGAGGGTGA3' (SEQ ID NO: 21)
iSN04(dell5): 5'AGATTAGGGTGAGG-TGA3' (SEQ ID NO: 22)
iSN04(del14-15): 5'AGATTAGGGTGAG--TGA3' (SEQ ID NO: 23)
iSN04(del13-15): 5'AGATTAGGGTGA---TGA3' (SEQ ID NO: 24)
iSN04(T5G): 5'AGATGAGGGTGAGGGTGA3' (SEQ ID NO: 25)
iSN04(G11T): 5'AGATTAGGGTTAGGGTGA3' (SEQ ID NO: 26)
iSN04(T5G,G11T): 5'AGATGAGGGTTAGGGTGA3' (SEQ ID NO: 27)

The results are shown in FIG. As is clear from the figure, even if the 5th and 11th bases from the 5' end of iSN04 are changed to either T or G, the appearance ratio of MHC-positive cells is almost unchanged. On the other hand, when exposing iSN04 (4-18) (SEQ ID NO: 19) in which 3 bases on the 5′ end side were deleted, the appearance rate of MHC-positive cells was about the same as MQ (control), and this variant No muscle differentiation promoting effect by application is observed. Almost the same results were obtained when iSN04(7-18) (SEQ ID NO: 20) with 6 bases deleted and iSN04(10-18) (SEQ ID NO: 21) with 9 bases deleted were applied. The above results indicate that the presence of 3 nucleotides (AGA or AAG) on the 5'-end side is important for the myoDN-promoting action of myoDN.

Furthermore, even oligo DNAs (SEQ ID NOs: 22, 23, 24) in which one and two Gs at positions 13 to 15 from the 5' side of iSN04 are all removed show a decrease in muscle differentiation activity. It is suggested that the role of the base GGG in is large.

(Reference example 5)
To verify that myoDN specifically promotes muscle differentiation, an experiment using iSN04 (SEQ ID NO: 4) was performed. Mouse myoblasts or fetal mouse fibroblasts cultured at a density of 5×10 ⁴ cells/well, respectively, were exposed to iSN04 (SEQ ID NO: 4) at 1 μM or 3 μM for 72 hours, and the inhibitory effect on cell proliferation was observed. Each experiment was performed three times and the average was plotted.

The upper graph in FIG. 7 shows the growth inhibitory effect on mouse myoblasts. Control (Ctrl) cells (cells to which iSN04 was not added) proliferated about twice after 72 hours, whereas iSN04 Those exposed to 3 μM had a p value of less than 0.05, and the increase was suppressed to about 20%.

However, as shown in the graph at the bottom of the figure, iSN04 exposure of about 3 μM could not suppress the growth of fetal mouse fibroblasts. That is, myoDN suppresses cell proliferation as a result of specifically promoting muscle differentiation, and does not suppress proliferation of all cells.

(Reference example 6)
An experiment was conducted to verify the enhancing effect of berberine or palmatine on the muscle differentiation-promoting action of myoDN. Mouse myoblasts cultured at a density of 10 ⁴ cells/well were exposed to 1 μM, 3 μM or 10 μM of berberine alone or palmatine alone, respectively, and iSN04 was exposed to a concentration of 0 or 3 μM for 48 hours. The appearance ratio of MHC-positive myocytes was measured later.

The results are shown in FIG. As is clear from the figure, berberine (Ber) alone lowers the appearance ratio of MHC-positive myocytes as compared to the control (MQ with white bars). This means that berberine may originally have the effect of suppressing muscle differentiation. However, when iSN04 was also exposed to 3 μM, the appearance ratio of MHC-positive muscle cells was increased by about 1.5 to 2 times compared to the administration of iSN04 alone (black bar MQ). This means that berberine has the function of enhancing the effect of myoDN.

Palmatine (Pal) also has the property of enhancing the effect of myoDN, although its effect is milder than that of berberine. On the other hand, the weak muscle differentiation inhibitory effect observed with berberine alone was not observed with palmatine alone.

Note that the iSN04-enhancing action of berberine or palmatine was most effective when the molar ratio of iSN04 to berberine or palmatine was 1:1 in all cases. For example, in FIG. 8, when 10 μM berberine was administered to 3 μM myoDN (iSN04) (Ber10), the appearance ratio of MHC-positive muscle cells was slightly lower than when 3 μM berberine was administered (Ber3).

(Reference example 7)
An experiment was conducted to clarify the effect of berberine in enhancing the muscle differentiation-promoting action of the iSN04 mutants (SEQ ID NOS: 19 to 27) shown in <Table 3>. A sample in which mouse myoblasts cultured at a density of 10 ⁴ cells/well were each exposed to iSN04 or a variant thereof alone at a concentration of 3 μM, and a sample to which 3 μM of berberine was administered in addition, MHC-positive muscle cells were observed after 48 hours. The appearance rate was measured.

The results are shown in FIG. When berberine (Ber) was not added (white bars), the appearance ratio of MHC-positive muscle cells when exposed to iSN04 or mutants under these conditions was around 20%, but when berberine was added (black bars). , a significant difference occurs depending on the variant. Only iSN04 and G11T (SEQ ID NO: 26) in which G at the 11th position from the 5'-terminal side was replaced with T were confirmed to have a remarkable effect of enhancing myoDN activity by berberine. Other mutants show almost no change in the effect (del15 of SEQ ID NO: 22, etc.) or rather suppress the effect (4-18 of SEQ ID NO: 19, etc.).

In FIG. 6 (Reference Example 4), it was shown that whether the 5th and 11th bases are T or G is not related to myoDN's muscle differentiation promoting effect. As the second base, T is shown to be more preferred.

(Reference example 8)
Although mouse myoblasts were used to verify muscle differentiation in the above Reference Example, the present invention is not limited to this. In experiments using myoblasts of other animals, for example, chicken, which is an avian species, oligo-DNA was found to promote muscle differentiation.

In this reference example, chicken myoblasts cultured at a density of 10 ⁵ cells per dish with a diameter of 3 cm were exposed to 0 μM, 3 μM or 10 μM of iSN04′, and 10 μM of berberine was used in combination. The appearance ratio of cells was measured.

The results are shown in FIG. 10(a). Compared to the control (0 μM white bar on the horizontal axis in the figure), the appearance ratio of MHC-positive muscle cells doubled in samples to which iSN04′ was administered at 3 μM or 10 μM. When berberine (Ber) was used in combination, the appearance rate of MHC-positive muscle cells was doubled. Also in this experiment, the highest muscle differentiation promoting effect was observed when the molar ratio of iSN04' and berberine was 1:1 (both 10 µM).

Furthermore, an experiment similar to that shown in FIG. 8 (Reference Example 6) was also performed on chicken myoblasts. The results are shown in FIG. 10(b). For chicken myoblasts, berberine (Ber) alone acted to suppress muscle differentiation, and when combined with iSN04, a remarkable muscle differentiation promoting effect was confirmed. It was also confirmed that palmatine (Pal) enhances the effect of iSN04, although the effect is milder than that of berberine.

(Reference example 9)
An experiment was conducted on the inhibitory effect of myoDN on the proliferation of human rhabdomyosarcoma cells and the effect of berberine. Samples of human rhabdomyosarcoma cells KYM1, RD, and ERMS1 (5×10 ⁴ cells/well) were each exposed to 10 μM iSN04, and the number of cells was measured after 24 to 96 hours. The results are shown in FIG. It has been shown that the inhibitory effect of iSN04 differs depending on the tumor line.

In FIG. 11, the graph (a) shows the results of exposing human rhabdomyosarcoma cells KYM1 to iSN04, which was replicated under substantially the same conditions as the graph shown in FIG. 5(c). This reference example also reproduces that the proliferation of sarcoma cells is suppressed to less than half (after 72 hours) compared to the control (Ctrl). On the other hand, about 25% suppression was observed for the RD strain after 96 hours with a p-value of less than 0.05 (Fig. 11(b)). The ERMS1 strain had an inhibitory effect of about 10% ((c) in the figure).

For the RD strain, administration of berberine together with iSN04 was found to dramatically improve the antiproliferative effect. FIG. 12 shows the results of measuring the number of cells after 96 hours in control (Ctrl), iSN04 alone (10 μM), and iSN04 and equimolar berberine (Ber) (10 μM) in combination. When iSN04 and berberine were used in combination, about 25% of the growth inhibitory effect was shown compared to the case of iSN04 alone, and about 50% of the growth inhibitory effect compared to the control.

[Example]
Examples of the present invention will be described below. In the above-mentioned reference example, it was shown that exposing skeletal myoblasts to myoDN or the like has a muscle differentiation promoting effect, but in this example, pluripotent stem cells (ES cells, iPS cells) were differentiated A method of exposing iSN04 (SEQ ID NO: 4), which is a representative oligo-DNA of myoDN at the induced stage, to induce myocardial differentiation will be described.

First, the difference between the exposure targets of the reference example and the present embodiment will be described with reference to FIG. 13 . It is generally known that ES cells, which are pluripotent stem cells, differentiate into endoderm, mesoderm, and ectoderm, and that endoderm differentiates into internal organs, mesoderm into muscle and skeleton, and ectoderm into nerves. ing. In the reference example described above, oligo-DNA (iSN04) was exposed to so-called progenitor cells that had already differentiated into skeletal myoblasts, and it was confirmed that differentiation into skeletal muscle was promoted (bold arrows in the bottom left of FIG. 13). In contrast, in this example, iSN04 (SEQ ID NO: 4) is exposed. Experiments using ES cells and their results will be described in Example 1, and results using iPS cells will be described in Example 2 below.

(Example 1) Exposure of myoDN to ES cells hCGp7 was used as an ES cell line. This cell line is a mouse ES cell line in which one of the myocardial-specific transcription factor Nkx2-5 gene loci is replaced with GFP, and myocardial progenitor cells that have differentiated to express the myocardial-specific transcription factor Nkx2-5. or myocardial cells are shown by green fluorescence. The ES cells were seeded at a density of 3×10 ⁴ cells in a gelatin-coated culture vessel with a diameter of 3 cm to initiate induction of differentiation. DMEM medium containing 10% FBS, 5% HS, NEAA and 2-ME was used as the differentiation medium.

On the 5th day of induction of differentiation, 10 μM iSN04 (SEQ ID NO: 4) was exposed, and then the differentiation medium containing iSN04 was changed every 2 days to newly expose iSN04. In addition, the mode of differentiation was observed with a microscope every day. FIG. 14 shows the state on day 8 of induction of differentiation (day 3 of exposure to iSN04). In the figure, the upper row shows the control, and the lower row shows the observation results of iSN04. In each, the left side shows the phase contrast image and the right side shows the fluorescence image. In FIG. 14, compared to control ES cells, GFP expression (grayish area, actually green) is marked in iSN04-exposed ES cells. Although not shown in the photograph, autonomous beating of clusters of GPF-positive cells is observed.

As described above, according to this example, it is clear that myoDN acts on ES cells that have been induced to differentiate for 5 days, and significantly promotes their differentiation into cardiomyocytes. In this example, no measures were taken to selectively induce myocardial differentiation at the stage of exposure to myoDN. If myoDN is used in a culture system specialized for inducing myocardial differentiation, it may be possible to obtain a greater number of myocardial cells.

(Example 2) Exposure of myoDN to iPS cells Mouse iPS cell line 20D17 is used as a target pluripotent stem cell in this example. The iPS cell line in this example was established by introducing the so-called four reprogramming factors (Oct3/4, Sox2, Klf4, c-Myc) into fetal mouse fibroblasts with GFP knock-in at the Nanog locus. . The differentiation medium and differentiation method (exchange of medium, supplementation of iSN04, etc.) are the same as in Example 1.

FIG. 15 shows the state on day 11 of differentiation induction (6 days after exposure to iSN04). In the same figure, the upper row shows the control images, and the lower row shows the iPS cells exposed to iSN04, respectively, phase-contrast microscope images. Since pluripotent stem cells, including iPS cells, can differentiate into all cell types that make up the body, cardiomyocytes spontaneously appear even without exposure to iSN04. In the cells, the appearance of clusters of cells thought to be myocardium (portion surrounded by a dashed line) is more prominently visible. In addition, the diameter of clusters of iPS cells exposed to iSN04 exceeds the diameter of clusters in controls.

Although not shown in the photograph, autonomous beating of this cell cluster is observed. FIG. 16 shows the results of measuring this autonomous pulsation. In the figure, the horizontal axis represents the number of days after exposure to iSN04, and the vertical axis represents the number of beats per minute. White bars represent controls, and black bars represent iPS cells exposed to iSN04. In FIG. 16, the number of beats per minute of the iPS cell clusters exposed to iSN04 exceeds the control by more than 20%. Increased beating rate suggests that myoDN-exposed cardiomyocytes are at a more mature stage than controls.

As described above, according to this example, the differentiation of iPS cells into cardiomyocytes is promoted in substantially the same manner as ES cells, and effects exceeding the control are obtained not only in the number of cardiomyocytes and the size of clusters but also in the beating rate.

As described above, according to the present invention, oligo-DNA can strongly promote myocardial differentiation. Moreover, since the oligo-DNA can be chemically synthesized and has a stable structure, it can be supplied and stored in large amounts in the future, and is expected to be highly safe because it is derived from the genome sequence of lactic acid bacteria. Furthermore, by using inexpensive and safe berberine or analogues thereof in combination, it becomes possible to enhance the myocardial differentiation-promoting action of oligo-DNA.

The present invention relates to the induction of differentiation into cardiomyocytes from pluripotent stem cells, pluripotent stem cells, stem cells derived from pluripotent stem cells, or derived from pluripotent stem cells, pluripotent stem cells, and pluripotent stem cells. Cardiac regenerative therapy using stem cells, cardiomyocytes differentiated from these stem cells, screening for drug discovery, and generation of cardiomyocyte progenitor cells or cardiomyocytes for treatment and research of heart diseases.

Claims (3)

It contains an oligo-DNA having an activity of promoting differentiation into myocardium by applying it to at least one selected from the group consisting of pluripotent stem cells, pluripotent stem cells, and stem cells derived from pluripotent stem cells. A myocardial differentiation-promoting agent, wherein the oligo DNA consists of the base sequence represented by SEQ ID NO: 4:
SEQ ID NO: 4: 5'AGATTAGGGTGAGGGTGA3'. 2. The agent for promoting myocardial differentiation according to claim 1, which is applied to at least one selected from the group consisting of mammal-derived pluripotent stem cells, pluripotent stem cells, and stem cells derived from pluripotent stem cells. 3. A method for promoting myocardial differentiation using the myocardial differentiation-promoting agent according to claim 1 or 2 (excluding a method of administering a myocardial differentiation-promoting agent to a human body).

Images