JP5795705B2 - Genetically modified plant with high accumulation of target protein - Google Patents

Description

  The present invention relates to a genetically modified plant, and more particularly to a genetically modified plant transformed so as to highly accumulate a desired target protein.

  Genetic modification technology has been applied as a plant breeding method, and genetically modified crops such as soybean, corn, rapeseed, cotton, potato, etc., which have already been added with herbicide resistance and insect resistance, have been developed and put to practical use. Has been. Furthermore, in recent years, research and development for creating a genetically modified plant by introducing a useful foreign gene onto a plant chromosome as a means for producing a functional protein or peptide such as a drug or a test drug has been promoted. Functional components produced using genetically modified plants include not only proteins and peptides that are the products of the introduced gene, but also, for example, products resulting from the reaction of the introduced enzyme protein. Functional component production in plants has many advantages, especially cost reduction compared to animal transgenic lines, easy adjustment of production scale according to market scale, viruses and prions, etc. May not be contaminated with animal-derived pathogens.

  Regarding technologies for efficiently producing functional components in plants, for example, in order to control the timing of expression, location, and amount of expression of functional components, promoters specific to tissues that accumulate functional components are used. A method used for gene recombination is disclosed (see, for example, Patent Document 1).

  On the other hand, with regard to techniques for producing crops having high productivity, for example, in order to improve the nitrogen absorption capacity of plants and improve production efficiency, plants transformed by introducing an ammonium transporter gene (for example, Patent Document 2) and plants transformed by introducing a nitrate transporter gene (for example, Non-Patent Document 1) have been reported.

JP 2007-306941 A JP 2006-020605 A

Shiga Prefectural Agricultural Technology Promotion Center Report 2007

  In the case of developing a technique for highly accumulating functional components in a plant body, the above-mentioned Patent Document 1 is limited to a technique that uses a promoter that highly expresses a functional component in a genetically modified plant. There is still room for improvement from the point of view. Moreover, in said patent document 2 and nonpatent literature 1, the effect is not only about the reduction of fertilizer application amount but the improvement of the production efficiency of a plant, and is not mentioned about productivity of a functional component.

  In view of the situation as described above, an object of the present invention is to provide a genetically modified plant with improved yield of desired functional components. In the present specification, any protein or peptide desired to be highly expressed in a genetically modified plant may be referred to as “target protein”.

  As a result of diligent research, the inventors of the present invention have introduced a polynucleotide encoding a target protein and a polynucleotide encoding a nitrogen transporter into the plant body, so that the target protein can be highly accumulated in the plant body. Successful. The present invention provides a genetically modified plant in which a target protein is highly accumulated in a plant body.

  According to the present invention, a desired target protein can be produced with higher yield.

FIG. 1 is a diagram showing an outline of a schedule for cultivation management and the like.

  The present invention provides a genetically modified plant, a cultivation method thereof, and a method for producing seeds of the genetically modified plant.

1) Genetically modified plant In the genetically modified plant of the present invention, these polynucleotides were introduced by introducing a polynucleotide encoding a target protein and a polynucleotide encoding a nitrogen transporter into a plant cell. Plant cells (transformants) can be obtained, and then the obtained transformants can be produced by redifferentiation. Hereinafter, 1-1) a polynucleotide encoding a target protein and a polynucleotide encoding a nitrogen transporter, and related matters, 1-2) a plant into which the polynucleotide is introduced, 1-3) a plant of the polynucleotide Method for introduction into cells 1-4) Redifferentiation of transformants will be described in detail.

1-1) Polynucleotide encoding target protein, and polynucleotide encoding nitrogen transporter, and related matters A) Polynucleotide encoding target protein, and promoter A-1) to which the polynucleotide is linked Polynucleotide encoding target protein The target protein can be any protein (eg, polypeptide, oligopeptide) that is to be highly expressed in seeds. A preferred embodiment includes so-called functional proteins. A functional protein means a protein useful for human beings. Examples of functional proteins include antibacterial proteins, enzymes, antigenic proteins that can be used as vaccines (eg, cedar pollen antigenic peptides or fusion proteins thereof), and proteins that can be used as pharmaceuticals (eg, soluble proteins such as growth factors). It is done. A polynucleotide encoding the target protein can be obtained by a technique such as cloning of cDNA or genomic DNA. Moreover, if the nucleotide sequence is clarified in advance, these may be obtained by chemical synthesis. Furthermore, even if the nucleotide sequence is not clear, if the amino acid sequence is clear, the nucleotide sequence deduced from the amino acid sequence can be chemically synthesized.

A-2) Promoter to which a polynucleotide encoding a target protein is linked A polynucleotide encoding a target protein can be placed under the control of a promoter. As the promoter, any promoter capable of expressing the target protein in any tissue of the plant can be used, and examples thereof include the cauliflower mosaic virus 35S promoter, the promoter of nopaline synthase, etc., preferably expressed in the seed of the plant A protein promoter is used. Such a promoter can be obtained, for example, by the following method.

<Acquisition of promoter of protein expressed in seed>
Proteins expressed in seeds include those whose nucleotide sequence or amino acid sequence or function is registered in a known database or the like. Alternatively, seed proteins may be separated by electrophoresis or the like, and amino acid sequences and nucleotide sequences may be specified by various protein analysis methods. The location and nucleotide sequence of the promoter that regulates the expression of the seed protein may also be known. In the present invention, a promoter may be specified using a known nucleotide sequence, or a nucleotide sequence upstream from a protein nucleotide sequence may be used as a promoter. The promoter may be identified, for example, by using a nucleotide sequence commonly observed in promoters such as a TATA box, CCAAT box, and GC-rich sequence located upstream of the transcription region as a clue. The encoding polynucleotide and a nucleotide sequence presumed to be a promoter may be linked, and the expression level of a known protein may be measured and specified.

<Selection method of promoter of protein expressed in seed>
Promoters for proteins expressed in seeds can be selected by methods well known in the art. As such a promoter, one obtained by a specific selection method may be used. Preferably, the method for selecting a promoter that can be suitably used in the present invention can be roughly divided into the following two steps, step A and step B. Step A is a step of detecting RNA highly expressed under high nitrogen cultivation conditions or seed storage protein highly expressed under high nitrogen cultivation conditions in a predetermined plant. Step B is a step of isolating a promoter that regulates the expression of RNA and seed storage protein that are highly expressed under high nitrogen cultivation conditions.

<Step A: Detection of RNA>
In the detection of RNA in step A, plants are cultivated under at least two different nitrogen conditions, and RNA that is highly expressed under certain high nitrogen cultivation conditions in a certain plant species is detected using the difference in RNA content as an index. To do.

As an embodiment of the RNA detection method of step A, RNA satisfying the following formula (1) is detected.
V / W> 1.0 (1)
(However, in Formula (1), V is 70 mg / L to 750 mg / L of nitrate nitrogen and / or 70 mg / L of ammonium nitrogen for a certain period between 30 days before the scheduled flowering date and the flowering date. L is the amount of RNA contained in seeds of a given plant grown in a medium adjusted to L to 750 mg / L, W is between 30 days before the expected flowering date and the flowering date (It is the amount of RNA contained in the seeds of the plant when the plant is cultivated in a medium adjusted to have a nitrogen concentration of 0 mg / L to 50 mg / L for a certain period.)

  RNA satisfying the above formula (1) is RNA highly expressed under high nitrogen cultivation conditions. Expression control regions such as promoters that promote RNA expression under high nitrogen cultivation conditions can be collected from the RNA information thus detected.

  The V / W ratio is> 1.0, preferably> 1.25, more preferably> 1.50, and even more preferably> 2.0.

<Step A: Detection of seed storage protein>
In the detection of the seed storage protein in step A, the plant is cultivated under at least two different nitrogen conditions, and a high expression level is obtained in a certain plant species under a predetermined high nitrogen cultivation condition using the difference in the amount of seed storage protein accumulation as an index. The seed storage protein is detected.

As an embodiment of the method for detecting a seed storage protein in step A, a seed storage protein that satisfies the following formula (2) is detected.
X / Y> 1.0 (2)
(However, in Formula (2), X is 70 mg / L to 750 mg / L of nitrate nitrogen and / or 70 mg / L of ammonium nitrogen for a certain period between 30 days before the scheduled flowering date and the flowering date. L is the seed storage protein content of the plant when the plant is cultivated in a medium adjusted to be L to 750 mg / L, Y is nitrogen for a certain period from 30 days before the flowering date to the flowering date (It is the seed storage protein content of the plant when the plant is cultivated in a medium adjusted to 0 mg / L to 50 mg / L.)

  The seed storage protein that satisfies the above formula (2) is a seed storage protein that is highly expressed under high nitrogen cultivation conditions. Expression control regions such as a promoter that promotes expression of the seed storage protein under high nitrogen cultivation conditions can be collected from the information of the seed storage protein thus detected.

<Plant to be tested>
The “predetermined plant” in step A means a plant to be tested. The plant to be tested in step A is a plant to be searched for a promoter that promotes the expression of RNA and seed storage protein, and appropriately considering conditions such as the type of genetically modified plant to be produced later You may choose. The plant to be detected for RNA and seed storage protein is not particularly limited as long as seeds are formed. For example, typical examples of dicotyledonous plants include tobacco, rapeseed, and soybean, and examples of monocotyledonous plants include cereals such as rice, corn, barley, and wheat, asparagus, and the like. Among these, rice is a suitable plant because it has a high ability to accumulate proteins in seeds and has good seed preservation.

<Cultivation conditions>
The plant to be examined is cultivated under at least two different nitrogen conditions. As a preferred embodiment, cultivation is performed under the first cultivation condition and the second cultivation condition. The first cultivation condition is a condition where the supplied nitrogen concentration is high. On the other hand, the second cultivation condition is a condition in which the nitrogen concentration is relatively lower than the first cultivation condition. Specifically, the following conditions are exemplified.

  First cultivation condition: nitrate nitrogen is 50 mg / L to 750 mg / L and / or ammonium nitrogen is 50 mg / L to 750 mg / L in a certain period from 30 days before the scheduled flowering date to the flowering date. Cultivate in a medium adjusted to

  2nd cultivation conditions: It grows with the culture medium adjusted so that it may become 0 mg / L-50 mg / L of nitrogen in the fixed period between 30 days before a flowering date and the flowering date.

  The nitrogen condition in the culture medium starts from a point 30 days before the scheduled flowering date. The expected date of flowering varies from plant to plant, but research has been done for each plant at which point in the cultivated crops. For example, in the case of rice, 30 days before the scheduled flowering date corresponds to the young panicle differentiation stage.

  The nitrogen condition in the medium is adjusted for a certain period between 30 days before the scheduled flowering date and the flowering date. It is important to expose the plant to high nitrogen conditions at least once during this period to provide a certain physiological stimulus. That is, the “certain period” herein may be a period sufficient to give a certain physiological stimulus to the plant. The period of the high nitrogen condition may be appropriately adjusted depending on conditions such as the growth state of the plant and the type of plant. Although it varies depending on conditions such as the growth state of the plant and the type of plant, it is preferably cultivated under high nitrogen cultivation conditions, preferably for about 1 week, more preferably for about 2 weeks. In addition, it is preferable to place the plant under high nitrogen cultivation conditions immediately after 30 days before the scheduled flowering date and / or for a certain period immediately before flowering. In the case of rice, it may be placed under high nitrogen cultivation conditions over the entire period from 30 days before the flowering date to the flowering date.

  In plant cultivation, the nitrogen concentration in the medium easily fluctuates due to the absorption of nutrients by the plant, the ability to retain the fertilizer in the medium, and the like. In the first and second cultivation conditions, it is not always necessary to keep the nitrogen concentration in the medium constant, and fertilization management may be performed so as to be within the above concentration range. As long as the nitrogen concentration in the medium is managed as described above, the timing and frequency of fertilization, the concentration of fertilizer, and the like may be appropriately adjusted.

  In addition, the measurement of nitrogen concentration in the medium is based on general soil analysis methods and fertilizers such as nitrate ion meters, ammonia nitrogen meters, and fertilizer analysis methods established by the Ministry of Agriculture, Forestry and Fisheries. This can be done based on analytical methods.

Nitrate nitrogen is a nitrogen component that exists in the form of nitric oxide, such as nitrate ions. Usually, it exists in the form of nitrate in which metal is bonded to nitrate ions in the form of NO ₃ ⁻ .

  Moreover, ammonium nitrogen is a nitrogen component which exists in the form of ammonium salt among nitrogen components.

  The nitrogen source in the medium is adjusted so that nitrate nitrogen in the medium is 70 mg / L to 750 mg / L and / or ammonium nitrogen in the medium is 70 mg / L to 750 mg / L. That is, both nitrate nitrogen and ammonium nitrogen may be used as the nitrogen source, and the concentrations thereof may be adjusted, respectively, or only one of them may be used as the nitrogen source to adjust the concentration. Preferably, both are used as nitrogen sources. The ratio of the content of nitrate nitrogen and ammonium nitrogen is, for example, 750: 0 to 0: 750, preferably 100: 1 to 1: 100, more preferably 30: 1 to 1:30, more The ratio is preferably 10: 1 to 1:10, more preferably about 3: 1 to 1: 3.

  The content of nitrate nitrogen in the first cultivation condition is 70 mg / L to 750 mg / L, preferably 100 mg / L to 700 mg / L, more preferably 150 mg / L to 700 mg / L. When the content of nitrate nitrogen is adjusted to 70 mg / L or less, the content of the seed storage protein is decreased, and it is difficult to obtain an appropriate index for comparison with the second cultivation condition. On the other hand, when the content of nitrate nitrogen is adjusted to 750 mg / L or more, root rot is likely to occur, resulting in poor growth.

  The content of ammonium nitrogen in the first cultivation condition is 70 mg / L to 750 mg / L, preferably 100 mg / L to 700 mg / L, more preferably 150 mg / L to 700 mg / L. When the content of ammonium nitrogen is adjusted to 70 mg / L or less, the stored protein content of the seed is reduced, and it is difficult to obtain an appropriate index compared with the case of the second cultivation condition. On the other hand, when the content of ammonium nitrogen is adjusted to 750 mg / L or more, root rot is likely to occur, resulting in poor growth.

  As described above, for points other than the different predetermined nitrogen conditions, fertilization management suitable for the plant may be appropriately performed according to the type of plant to be cultivated. Examples of other components contained in the medium include phosphorus, potassium, manganese, boron, iron, calcium, copper, zinc, and magnesium.

  Examples of the cultivation of plants include hydroponics and soil cultivation. In soil cultivation, since the fertilizer component is adsorbed in the soil, there is an advantage that rapid fluctuation of the fertilizer component can be suppressed, but on the other hand, the fertilizer component that can be used by the plant is reduced. On the other hand, in hydroponics, all fertilizer components in the medium are in a state where the plant can be used. In the method for selecting a plant of the present invention, it is necessary to perform fertilization management so that nitrogen is adjusted to a predetermined condition. Therefore, hydroponics is more preferable in terms of easy adjustment of fertilizer components in the medium.

<Measurement of RNA contained in seed and determination of RNA>
RNA contained in seeds obtained from the plants grown under the first and second cultivation conditions is measured. The amount of RNA contained in the seeds of the plant cultivated under the first cultivation condition is V, and the amount of RNA contained in the seeds of the plant cultivated under the second cultivation condition is W.

  For the RNA contents V and W, various known RNA detection methods can be used. As one embodiment, for example, the amount of RNA can be measured using a microarray as follows. First, RNA is extracted from seeds, and a fluorescently labeled cDNA is synthesized and then hybridized with a DNA fragment on a microarray. After capturing a microarray image using a scanner, the fluorescence intensity of each spot is calculated using analysis software. The amount of RNA can be determined from the calculated spot intensity.

The RNA to be measured may be RNA contained in seeds. Based on RNA content V and W, the following formula (1):
V / W> 1.0 (1)
RNAs satisfying the requirements are selected. RNA satisfying formula (1) can exhibit high expression under predetermined high nitrogen cultivation conditions. Such RNA promoters can further promote RNA expression under high nitrogen cultivation conditions. Examples of RNA satisfying the above formula (1) include AK101497, AK120826, AJ002893, Os05g0329200, AK107271 (Gluterin A-3), AK102194, AK120697, AK067141, AK065009, AF017205, AK07586, AK0586, AK0659, AK0586, AK0658, AY987390 (Gluterin B-2), AK107314, X15833, AY196923 (Gluterin B-5), AK061894, AK107343 (Gluterin B-1), AK063955, J100041C23, J090009I07, AK063456, AK1073314, U4 0, AK064485, AK101309, AK107983, AK099918, AK100306, X83434, AK070414, AK103220, AK121856, AK062758, AK103306, AK061207, AK068266, Os06g0598500, AK119900, L19598, AK070851, Os01g0840300, AK059805, AK106244, AK108127, AK108230, AK061237, AK062517, AK065259, AK065604, AK106964, AK060983, J075074G08, AK099719 (GenBank Accession No.), glutelin, globulin, prolamin, etc. are mentioned (Reference Example 2 and (See Table 5). The plant from which these RNAs are derived is not particularly limited, and examples thereof include rice. The value of V / W is preferably 1.25 or more, more preferably 1.50 or more, and still more preferably 2.0 or more. RNA showing such values is clear from the description in Reference Example 2 and Table 5, for example. Therefore, such an RNA promoter is preferably used as the promoter of the target protein.

<Measurement of seed storage protein content and determination of seed storage protein>
Proteins stored in seeds obtained from plants grown under the first and second cultivation conditions are measured. Let X be the seed storage protein content of the plant cultivated under the first cultivation condition, and Y be the seed storage protein content of the plant cultivated under the second cultivation condition.

  The seed storage protein content X and Y can use various known protein detection methods. In one embodiment, for example, the protein content can be measured using electrophoresis as follows. First, various child storage proteins are separated into single spots on the gel by two-dimensional gel electrophoresis. Next, after the gel information is converted into an image file by a scanner, the fluorescence intensity of each spot is calculated using image analysis software. The protein content can be determined from the calculated spot intensity.

The protein to be measured may be a seed storage protein. Based on the seed storage protein content X and Y, the following formula (2):
X / Y> 1.0 (2)
Select a seed storage protein that satisfies The seed storage protein satisfying the formula (2) can exhibit high expression under predetermined high nitrogen cultivation conditions. In addition, such a seed storage protein promoter may further promote protein expression under high nitrogen cultivation conditions. Examples of the protein satisfying the above formula (2) include glutelin, globulin, prolamin protein, and more specifically, glutelin B-1, glutelin B-2, glutelin B-5, glutelin A-3, Globulin, 13 KDa prolamin and the like (see Reference Example 3 and Table 6). Although it does not specifically limit as a plant from which these proteins are derived, For example, a rice is mentioned. The value of X / Y is preferably 1.5 or more, more preferably 2.0 or more. The protein showing such a value is clear from the description in Reference Example 3 and Table 6, for example. Therefore, such a protein promoter is preferably used as the promoter of the target protein.

  As described above, RNA and seed storage protein whose expression level increases under predetermined high nitrogen cultivation conditions can be selected. The promoter of the seed storage protein thus selected is a promoter whose activity is improved by nitrogen, and further promotes protein expression in the plant body into which the nitrogen transporter gene has been introduced. By introducing such a promoter into a genetically modified plant described below, it can be a material for a genetically modified plant that highly expresses a desired target protein.

<Step B: Isolation of RNA that is highly expressed under high nitrogen cultivation conditions and promoter that regulates expression of seed storage protein>
In step B, a promoter that regulates the expression of RNA and seed storage proteins that are highly expressed under high nitrogen cultivation conditions is isolated. Such a promoter can be isolated from, for example, a plant to be tested in the above-described step A and from which RNA and seed storage proteins that are highly expressed under high nitrogen cultivation conditions are detected. A promoter can be isolated from expression control regions located upstream of a polynucleotide encoding RNA and seed storage protein.

  Various RNA and seed storage proteins and nucleotide sequences encoding them are known from known databases and the like. The location and nucleotide sequence of promoters that regulate the expression of RNA and seed storage proteins may also be known. In the present invention, the promoter may be specified using a known nucleotide sequence, or the nucleotide sequence encoding the RNA and seed storage protein selected in step A is searched, and the upstream nucleotide sequence is used as the promoter. May be used. The promoter may be identified by using, for example, a nucleotide sequence commonly observed in the promoter such as a TATA box, CCAAT box, or GC-rich nucleotide sequence located upstream of the transcription region, or a known protein. And a nucleotide sequence presumed to be a promoter may be ligated, and the expression level of a known protein may be measured and specified.

B) Polynucleotide encoding nitrogen transporter and promoter to which the polynucleotide is linked B-1) Polynucleotide encoding nitrogen transporter In the present invention, the nitrogen transporter is an ammonium transporter (AMT: Ammonium Transporter). ) And a nitrate ion transporter (NRT: Nitrate Transporter). There are a plurality of types of ammonium transporters and nitrate ion transporters in plants, and there are those in which nucleotide sequences, amino acid sequences, functions, etc. are registered in known databases. In the present invention, a nitrogen transporter may be specified by utilizing a known nucleotide sequence or amino acid sequence, or a nitrogen transporter from nucleotide sequence homology comparison, amino acid sequence homology comparison, protein structure comparison, etc. May be searched for and used. The nucleotide sequence of the nitrogen transporter to be used may be obtained by a cloning technique such as genomic DNA or cDNA, or may be obtained by artificial synthesis of a nucleotide sequence based on the sequence information. Furthermore, even if the nucleotide sequence is not clear, if the amino acid sequence is clear, the nucleotide sequence deduced from the amino acid sequence can be chemically synthesized. Examples of the nitrate ion transporter (NRT) include NRT1 and NRT2, and there are four NRT2 (NRT2.1, NRT2.2, NRT2.3, NRT2.4) for rice NRT2. Of these, it is preferable to use NRT2.1.

B-2) Promoter to which a polynucleotide encoding a nitrogen transporter is linked A polynucleotide encoding a nitrogen transporter can be placed under the control of a promoter. As the promoter, any promoter capable of expressing a nitrogen transporter in plant roots can be used. Examples of such a promoter include a promoter capable of specifically expressing a nitrogen transporter in plant roots, and a promoter capable of non-specifically expressing a nitrogen transporter in any plant tissue. Examples of promoters that can specifically express nitrogen transporters in plant roots include promoters of proteins that are highly expressed in roots, such as AB028882, Ay023261, J03469, O10273, P80627, and AF019212 (NCBI accession No.). Area. Examples of promoters that can non-specifically express a nitrogen transporter in any plant tissue include cauliflower mosaic virus 35S promoter, nopaline synthase promoter, 35SΩ promoter with various Ω sequences added to 35S promoter, and the like. Can be mentioned.

C) Expression vector As described above, a polynucleotide encoding a protein of interest and / or a nitrogen transporter can be placed under the control of a promoter. Therefore, the polynucleotide encoding the target protein and the polynucleotide encoding the nitrogen transporter may be preferably provided in the form of an expression vector. Examples of expression vectors that can be used in the production of the transgenic plant of the present invention include, for example, (i) an expression vector containing a polynucleotide encoding the target protein (expression vector for the target protein), and (ii) encoding a nitrogen transporter. An expression vector containing the polynucleotide to be expressed (nitrogen transporter expression vector), (iii) an expression vector comprising the polynucleotide encoding the target protein and the polynucleotide encoding the nitrogen transporter (expression of the target protein and nitrogen transporter) Vector). The present invention also provides such an expression vector or set thereof.

C-1) Target Protein Expression Vector The target protein expression vector includes a polynucleotide encoding the target protein and a promoter operably linked to the polynucleotide. The target protein expression vector can be prepared by ligating a polynucleotide encoding the target protein in a functional manner downstream of the promoter isolated as described above. The promoter used may be isolated from selected plant cells or may be synthesized.

  The target protein expression vector further includes a terminator (eg, a gene encoding a heat shock protein, a terminator derived from a nopaline synthase gene or cauliflower mosaic virus, a terminator region of a gene encoding a seed storage protein), a marker gene (eg, It may contain a kanamycin resistance gene (NPTII gene), a hygromycin resistance gene (http gene), a phosphinothricin acetyltransferase (bar) gene conferring resistance to bialaphos, an expression promoting element and the like. Known or commercially available vectors can be used. Examples of such vectors include pTL7, pBI101, pBI121, pBI2113, pBI2113Not, pBI221, pBIG, pGA482, pGAH, pLGV23Neo, pMON200, and pNCAT. Alternatively, pGluBsig7CrpKDEL may be used as an expression vector for the target protein (see JP 2004-321079 A).

C-2) Nitrogen Transporter Expression Vector The nitrogen transporter expression vector includes a polynucleotide encoding the nitrogen transporter and a promoter operably linked to the polynucleotide. A nitrogen transporter expression vector can be prepared by ligating a polynucleotide encoding a nitrogen transporter downstream of the above promoter in a functional manner. The promoter used may be isolated from selected plant cells or may be synthesized.

  The expression vector for the nitrogen transporter may further contain a terminator (eg, the terminator described above), a marker gene (eg, the gene described above), an expression promoting element, and the like. Known or commercially available vectors can be used. As such a vector, for example, the vectors described above may be used.

C-3) Expression vector of target protein and nitrogen transporter An example of an expression vector of the target protein and nitrogen transporter includes a first polynucleotide encoding the target protein and a second polynucleotide encoding the nitrogen transporter, and An expression vector comprising a promoter operably linked to the first and second polynucleotides. This expression vector allows transcription of polycistronic mRNA encoding the protein of interest and nitrogen transporter, followed by translation of the protein of interest and nitrogen transporter. The first polynucleotide encoding the target protein may be located upstream or downstream of the second polynucleotide encoding the nitrogen transporter. As the promoter, a promoter capable of expressing a protein in seeds and roots can be used. Examples of such a promoter include the promoters described above.

  Another example of a target protein and nitrogen transporter expression vector is a first polynucleotide composed of a first polynucleotide encoding a target protein and a first promoter operably linked to the first polynucleotide. An expression vector comprising: a second expression unit comprising: a second polynucleotide encoding a nitrogen transporter; and a second promoter operably linked to the second polynucleotide. . The first promoter may be the same as that described in the above A-2), and the second promoter may be the same as that described in the above B-2).

  The target protein and nitrogen transporter expression vector may further contain a terminator (eg, the terminator described above), a marker gene (eg, the gene described above), an expression promoting element, and the like. Known or commercially available vectors can be used. As such a vector, for example, the vectors described above may be used.

1-2) Plant into which polynucleotide is introduced As a host into which the expression vector prepared as described above or a set thereof is introduced, a plant cell that produces a target protein as a genetically modified plant is used. The type of plant used as a host is not limited as long as the above promoter is recognized and the target protein can be expressed. The plant to be used as a host is suitable for the production of the target protein in consideration of the ease of cultivation management, the environment of the cultivation area, the growth period, the ease of harvesting, and the conditions such as the nature, size and yield of the seed. You may select a thing suitably. A preferred embodiment includes a form in which the same plant species as the promoter is selected as the host.

  An example of a plant to be used as a host, that is, a plant to be cultivated as a genetically modified plant is a seed plant. Examples of seed plants include dicotyledonous plants such as tobacco, rapeseed, and soybean, cereals such as rice, corn, barley, and wheat, and monocotyledonous plants such as asparagus. Among these, a plant belonging to the family Gramineae, particularly rice, is a preferred plant because it has a high ability to accumulate proteins in seeds and has good seed preservation.

1-3) Method of introducing polynucleotide into plant cell Plant transformed cells are prepared using the constructed expression vector or set thereof. The plant cell to be transformed can be, for example, a plant-derived cell that can be cultivated in large quantities as a genetically modified plant.

  Examples of methods for introducing the constructed expression vector or a set thereof into plant cells include physical and chemical methods such as microinjection, electroporation, polyethylene glycol, fusion, and high-speed ballistic penetration. (I. Potrykus, Annu. Rev. Plant Physiol. Plant Mol. Biol., 42: 205, 1991). In addition, an indirect introduction method can be used for plant cells via viruses or bacteria that infect plants (I. Potrykus, Annu. Rev. Plant Physiol. Plant Mol. Biol., 42: 205, 1991). In this case, cauliflower mosaic virus, gemini virus, tobacco mosaic virus, brom mosaic virus and the like can be used as viruses, and Agrobacterium tumefaciens, Agrobacterium rhizogenes and the like can be used as bacteria.

1-4) Redifferentiation of transformant Next, a recombinant tissue or a recombinant individual is cultured from a plant cell into which a foreign gene has been introduced by the above method. Cells that have undergone gene transfer treatment are appropriately grown and re-differentiated by selection using the target gene or selection marker gene as a marker while selecting specific traits for expression or loss of specific traits due to gene deletion, etc. A recombinant tissue or a recombinant individual can be cultured. A seed can be collected from a plant obtained by redifferentiation, and the gene recombinant can be propagated using the obtained seed.

  Although not necessarily clear, one reason why the productivity of a desired target protein is improved by the present invention is presumed as follows. It is known that plant nitrogen metabolism is activated by activation of a transporter gene by nitrate ions or ammonium ions. By introducing a nitrogen transporter into plants, it is assumed that nitrogen can be efficiently absorbed as a raw material for amino acid generation during the vegetative growth period, and as a result, genes involved in amino acid synthesis can be activated. The In addition, when the seed ripening period is entered, it is presumed that the protein synthesis gene of the seed is activated by the influence of amino acids highly accumulated in the plant body. As the amount of protein in the seed increases, the amount of target protein is also considered to increase. It is thought that the target protein will increase by improving the activity of the genes related to nitrogen metabolism, so the protein that works to improve the activity of genes related to nitrogen metabolism by high expression such as glutamate transporter It is speculated that the same effect as the nitrogen transporter can be expected.

2) Cultivation method of genetically modified plant The genetically modified plant produced by the “method for producing genetically modified plant” can be cultivated by a known cultivation method. The genetically modified plant of the present invention may also be cultivated under any nitrogen condition (known fertilizer management method, known medium (cultured soil / hydroponic solution)), but is described in the following Step C. It may be grown under nitrogen conditions.

<Step C: Cultivation of genetically modified plants under predetermined nitrogen conditions>
Preferably, nitrate nitrogen is 70 mg / L to 750 mg / L and / or ammonium nitrogen is 70 mg / L to 750 mg / L for a certain period between 30 days before the scheduled flowering date and the flowering date of the plant. Cultivate in a medium adjusted to be. In addition, you may adjust suitably the specific cultivation conditions other than nitrogen conditions according to the kind of plant about a genetically modified plant. More preferably, it is cultivated under the above fertilizer conditions by a hydroponics method.

3) Seed production method The genetically modified plant cultivated in the present invention may be used as it is, or may be used after separating and purifying the introduced target protein.

  When the genetically modified plant is a seed plant, the cultivation method of the genetically modified plant of the present invention is also a seed production method. Examples of seed plants include monocotyledonous plants (eg, grains such as rice, corn, barley, wheat, and asparagus) and dicotyledonous plants (eg, tobacco, rapeseed, soybean), but seed protein storage. Because of its high nature, grasses are preferred, and rice is more preferred.

  In the case of seed production, seeds are collected when they form and reach a predetermined maturity level. Collecting here is synonymous with harvesting in fields such as agriculture and horticulture. Therefore, it widely includes not only the isolation of the seed itself but also the recovery of the plant body containing the seed from the cultivation area.

  The target protein is highly expressed in the seeds produced by the seed plant production method of the present invention. The target protein may be purified from the seed, or the seed itself may be used as it is. When the target protein is a functional protein that can be ingested by humans, the seed may be ingested as it is, or may be ingested after being subjected to any treatment (eg, cooking, processing). Seeds or processed products thereof are useful, for example, as food (eg, functional food), pharmaceuticals (eg, vaccines, antibodies), and reagents (eg, diagnostic agents, culture reagents).

  Once a genetically modified plant as described above is produced, the genetically modified plant line can be maintained according to the normal breeding method of the plant species.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated further in detail, this invention is not limited to the Example which concerns. In the following examples, more detailed experimental operations are performed according to Molecular Cloning (Sambrook et. Al., 1989) or the manufacturer's instructions for molecular biological techniques, unless otherwise specified. It was.

[Example 1]
1. Production of transgenic plant <Creation of vector for gene introduction>
35S promoter fragments (fragment A) (Primer 1: AACCTGCAGGGAGACATGGTGGAGCACGACACTCT (SEQ ID NO: 1), Primer 2: TTAGATCTTGTAGTTTGATAGATG number) were added by PCR to the Sse8387I site at the N-terminus and the XbaI site at the C-terminus.

  Nrt2 mRNA sequence (ACCESSION AB008519) was obtained from NCBI HomePage, Nucleotide Database. Based on the acquired sequence information, a PCR primer (Primer3: AATCTAGAATGGGACTCGTCGGACGGTGGGGCGCTC (SEQ ID NO: 3)) added with an XbaI site at the N-terminus and a PCR primer (Primer4: TTCCATGGTGTGCGTGTGCGTCTGCGTGCTGGTGTGCGTCTGCGTGCTGGTGTGCGTC Designed. Using the designed primers and Total RNA extracted from Nipponbare, TaKaRa RNA PCR Kit (AMV) Ver. 3.0 (purchased from Takara Bio Inc.) gave an Nrt2 fragment (fragment B) with an XbaI site added to the N-terminus and a KpnI site added to the C-terminus.

  PCR was performed using the plasmid pRI910 35S-GUS-HSP containing the HSP terminator as a template, and a KpnI site at the N-terminus and an EcoRI site at the C-terminus (fragment C) (Primer5: AAGGTACCATATGAAGATGAAGATGAAA (SEQ ID NO: 5), Primer6 : AAGAATTCCCTTATCTTTAATCATATTCC (SEQ ID NO: 6)).

  The obtained fragment A and pUC18 were treated with Sse8387I (purchased from Takara Bio Inc.) and XbaI (purchased from Takara Bio Inc.), then ligated using DNA Ligation Kit (purchased from Takara Bio Inc.), and DH5-α (Takara Bio Inc.) Purchased from the company) and amplified. The obtained pUC18 and fragment B containing fragment A were treated with XbaI and KpnI (purchased from Takara Bio Inc.), then ligated using DNA Ligation Kit, introduced into DH5-α and amplified. The obtained pUC18 and fragment C containing fragment A and fragment B were treated with KpnI and EcoRI (purchased from Takara Bio Inc.), ligated using DNA Ligation Kit, introduced into DH5-α and amplified. The obtained pUC18 containing fragment A, fragment B and fragment C was treated with Sse8387I and EcoRI, and then fragments A, B and C were converted into plasmid pTL7 (H. Ebinuma et al., Molecular Methods of Plant Analysis, 22:95, 2002). The expression vector was constructed by ligating between the EcoRI-Sse8387I restriction enzyme sites in (1) using the DNA Ligation Kit.

<Introduction to Agrobacterium>
Agrobacterium tumefaciens (A. tumefaciens) strain EHA105 was added to 10 ml of YEB liquid medium (5 g / l beef extract, 1 g / l yeast extract, 5 g / l peptone, 5 g / l sucrose, 2 mM MgSO ₄ , pH 7 at 22 ° C. .2 (hereinafter referred to as pH at 22 ° C. unless otherwise specified)) and OD. After culturing at 28 ° C. until 630 reaches a range from 0.4 to 0.6, the culture solution was centrifuged at 6900 × g, 4 ° C. for 10 minutes to collect the cells. The collected cells are suspended in 20 ml of 10 mM HEPES (pH 8.0) and collected again by centrifugation at 6900 × g, 4 ° C. for 10 minutes, and the cells are suspended in 200 μl of YEB liquid medium. Thus, a bacterial solution for plasmid introduction was obtained. In a 0.5 ml tube, 50 μl of the above-mentioned plasmid-introducing bacterial solution and an expression vector are mixed, and electroporation method (Gen Pulser II system (purchased from BIORAD)) is used. An expression vector was introduced into the Tumefaciens EHA105 strain. The cells after the expression vector introduction treatment were added with 200 μl of YEB liquid medium and cultured at 25 ° C. for 1 hour with shaking, and then 50 mg / l kanamycin-added YEB agar medium (agar 1.5 w / v%). The other compositions were the same as above.) And cultured at 28 ° C. for 2 days. Subsequently, the resulting bacterial colonies were transplanted into a YEB liquid medium and further cultured. Plasmids were extracted from the grown bacterial cells by the alkaline method, and it was confirmed that expression vectors were introduced into these bacterial cells.

<Rice transformation by Agrobacterium EHA105>
Rice producing allergen-specific human T cell epitope-linked peptide (7CRP) (7CRP rice: described in JP-A No. 2004-321079. Expression vector pGluBsig7CrpKDEL containing a polynucleotide encoding 7CRP linked to the promoter of glutelin B-1 Is sterilized according to the method of Cell Engineering, separate volume Plant Cell Engineering Series 4 Model Plant Experiment Protocol (p93-98), and then the mature seed is treated with N6Cl2 medium (N6 inorganic salts and vitamins). (Chu CC, 1978, Proc. Symp. Plant TissueCure, Science Press Peking, pp. 43-50), 30 g / l sucrose, 2.8 g / l proline, 0.3 g / l casamino acid, 2 m / L 2,4-D, 4g / l Gelrite, pH = 5.8) To plated, sealed germinated by culturing at 28 ℃ bright place since in surgical tapes, was infected material with Agrobacterium EHA105. Agrobacterium EHA105 introduced with an expression vector cultured in a YEB agar medium (15 g / l bacto agar, other composition is the same as above) was transplanted into a YEB liquid medium and cultured overnight at 25 ° C. and 180 rpm. Thereafter, the cells were collected by centrifugation at 3000 rpm for 20 minutes, and N6 liquid medium containing 10 mg / l acetosyringone (N6 inorganic salts and vitamins, 30 g / l sucrose, 2 mg / l 2,4-D, pH = 5. 8), OD. The suspension was suspended so that 630 = 0.15 to obtain an Agrobacterium suspension for infection. The adjusted rice germination seeds were put into a 50 ml tube, and the Agrobacterium suspension for pouring was poured and immersed for 1.5 minutes. After soaking, the Agrobacterium suspension is discarded, and the germinated seeds are placed on a sterilized filter paper to remove excess water. / L sucrose, 2.8 g / l proline, 0.3 g / l casamino acid, 2 mg / l 2,4-D, 4 g / l gellite, pH = 5.2) and sealed with surgical tape 28 C. in the dark for 3 days and then N6Cl2TCH25 medium (N6 inorganic salts and vitamins, 30 g / l sucrose, 2.8 g / l proline, 0.3 g / l casamino acid, 2 mg / l 2,4-D , 500 mg / l carbenicillin, 25 mg / l hygromycin, 4 g / l gellite) and cultured.

<Redifferentiation of transformants>
One week after the start of cultivation in the N6Cl2TCH25 medium, germinated buds were removed from the scutellum tissue, and the remaining scutellum tissue was removed from the N6Cl4TCH25 medium (N6 inorganic salts and vitamins, 30 g / l sucrose, 2.8 g). / L proline, 0.3 g / l casamino acid, 4 mg / l 2,4-D, 500 mg / l carbenicillin, 25 mg / l hygromycin, 4 g / l gellite) for one week, and further MSRC medium (MS inorganic Salts and vitamins (Murashige, T. and Skog, F., 1962 Physiol. Plant., 15, 473), 30 g / l sucrose, 30 g / l sorbitol, 2 g / l casamino acid, 500 mg / l carbenicillin, 4 g / l Gerlite) transplanted and cultured, buds or seedlings Were redifferentiated.

Measurement of V / W and X / Y of 2.7 CRP expression promoter Rice was cultivated under the first and second cultivation conditions as described below. An outline of the cultivation schedule is shown in FIG. In addition, Table 1 shows the composition of the cultivation liquid A and the cultivation liquid B used.

<First cultivation condition for measuring RNA content V and seed storage protein X>
Seed of Nipponbare, a rice variety, was sterilized with hypochlorous acid and ethanol, spread evenly in a petri dish containing sterilized water, shielded from light, and cultured at 28 degrees for 5 days.

  Inside the artificial sunlight room, a seedling box was laid with a urethane mat soaked with water, and the seeds sprouting were sown. Light conditions: temperature 28 degrees, humidity 50%, 11 hours, dark conditions: temperature 23 degrees, humidity 50%, 13 hours, seedlings were cultured for 15 days.

  Filled with a cultivated bed of the simmering method (manufactured by M-type Hydroponics Research Laboratories) with 100 L of the culture solution A (see Table 1) and planted 77 seedlings one by one, light conditions: temperature 28 degrees, humidity 50%, 11 hours, dark condition: cultured at 45 ° C. for 45 days at 23 ° C. and 50% humidity.

  After additional fertilization to become a component of the cultivation liquid B (see Table 1), light conditions: temperature 28 degrees, humidity 50%, 11 hours, dark conditions: temperature 23 degrees, humidity 50%, 13 hours after culturing for 45 days, Seeds were obtained.

  Since hydroponics was performed as described above, the nitrogen concentration in the medium was controlled by controlling the nitrogen concentration of moisture in the cultivation bed. The nitrate nitrogen concentration was measured using a nitrate ion composite electrode (manufactured by Toa DKK Corporation). The ammonium nitrogen concentration was measured using an ammonia composite electrode (manufactured by TOA DK Corporation).

<Second cultivation condition for measuring RNA content W and seed storage protein Y>
Nipponbare seeds were sterilized with hypochlorous acid and ethanol, spread evenly on a petri dish containing sterilized water, protected from light, and cultured at 28 degrees for 5 days.

  Inside the artificial sunlight room, a seedling box was laid with a urethane mat soaked with water, and the seeds sprouting were sown. Light condition: temperature 28 degrees, humidity 50%, 11 hours, dark condition: temperature 23 degrees, humidity 50%, 13 hours, cultured for 15 days.

  Fill the cultivation pot with 5 L of soil containing 50 mg / L of nitrogen, plant one seedling obtained, light condition: temperature 28 degrees, humidity 50%, 11 hours, dark condition: temperature 23 degrees, humidity 50%, Cultivated at 13 hours for 45 days.

  Top fertilization was performed so that nitrogen in the soil was 50 mg / L, light conditions: temperature 28 degrees, humidity 50%, 11 hours, dark conditions: temperature 23 degrees, humidity 50%, 13 hours, cultured for 45 days, seeds Got.

2. RNA analysis <Preparation of microarray sample>
Each seed on the 20th day after flowering obtained by cultivation under the above conditions was frozen in liquid nitrogen, crushed in a mortar, treated with Fruit-mate for RNA Purification (purchased from Takara Bio Inc.), RNAiso Plus ( (Purchased from Takara Bio Inc.). Thereafter, it was treated with Recombinant DNase I (RNase-free) (purchased from Takara Bio Inc.), purified with Oligotex ^™ -dT30 <Super> mRNA Purification Kit (From Total RNA) (purchased from Takara Bio Inc.), and the RNA solution was purified. Obtained.

  Total RNA obtained from rice seeds grown under the first cultivation conditions and Total RNA obtained from rice seeds grown under the second cultivation conditions were adjusted to 800 ng / 1 sample, and cyanine 3-CTP It dispensed to a tube so that it might become 400ng for dye labels and 400ng for cyanine 5-CTP dye labels, respectively. Cyanine-labeled cDNA was generated using Low RNA Fluorescent Linear Amplification Kit PLUS, for 2 colors (purchased from Agilent Technologies), and purified using RNeasy mini kit (purchased from Qiagen).

<Hybridization>
Divide each tube with 825 ng of cDNA obtained from rice seeds cultivated under the first cultivation conditions labeled with cyanine 3-CTP dye and 825 ng of cDNA obtained from rice seeds cultivated with the second cultivation condition labeled with cyanine 5-CTP dye. Then, after treatment with Gene Expression Hybridization Kit (purchased from Agilent Technologies), rice oligo DNA microarray 4x44K RAP-DB (purchased from Agilent Technologies) was filled and hybridized.

<Image analysis>
Images were scanned with a DNA microarray scanner (manufactured by Agilent Technologies), and the spots were digitized. Furthermore, using the image analysis software GeneSpring GX (manufactured by Agilent Technologies), the fluorescence intensities of the 3-CTP dye and the 5-CTP dye were compared, and V / W was measured.

3. Protein analysis <Preparation of two-dimensional gel sample>
Each seed obtained by cultivating under the first and second cultivation conditions was crushed with a multi-bead shocker (manufactured by Yasui Kikai Co., Ltd.) after removing the scutellum, and 8M urea, 4% (w / v) ) Homogenized in an extraction solution containing SDS, 20% (w / v) glycerol, 50 mM phosphate buffer to obtain a protein solution. The obtained protein solution was purified with ReadyPre 2-D Cleanup Kit (purchased from BIO-RAD LABORATORIES (hereinafter abbreviated as BIO-RAD)), and ReadyStripe 7-10 Buffer (purchased from BIO-RAD) was purchased. Added. The total protein concentration was determined using RC DC Protein Assay (purchased from BIO-RAD).

<Two-dimensional gel electrophoresis>
Isoelectric focusing for protein separation in the first dimension was carried out using PROTEAN IEF cell (purchased from BIO-RAD) and 7 cm ReadyStrip IPG Strip 3-7NL (purchased from BIO-RAD). Electrophoresis for protein separation in the second dimension is carried out by equilibrating IPG Strip with equivalence buffer I and equivalence buffer II (purchased from BIO-RAD), PROTEAN cell (purchased from BIO-RAD) and 10-20% resolving ready. The test was performed using Gel Precast Gel (purchased from BIO-RAD). Samples were run with a molecular weight marker and an isoelectric point pl calibration marker for calculation of the molecular weight and isoelectric point of the protein spot during image analysis. Immediately after the two-dimensional SDS-PAGE, Gel was infiltrated into a fixative containing 40% ethanol and 10% acetic acid for 2 hours and treated with Flamingo Gelstein (purchased from BIO-RAD).

<Image analysis of two-dimensional gel>
The treated gel was digitized using a Pharos FX Molecular Imager (purchased from BIO-RAD). Quantity One and PDQuest (purchased from BIO-RAD) were used to identify the spot positions of the six seed storage proteins, and X / Y was measured from the spot intensity. The six seed storage proteins are globulin, glutelin, glutelin B-5, glutelin B-1, 10 kDa prolamin, and 13 kDa prolamin.

4). Cultivation of genetically modified plants The rice obtained in the above "1. Production of genetically modified plants" was cultivated in the following manner. Table 2 shows the composition of the cultivation liquid C and the cultivation liquid D used for cultivation.

  First, buds or seedlings re-differentiated from the scutellum tissue obtained by “1. Production of genetically modified plants” above were transplanted to a rooting medium and grown to become seedlings having a height of about 20 cm. .

  Filled with a cultivated bed (M-type Hydroponic Research Laboratories) with 100L of cultivation liquid C (see Table 2) and planted 77 seedlings one by one, light conditions: temperature 28 degrees, humidity 50%, 11 hours, dark condition: cultured at 45 ° C. for 45 days at 23 ° C. and 50% humidity.

  Additional fertilization was performed so as to become a component of the cultivation liquid D (see Table 2), and the culture was performed for 45 days under bright conditions: temperature 28 degrees, humidity 50%, 11 hours, dark conditions: temperature 23 degrees, humidity 50%, 13 hours.

5. Measurement of protein content Seeds were collected from the plant obtained in “4. Cultivation of genetically modified plants”, and the protein content in the seeds was measured in the following manner.

<Total protein content of seeds>
The protein content in the seed from which the cup was removed was measured with a near infrared protein analyzer NIRFLEX N-500 (manufactured by BUCHI), and the total protein content was calculated from the seed weight.

<Amount of functional protein (hay fever alleviation peptide: 7crp)>
The protein in the seed and a protein marker of a known concentration were migrated with an SDS-PAGE kit (purchased from BIO-RAD), Gel was permeated into a fixative containing 40% ethanol and 10% acetic acid for 2 hours, and Flamingo Gelstein ( Purchased from BIO-RAD). The treated gel was digitized using a Pharos FX Molecular Imager (purchased from BIO-RAD). The band position of 7crp was specified using Quantity One (purchased from BIO-RAD), and the weight of pollen alleviation peptide (7crp) was calculated in comparison with the band intensity of a marker with a known concentration. In this way, the amount of total protein in the seed collected from the genetically modified plant and the amount of functional protein introduced by transformation were determined.

[Example 2]
Cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1 except that the 7CRP expression promoter was G / H = 1.59 and X / Y = 2.40 Glutelin B-5. It was.

[Example 3]
Except that the ammonium nitrogen content of the culture solution D was 150 mg / L, cultivation of the genetically modified plant and measurement of the protein content were performed in the same manner as in Example 1.

[Example 4]
Cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1 except that the nitrate nitrogen content of the culture medium D was 50 mg / L and the ammonium nitrogen content was 150 mg / L. It was.

[Example 5]
Cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1 except that the nitrate nitrogen content of the culture solution D was 70 mg / L and the ammonium nitrogen content was 70 mg / L. It was.

[Example 6]
Cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1 except that the nitrate nitrogen content of the culture medium D was 750 mg / L and the ammonium nitrogen content was 750 mg / L. It was.

[Example 7]
Except that the cultivation conditions for W and Y were hydroponics, the cultivation of genetically modified plants and the measurement of protein content were carried out in the same manner as in Example 1.

[Example 8]
Except that the ammonium nitrogen content of the culture broth B was 20 mg / L, the cultivation of the genetically modified plant and the protein content were measured in the same manner as in Example 1.

[Example 9]
Except that the nitrate nitrogen content of the culture solution B was 20 mg / L, the cultivation of the genetically modified plant and the measurement of the protein content were performed in the same manner as in Example 1. Except that the nitrate nitrogen content of the culture solution B was 20 mg / L, the cultivation of the genetically modified plant and the measurement of the protein content were performed in the same manner as in Example 1.

[Example 10]
Except that the 7 CRP expression promoter was a 10 KDa prolamin promoter of V / W = 0.80, cultivation of the genetically modified plant and measurement of protein content were carried out in the same manner as in Example 1.

[Example 11]
The cultivation of genetically modified plants and the measurement of protein content were carried out in the same manner as in Example 1 except that the nitrate nitrogen content of the culture broth B was 20 mg / L and the ammonium nitrogen content was 20 mg / L. went.

[Comparative Example 1]
Except that 7CRP rice was used for cultivation, cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1.

[Comparative Example 2]
Except for using Nipponbare for transformation of rice with Agrobacterium EHA105, cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1.

[Comparative Example 3]
Except for using Nipponbare for cultivation, cultivation of genetically modified plants and measurement of protein content were carried out in the same manner as in Example 1.

  Table 3 shows details of the transgene and the promoter of the target gene for Examples 1 to 11 and Comparative Examples 1 to 3.

  Table 4 shows details of the cultivation conditions of the genetically modified plant, the total protein amount in the seed, and the target protein (7CRP) amount in the seed for Examples 1 to 11 and Comparative Examples 1 to 3.

[Reference Example 1]
Natural rice (non-genetically modified plant) was cultivated under the first and second cultivation conditions described in Example 1. The outline of the cultivation schedule was as shown in FIG. Moreover, the composition of the used cultivation liquid A and the cultivation liquid B was as Table 1 showed. Specifically, seeds of Nipponbare, which is a variety of rice, were cultured under the first and second cultivation conditions described in Example 1 to obtain seeds.

[Reference Example 2]
Each seed on the 20th day after flowering obtained by cultivation under the conditions described in Reference Example 1 is subjected to the treatment described in “2. Analysis of RNA” above, and RNA satisfying V / W> 1 Was detected. Table 5 shows the measured spot intensity values.

[Reference Example 3]
Each seed on the 45th day after flowering obtained by cultivation under the conditions described in Reference Example 1 was subjected to the treatment described in “3. Protein analysis” above. Table 6 shows the measured spot intensity values.

  About the said reference examples 1-3, it is based on the Japanese application (application number: 2009-021846) for which it applied on February 2, 2009, and the PCT application (application number: on application number: August 26, 2009). See also PCT / JP2009 / 64876).

SEQ ID NO: 1: forward primer for cloning 35S promoter fragment (Primer1)
SEQ ID NO: 2: Reverse primer for cloning 35S promoter fragment (Primer2)
SEQ ID NO: 3: Forward primer for cloning Nrt2 fragment (Primer3)
SEQ ID NO: 4: Reverse primer (Primer4) for cloning the Nrt2 fragment
SEQ ID NO: 5: forward primer for cloning HSP terminator fragment (Primer5)
SEQ ID NO: 6: Reverse primer for cloning the HSP terminator fragment (Primer6)

Claims (17)

A genetically modified plant into which a polynucleotide encoding a target protein and a polynucleotide encoding a nitrogen transporter are introduced,
Introducing a polynucleotide encoding a target protein includes the expression vector of the target protein including a promoter of the protein expressed in the seed selected from glutelin, globulin, and prolamin operably linked to the polynucleotide and the polynucleotide Is introduced,
Introduction of a polynucleotide encoding a nitrogen transporter, the polynucleotide, and a promoter that is expressed in the roots of the polynucleotide operably linked plant is another vector and the expression vector, nitrogen By introducing a transporter expression vector,
Genetically modified plant.   The genetically modified plant according to claim 1, wherein the nitrogen transporter is a nitrate transporter (NRT).   The genetically modified plant according to claim 2, wherein the nitrogen transporter (NRT) is NRT2.   The genetically modified plant according to claim 3, wherein the NRT2 is rice NRT2.1. The promoter of the protein expressed in the seed is represented by the following formula (1):
V / W> 1.0 (1)
(However, in Formula (1), V is 70 mg / L to 750 mg / L of nitrate nitrogen and / or 70 mg / L of ammonium nitrogen for a certain period between 30 days before the scheduled flowering date and the flowering date. L is the amount of RNA contained in seeds of a given plant grown in a medium adjusted to L to 750 mg / L, W is between 30 days before the expected flowering date and the flowering date Expression of RNA expressed in seeds that satisfy the plant seeds when the plant is cultivated in a medium adjusted to nitrogen 0 mg / L to 50 mg / L for a certain period of time) The genetically modified plant according to any one of claims 1 to 4, which is a promoter to be regulated. The promoter of the protein expressed in the seed is represented by the following formula (2):
X / Y> 1.0 (2)
(However, in Formula (2), X is 70 mg / L to 750 mg / L of nitrate nitrogen and / or 70 mg / L of ammonium nitrogen for a certain period between 30 days before the scheduled flowering date and the flowering date. L is the content of the seed storage protein contained in the seed of the plant when the predetermined plant is grown in a medium adjusted to L to 750 mg / L, Y is the flowering date from 30 days before the scheduled flowering date The content of the seed storage protein contained in the seed of the plant when the plant is cultivated in a medium adjusted to be 0 mg / L to 50 mg / L of nitrogen for a certain period of time. The genetically modified plant according to any one of claims 1 to 4, which is a promoter that regulates expression of a seed storage protein that is satisfied.   The genetically modified plant according to claim 5 or 6, wherein the predetermined plant and the genetically modified plant are the same plant species.   The genetically modified plant according to claim 7, wherein the predetermined plant and the genetically modified plant are gramineous plants.   The cultivation method of a genetically modified plant including cultivating the genetically modified plant in any one of Claims 1-8.   During a certain period of time from 30 days before the flowering date of the genetically modified plant to the flowering date, the nitrate nitrogen is 70 mg / L to 750 mg / L and / or the ammonium nitrogen is 70 mg / L to 750 mg / L. The cultivation method of Claim 9 performed by the culture medium adjusted so that it may become.   The cultivation method according to claim 9 or 10, wherein the genetically modified plant is cultivated by hydroponics.   A method for producing seeds of a genetically modified plant, comprising cultivating the genetically modified plant by the method according to any one of claims 9 to 11 and collecting seeds.   The seed production method according to claim 12, wherein the plant is rice and the seed is rice.   The seed of the genetically modified plant in any one of Claims 1-8. A target protein expression vector comprising a polynucleotide encoding the target protein and a promoter of a protein expressed in a seed selected from the group consisting of glutelin, globulin, and prolamin, operably linked to the polynucleotide, and nitrogen comprising a polynucleotide encoding a transporter, and a promoter that is expressed in the roots of the polynucleotide operably linked plant is another vector and the expression vector, the expression vector of nitrogen transporter ,
A set of expression vectors for production of genetically modified plants that highly express the target protein. In introducing a polynucleotide encoding a target protein and a polynucleotide encoding a nitrogen transporter,
Introducing a polynucleotide encoding a target protein includes the expression vector of the target protein including a promoter of the protein expressed in the seed selected from glutelin, globulin, and prolamin operably linked to the polynucleotide and the polynucleotide Is introduced,
Introduction of a polynucleotide encoding a nitrogen transporter, the polynucleotide, and a promoter that is expressed in the roots of the polynucleotide operably linked plant is another vector and the expression vector, nitrogen By introducing a transporter expression vector,
A method for producing a transgenic plant.   A method for producing a genetically modified plant, comprising introducing the set of expression vectors according to claim 15 into a plant to obtain a transformed genetically modified plant.

Images