CN113736798B

CN113736798B - Zinc-cadmium-resistant gene TmZRC1S from truffle and application thereof

Info

Publication number: CN113736798B
Application number: CN202110871650.3A
Authority: CN
Inventors: 王丽娟; 姚泉洪; 彭日荷; 韩红娟; 田永生; 高建杰; 许晶; 付晓燕; 王波; 李振军; 张福建; 张文慧; 邓永东; 王宇
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2021-07-30
Filing date: 2021-07-30
Publication date: 2023-11-28
Anticipated expiration: 2041-07-30
Also published as: CN113736798A

Abstract

Zinc-cadmium-resistant gene derived from truffle melanosporumTmZRC1S and application thereof, a predicted zinc transport protein gene sequence GSTUMT00007113001 derived from truffle is modified according to plant codon preference, and gene synthesis is performed by a gene synthesis method to obtain a nucleotide sequence shown as SEQ ID No. 1TmThe ZRC1S gene is used for constructing a recombinant expression vector and transferring the recombinant expression vector into arabidopsis thaliana, so that a transgenic arabidopsis thaliana plant with stronger zinc-cadmium resistance and zinc-cadmium enrichment capability is obtained. After being treated by zinc and cadmium solution, the transgenic strain grows better than the wild strain, and the zinc and cadmium content in the transgenic strain is obviously higher than that of the wild strain, especially the zinc content in the overground part is 3.74 times of that of the wild strain, and the cadmium content is 3.36 times of that of the wild strain, which indicates that the invention is modified and synthesizedTmThe ZRC1S gene has the capability of improving plant resistance and enriching zinc and cadmium, and can be used for cultivating plants enriched with zinc and cadmium.

Description

Zinc-cadmium-resistant gene TmZRC1S from truffle and application thereof

Technical Field

The invention belongs to the technical field of cultivation of zinc-cadmium-enriched plants, and particularly relates to a zinc-cadmium-resistant gene TmZRC1S derived from truffle and application thereof.

Background

The treatment of heavy metal pollution in soil becomes a research hot spot. The conventional method for repairing the heavy metal polluted soil comprises physical repair and chemical repair, wherein the method is based on the related characteristics of the physicochemical property of the soil and the difference of the heavy metals, and adopts a chemical or physical method to fix or separate the heavy metals in the soil, so that the pollution influence is reduced. These methods tend to be complex in steps, costly to produce, and prone to secondary pollution. The enrichment effect of some super-accumulated plants on heavy metals is also attracting attention, and the method for repairing the heavy metal contaminated soil by using the plants has the advantages of low cost, easy operation, no damage to the soil structure and the like.

The transport protein plays an important role in the tolerance of plants to heavy metals and the super accumulation action mechanism, and is not involved in the transport protein whether the high-efficiency absorption and transport of heavy metals or the separation detoxification of heavy metals are carried out. Among the metal ion transporters identified, the most studied ones for zinc ion absorption and transport are the ZIP (Zn-regulated, ion-regulated transporter-like Protein) family and the CDF (Cation Diffusion Factor) family of proteins. Overall, the main function of the ZIP family is to take up zinc, while members of the CDF family are primarily involved in the efflux of zinc and compartmentalization of zinc within cells for detoxification or storage purposes. Zinc can regulate the activity of both types of transporters at both the transcriptional and translational levels to maintain zinc homeostasis at the cellular and organism levels.

The TmZRC1S gene belongs to CDF family, and research report on the application of the gene to plant zinc and cadmium resistance is not seen at present.

Disclosure of Invention

The invention aims to solve the technical problem of providing a zinc-cadmium resistant gene TmZRC1S derived from black fungus (Tuber melanosporum) and application thereof, and the gene is transferred into arabidopsis thaliana, so that the capability of heavy metal zinc and cadmium resistance of transgenic plants is improved, the accumulation of zinc and cadmium of the transgenic plants is improved, and the gene can be used for cultivating plant varieties with improved zinc-cadmium resistance and enrichment capability.

In order to achieve the above purpose, the invention is realized by the following technical scheme:

a zinc-cadmium-resistant gene TmZRC1S from Blackeria melanosporum, the nucleotide sequence of which is shown as SEQ ID NO1, is obtained by an artificial synthesis method according to plant preference codons, namely complete gene synthesis (PTDS) is carried out by two-step PCR by using a large number of overlapped primers (Nucleic Acids Research,2004, 32:e98).

The recombinant expression vector containing the zinc-cadmium-resistant gene TmZRC1S also comprises a double 35S promoter, a GUS reporter gene and a kanamycin resistance marker gene with introns.

The invention provides application of a zinc-cadmium-resistant gene TmZRC1S derived from truffle melanosporum in cultivation of zinc-cadmium-resistant plants. Preferably, the zinc-cadmium resistant plant is arabidopsis thaliana.

A method for transferring the zinc-cadmium-resistant gene TmZRC1S into Arabidopsis comprises the following steps:

1) Construction of recombinant expression vector BH440

After the PCR product is subjected to double digestion by BamHI and SacI, the TmZRC1S gene synthesized by the method is connected with a plant expression vector pCAMBIA-1301 containing double 35S promoters through T4DNA ligase, and a recombinant expression vector BH440 containing the target gene TmZRC1S is obtained through enzyme digestion identification and sequence determination.

2) Electric shock method for transforming agrobacterium

And introducing the constructed recombinant expression vector BH440 into agrobacterium tumefaciens by using an electric shock method, wherein the agrobacterium tumefaciens strain is LBA4404.

3) Agrobacterium dip-flower method for transforming arabidopsis thaliana

Agrobacterium tumefaciens introduced with the TmZRC1S gene was transformed into Arabidopsis thaliana by the Agrobacterium dip-plating method (Clough et al The plant journal,1998, 16 (6): 735-743), transformed plants were selected by using 50. Mu.g/ml hygromycin, seedlings that normally grew on hygromycin plates were transplanted, harvested, and positive seedlings were identified.

The zinc-cadmium-resistant gene TmZRC1S derived from the truffle belongs to CDF family, the CDF family gene derived from the truffle is modified for the first time, plant zinc-cadmium resistance research is carried out after transformation in Arabidopsis thaliana, and the zinc-cadmium enrichment capability of the plant zinc-cadmium-resistant gene TmZRC1S is verified.

And constructing a recombinant expression vector and transferring the recombinant expression vector into arabidopsis thaliana to obtain a transgenic arabidopsis thaliana plant with stronger zinc-cadmium resistance and zinc-cadmium enrichment capability. After being treated by zinc and cadmium solutions, the transgenic plant system grows better than a wild plant system, and the TmZRC1S gene modified and synthesized by the invention has the capability of improving plant resistance and enriching zinc and cadmium, and can be used for cultivating plants enriching zinc and cadmium.

The TmZRC1S gene is transferred into arabidopsis, the arabidopsis is subjected to selfing and homozygosis for 2 generations to obtain a homozygosis transformant, seeds are collected for sowing, the seedlings are irrigated with zinc and cadmium solutions, the growth of contrast wild arabidopsis is greatly influenced after 10 days of treatment, the arabidopsis transgenic plants containing the TmZRC1S gene are good in growth, and leaves are green, so that the TmZRC1S gene can improve the zinc and cadmium resistance of arabidopsis.

The harvested homozygous 2-generation seeds and wild arabidopsis seeds are sterilized and sown on an MS solid culture medium, after 10-14 days, the seeds are transplanted to water culture, 1/2Hoagland nutrient solution is used for culturing (the nutrient solution is replaced every 3 days), after the seedlings are subjected to zinc and cadmium solution treatment, the zinc and cadmium contents of the upper parts and roots of wild type and transgenic plants are measured, the zinc and cadmium content in the transgenic plants is obviously higher than that of the wild type plants, particularly the zinc content of the upper parts is 3.74 times that of the wild type plants, and the cadmium content is 3.36 times that of the wild type plants, so that the TmZRC1S gene can improve the zinc and cadmium enrichment capability of arabidopsis.

The invention has at least the following beneficial effects:

the invention synthesizes a zinc-cadmium-resistant gene TmZRC1S from truffle nigrum by an artificial synthesis method according to plant preference codons, and successfully transfers the geneThe transgenic arabidopsis thaliana is obtained after the transgenic arabidopsis thaliana is transformed into the arabidopsis thaliana for high-efficiency expression; the arabidopsis strain transformed with TmZRC1S gene has obvious difference in zinc-cadmium resistance from a wild type strain, and the transgenic strain can tolerate 25mM ZnSO ₄ Solution or 5mM CdCl ₂ Pouring the solution for three times continuously; at 250. Mu.M ZnSO ₄ Or 50. Mu.M CdCl ₂ After three days of treatment, the zinc-cadmium content in the transgenic lines is significantly higher than that in the wild-type lines, in particular the zinc content in the aerial parts is 3.74 times that in the wild-type lines and the cadmium content is 3.36 times that in the wild-type lines.

Drawings

FIG. 1 is a schematic diagram showing construction of recombinant expression vector BH440 containing TmZRC1S gene of the present invention

FIG. 2 is a PCR electrophoretogram of the seedling stage of transgenic Arabidopsis according to example 4 of the present invention, wherein WT is a wild-type plant, and Tm3, tm11, and Tm12 are different lines of transgenic Arabidopsis;

FIG. 3 is a photograph of an Arabidopsis plant transformed with TmZRC1S gene, which was observed after 10 days of treatment with zinc and cadmium solutions, wherein WT is a wild-type plant and Tm3, tm11, and Tm12 are different strains of transgenic Arabidopsis.

Detailed Description

The invention is further described below with reference to the drawings and specific examples.

The test methods used in the examples are all conventional molecular biology methods unless otherwise indicated; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

EXAMPLE 1 Gene Synthesis of zinc-cadmium-resistant Gene TmZRC1S derived from Blackeria

According to a predicted zinc transporter gene Sequence (GSTUMT 00007113001, NCBI Sequence ID: XM_ 002839168.1) from Brevibacterium nigrum (Tuber melanosporum), a zinc-cadmium-resistant gene TmZRC1S is obtained by artificial synthesis according to plant preference codons by adopting continuous extension PCR (Nucleic Acids Research,2004,32, e 98) on the basis of keeping the amino acid Sequence unchanged. 44 pairs of primers were designed for the artificial synthesis of the TmZRC1S gene, the primers designed were as follows:

TmZRC1S-p1

GGATCCATGGCATTCTCTCGTTCTGCACGTATCATCACTCTGCTGGTCATTGACTCTCTG TmZRC1S-p2

AGTGGACAGAGTAACCAACGATGATCTCCAACAGGAAGAACAGAGAGTCAATGACCAG

CA TmZRC1S-p3

TTCTTCCTGTTGGAGATCATCGTTGGTTACTCTGTCCACTCTCTTGCACTTGTTGCTGAC TmZRC1S-p4

CAACCAGCAGGGAGAAGACGTCGTTCAGCATGTGGAAGGAGTCAGCAACAAGTGCAA

GAG TmZRC1S-p5

CGTTGGTTACTCTGTCCACTCTCTTGCACTTGTTGCTGACTCCTTCCACATGCTGAACGATmZRC1S-p6

CAGCTTGATTGCCCACAATGCAACCAGCAGGGAGAAGACGTCGTTCAGCATGTGGAAG

GA

TmZRC1S-p7

CGTCTTCTCCCTGCTGGTTGCATTGTGGGCAATCAAGCTGGCACGTCAGAAGTCCACCT

C

TmZRC1S-p8

GCACGTCAGAAGTCCACCTCCTCCTACACCTACGGTTGGCAACGTGCTGAAGTCCTTGG

T

TmZRC1S-p9

CTCCTACACCTACGGTTGGCAACGTGCTGAAGTCCTTGGTGCACTGATCAACGGTGTCT

T

TmZRC1S-p10

GATTGCTTCCAGGAAGATGGACAGACACAGTGCAAGCAAGAAGACACCGTTGATCAGT

GC

TmZRC1S-p11

CTTGCTTGCACTGTGTCTGTCCATCTTCCTGGAAGCAATCCAGCGTTTCTTCGAACCACATmZRC1S-p12

AGAACCAACACCAAGGACCAACCAAGGAGTAGAGATTTCCTGTGGTTCGAAGAAACGC

TG

TmZRC1S-p13

GGAAATCTCTACTCCTTGGTTGGTCCTTGGTGTTGGTTCTGCTGGTCTTGCATCCAACATTmZRC1S-p14

ATGAGAGTGACCATGATCATGGAACAAGAACAAACCCAGGATGTTGGATGCAAGACCA

GC

TmZRC1S-p15

CCTGGGTTTGTTCTTGTTCCATGATCATGGTCACTCTCATGGTGGTAACTCCCATGAACATmZRC1S-p16

AGCAGCAGACTCCTCACCAACAAGAGAGGACTCAAGATCGTGTTCATGGGAGTTACCA

CC

TmZRC1S-p17

CGATCTTGAGTCCTCTCTTGTTGGTGAGGAGTCTGCTGCTGCTGGTCATGAGCACCACA

A

TmZRC1S-p18

AGCAGGATCATGGATGTGACCACGCAGACCACGAGTGTGTTTGTGGTGCTCATGACCAG

C

TmZRC1S-p19

ACACACTCGTGGTCTGCGTGGTCACATCCATGATCCTGCTGAAGATGATCGTGGTGACATTmZRC1S-p20

TGCACGTTTACGACCAACGATGTCAGGCAGGATGTCGTCGATGTCACCACGATCATCTTCTmZRC1-p21

CGACGACATCCTGCCTGACATCGTTGGTCGTAAACGTGCATACTCTCGTTCCTGCCATCATmZRC1S-p22

AGAGGACTTGTTCTCCTTTGGCTTTGCATGGTTGTGGTTCTGATGGCAGGAACGAGAGT

A

TmZRC1S-p23

GAACCACAACCATGCAAAGCCAAAGGAGAACAAGTCCTCTCACTCCCATCAGAACCTG

AA

TmZRC1S-p24

CAGTGCATCACCAAGAACATGCAGGAAGACACCACGCATGTTCAGGTTCTGATGGGAG

TG

TmZRC1S-p25

CATGCGTGGTGTCTTCCTGCATGTTCTTGGTGATGCACTGGGTAACGTTGGTGTCATGTCTmZRC1S-p26

CCAGATGGTCTCAGGCAGAAGAAGCAGAGCACCAGCAACGGACATGACACCAACGTTA

CC

TmZRC1S-p27

CGTTGCTGGTGCTCTGCTTCTTCTGCCTGAGACCATCTGGTGGCGTCATCTGCTGGACCCTmZRC1S-p28

AGAGGAGAAGATGATCATGGTGATCAGCAGAGAGATGGATGGGTCCAGCAGATGACGC

CA

TmZRC1S-p29

ATCCATCTCTCTGCTGATCACCATGATCATCTTCTCCTCTGCACTGCCACTGTGCAAGTCTmZRC1S-p30

GATACCCTTAGGAACACCTTGAAGCAAGATTTTGGATGCAGACTTGCACAGTGGCAGTG

C

TmZRC1S-p31

TGCATCCAAAATCTTGCTTCAAGGTGTTCCTAAGGGTATCTCTCTGGAGGAAGTCAAAG

A

TmZRC1S-p32

TTCGTGGACGGATTCGACACCTTGGATGGATGCGATGTCTTCTTTGACTTCCTCCAGAGATmZRC1S-p33

AGACATCGCATCCATCCAAGGTGTCGAATCCGTCCACGAACTGCACATCTGGCAACTGT

C

TmZRC1S-p34

TGCGATCTGGATGTGCAGAGATGCGATCATCTTGACGTCGGACAGTTGCCAGATGTGCA

G

TmZRC1S-p35

CGACGTCAAGATGATCGCATCTCTGCACATCCAGATCGCATTCGATCCTGAGTGCGAAG

G

TmZRC1S-p36

GGTACGGACTGCGTTTGCAAGTTGCATGTAACGACCACCACCTTCGCACTCAGGATCGA

A

TmZRC1S-p37

TGGTGGTCGTTACATGCAACTTGCAAACGCAGTCCGTACCTGCCTTCATGCATACGGTATTmZRC1S-p38

CTCTTCTTTGGTGTACTCAGGCTGAATGGTGGAGGAGTGGATACCGTATGCATGAAGGC

A

TmZRC1S-p39

CCACTCCTCCACCATTCAGCCTGAGTACACCAAAGAAGAGGAAGCTGCTGCATCTCGTA

C

TmZRC1S-p40

ACATGCAGCCTCTTCTTCAGTGCCACCACGAGTAGAGCCAGTACGAGATGCAGCAGCTT

C

TmZRC1S-p41

TGGCTCTACTCGTGGTGGCACTGAAGAAGAGGCTGCATGTCTGTTGGAATGTGGTGATG

G

TmZRC1S-p42

AGCACCAGAACCAGGTGCACAGCACTTACCGTCAACGCAACCATCACCACATTCCAAC

AG

TmZRC1S-p43

TTGCGTTGACGGTAAGTGCTGTGCACCTGGTTCTGGTGCTCCTGGTGATGAAGTCATCG

G

TmZRC1S-p44

GAGCTCTTAACCGATGACTTCATCACCAGGAGCACCAGAACCAGGTGCACAGCACTTAC

C

the zinc transport protein gene amplification was performed by PCR, in a 100. Mu.l reaction system, the total amount of 44 inner primers TmZRC1S-p2 to TmZRC1S-p43 was 2ng, the amounts of the outer primers TmZRC1S-p1 and TmZRC1S-p44 were 30ng, and the amplification conditions were: preheating at 94 ℃ for 1min; taq DNA polymerase used was KOD FX Taq enzyme (Toyobo Co., japan) at 94℃for 30s,50℃for 30s, and 72℃for 2min for 25 cycles.

After the PCR was completed, 1% agarose gel was recovered, and 10. Mu.l of the mixture was directly connected to a T/A cloning vector (Dalianbao biological Co.). Ligation overnight at 4℃was performed to efficiently transform DH 5. Alpha. Competence. The positive clone is obtained, and the gene synthesized by the gene synthesis method is completely consistent with the amino acid sequence coded by GSTUMT00007113001 gene in the truffle through sequence determination and BLAST comparison, namely the TmZRC1S gene derived from the truffle, the nucleotide sequence of which is shown as SEQ ID NO1, and the coded amino acid sequence of which is shown as SEQ ID NO 2.

EXAMPLE 2 construction of plant expression vector containing TmZRC1S Gene

Double digestion is carried out by BamHI and SacI respectively, DNA fragments are recovered, the TmZRC1 enzyme gene is connected with a pCAMBIA-1301 vector containing double 35S promoters through T4DNA ligase, and recombinant plasmid BH440 containing the TmZRC1S gene is obtained through enzyme digestion identification and sequencing, as shown in FIG. 1. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with introns.

EXAMPLE 3 Agrobacterium culture and electric transformation

The agrobacterium strain is agrobacterium tumefaciens LBA4404 strain. Recombinant expression vector BH440 obtained in example 2 was introduced into Agrobacterium LBA4404 by electric shock. Single bacteria are selected to 25ml of YEB culture medium (50 mg/l rifampicin) for culture overnight, 5ml of bacterial liquid is transferred to 100ml of YEB culture medium (50 mg/l rifampicin), the culture is carried out until OD600 = 0.7-0.8, the bacterial liquid is placed on ice for 10 minutes, centrifugation is carried out at 5000rpm for 10 minutes, the temperature of 4 ℃ is 4 ℃, bacterial cells are collected, and 100ml of sterile double distilled water is added for cleaning twice. 4ml of 10% glycerol suspension cells were added and transferred to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4 ℃. The cells were collected, 500. Mu.l of 10% glycerol-suspended cells were added, and transferred to a 1.5ml centrifuge tube to obtain Agrobacterium competent cells. 70 μl of competent cells were taken, 1 μl of recombinant expression vector BH440 was added, and the mixture was transferred to a 0.1cm cuvette with the yellow tip removed. Electric shock parameters: 200 Ω,1.7KV,2.5F, and 800. Mu.l SOC broth immediately after the shock. After 1 hour of incubation, 200. Mu.l of the coated resistance plate was incubated overnight at 28℃to select strains successfully introduced into the recombinant expression vector BH440.

EXAMPLE 4 transformation of Arabidopsis thaliana by the flower dipping method

The screened single colony of the agrobacterium strain is inoculated in 5ml of LB culture medium containing corresponding antibiotics for 2 days at 28 ℃.5ml of the bacterial liquid was transferred to 500ml of liquid LB medium and cultured at 28℃for 16-24 hours (OD=1.5-2.0), and the cells were collected by centrifugation at room temperature for 10 minutes at 5000 rpm. Suspended with an equal volume of 5% fresh sucrose solution. Adding 0.02% of Silwet-77, uniformly mixing, and transferring into a beaker to obtain a transformed bacterial liquid. Each strain was transformed with 300ml, 2-3 pots. After 7 days of separation, the transformation was carried out 1 more time. Seeds of Arabidopsis thaliana (Columbia type, ecotype columbia) were inverted and immersed in the transformed bacterial solution for 10 seconds, and rosettes and inflorescences were all infected. And (3) drying the bacterial liquid of the transformed plant for 3-5 seconds after infection. The transformed plants are circled by a preservative film and are flatly placed for 16-24 hours. And (5) uncovering the preservative film, keeping a certain humidity, and harvesting seeds after the seeds grow for 1 month. And (3) screening transformed plants by using 50 mug/ml hygromycin, transplanting seedlings which normally grow on a hygromycin plate, collecting seeds, and identifying positive seedlings.

Total RNA was extracted from Arabidopsis leaves grown to 3 weeks, reverse transcribed into cDNA, and PCR detection was performed on transformed plants using primers R45425- (TCCGACGTCAAGATGATCGCA) and R45426- (ACCGATGACTTCATCACCAGG) (see guidelines for molecular cloning experiments, sambrook and Russell, 2001) under the following amplification conditions: preheating at 94 ℃ for 1min;94 ℃,30s,60 ℃,30s,72 ℃ for 4min. The results of 25 cycles with Arabidopsis action gene as reference are shown in FIG. 2. From the figure, no target band was detected in the wild type plants, and target bands were detected in the transgenic plants, which proved to be positive seedlings, indicating that the target gene was successfully introduced into Arabidopsis and expressed at the transcription level.

Example 5 Zinc cadmium resistance experiment of TmZRC1S Gene-transferred Arabidopsis thaliana

And (3) carrying out selfing homozygote 2 generations on the arabidopsis transgenic plant successfully transferred into the target gene to obtain a homozygote transformant, collecting seeds, sowing the seeds into soil, and simultaneously culturing a wild plant as a control experiment. Seedlings grown at 22℃for about 3 weeks were irrigated with 50ml 25mM ZnSO every three days ₄ Solution or 5mM CdCl ₂ The solution was treated for 10 days and the growth of Arabidopsis was observed. The specific experimental results are as follows: after 25mM ZnSO ₄ Solution or 5mM CdCl ₂ After the solution treatment, leaves of the control wild type Arabidopsis thaliana are almost yellow, while Arabidopsis transgenic plants containing the target genes of the invention grow well, and the leaves are green, as shown in FIG. 3. The TmZRC1S gene of the invention can improve the zinc-cadmium resistance of plants.

Example 6 Zinc cadmium enrichment of TmZRC1S Gene-transferred Arabidopsis thaliana

Sterilizing the harvested homozygous 2-generation seeds and wild Arabidopsis seeds, sowing on an MS solid culture medium, transferring the seeds after 10 to 14 days for water planting, culturing the seeds with 1/2Hoagland nutrient solution (changing the nutrient solution every 3 days), and then adding heavy metals (250 mu M ZnSO) with different concentrations ₄ Or 50. Mu.M CdCl ₂ ) Culturing for 3 days, harvesting plants, cleaning impurities with deionized water, and then using 5mM CaCl ₂ Soaking for 15min, washing with water for 3 times, drying the surface water by using water absorbing paper, dividing into overground parts and root parts, respectively placing into envelopes, finally placing into an oven, deactivating enzyme at 105 ℃ for 15min, and drying at 65 ℃ to constant weight. With no heavy metals added as controls, 3 replicates per treatment were performed. By ICP-MS (Agilen)t 7700ICP-MS, USA) the upper and root zinc, cadmium content of wild type and transgenic plants was determined as shown in Table 1.

TABLE 1 Zinc cadmium content of wild type and TmZRC1S transgenic Arabidopsis thaliana after heavy metal ion treatment

Experimental results show that the zinc content of the aerial parts of the arabidopsis plants transformed with the TmZRC1S gene is obviously higher than that of wild plants and is 3.74 times of that of the wild plants; the zinc content of roots has the same trend, and the zinc content of roots of the transformed strain is obviously increased by 80 percent compared with that of wild plants. The cadmium content of the upper part of the arabidopsis plant transformed with the TmZRC1S gene is 3.36 times that of the wild plant, and the cadmium content of the root of the transformed plant is increased by 25 percent relative to the WT. The TmZRC1S gene of the invention can improve the zinc-cadmium enrichment capability of plants.

Sequence listing

<110> Shanghai national academy of sciences of agriculture

<120> a zinc-cadmium-resistant gene TmZRC1S derived from Blackia and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1278

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggcattct ctcgttctgc acgtatcatc actctgctgg tcattgactc tctgttcttc 60

ctgttggaga tcatcgttgg ttactctgtc cactctcttg cacttgttgc tgactccttc 120

cacatgctga acgacgtctt ctccctgctg gttgcattgt gggcaatcaa gctggcacgt 180

cagaagtcca cctcctccta cacctacggt tggcaacgtg ctgaagtcct tggtgcactg 240

atcaacggtg tcttcttgct tgcactgtgt ctgtccatct tcctggaagc aatccagcgt 300

ttcttcgaac cacaggaaat ctctactcct tggttggtcc ttggtgttgg ttctgctggt 360

cttgcatcca acatcctggg tttgttcttg ttccatgatc atggtcactc tcatggtggt 420

aactcccatg aacacgatct tgagtcctct cttgttggtg aggagtctgc tgctgctggt 480

catgagcacc acaaacacac tcgtggtctg cgtggtcaca tccatgatcc tgctgaagat 540

gatcgtggtg acatcgacga catcctgcct gacatcgttg gtcgtaaacg tgcatactct 600

cgttcctgcc atcagaacca caaccatgca aagccaaagg agaacaagtc ctctcactcc 660

catcagaacc tgaacatgcg tggtgtcttc ctgcatgttc ttggtgatgc actgggtaac 720

gttggtgtca tgtccgttgc tggtgctctg cttcttctgc ctgagaccat ctggtggcgt 780

catctgctgg acccatccat ctctctgctg atcaccatga tcatcttctc ctctgcactg 840

ccactgtgca agtctgcatc caaaatcttg cttcaaggtg ttcctaaggg tatctctctg 900

gaggaagtca aagaagacat cgcatccatc caaggtgtcg aatccgtcca cgaactgcac 960

atctggcaac tgtccgacgt caagatgatc gcatctctgc acatccagat cgcattcgat 1020

cctgagtgcg aaggtggtgg tcgttacatg caacttgcaa acgcagtccg tacctgcctt 1080

catgcatacg gtatccactc ctccaccatt cagcctgagt acaccaaaga agaggaagct 1140

gctgcatctc gtactggctc tactcgtggt ggcactgaag aagaggctgc atgtctgttg 1200

gaatgtggtg atggttgcgt tgacggtaag tgctgtgcac ctggttctgg tgctcctggt 1260

gatgaagtca tcggttaa 1278

<210> 2

<211> 425

<212> PRT

<213> Blackfish (Tuber melanosporum)

<400> 2

Met Ala Phe Ser Arg Ser Ala Arg Ile Ile Thr Leu Leu Val Ile Asp

1 5 10 15

Ser Leu Phe Phe Leu Leu Glu Ile Ile Val Gly Tyr Ser Val His Ser

20 25 30

Leu Ala Leu Val Ala Asp Ser Phe His Met Leu Asn Asp Val Phe Ser

35 40 45

Leu Leu Val Ala Leu Trp Ala Ile Lys Leu Ala Arg Gln Lys Ser Thr

50 55 60

Ser Ser Tyr Thr Tyr Gly Trp Gln Arg Ala Glu Val Leu Gly Ala Leu

65 70 75 80

Ile Asn Gly Val Phe Leu Leu Ala Leu Cys Leu Ser Ile Phe Leu Glu

85 90 95

Ala Ile Gln Arg Phe Phe Glu Pro Gln Glu Ile Ser Thr Pro Trp Leu

100 105 110

Val Leu Gly Val Gly Ser Ala Gly Leu Ala Ser Asn Ile Leu Gly Leu

115 120 125

Phe Leu Phe His Asp His Gly His Ser His Gly Gly Asn Ser His Glu

130 135 140

His Asp Leu Glu Ser Ser Leu Val Gly Glu Glu Ser Ala Ala Ala Gly

145 150 155 160

His Glu His His Lys His Thr Arg Gly Leu Arg Gly His Ile His Asp

165 170 175

Pro Ala Glu Asp Asp Arg Gly Asp Ile Asp Asp Ile Leu Pro Asp Ile

180 185 190

Val Gly Arg Lys Arg Ala Tyr Ser Arg Ser Cys His Gln Asn His Asn

195 200 205

His Ala Lys Pro Lys Glu Asn Lys Ser Ser His Ser His Gln Asn Leu

210 215 220

Asn Met Arg Gly Val Phe Leu His Val Leu Gly Asp Ala Leu Gly Asn

225 230 235 240

Val Gly Val Met Ser Val Ala Gly Ala Leu Leu Leu Leu Pro Glu Thr

245 250 255

Ile Trp Trp Arg His Leu Leu Asp Pro Ser Ile Ser Leu Leu Ile Thr

260 265 270

Met Ile Ile Phe Ser Ser Ala Leu Pro Leu Cys Lys Ser Ala Ser Lys

275 280 285

Ile Leu Leu Gln Gly Val Pro Lys Gly Ile Ser Leu Glu Glu Val Lys

290 295 300

Glu Asp Ile Ala Ser Ile Gln Gly Val Glu Ser Val His Glu Leu His

305 310 315 320

Ile Trp Gln Leu Ser Asp Val Lys Met Ile Ala Ser Leu His Ile Gln

325 330 335

Ile Ala Phe Asp Pro Glu Cys Glu Gly Gly Gly Arg Tyr Met Gln Leu

340 345 350

Ala Asn Ala Val Arg Thr Cys Leu His Ala Tyr Gly Ile His Ser Ser

355 360 365

Thr Ile Gln Pro Glu Tyr Thr Lys Glu Glu Glu Ala Ala Ala Ser Arg

370 375 380

Thr Gly Ser Thr Arg Gly Gly Thr Glu Glu Glu Ala Ala Cys Leu Leu

385 390 395 400

Glu Cys Gly Asp Gly Cys Val Asp Gly Lys Cys Cys Ala Pro Gly Ser

405 410 415

Gly Ala Pro Gly Asp Glu Val Ile Gly

420 425

Claims

1. The application of zinc-cadmium-resistant gene TmZRC1S from Blackia in cultivating zinc-cadmium-resistant plants is characterized in that the gene is transferred into Arabidopsis thaliana to improve the heavy metal zinc-cadmium resistance of transgenic plants, the nucleotide sequence of the zinc-cadmium-resistant gene TmZRC1S is shown as SEQ ID NO1, and the zinc-cadmium-resistant plants are Arabidopsis thaliana.

2. The use according to claim 1, wherein the method for transferring the zinc-cadmium-resistant gene TmZRC1S derived from Blackia comprises the following steps:

1) Construction of recombinant expression vector BH440

After carrying out double enzyme digestion on the PCR product by utilizing BamHI and SacI, connecting the synthesized TmZRC1S gene with a plant expression vector pCAMBIA-1301 containing double 35S promoters through T4DNA ligase, and carrying out enzyme digestion identification and sequence determination to obtain a recombinant expression vector BH440 containing the target gene TmZRC 1S;

2) Electric shock method for transforming agrobacterium

Introducing the constructed recombinant expression vector BH440 into agrobacterium tumefaciens by utilizing an electric shock method, wherein the agrobacterium tumefaciens strain is LBA4404;

3) Agrobacterium dip-flower method for transforming arabidopsis thaliana

The agrobacterium tumefaciens with the TmZRC1S gene is transformed into Arabidopsis thaliana by using an agrobacterium tumefaciens flower dipping method, transformation plant screening is carried out by using hygromycin, seedling transplanting is carried out on seedlings which normally grow on a hygromycin plate, seeds are harvested, and positive seedling identification is carried out.