JP5142244B2 - Novel fluorescently labeled nucleic acid - Google Patents

Description

  The present invention relates to a novel nucleic acid molecule having a stem-and-loop structure labeled with a fluorescent dye that is quenched by a nucleobase, and a method for detecting a specific nucleic acid molecule by distinguishing it from similar nucleic acid molecules using this as a probe.

Living organisms have their own genomes, and there is almost no change in the sequence of genes in each cellular tissue from birth to death. Despite the fact that each cell tissue has the same genome, the reason why each cell tissue shows different functions and forms is that the RNA and protein read from the gene are expressed in a tissue-specific and time-specific manner It is none other than that. In order to read information obtained from living cells, it is necessary to know the amount of expressed RNA or protein, and many methods have been developed for specific detection of these biopolymers. In particular, it is difficult to identify changes in one amino acid in a protein, but it is relatively easy to identify a difference in one base in RNA. Detection methods have been developed.
The most widely used RNA detection method is the RT-PCR method. A reverse transcription reaction is performed using DNA having a sequence complementary to the template RNA as a primer, followed by a PCR reaction to specifically amplify cDNA. To do. The merit of this method is that a nucleic acid molecule can be specifically detected from an RNA sample through an amplification process.

  On the other hand, since the RT-PCR method cannot know the length of the transcribed RNA, the Northern Blotting method is used to know the behavior of the expressed RNA. RNA transcribed from DNA functions as mature RNA through a complex processing process, but sometimes the same RNA functions as another length of RNA due to different splicing. In such a case, information on RNA length is required, and the Northern Blotting method that directly reflects the molecular weight of RNA is used. However, the Northern Blotting method is complicated in operation and is not suitable for analyzing a large number of samples. Electrophoresis after RNA purification, transfer to nylon membrane, immobilize RNA, label nucleic acid molecule with sequence complementary to target RNA with fluorescent dye or radioisotope, and perform hybridization for half a day . Although the amount of information obtained from Northern Blotting analysis is attractive, it is difficult to say that it is a technology that can be used by beginners.

  In recent years, small functional RNA has attracted attention as a molecule that controls cell fate. Among them, RNA of only about 20 bases, such as microRNA and siRNA, is known to regulate gene expression in a tissue-specific manner, specifically at the stage of development, and is now also involved in diseases. It has become clear. As a technique for detecting small RNAs such as microRNAs, the Northern Blotting method, the microarray method, and the like are used. The main reason why the RT-PCR method, which is actively used for detecting normal RNA, is difficult to use for microRNA analysis, is that primer binding is very difficult. The RT-PCR method is also applied to the microarray method and the like, but has the same problem that occurs because the target RNA is short. Therefore, a method of performing RT-PCR after binding the adapter molecule to RNA has been devised, but there is a problem in the reproducibility of the ligation reaction of the adapter molecule, and it is difficult to use.

On the other hand, to know the function of RNA, it is very important to know the intracellular localization of RNA. Intranuclear, nuclear-cytoplasmic RNA localization may alter cell fate. In situ hybridization is known as a method for directly observing the intracellular localization of RNA. A probe nucleic acid complementary to the target RNA is prepared and infiltrated into the immobilized cells. By using a fluorescently labeled probe nucleic acid, the localization of the target RNA can be visualized in the form of cells / tissues.
The molecular beacon method is known as a nucleic acid molecule detection technique used for such in situ hybridization (see Non-Patent Document 1), and this technique was developed by Tyagi et al. In 1996.

However, when designing a probe for in situ hybridization, if a sequence complementary to mature microRNA is used, such a probe will simultaneously hybridize with the precursor pre-microRNA. Therefore, the intracellular localization of only mature microRNA cannot be determined by ordinary in situ hybridization methods. The same applies to the above-described Molecular Beacon method.
Regarding the detection method of microRNA, research has just started, and there are few established techniques. If a technique for detecting microRNAs quickly and easily is established, it is likely to be used not only for functional analysis of microRNAs but also in the field of diagnostic agents.
Nature Biotechnology 1996Mar; 14 (3); 303-308

The object of the present invention is to detect particularly low-molecular-weight nucleic acids without using enzymes such as those found in PCR methods, and are very similar to those found in, for example, microRNAs and their precursors. An object of the present invention is to provide a new means for enabling even a nucleic acid molecule to be discriminated and selectively detecting a target nucleic acid molecule.

The present inventor has focused on small RNAs present in large numbers in cells, especially microRNAs and siRNAs related to the RNAi phenomenon, and analyzed the intracellular localization of these short RNAs using in situ hybridization methods. For example, since the probe for detecting mature microRNA contains the base sequence of mature microRNA, it also detects its precursor and cannot effectively identify these precursors. Faced.
Therefore, as a result of earnest research, the present inventor improved the Molecular Beacon method, utilizing the phenomenon that the fluorescent dye quenches based on base pair formation, and forms a base pair with the precursor microRNA to quench, We designed nucleic acid molecules that generate fluorescence by not forming base pairs with mature microRNAs. It was found that by using this as a fluorescent probe, mature microRNA and its precursor can be effectively distinguished, and only mature microRNA can be detected. Furthermore, the inventors have convinced that this means can be applied not only to mature microRNAs but also to selective detection of target nucleic acid molecules, and thus completed the present invention. That is, the present invention is as follows.

(1) A nucleic acid molecule having a loop region having a base sequence that forms a base pair with a nucleic acid molecule to be detected, and a stem region, the stem regions being on both sides of the loop region and having complementary base sequences And a fluorescently labeled nucleic acid molecule forming a stem-loop structure, characterized in that a molecular terminal base of one stem region has a fluorescent residue that is quenched by the proximity of a nucleobase.

(2) The fluorescently labeled nucleic acid molecule according to (1) above, wherein the terminal base of the stem region having a fluorescent residue is located within 2 bases from the end of the complementary base sequence.

(3) The above terminal base having a fluorescent residue forms a base pair with a base in a base sequence other than the base sequence in a nucleic acid molecule containing the base sequence of the nucleic acid molecule to be detected. The fluorescently labeled nucleic acid molecule according to 1) or (2).

(4) The nucleic acid molecule to be detected is a mature substance, and the nucleic acid molecule containing the base sequence of the nucleic acid molecule to be detected is a precursor thereof, according to any one of (1) to (3) above Fluorescently labeled nucleic acid molecules.

(5) The fluorescently labeled nucleic acid molecule according to (4) above, wherein the matured body is microRNA, siRNA, tRNA, snRNA, mRNA, or non-coding RNA.
(6) The fluorescently labeled nucleic acid molecule according to any one of claims 1 to 5, wherein the fluorescently labeled nucleic acid molecule is DNA, RNA, PNA, BNA, LNA, HNA or morpholinated oligonucleotide.

(7) The fluorescently labeled nucleic acid molecule is substituted with a nucleotide analog capable of forming a base pair with a nucleotide in the nucleic acid molecule to be detected other than the nucleotides constituting DNA and RNA. 6. The fluorescently labeled nucleic acid molecule according to any one of 6.

(8) The fluorescently labeled nucleic acid according to (7) above, wherein the corresponding base moiety in the analog is inosine, 2-aminopurine, phenoxazine, G-Clamp, or Guanido G-Clamp. molecule.


(9) A fluorescent probe comprising the fluorescently labeled nucleic acid molecule according to any one of (1) to (8) above.

(10) Contacting the fluorescently labeled nucleic acid molecule according to any one of (1) to (9) above with a nucleic acid-containing sample in a state in which base sequences complementary to each other in the stem region are quenched by forming intramolecular base pairs When the fluorescently labeled nucleic acid molecule forms a base pair with the nucleic acid molecule to be detected, the terminal base having a fluorescent residue detects fluorescence generated by not forming a base pair with the nucleic acid molecule to be detected. A method for detecting a nucleic acid molecule in a sample.

(11) A nucleic acid molecule having a loop region having a base sequence that forms a base pair with a nucleic acid molecule to be detected, and a stem region, the stem regions being on both sides of the loop region and having mutually complementary base sequences And the molecular terminal base of one stem region has a fluorescent residue that is quenched by the proximity of the nucleobase, and the fluorescently labeled nucleic acid molecule forms a base pair with the nucleic acid molecule to be detected. A fluorescence-labeled nucleic acid molecule, which detects fluorescence generated when a terminal base having an amino acid does not form a base pair with a nucleic acid molecule to be detected.

  The present invention is an improvement of the Molecular Beacon method using the fluorescence quenching phenomenon caused by nucleobases. According to the present invention, a nucleic acid molecule to be detected can be distinguished from a nucleic acid molecule containing the base sequence of the molecule, and only the detection target molecule can be detected. When used as a probe, the fluorescence-labeled nucleic acid molecule of the present invention detects only microRNA and not its precursor RNA. That is, when the precursor RNA and the fluorescently labeled nucleic acid molecule of the present invention are hybridized, the nucleobase contained in the precursor RNA emits fluorescence by quenching the fluorescent dye bound to the labeled nucleic acid molecule. Instead, it emits fluorescence only when the mature RNA and the labeled nucleic acid molecule are hybridized.

  Furthermore, in the case of only the labeled nucleic acid molecule, a stem-loop structure is formed, and the fluorescent dye linked to the stem region does not emit fluorescence due to the adjacent base quenching molecule (nucleobase) due to the base pairing of the stem. The background during detection is extremely low. This method further develops the concept of the Molecular Beacon method, which not only detects mature RNA, but also quenches fluorescent molecules by precursor RNA, so this method eliminates similar RNA generated by alternative splicing. It can also be used to distinguish RNAs that are differentiated or that are not expected due to similarities.

Examples of how to use such molecules include selective detection of nucleic acid molecules obtained from cells and the like, and selective visualization of nucleic acid molecules by directly introducing a fluorescent probe into cells. In the field of detecting nucleic acid molecules extracted from cells, in addition to research kits, reagents that can be used for diagnosis are conceivable. For example, the present invention can be used for diagnosis and pathological examination of diseases caused by abnormal expression of specific miRNA. In addition, if selective visualization of nucleic acid molecules becomes possible, the intracellular behavior of nucleic acid molecules that has not been clarified so far may be elucidated.

The fluorescently labeled nucleic acid molecule of the present invention is a nucleic acid molecule having a loop region having a base sequence that forms a base pair with a nucleic acid molecule to be detected, and a stem region, and the stem region is on both sides of the loop region, The stem region has a base sequence complementary to each other, and the molecular terminal base in one stem region has a fluorescent residue that is quenched by the proximity of the nucleobase.
The loop region in the fluorescently labeled nucleic acid molecule of the present invention is designed so as to have a base sequence complementary to at least a part of the base sequence of the detection target nucleic acid molecule so as to form a base pair with the detection target nucleic acid molecule. The number of bases of this complementary base sequence is preferably 10 to 40 bases.
The two stem regions have base sequence parts complementary to each other, thereby forming a base pair within the molecule, and designed so that the fluorescently labeled nucleic acid molecule can form a stem-loop structure.

Furthermore, the molecular terminal base of one of the two stem regions has a fluorescent residue labeled with a fluorescent dye. As this fluorescent dye, a fluorescent dye that is quenched by the proximity of a nucleobase is used.
The base having a fluorescent residue is preferably arranged at the end of the complementary base sequence or at least within 2 bases from this end base. If it is within 2 bases, the fluorescent region of the fluorescently labeled nucleic acid molecule of the present invention forms a stem-loop structure, and the stem region forms a base pair, so that the labeled fluorescent dye is close to the base and quenched or attenuated. It is possible to be in a state of being.
Examples of the fluorescent dye to be used include BODIPY-FL, pyrene, fluorescein derivatives, tetramethylrhodamine derivatives, coumarin derivatives, oxazine derivatives, 2-aminopurine and the like.

  On the other hand, in order to distinguish between a detection target nucleic acid molecule and a nucleic acid molecule similar to the detection target nucleic acid molecule containing the base sequence of the detection target nucleic acid molecule (hereinafter, sometimes simply referred to as a similar nucleic acid molecule), the detection target A base that the fluorescent dye quenches is found in a base sequence that does not exist in the nucleic acid molecule but exists in the similar nucleic acid molecule, and the fluorescent dye quenches one of the two stem regions on both sides of the loop region. It is designed to have a base sequence complementary to the base sequence of a similar nucleic acid molecule containing a base. In this case, the fluorescently labeled base is located at the end of a base sequence complementary to the similar nucleic acid molecule in the stem region.

Therefore, in this case, of course, the other stem region has a base sequence complementary to the base sequence of the stem region having a base sequence complementary to the base sequence of a similar nucleic acid molecule containing a base to which the fluorescent dye is quenched. As designed and described above, the fluorescent label is quenched or dimmed by base pairing of the two stem regions.
The number of bases in the base sequence complementary to the similar nucleic acid molecule containing the labeling base in the stem region is preferably 3 to 10 bases. The base sequence from the fluorescently labeled base to the end of the loop region is preferably designed to form a continuous base pair with the base sequence of the similar nucleic acid molecule.

Hereinafter, the principle of the nucleic acid molecule detection means of the present invention will be described with reference to FIG. 1 in comparison with the Molecular Beacon method. In the following, the detection method of the present invention may be referred to as a Molecular Spotter method.
The Molecular Beacon method (FIG. 1A) uses a fluorescently labeled nucleic acid molecule that forms a stem-loop structure. When the fluorescently labeled nucleic acid molecule forms a stem-soup structure, a fluorescent dye labeled at the end of the stem region (FL) is in a quenched state due to the quenching molecule (Q) at the other stem region end. When detecting the mature RNA processed from the precursor RNA in the sample, the loop region having a base sequence complementary to the mature RNA and the mature RNA are hybridized, and the fluorescent dye (FL) Mature RNA can be detected by quenching the quenching molecule (Q) for quenching and generating fluorescence. However, when the precursor RNA is present at the same time, the precursor RNA has a base sequence of mature RNA, and thus the fluorescently labeled nucleic acid molecule hybridizes with the precursor RNA and generates fluorescence.

Therefore, mature RNA and precursor RNA cannot be distinguished and detected by the Molecular Beacon method.
On the other hand, according to the Molecular Spotter method (FIG. 1B), when the fluorescently labeled nucleic acid molecule of the present invention forms a stem-soup structure, the fluorescent dye (FL) labeled at the end of the stem region is one stem region. The base of the other fluorescent region and the base of the other stem region form a base pair, and the fluorescent dye (FL) labeled at the end of the stem region is close to the base (G) that quenches the fluorescent label in the other stem region. The light is extinguished. On the other hand, in the case of detecting mature RNA in a sample, a fluorescent dye (FL) and a base for quenching the fluorescent dye (FL) are hybridized by hybridizing a loop region having a base sequence complementary to the mature RNA and the mature RNA. (G) is separated to generate fluorescence. On the other hand, even when the mature RNA and its precursor RNA coexist in the sample, the fluorescently labeled nucleic acid molecule of the present invention has a base sequence other than the base sequence of the mature RNA in the precursor RNA and a complementary base sequence, and is fluorescent. Since the labeled base forms a base pair with the base (G) of the precursor RNA, the fluorescent label comes close to the base (G), and the generation of fluorescence is suppressed. Therefore, by using the fluorescently labeled nucleic acid molecule of the present invention, it is possible to distinguish between mature RNA and its precursor RNA and detect only mature RNA.

Next, the detection of chimeric gene type BCR-ABL, which is a causative gene of chronic myeloid leukemia using the fluorescently labeled nucleic acid molecule of the present invention shown in Example 3 below, will be given to further illustrate the present invention. This will be described (see FIG. 2).
It is known that chronic myelogenous leukemia develops due to the BCR-ABL chimeric gene BCR-ABL caused by chromosomal translocation. Chimeric genes are broadly divided into b2a2 and b3a2 types, the latter being more frequent. Also, there are differences in symptoms such as different platelet counts between b2a2 type patients and b3a2 type patients. If the chimeric gene can be easily distinguished and detected, it will be useful for diagnosis of leukemia. However, the normal ABL genes a1a2, leukemia b2a2 and leukemia b3a2 are very similar in sequence and therefore difficult to selectively detect.

  In FIG. 2, the top base sequence is the base sequence of the synthesized fluorescently labeled nucleic acid molecule of the present invention, and A1A2, B2A2 and B3A2 are the DNA equivalents of a1a2, b2a2 and b3a2, respectively. The underlined portion represents a portion forming an intramolecular base pair in the stem region, and in the A1A2 sequence, the upper case represents the ABL gene sequence (A1 sequence), the lower case represents the ABL gene (A2 sequence), and the B2A2 sequence , Capital letters represent BCR gene sequences (B2 sequences), small letters represent ABL gene sequences (A2 sequences), and in B3A2 sequences, capital letters represent BCR gene sequences (B3 sequences), and small letters represent ABL gene sequences (A2 sequences).

  In designing the fluorescently labeled nucleic acid molecule of the present invention, normal type (A1A2) is not detected, but only the leukemia gene is detected. Therefore, in the region spanning the leukemia gene to be detected and the normal type gene, it exists in the normal type gene. Then, a base (for example, G (guanine)) that quenches a fluorescent dye (F; for example, BODIPY-FL) that does not exist in the leukemia gene to be detected is found, and the ABL gene (A2 sequence) is included from this base (G). The base sequence complementary to the base sequence up to (region) is defined as the base sequence of the loop region and one stem region of the fluorescently labeled nucleic acid molecule of the present invention. The base sequence of this loop region naturally includes a base sequence complementary to the base sequence of the leukemia gene to be detected (A2 sequence; lowercase part). A base sequence complementary to the sequence of 3 to 10 bases including this base (G) is used as the base sequence of one stem region (underlined part a). Further, the base sequence complementary to the base sequence of the one stem region is used as the base sequence of the other stem region (underlined b), and the base sequence of the other stem region is linked to the end of the loop region, The design of the base sequence of the fluorescently labeled nucleic acid molecule is completed. Next, a nucleic acid is synthesized based on the design, and the base (C; cytosine) of the one stem region complementary to the base (G) is labeled with a fluorescent dye (F). The fluorescently labeled nucleic acid molecule (MSPrbB3A2) of the present invention ).

  When the fluorescently labeled nucleic acid molecule of the present invention is used as a fluorescent probe, a base pair is formed as shown in FIG. 2 (1) for the normal type A1A2, and the fluorescent label (F) quenches the base. Quenching by approaching (G). In contrast, for B2A2 and B3A2 of the chronic myeloid leukemia gene, as shown in FIGS. 2 (2) and (3), the base having the fluorescent label (F) and the base sequence in the vicinity thereof are bases. The fluorescent label (F) does not form a pair and does not come close to the base (G) that quenches it, and generates fluorescence. As a result, it is possible to discriminate from the normal gene and detect only the leukemia gene.

  Furthermore, it is also possible to discriminate between leukemia genes B2A2 and B3A2. For this purpose, for example, the base (G) in the leukemia gene B2A2 gene is selected, and a base sequence complementary to the base sequence from the base to the ABL gene (A2 sequence) is designed. A nucleic acid molecule may be synthesized. The fluorescently labeled nucleic acid molecule synthesized in this way does not generate fluorescence with respect to this B2A2, and can detect only the B3A2 gene.

Examples of the nucleic acid molecule to be detected in the present invention include RNA, microRNA, siRNA, tRNA, snRNA, mRNA, or non-coding RNA that are alternative splicing products.
On the other hand, examples of the form of the nucleic acid constituting the fluorescence-labeled nucleic acid molecule of the present invention include DNA and RNA. Further, even in the form of a modified nucleic acid having high base sequence specificity and improved enzymatic stability. Good. Examples of these include PNA, BNA, LNA, HNA, or morpholino oligonucleotide.
In addition, the fluorescently labeled nucleic acid molecule of the present invention may be substituted with a nucleotide analog that can form a base pair with a nucleotide in the nucleic acid molecule to be detected, other than the nucleotides of DNA and RNA.

Substituted nucleotide analogs include those in which the corresponding base moiety in the analog is inosine, 2-aminopurine, phenoxazine, G-Clamp, or Guanido G-Clamp, and further as nucleotide analogs The sugar moiety of the nucleotide may be replaced with a modified sugar, or the phosphate moiety may be replaced with a modified phosphate.
Among these, for the former, the sugar ring structure is a bicyclic ring containing a furanose ring, a pyranose ring, or a ribose ring, and the hydroxyl groups on these sugar skeletons are 3′-oxy, 2′-methoxy, Those converted to 2′-fluoro, 2′-O alkyl, or a morpholino group are exemplified.

In the latter case, the phosphate moiety of the nucleotide is substituted with phosphorothioate, boranophosphate, phosphoramidate, methyliminomethyl, thioformacetal, methylphosphonate, methoxyphosphonate, cyanoethylphosphonate, or alkoxyphosphonate. Can be mentioned.
Fluorescently labeled nucleic acid molecules substituted with these nucleotide analogs have improved base sequence specificity and form stable base pairs.

EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited by these Examples.

  In the experiment of the example shown below, as a model system, microRNA and its precursor and DNA each equivalent in sequence were used as a target sample. The DNA equivalent to microRNA and its precursor, and the base sequence of the fluorescent probe are shown in SEQ ID NOs: 1 to 8 below. The composition of the 10X hybrid solution used in these experiments is also shown.

a) Target sample SEQ ID NO: 1
Sequence name: miR133 (d) (miR133 equivalent)
Sequence: 5'- TTGGTCCCCTTCAACCAGCTGT -3 '
SEQ ID NO: 2
Sequence name: Pre-miR133 (d) (Pre-miR133 equivalent)
Sequence: 5'-GGATTTGGTCCCCTTCAACCAGCTGTAGCT -3 '
SEQ ID NO: 3
Sequence name: miR21 (d) (miR21 equivalent)
Sequence: 5'-TAGCTTATCAGACTGATGTTGA-3 '
SEQ ID NO: 4
Sequence name: Pre-miR21 (d)
Sequence: 5'-GGGTAGCTTATCAGACTGATGTTGACTGT -3 '
(The above synthetic DNA was purchased from Hokkaido System Science.)

b) Fluorescent probe sequence number 5
Sequence name: MSPrb_miR133S4
Sequence: 5'-GGATACAGCATGGTTGAAGGGGACCAAATCCX-3 '
Where X is BODIPY-FL
SEQ ID NO: 6
Sequence name: MSPrb_miR133S6
Sequence: 5'-GGATTTACAGCATGGTTGAAGGGGACCAAATCCX-3 '
Where X is BODIPY-FL
SEQ ID NO: 7
Sequence name: MSPrb_miR133S8
Sequence: 5'-GGATTTGGACAGCATGGTTGAAGGGGACCAAATCCX-3 '
Where X is BODIPY-FL
SEQ ID NO: 8
Sequence name: MSPrb_miR21S4
Sequence: 5'-GGGTCAACATCAGTCTGAATAAGCTACCCX-3 '
Where X is BODIPY-FL
(The above synthetic DNA was purchased from Nippon Bio Service Co., Ltd.)

The fluorescent probe DNA was dissolved in pure water to 1 mM. 20 μl of a 1 mM DNA solution was taken and electrophoresed on a 15% acrylamide gel (8M Urea), and a visible band was cut out together with the gel. The DNA in the gel was eluted by stirring overnight in pure water and purified by ethanol precipitation. Furthermore, after being dissolved in pure water, purified using a micro bio spin column (Bio-Rad) was used. The concentration of the fluorescent probe was determined by measuring the purified fluorescent probe DNA solution with a UV-visible light measuring instrument (JASCO) and based on the absorbance obtained from 260 nm and 488 nm.

c) Composition of 10X hybrid solution;
100 mM Tris-HCl (pH 7.0), 1 M NaCl, 100 mM MgCl2 (final concentration: 10 mM Tris-HCl (pH 7.0), 100 mM NaCl, 10 mM MgCl2)

[Example 1]
Detection of microRNA-133 (d)
1 μl of a fluorescent probe DNA (MSPrb_miR133S4) solution shown in SEQ ID NO: 5 at a concentration of 100 μM, 1 μl of a mature miR133 equivalent (miR133 (d)) solution shown in SEQ ID NO: 1 at a concentration of 100 μM, 10 μl of a 10 × hybrid solution having the following composition and pure water (88 μl) was mixed at 4 ° C. and photographed with a digital camera while irradiating UV light with a UV transilluminator (ULTRA-LUM).
On the other hand, instead of 1 μl of the target mature miR133 equivalent (miR133 (d)) solution shown in SEQ ID NO: 1, 1 μl of the miR133 precursor equivalent (Pre-miR133 (d)) solution shown in SEQ ID NO: 2 at the same concentration A similar experiment was conducted using Further, an experiment was also conducted in which only the fluorescent probe DNA was used and the mature miR133 equivalent (miR133 (d)) and its precursor equivalent (Pre-miR133 (d)) solution were not added.
The results are shown in FIG.

  According to this, in the solution to which only the fluorescent probe was added, the fluorescence was hardly emitted (left of FIG. 3). When the precursor equivalent shown in SEQ ID NO: 2 (pre-miR133 (d)) was added to the fluorescent probe, no fluorescence was emitted (center of FIG. 3). On the other hand, when the target mature miRNA equivalent (miR133 (d);) shown in SEQ ID NO: 1 was added to the fluorescent probe, fluorescence was emitted (right side of FIG. 3). This experiment revealed that the fluorescent probe of the present invention can detect a precursor nucleic acid molecule separately from a mature short nucleic acid molecule. Similarly, in experiments using miR-21 equivalents, MSPrb_miR21 detected only mature miRNA and not precursor miRNA.

(Example 2)
Fluorescence detection based on hybridization of fluorescent probe and target nucleic acid molecule
1 μl of a fluorescent probe DNA (MSPrb_miR133S4) solution shown in SEQ ID NO: 5 at a concentration of 100 μM, 100
Mix 1 μl of target mature miR133 equivalent (miR133 (d)) solution shown in SEQ ID NO: 1 at a μM concentration, 1 μl of 10X hybrid solution, 7 μl of pure water, and 10X loading buffer at 4 ° C to obtain a 12% acrylamide gel. Electrophoresis was performed under (non-denaturing conditions). The electrophoresis buffer was 1XTBE, and electrophoresis was performed at 4 ° C. An image after electrophoresis was captured using a fluorescence image analyzer (Molecular Dynamics). The acrylamide gel after image capture was stained with Mupid-Blue staining reagent (Advance-Bio).

On the other hand, instead of 1 μl of the mature miR133 equivalent (miR133 (d)) solution shown in SEQ ID NO: 1, 1 μl of the miR133 precursor equivalent (Pre-miR133 (d)) solution shown in SEQ ID NO: 2 at the same concentration was used. A similar experiment was conducted. Furthermore, an experiment was conducted in which only the fluorescent probe DNA was used and no mature miR133 equivalent (miR133 (d)) or precursor equivalent (Pre-miR133 (d)) solution was added.
The results are shown in FIG.

  According to the results of FIG. 4, it can be seen that the Mupid-Blue staining reagent is a reagent for staining nucleic acid molecules, and all the nucleic acid molecules used in the electrophoresis experiment are stained. The target DNA (miR133 (d)) hybridized with the fluorescent probe molecule has a low mobility and is shifted to the polymer side. Mature microRNA equivalents that interact with fluorescent probe molecules fluoresce. However, the precursor microRNA equivalent that interacted with the fluorescent probe molecule fluoresced little. From this, it was confirmed that the fluorescent probe was surely hybridized, and it was clarified that only matured bodies can be detected. In particular, it was confirmed that no fluorescence was detected by hybridization in the precursor.

Example 3
Detection of Chronic Myelogenous Leukemia Gene The experimental example according to the present example aims to detect B2A2 type and B3A2 type chimeric genes, which are chronic leukemia genes, using the fluorescent probe of the present invention. The base sequences of the target sample and fluorescent probe used in this experiment are shown below.

a) Target sample SEQ ID NO: 9
Sequence name: A1A2 (d) (A1A2 gene equivalent)
Sequence: 5'- TGTTATCTGGAAGaagcccttcagcggcc -3 '
SEQ ID NO: 10
Sequence name: B2A2 (d) (B2A2 gene equivalent)
Sequence: 5'- ATCAATAAGGAAGaagcccttcagcggcc -3 '
SEQ ID NO: 11
Sequence name: B3A2 (d) (B3A2 gene equivalent)
Sequence: 5'- AAGCAGAGTTCAAaagcccttcagcggcc -3 '
SEQ ID NO: 12
Sequence name: B3A2 (d) (B3A2 gene equivalent)
Sequence: 5'- AAGCAGAGTTCAAaagcccttcagcggcc -3 '
The above synthetic DNA was purchased from Hokkaido System Science.

b) Fluorescent probe sequence number 13
Sequence name: MSPrb_B3A2
Sequence: 5'-GTTATCTGCTGAAGGGCTTCTTCCAGATAACX -3 '
Where X is BODIPY-FL
The above synthetic DNA was purchased from Nippon Bio Service Co., Ltd.

c) Detection of B2A2 and B3A2
1 μl of the fluorescent probe DNA solution shown in SEQ ID NO: 12 at 100 μM concentration, 1 μl of each target sample DNA solution shown in SEQ ID NOs: 9, 10, and 11 at 100 μM concentration, 4 of 10X hybrid solution (1 μl) and pure water (7 μl) The mixture was mixed at ° C and photographed with a digital camera while irradiating UV light with a UV transilluminator (ULTRA-LUM). The results are shown in FIG.
As shown in FIG. 5, when the normal gene A1A2 gene equivalent DNA and a fluorescent probe were mixed, almost no fluorescence was observed. When the abnormal B2A2 gene equivalent DNA was mixed with a fluorescent probe, weak fluorescence was observed. When an abnormal B3A2 gene equivalent DNA and a fluorescent probe were mixed, fluorescence was obtained. That is, it succeeded in detecting B2A2 and B3A2 gene equivalent DNAs, which are abnormal genes, without detecting A1A2 gene equivalent DNA, which is a normal gene.

It is a figure which shows the outline of the conventional Molecular Beacon method and the Molecular Spotter method of this invention. It is a figure which shows the outline of the fluorescent labeling nucleic acid molecule design of this invention for identifying and detecting a chronic myeloid leukemia gene. 2 is a photograph of the results of Example 1 showing that the fluorescently labeled nucleic acid molecule of the present invention can be detected by distinguishing microRNA from its precursor. 2 is an electrophoretogram showing the results of an experiment in Example 1. 6 is a photograph showing the results of an experiment of Example 2.

Claims (8)

A loop region having a base sequence that forms a base pair with at least a part of the base sequence of the nucleic acid molecule to be detected; a stem region; the stem regions are on both sides of the loop region and have mutually complementary base sequences And a fluorescently labeled nucleic acid molecule forming a stem-and-loop structure in which the molecular terminal nucleic acid residue of one stem region has a fluorescent residue that is quenched by the proximity of a nucleobase, A nucleic acid molecule similar to the detection target nucleic acid molecule, wherein the sequence on the other side includes at least a part of the base sequence of the detection target nucleic acid molecule and a base sequence that does not exist in the detection target nucleic acid molecule following the sequence, A nucleotide sequence that forms a base pair with a sequence that does not exist in the nucleic acid molecule to be detected, and forms a base pair with a sequence that does not exist in the nucleic acid molecule to be detected. A fluorescently labeled nucleic acid molecule, which is a quenching base sequence, is brought into contact with a nucleic acid-containing sample in a state where the base sequences complementary to each other in the stem region are quenched by forming an intramolecular base pair. When the fluorescently labeled nucleic acid molecule forms a base pair with the nucleic acid molecule to be detected, it detects fluorescence generated when the terminal nucleic acid residue having a fluorescent residue does not form a base pair with the nucleic acid molecule to be detected. The target nucleic acid molecule in the sample is similar to the target nucleic acid molecule including at least a part of the base sequence of the target nucleic acid molecule and a base sequence that does not exist in the target nucleic acid molecule following the sequence. A method for identifying and detecting nucleic acid molecules. A loop region having a base sequence that forms a base pair with at least a part of the base sequence of the nucleic acid molecule to be detected; a stem region; the stem regions are on both sides of the loop region and have mutually complementary base sequences And a fluorescently labeled nucleic acid molecule forming a stem-and-loop structure in which the molecular terminal nucleic acid residue of one stem region has a fluorescent residue that is quenched by the proximity of a nucleobase, A nucleic acid molecule similar to the detection target nucleic acid molecule, wherein the sequence on the other side includes at least a part of the base sequence of the detection target nucleic acid molecule and a base sequence that does not exist in the detection target nucleic acid molecule following the sequence, A nucleotide sequence that forms a base pair with a sequence that does not exist in the nucleic acid molecule to be detected, and forms a base pair with a sequence that does not exist in the nucleic acid molecule to be detected. Characterized in that but a nucleotide sequence to quench consists fluorescently labeled nucleic acid molecule, a fluorescent-labeled nucleic acid probe for use in a method according to claim 1. The fluorescently labeled nucleic acid probe according to claim 2 , wherein the terminal nucleic acid residue of the stem region having a fluorescent residue is located within 2 bases from the end of the complementary base sequence. A nucleic acid molecule similar to a detection target nucleic acid molecule, wherein the detection target nucleic acid molecule is a mature form, and includes at least a part of the base sequence of the detection target nucleic acid molecule and a base sequence that does not exist in the detection target nucleic acid molecule following the sequence The fluorescently labeled nucleic acid probe according to claim 2 or 3 , wherein is a precursor thereof. The fluorescently labeled nucleic acid probe according to claim 4 , wherein the matured body is a microRNA, siRNA, tRNA, snRNA, mRNA, or non-coding RNA. The fluorescently labeled nucleic acid probe according to any one of claims 2 to 5 , wherein the fluorescently labeled nucleic acid molecule is DNA, RNA, PNA, BNA, LNA, HNA or a morpholinolized oligonucleotide. Fluorescently labeled nucleic acid molecule, characterized in that it is substituted by the nucleotide analogs that form nucleotide base-pairs in the detection target nucleic acid molecules, fluorescent-labeled nucleic acid probe according to any one of claims 2-6 . The fluorescent-labeled nucleic acid probe according to claim 7 , wherein the base moiety in the nucleotide analog is inosine, 2-aminopurine, phenoxazine, G-Clamp, or Guanido G-Clamp.