JP2018191580A - NUCLEIC ACID MOLECULE FOR INHIBITING FUNCTIONS OF U11 snRNA AND USE THEREFOR - Google Patents

Abstract

To newly identify an endogenous nucleic acid having strong immunogenicity inducing inflammation, and inhibit the immunogenicity of the nucleic acid, thus providing novel therapeutic means for autoimmune disease and inflammatory disease.SOLUTION: A nucleic acid molecule for inhibiting the functions of U11 snRNA contains a sequence complementary to a partial sequence of continuous 15-30 nucleotides in a nucleotide sequence of U11 snRNA.SELECTED DRAWING: None

Description

  The present invention relates to a nucleic acid molecule that suppresses the function of U11 snRNA and use thereof.

  The immune system is an important mechanism for protecting the living body by discriminating between self and non-self and eliminating pathogens as foreign substances. The immune system is mainly divided into two types, the adaptive immune system and the innate immune system. The adaptive immune system recognizes the molecular structure of pathogens with very high specificity, eliminates foreign substances with a strong response, and differentiates cell groups for the next infection as immune memory. On the other hand, the innate immune system recognizes the pattern structure of pathogens with relatively low specificity, and is responsible for bridging the initial response at the time of pathogen infection and subsequent activation of the adaptive immune system.

  In recent years, the pattern recognition receptors (PRR) pathway has been activated not only by pathogen components but also by self-molecules (Damage-associated molecular patterns; DAMPs) that are released to the outside of cells due to cell injury or cell death. Has been revealed. Among them, nucleic acids are particularly attracting attention as powerful and abundant DAMPs because they have a structure common to pathogens and hosts and are present in all host cells. Endogenous nucleic acids that have been reported to have immunogenicity so far include mitochondrial DNA, Alu RNA, microRNA, U1 small nuclear RNA (snRNA) and the like.

  U1 snRNA is a major component of the spliceosome that catalyzes the splicing of mRNA (cleavage of GT-AG type intron), and there are about 2 to 100,000 per cell, the second largest after a single rRNA. CD14-positive cells isolated from human peripheral blood mononuclear cells, which are complexed with U1 snRNAs and other snRNAs and proteins (snRNP) by binding to autoantibodies and being incorporated into cells via Fcγ receptors In addition to activating TLR7 / 8 and NLRP3 (Non-patent Document 1), U1 snRNA alone has also been reported to activate TLR3, TLR7, and NLRP3 (Non-patent Documents 1 to 3). However, it remains unclear whether the main body of stimulating activity is U1 snRNA. In addition, U1 snRNA contains methylated bases, but RNA methylation significantly reduces its immunogenicity, so it is clear how physiologically important U1 snRNA is as an immunogenic RNA. is not.

Savarese, E. et al., Blood 107, 3229-3234 (2006). Sadik, C. D. et al., Nucleic Acids Res 37, 5041-5056 (2009) Shin, M. S. et al., J Immunol 188, 4769-4775 (2012)

  The present invention provides a novel therapeutic means for autoimmune diseases and inflammatory diseases by newly identifying endogenous nucleic acids having strong immunogenicity that cause inflammation and suppressing the immunogenicity of the nucleic acids. For the purpose.

In order to achieve the above object, the present inventors, like U1 snRNA, contain a large amount in the cell, but unlike U1 snRNA, U11 snRNA (AT-AC type) that does not have methylation modification in the molecule. Focusing on U1 snRNA in the spliceosome involved in intron cleavage and recognizing 5 'splice site, we examined its immunogenicity. Specifically, U11 snRNA in the serum of various autoimmune disease models (collagen-induced arthritis (CIA) model mouse, model of rheumatoid arthritis, lupus nephritis model mouse, model of systemic lupus erythematosus, BXSB Yaa ^- mouse) Checked the level. As a result, it was found that high levels of U11 snRNA were detected in sera of these disease models as compared to control mice. In addition, U11 snRNA is an endogenous nucleic acid that strongly induces the expression of inflammatory cytokine genes and type I interferon (IFN) genes that are thought to be involved in the onset and exacerbation of these diseases. Further, the present inventors have found that the ability to induce gene expression is inhibited by a nucleic acid having a complementary sequence of U11 snRNA, and have completed the present invention.

That is, the present invention is as follows.
[1] A nucleic acid molecule that suppresses the function of U11 snRNA, comprising a sequence that is complementary to a partial sequence of continuous 15 to 30 nucleotides in the nucleotide sequence of U11 snRNA.
[2] The nucleic acid molecule according to [1], wherein the partial sequence includes all or part of the stem-loop 3.
[3] The partial sequence is a sequence represented by nucleotide numbers 55 to 74 or a corresponding sequence in a non-human mammal ortholog or a gene polymorphism thereof in the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1. The nucleic acid molecule according to [2].
[4] The nucleic acid molecule according to [1], wherein the partial sequence includes all or part of an sm binding domain.
[5] The partial sequence is a sequence represented by nucleotide numbers 83 to 101, 84 to 102, or 85 to 103 in the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1, or a non-human mammal ortholog or a gene thereof The nucleic acid molecule according to [4], which is a corresponding sequence in the polymorphism.
[6] The nucleic acid molecule according to any one of [1] to [5], which is an antisense nucleic acid against U11 snRNA.
[7] The nucleic acid molecule according to [6], comprising the nucleotide sequence represented by SEQ ID NO: 2 (wherein U may be T).
[8] The nucleic acid molecule according to [6] or [7], wherein the antisense nucleic acid is a gapmer type.
[9] The nucleic acid molecule according to any one of [1] to [5], which is a siRNA against U11 snRNA.
[10] The siRNA comprises a nucleotide sequence represented by any one of SEQ ID NOs: 3 to 5 (provided that U may be T in the sequence) and a complementary sequence thereto [9] ] The nucleic acid molecule according to.
[11] The nucleic acid molecule according to [9] or [10], wherein the siRNA has a 3′-overhang on one or both strands.
[12] A nucleotide sequence X including a sequence Xa complementary to the partial sequence, and a nucleotide sequence Y including a sequence Ya complementary to the sequence Xa via a linker L in the 3 ′ to 5 ′ direction The nucleic acid molecule according to any one of [1] to [5], wherein the sequence Xa and the sequence Ya are linked in the order of LY and in an orientation capable of forming a double chain in the molecule.
[13] The nucleic acid molecule according to [12], wherein the linker L is a proline derivative linker represented by the following formula.

[14] The sequence X has an additional sequence Xb at the 5 ′ end of the sequence Xa, and the sequence Y has an additional sequence Yb at the 3 ′ end of the sequence Ya. The sequence Xb and the sequence Yb are complementary to each other. The nucleic acid molecule according to [12] or [13], which is a target.
[15] The nucleic acid molecule according to any one of [12] to [14], wherein the sequence X has a 3′-overhang.
[16] Any of [12] to [15], wherein the sequence Xa is a nucleotide sequence represented by any one of SEQ ID NOs: 3 to 5 (wherein U may be T) A nucleic acid molecule according to any one of the above.
[17] A U11 snRNA function inhibitor comprising the nucleic acid molecule according to any one of [1] to [16].
[18] The agent according to [17], wherein the function of the U11 snRNA is induction of expression of type I interferon and / or inflammatory cytokine.
[19] A medicament comprising the nucleic acid molecule according to any one of [1] to [16].
[20] The medicament according to [19], which is a therapeutic agent for a disease involving increased expression of type I interferon and / or inflammatory cytokine.
[21] The medicament according to [20], wherein the disease is an autoimmune disease or an inflammatory disease.

  According to the nucleic acid molecule of the present invention, the function of U11 snRNA can be suppressed. In addition, the nucleic acid molecule of the present invention can be used as a therapeutic agent for a disease involving increased expression of type I interferon and / or inflammatory cytokine.

FIG. 1 shows the results of examining the immunogenicity of mouse full-length U11 snRNA. FIG. 2 shows the results of verifying the immunogenicity of U11 snRNA in human cells. FIG. 3 shows the results of verification of a receptor that recognizes U11 snRNA using spleen cells derived from TLR7-deficient mice. FIG. 4 is a schematic diagram of secondary structures of human U11 snRNA and human U1 snRNA. FIG. 5 shows the results of examining the immunogenicity of U11 snRNA with or without methylation modification. FIG. 6 shows the results of analyzing the U11 snRNA concentration in the blood of a mouse disease model. FIG. 7 shows the results of verifying the suppression of U11 snRNA immunogenicity by siRNA having a sequence complementary to U11 snRNA and single-stranded nucleic acid molecules. FIG. 8 shows the result of verifying suppression of immunogenicity of U11 snRNA by an antisense nucleic acid having a sequence complementary to U11 snRNA.

  The terms used in this specification can be used in the meaning normally used in the art unless otherwise specified.

1. Nucleic acid molecule that suppresses U11 snRNA function The present invention describes a nucleic acid molecule that suppresses the function of U11 snRNA, including a sequence complementary to the nucleotide sequence of U11 snRNA (hereinafter referred to as “the nucleic acid molecule of the present invention”). May provide.)

  Here, “the function of U11 snRNA” means the immunogenicity newly discovered by the present inventors, more specifically, the fact that self cells expressing U11 snRNA cause cell death and the like. When U11 snRNA is released to the outside of the cell, not only the action of inducing the expression of type I IFN and / or inflammatory cytokines from immune system cells that recognize U11 snRNA, but also conventionally known functions such as AT-AC type In the spliceosome involved in intron cleavage, it is also used to include a function of recognizing a 5 ′ splice site. Therefore, if any of the above functions is suppressed, it is included in the nucleic acid molecule of the present invention. Preferably, the nucleic acid molecule of the present invention has an activity that attenuates immunogenicity, ie, type I IFN and / or Or what has at least the activity which suppresses the expression induction ability of an inflammatory cytokine is mentioned.

  The nucleic acid molecule of the present invention includes a sequence complementary to all or part of the nucleotide sequence of U11 snRNA as a sequence that suppresses the function of U11 snRNA. As the nucleotide sequence of U11 snRNA, the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1 (registered in the Ensembl database as Transcript ID: ENST00000602813) or its non-human mammal ortholog (for example, mouse U11 snRNA The nucleotide sequence is registered in the Ensembl database as Transcript ID: ENSMUST00000104135), or its polymorphism (for example, URL for human U11 snRNA: http://www.ensembl.org/Homo_sapiens/Transcript/Variation_Transcript / Table? Db = core; g = ENSG00000270103; r = 1: 28648600-28648730; t = ENST00000602813, URL for mouse U11 snRNA: http://www.ensembl.org/Mus_musculus/Transcript/Variation_Transcript/Table?db = core; g = ENSMUSG00000077323; r = 4: 132270080-132270213; t = ENSMUST00000104135, “Variant table” is a gene polymorphism listed as “Non coding transcript exon variant”). In the present specification, unless otherwise specified, the nucleotide position, the range of the nucleotide sequence, and the like are described based on the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1. The corresponding nucleotides and nucleotide sequences in polymorphisms and non-human mammal orthologs are also included in the description.

SEQ ID NO: 1
5'- aaaaagggcu ucugucguga guggcacacg uagggcaacu cgauugcucu gcgugcggaa
ucgacaucaa gagauuucgg aagcauaauu uuuugguauu ugggcagcug gugaucguug
gucccggcgc ccuuu -3 '
(Hereinafter, unless otherwise stated, nucleotide sequences are written from left to right in the 5 ′ to 3 ′ direction.)

  The sequence that suppresses the function of U11 snRNA is a sequence that is complementary to all or part of the nucleotide sequence of U11 snRNA. Here, the “complementary sequence” is not only a sequence that is completely complementary to the target sequence (ie, hybridizes without mismatch), but can hybridize with U11 snRNA under physiological conditions of mammalian cells. As long as it is a sequence containing a mismatch of 1 to several nucleotides (eg, 1, 2, 3, 4, 5 nucleotides). For example, sequences having 95% or more, 96% or more, 97% or more, 98% or more, 99% or more identity to the complementary strand sequence of the target nucleotide sequence in U11 snRNA.

  The nucleotide sequence of U11 snRNA targeted by a sequence that suppresses the function of U11 snRNA is not particularly limited as long as the nucleic acid molecule of the present invention can suppress the function of U11 snRNA, in particular, immunogenicity to self. Considering the specificity, the nucleotide sequence of U11 snRNA is preferably a sequence of 12 nucleotides or more, more preferably a sequence of 15 nucleotides or more. The upper limit of the length of the target nucleotide sequence is not particularly limited, but considering easiness of synthesis, for example, it is 100 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less, more preferably 25 nucleotides or less. Is a continuous partial nucleotide sequence. Accordingly, the target nucleotide sequence can be a partial nucleotide sequence of preferably 15 to 30 nucleotides, more preferably 15 to 25 nucleotides in the nucleotide sequence of U11 snRNA.

  The partial sequence (target partial sequence) in the snRNA targeted by the sequence that suppresses the function of U11 snRNA is not particularly limited as long as the nucleic acid molecule of the present invention can suppress the function of U11 snRNA, particularly immunogenicity to self. However, from the viewpoint that the nucleic acid molecule of the present invention is a target-friendly sequence, for example, a sequence including a single-stranded portion that does not form a complementary strand in the secondary structure of U11 snRNA, and the like can be mentioned. Specifically, for example, a sequence including a loop part of a stem-loop structure or an sm binding domain may be mentioned. Stem-loop is a single-strand RNA (in its secondary structure) having a stem (stem) with a structure that forms a partially complementary base pair, while the other part is a base pair. Refers to the structure of a single-stranded loop that does not form Examples of the stem loop include stem-loop 1, stem-loop 2, and stem-loop 4 in addition to stem-loop 3 having the longest loop. The stem-loop 3 is a sequence represented by nucleotide numbers 56 to 79 (of which the loop portion is nucleotide numbers 62 to 73) in the nucleotide sequence represented by SEQ ID NO: 1. The sm binding domain is a sequence represented by nucleotide numbers 87 to 96 in the nucleotide sequence represented by SEQ ID NO: 1. The target subsequence preferably comprises all or part of the stem-loop 3 and sm binding domain.

  When the sequence that suppresses the function of U11 snRNA targets stem-loop 3, the target partial sequence is preferably a sequence of a region containing more U or G in stem loop 3, for example, represented by SEQ ID NO: 1. Among these nucleotide sequences, the sequences represented by nucleotide numbers 60 to 80, the sequences represented by nucleotide numbers 55 to 74, and the like can be mentioned.

  Further, when the sequence that suppresses the function of U11 snRNA targets the sm binding domain, the target partial sequence is preferably a sequence of a region containing more sm binding domain and adjacent U or G. Examples of the nucleotide sequence represented by No. 1 include the sequences represented by nucleotide numbers 83 to 101, 84 to 102, or 85 to 103.

  The nucleic acid molecule of the present invention may be RNA, DNA, or DNA / RNA chimera as long as it can suppress the function of U11 snRNA, particularly immunogenicity against self. Further, the nucleic acid molecule of the present invention may be a double-stranded nucleic acid or a single-stranded nucleic acid as long as it can suppress the function of U11 snRNA, particularly immunogenicity against self. In the case of a double-stranded nucleic acid, any of double-stranded DNA, double-stranded RNA, DNA: RNA hybrid, and DNA / RNA chimera and DNA, RNA, or DNA / RNA chimera hybrid may be used.

  When the nucleic acid molecule of the present invention is a double-stranded nucleic acid, one strand contains a sequence that suppresses the function of U11 snRNA, that is, a sequence that is complementary to all or part of the nucleotide sequence of U11 snRNA (hereinafter referred to as U11 snRNA). The other strand contains a sequence complementary to at least the sequence that suppresses the function of U11 snRNA (hereinafter referred to as the function of U11 snRNA). The strand containing a sequence complementary to the sequence that suppresses the term "passenger strand" is also referred to. Here, the “complementary sequence” has the same meaning as described above for the complementarity of the sequence that suppresses the function of the snRNA to the nucleotide sequence of U11 snRNA.

  In the case where the nucleic acid molecule of the present invention is a single-stranded nucleic acid, a sequence that suppresses the function of U11 snRNA in the molecule, in which only the above-mentioned guide strand is present, and the guide strand and passenger strand are linked via an arbitrary linker And a sequence complementary thereto may hybridize to form a duplex.

  Examples of the structural unit of the nucleic acid molecule of the present invention include ribonucleotide residues and deoxyribonucleotide residues. These nucleotide residues may be modified or unmodified, for example. The nucleic acid molecule of the present invention includes, for example, a modified nucleotide residue, whereby nuclease resistance is improved and stability can be improved. Moreover, the nucleic acid molecule of the present invention may further contain a non-nucleotide residue in addition to the nucleotide residue, for example.

In the nucleic acid molecule of the present invention, the constituent unit of the region other than the linker (guide strand or passenger strand) is preferably a nucleotide residue. Each region is composed of the following residues (1) to (3), for example.
(1) Unmodified nucleotide residues (2) Modified nucleotide residues (3) Unmodified nucleotide residues and modified nucleotide residues

The nucleic acid molecule of the present invention may be labeled with a labeling substance, for example. The labeling substance is not particularly limited, and examples thereof include fluorescent substances, dyes, isotopes and the like. Examples of the labeling substance include fluorophores such as pyrene, TAMRA, fluorescein, Cy3 dye, and Cy5 dye, and examples of the dye include Alexa dye such as Alexa488. Examples of isotopes include stable isotopes and radioactive isotopes. For example, stable isotopes have a low risk of exposure and do not require a dedicated facility, so that they are easy to handle and can reduce costs. In addition, stable isotopes, for example, have no change in physical properties of labeled compounds and are excellent in properties as tracers. Examples of stable isotopes include ² H, ¹³ C, ¹⁵ N, ¹⁷ O, ¹⁸ O, ³³ S, ³⁴ S, and ³⁶ S.

  Nucleotide residues include sugars, bases and phosphates as building blocks. Ribonucleotide residues have ribose residues as sugars and bases as adenine (A), guanine (G), cytosine (C) and uracil (U) (which can also be replaced by thymine (T)). However, deoxyribonucleotide residues have deoxyribose residues as sugars, and can be replaced with bases as adenine (dA), guanine (dG), cytosine (dC) and thymine (dT) (uracil (dU)) ).

  The modified nucleotide residue may be modified in any component of the nucleotide residue. In the present invention, the “modification” may be, for example, substitution, addition and / or elimination of the component, substitution, addition and / or elimination of an atom and / or a functional group in the component. The modified nucleotide residue may be, for example, a naturally occurring modified nucleotide residue or an artificially modified nucleotide residue. For example, Limbac et al. (Limbach et al., 1994, Summary: the modified nucleosides of RNA, Nucleic Acids Res. 22: 2183-2196) can be referred to as naturally occurring modified nucleotide residues.

  Examples of the modification of the nucleotide residue include modification of a ribose-phosphate skeleton (hereinafter referred to as ribophosphate skeleton).

  In the ribophosphate skeleton, for example, a ribose residue can be modified. The ribose residue can be modified, for example, at the 2′-position carbon. Specifically, for example, a hydroxyl group bonded to the 2′-position carbon is a hydrogen atom, a halogen atom such as fluorine, or an —O-alkyl group (eg, -O-Me group), -O-acyl group (eg, -O-COMe group) and an atom or group selected from the group consisting of amino groups, preferably selected from the group consisting of hydrogen atoms, methoxy groups and fluorine atoms Can be substituted with an atom or group. By substituting the hydroxyl group at the 2'-position with hydrogen, the ribose residue can be replaced with deoxyribose. The ribose residue can be substituted with, for example, a stereoisomer, and can be substituted with, for example, an arabinose residue.

  The ribolinic acid skeleton may be substituted with, for example, a non-ribophosphate skeleton having a non-ribose residue and / or non-phosphate. Examples of the non-ribophosphate skeleton include uncharged ribophosphate skeletons. Examples of nucleotide substitutes substituted with a non-ribophosphate skeleton include morpholino, cyclobutyl, pyrrolidine and the like. Other examples of the substitute include artificial nucleic acid monomer residues. Specific examples include PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), ENA (2'-O, 4'-C-Ethylenebridged Nucleic Acid), and PNA is preferable.

  The phosphate group can be modified in the ribolinic acid skeleton. In the ribolinic acid skeleton, the phosphate group closest to the sugar residue is called the α-phosphate group. The alpha phosphate group is negatively charged, and the charge is evenly distributed across the two oxygen atoms that are unbound to the sugar residue. Of the four oxygen atoms in the α-phosphate group, the two oxygen atoms that are non-bonded to the sugar residue in the phosphodiester bond between nucleotide residues are hereinafter also referred to as “non-linking oxygen”. . On the other hand, in a phosphodiester bond between nucleotide residues, two oxygen atoms bonded to a sugar residue are hereinafter referred to as “linking oxygen”. The α-phosphate group is preferably modified, for example, to be uncharged or to be asymmetric in the charge distribution in non-bonded oxygen.

  The phosphate group may substitute, for example, non-bonded oxygen. Non-bonded oxygen is, for example, any of S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen) and OR (R is an alkyl group or an aryl group) And is preferably substituted with S. For example, both non-bonded oxygens are preferably substituted, more preferably both are substituted with S. Such modified phosphate groups include, for example, phosphorothioates, phosphorodithioates, phosphoroselenates, boranophosphates, boranophosphate esters, phosphonate hydrogens, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. Among them, phosphorodithioate in which the two non-bonded oxygens are both substituted with S is preferable.

  The phosphate group may replace, for example, the bonded oxygen. The bonded oxygen can be substituted with, for example, any of S (sulfur), C (carbon) and N (nitrogen) atoms. Examples of such modified phosphate groups include bridged phosphoramidates substituted with N , Bridged phosphorothioates substituted with S, bridged methylenephosphonates substituted with C, and the like. The binding oxygen substitution is preferably performed, for example, on at least one of the 5 ′ terminal nucleotide residue and the 3 ′ terminal nucleotide residue of the nucleic acid molecule of the present invention. On the side, substitution with N is preferred.

  The phosphate group may be substituted with, for example, a phosphorus-free linker. Examples of the linker include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform acetal, form acetal, oxime, methylene imino, methylene methyl imino, methylene hydrazo, methylene dimethyl. Examples thereof include hydrazo and methyleneoxymethylimino, and preferably include a methylenecarbonylamino group and a methylenemethylimino group.

  In the nucleic acid molecule of the present invention, for example, at least one nucleotide residue at the 3 'end and the 5' end may be modified. The modification is as described above, and is preferably performed on the terminal phosphate group. The phosphate group may be modified as a whole or one or more atoms in the phosphate group may be modified. In the former case, for example, the entire phosphate group may be substituted or deleted.

  Examples of modification of the terminal nucleotide residue include addition of other molecules. Examples of other molecules include functional molecules such as labeling substances and protecting groups. Examples of the protecting group include S (sulfur), Si (silicon), B (boron), and ester-containing groups. The functional molecule such as the labeling substance can be used for detecting the nucleic acid molecule of the present invention, for example.

  Other molecules may be added to the phosphate group of the nucleotide residue, or may be added to the phosphate group or sugar residue via a spacer. The terminal atom of the spacer can be added or substituted, for example, to the bonding oxygen of the phosphate group, or O, N, S or C of the sugar residue. The binding site of the sugar residue is preferably, for example, C at the 3 ′ position or C at the 5 ′ position, or an atom bonded to these. The spacer can be added or substituted at the terminal atom of the nucleotide substitute such as PNA.

The spacer is not particularly limited.For example,-(CH ₂ ) _n -,-(CH ₂ ) _n N-,-(CH ₂ ) _n O-,-(CH ₂ ) _n S-, O (CH ₂ CH ₂ O) _n CH ₂ CH ₂ OH, abasic sugar, amide, carboxy, amine, oxyamine, oximine, thioether, disulfide, thiourea, sulfonamide, morpholino and the like, biotin reagent, fluorescein reagent and the like. In the above formula, n is a positive integer, and n = 3 or 6 is preferable.

In addition to these, molecules added to the terminal include, for example, dyes, intercalating agents (for example, acridine), crosslinking agents (for example, psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, suffirin), polycyclic aromatics Group hydrocarbons (eg, phenazine, dihydrophenazine), artificial endonucleases (eg, EDTA), lipophilic carriers (eg, cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (Hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) coal Acid, dimethoxytrityl, or phenoxa Emissions) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl , Radiolabeled markers, enzymes, haptens (eg, biotin), transport / absorption enhancers (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole complexes) , Tetraaza macrocycle Eu ³⁺ complex) and the like.

The nucleic acid molecule of the present invention may be modified at the 5 ′ end with, for example, a phosphate group or a phosphate group analog. Examples of phosphoric acid groups include 5 'monophosphate ((HO) ₂ (O) PO-5'), 5 'diphosphate ((HO) ₂ (O) POP (HO) (O) -O-5 '), 5' triphosphate ((HO) ₂ (O) PO- (HO) (O) POP (HO) (O) -O-5 '), 5'-guanosine cap (7-methylated or non-methylated) Methylation, 7m-GO-5 '-(HO) (O) PO- (HO) (O) POP (HO) (O) -O-5'), 5'-adenosine cap (Appp), any modification Or unmodified nucleotide cap structure (NO-5 '-(HO) (O) PO- (HO) (O) POP (HO) (O) -O-5'), 5 'monothiophosphate (phosphorothioate: (HO ) ₂ (S) PO-5 ′), 5 ′ dithiophosphoric acid (phosphorodithioate: (HO) (HS) (S) PO-5 ′), 5′-phosphorothiolic acid ((HO) ₂ (O PS-5 '), sulfur-substituted monophosphates, diphosphates and triphosphates (eg 5'-α-thiotriphosphate, 5'-γ-thiotriphosphate etc.), 5'-phospho Luamidate ((HO) ₂ (O) P—NH-5 ′, (HO) (NH ₂ ) (O) PO-5 ′), 5′-alkylphosphonic acids (eg RP (OH) (O) -O-5 ', (OH) 2 (O) P-5'-CH 2, R is alkyl (e.g., Til, ethyl, isopropyl, propyl etc.)), 5'-alkyl ether phosphonic acids (eg RP (OH) (O) -O-5 ', R is alkyl ether (eg methoxymethyl, ethoxymethyl etc.)) etc. Is given.

  In the nucleotide residue, the base is not particularly limited. The base may be a natural base or a non-natural base. For example, a general base, its modified analog, etc. can be used.

  Examples of the base include purine bases such as adenine and guanine, and pyrimidine bases such as cytosine, uracil and thymine. Other examples of the base include inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine and the like. Bases include, for example, alkyl derivatives such as 2-aminoadenine and 6-methylated purine; alkyl derivatives such as 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; Azouracil, 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyluracil; 8-halogenated, aminated, thiol , Thioalkylation, hydroxylation and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidines; 6, and O-6 substituted purines (including 2-aminopropyladenine); 5-propynyluracil and 5-propynylcytosine; dihydrouracil; 2-aminopurine; 5-alkyluracil; 7-alkylguanine; 5-alkylcytosine; 7-deazaadenine; N6, N6-dimethyladenine; 2,6-diaminopurine; 5-amino-allyl- N-methyluracil; substituted 1,2,4-triazole; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 5 -Methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3- (3-amino-3-carboxypropyl) uracil; 3-methylcytosine; 5-methylcytosine N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; It may be killed bases like. Purines and pyrimidines include, for example, US Pat. No. 3,687,808, “Concise Encyclopedia Of Polymer Science And Engineering”, pages 858-859, edited by Kroschwitz JI, John Wiley & Sons, 1990, and English. (Englisch et al.), Angewandte Chemie, International Edition, 1991, Volume 30, p.613.

  In addition to these, modified nucleotide residues may include, for example, residues that lack a base, ie, an abasic ribophosphate backbone. The modified nucleotide residues are, for example, US Provisional Application No. 60 / 465,665 (filing date: April 25, 2003) and International Application No. PCT / US04 / 07070 (filing date: March 8, 2004). ) Can be used, and the present invention can incorporate these documents.

  The method for synthesizing the nucleic acid molecule of the present invention is not particularly limited, and a conventionally known method can be adopted. Examples of the synthesis method include a synthesis method using a genetic engineering technique, a chemical synthesis method, and the like. Examples of genetic engineering techniques include in vitro transcription synthesis, a method using a vector, and a method using a PCR cassette. The vector is not particularly limited, and examples thereof include non-viral vectors such as plasmids and viral vectors. The chemical synthesis method is not particularly limited, and examples thereof include a phosphoramidite method and an H-phosphonate method. In the chemical synthesis method, for example, a commercially available automatic nucleic acid synthesizer can be used. In the chemical synthesis method, amidite is generally used. The amidite is not particularly limited, and commercially available amidites include, for example, RNA Phosphoramidites (2'-O-TBDMSi, trade name, Michisato Pharmaceutical), ACE amidite and TOM amidite, CEE amidite, CEM amidite, TEM amidite, etc. Can be given.

  Examples of the nucleic acid molecule of the present invention include antisense nucleic acid against U11 snRNA, siRNA against U11 snRNA, and the like. Examples of the nucleic acid molecule of the present invention include a single-stranded nucleic acid molecule capable of forming a double strand in which a guide strand and a complementary passenger strand are linked via a linker.

(1) Antisense nucleic acid against U11 snRNA
The antisense nucleic acid against U11 snRNA includes all or a part of the nucleotide sequence of U11 snRNA, preferably a sequence complementary to a partial sequence of 15 to 30 nucleotides in the nucleotide sequence, and a target nucleotide in U11 snRNA A nucleic acid having an action of suppressing the function of U11 snRNA, preferably the immunogenicity of the snRNA, by forming a specific double strand with the sequence and binding. Here, the “complementary sequence” has the same meaning as described above.

  The length of the antisense nucleic acid against U11 snRNA is not particularly limited as long as it includes a sequence that suppresses the function of U11 snRNA, that is, a sequence that is complementary to all or part of the nucleotide sequence of the snRNA. It is a nucleotide, preferably 15 to 40 nucleotides, more preferably 15 to 30 nucleotides.

  The antisense nucleic acid against U11 snRNA has a sequence complementary to any of the target nucleotide sequences in the above-mentioned snRNA as a sequence that suppresses the function of U11 snRNA. In a preferred embodiment, the function of U11 snRNA The following nucleotide sequence (SEQ ID NO: 2) (provided that U may be T in the sequence) is included as a sequence that suppresses.

Sequence number 2: UCUCUUGAUGUCGAUUCCGC

  The antisense nucleic acid against U11 snRNA may be a gapmer type. A gapmer type antisense nucleic acid is a nucleic acid having DNA and a nucleic acid having a modification or a bridge introduced on both sides thereof. With the DNA strand as the main strand, RNA complementary to the main strand forms a heteroduplex nucleic acid, and the RNA is degraded by RNAase H. A gapmer type antisense nucleic acid against U11 snRNA has, for example, the following structure.

Sequence number 42: mU * mC * mU * mC * mU * t * g * a * t * g * t * c * g * a * t * mU * mC * mC * mG * mC *
("MN" indicates 2'-OMe-RNA, lower case letters indicate DNA, and "*" indicates phosphorothioate linkage.)

  O-methylation at the 2 'position of the sugar improves the stability of the antisense nucleic acid and increases the binding affinity to the target. In addition, the phosphorothioate bond increases the nuclease resistance of the antisense nucleic acid.

  The method for synthesizing an antisense nucleic acid against U11 snRNA is not particularly limited, and conventionally known nucleic acid production methods can be employed. Examples of the synthesis method include a method of preparing each nucleic acid containing the complementary sequence by synthesizing with a DNA / RNA automatic synthesizer. Antisense nucleic acids containing the various modifications described above can also be chemically synthesized by a conventionally known method.

(2) siRNA against U11 snRNA
The siRNA for U11 snRNA is a double-stranded oligo RNA consisting of a guide strand containing a sequence complementary to a part of the nucleotide sequence of U11 snRNA and a passenger strand containing a complementary sequence to the RISC complex. Is a nucleic acid that is incorporated into the U11 snRNA in the guide strand and forms a duplex with the target nucleotide sequence in the U11 snRNA, thereby cleaving the snRNA and suppressing the function of the U11 snRNA. Here, the “complementary sequence” has the same meaning as described above.

  The length of siRNA relative to U11 snRNA is not particularly limited as long as it includes a sequence complementary to a part of the nucleotide sequence of snRNA in the guide strand, but the target nucleotide sequence is in principle 15 to 50 nucleotides, preferably It may be 19-30 nucleotides, more preferably 19-27 nucleotides. The guide strand and passenger strand may have additional nucleotides at the 5 'or 3' end. The length of the additional nucleotide is usually about 2 to 4 nucleotides, and the total length of siRNA is 19 nucleotides or more. The additional nucleotide may be DNA or RNA, but the use of DNA may improve the stability of the nucleic acid. Such additional nucleotide sequences include, for example, ug-3 ′, uu-3 ′, tg-3 ′, tt-3 ′, ggg-3 ′, guuu-3 ′, gttt-3 ′, ttttt-3 Examples include, but are not limited to, ', uuuuu-3'.

  The siRNA for U11 snRNA contains a sequence complementary to any of the target nucleotide sequences in the snRNA described above as a sequence that suppresses the function of U11 snRNA in the guide strand. In one preferred embodiment, U11 snRNA As a sequence that suppresses the function of, a guide strand comprising any of the following nucleotide sequences (SEQ ID NOs: 3 to 5) (wherein U may be T), and a passenger strand complementary thereto And the like.

Sequence number 3: AAAUACCAAAAAAUUAUGC
Sequence number 4: CAAAUACCAAAAAAUUAUG
Sequence number 5: CCAAAUACCAAAAAAUUAU

  The siRNA against U11 snRNA may have a 3'-overhang on one or both strands. In the case of having an overhang, the length of the overhang is not particularly limited, and the lower limit is, for example, 1 base length, the upper limit is, for example, 4 base lengths, 3 base lengths, and the range is, for example, 1 base length. It is ˜4 bases long, 1-3 bases long, 1-2 bases long.

  The overhang sequence is not particularly limited, and may be any of A, U, G, C, and T. Examples of the overhang sequence include TT, UU, CU, GC, UA, AA, CC, UG, CG, and AU from the 3 'side. The overhang can be added with resistance to RNase by, for example, TT or UU.

  The method for synthesizing siRNA for U11 snRNA is not particularly limited, and conventionally known methods for producing nucleic acids can be employed. As a synthesis method, for example, a nucleic acid containing the complementary sequence and a nucleic acid having a complementary sequence thereto are respectively synthesized by a DNA / RNA automatic synthesizer, and about 90 to about 95 ° C. in an appropriate annealing buffer. Examples include a method of preparing by denaturing for about 1 minute and then annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing shRNA that is a precursor of siRNA and cleaving it with a dicer. The nucleotide residues constituting siRNA may also be modified in the same manner as described above in order to improve stability, specific activity and the like. However, in the case of siRNA, RNAi activity may be lost if all ribonucleotide residues in natural RNA are replaced with modified forms, so the introduction of the minimum number of modified nucleotide residues that allow the RISC complex to function is introduced. is necessary.

(3) Single-stranded nucleic acid molecule for U11 snRNA In the present invention, `` single-stranded nucleic acid molecule for U11 snRNA '' means a guide strand sequence X containing a sequence Xa complementary to a part of the nucleotide sequence of U11 snRNA, A passenger strand sequence Y comprising a sequence Ya complementary to Xa, in a 5 ′ to 3 ′ direction or a 3 ′ to 5 ′ direction in the X-L-Y order via the linker L, and the sequence Xa and the sequence A nucleic acid molecule that suppresses the function of U11 snRNA, which is linked with Ya in an orientation capable of forming a duplex within the molecule. Here, the “complementary sequence” has the same meaning as described above.

  The sequence Xa is not particularly limited as long as it comprises a sequence complementary to all or part of the nucleotide sequence of U11 snRNA, but the target nucleotide sequence is in principle 15-50 nucleotides in the nucleotide sequence of the snRNA, preferably Is a sequence complementary to a partial sequence of 15 to 30 nucleotides, more preferably 19 to 30 nucleotides, more preferably 19 to 21 nucleotides.

  The single-stranded nucleic acid molecule for U11 snRNA contains a sequence complementary to any of the target nucleotide sequences in the snRNA described above as a sequence Xa in the guide strand sequence X as a sequence that suppresses the function of U11 snRNA. In one preferred embodiment, as the sequence Xa, a guide strand sequence X comprising any of the following nucleotide sequences (SEQ ID NOs: 3 to 5) (wherein U may be T): Examples thereof include a nucleic acid molecule containing a passenger strand sequence Y containing a sequence Ya complementary to the sequence Xa.

Sequence number 3: AAAUACCAAAAAAUUAUGC
Sequence number 4: CAAAUACCAAAAAAUUAUG
Sequence number 5: CCAAAUACCAAAAAAUUAU

  The guide strand sequence X may consist of, for example, the sequence Xa alone or may further have an additional sequence Xb. In the latter case, the additional sequence Xb need not be complementary to the nucleotide sequence of U11 snRNA. The additional sequence Xb may be added to either the 5 'end or the 3' end of Xa, or may be added to both ends (Xb and Xb '). Preferably, it is added to the end of the Xa linked to the linker L. The length of the sequence Xb (Xb ′) is, for example, 1 to 35 nucleotides, preferably 1 to 25 nucleotides, more preferably 1 to 11 nucleotides, and particularly preferably 1, 2, 3 4, 5, or 6 nucleotides.

  The passenger strand sequence Y is not particularly limited as long as it includes a sequence Ya complementary to the sequence Xa. For example, the passenger strand sequence Y may comprise only the sequence Ya or may further have an additional sequence Yb. In the latter case, the additional sequence Yb does not need to be complementary to the additional sequence Xb, but is preferably complementary, and in particular, the additional sequences Xb and Yb are linked to the linker L of Xa and Ya, respectively. More preferably, Xb and Yb are complementary when added to the terminal ends. The additional sequence Yb may be added to either the 5 'end or 3' end of Ya, or may be added to both ends (Yb and Yb '). Preferably, it is added to the end of Ya linked to the linker L. The length of the sequence Yb (Yb ′) is, for example, 1 to 35 nucleotides, preferably 1 to 25 nucleotides, more preferably 1 to 11 nucleotides, and particularly preferably 1, 2, 3 4, 5, or 6 nucleotides.

  The guide strand sequence X and the passenger strand sequence Y may further have an overhang at the end not linked to the linker L. The overhang is preferably added to the 3 'end of the sequence of the guide strand sequence X and passenger strand sequence whose 5' end is linked to the linker L.

  The length of the overhang is not particularly limited, and the lower limit is, for example, 1 base length, the upper limit is, for example, 4 base lengths, 3 base lengths, and the range is, for example, 1 to 4 base lengths, 1 It is ~ 3 bases long and 1-2 bases long.

  The overhang sequence is not particularly limited, and may be any of A, U, G, C, and T. Examples of the overhang sequence include TT, UU, CU, GC, UA, AA, CC, UG, CG, AU and the like from the 5 'side. The overhang can add resistance to RNase by, for example, TT or UU.

  In a preferred embodiment, the single-stranded nucleic acid molecule for U11 snRNA comprises a nucleotide sequence X and a nucleotide sequence Y, in a 3 ′ to 5 ′ direction in the X-L-Y order via a linker L, and The sequence Xa and the sequence Ya are linked in an orientation capable of forming a double chain in the molecule. The linker L may be composed of, for example, a nucleotide residue, a non-nucleotide residue, or a nucleotide residue and a non-nucleotide residue. Examples of nucleotide residues include ribonucleotide residues and deoxyribonucleotide residues.

  When the linker L is composed of nucleotide residues, the sense region and the antisense region base pair with each other in one molecule to form a stem structure, and at the same time, the nucleotide sequence of the linker L forms a loop structure. The whole molecule forms a hairpin-type stem-loop structure, and the single-stranded nucleic acid molecule for U11 snRNA can be said to be shRNA (small hairpin RNA or short hairpin RNA). The length of the linker L is not particularly limited, but for example, it is preferable that the sequence Xa and the sequence Ya can form a double chain in the molecule. The lower limit of the number of bases of the linker L is, for example, 1 base, 2 bases, 3 bases, and the upper limit is, for example, 100 bases, 80 bases, 50 bases. Specific examples of the number of bases in each linker region include 1-50 bases, 1-30 bases, 1-20 bases, 1-10 bases, 1-7 bases, 1-4 bases, etc. It is not limited to. The linker L is preferably a structure that does not cause self-annealing.

  A linker L composed of non-nucleotide residues, or a linker L composed of nucleotide residues and non-nucleotide residues is represented, for example, by the following formula (I).

In formula (I), for example,
X ¹ and X ² are each independently H ₂ , O, S or NH;
Y ¹ and Y ² are each independently a single bond, CH ₂ , NH, O or S;
R ³ is a hydrogen atom or substituent bonded to C-3, C-4, C-5 or C-6 on ring A;
L ¹ is an alkylene chain consisting of n atoms, where the hydrogen atom on the alkylene carbon atom is replaced by OH, OR ^a , NH ₂ , NHR ^a , NR ^a R ^b , SH, or SR ^a May or may not be substituted, or
L ¹ is a polyether chain in which one or more carbon atoms of the alkylene chain are substituted with oxygen atoms,
Provided that when Y ¹ is NH, O or S, the L ¹ atom bonded to Y ¹ is carbon, the L ¹ atom bonded to OR ¹ is carbon, and oxygen atoms are not adjacent to each other;
L ² is an alkylene chain consisting of m atoms, wherein the hydrogen atom on the alkylene carbon atom is substituted with OH, OR ^c , NH ₂ , NHR ^c , NR ^c R ^d , SH or SR ^c May not be substituted, or
L ² is a polyether chain in which one or more carbon atoms of the alkylene chain are substituted with oxygen atoms,
Provided that when Y ² is NH, O or S, the L ² atom bonded to Y ² is carbon, the L ² atom bonded to OR ² is carbon, and oxygen atoms are not adjacent to each other;
R ^a , R ^b , R ^c and R ^d are each independently a substituent or a protecting group;
l is 1 or 2;
m is an integer ranging from 0 to 30;
n is an integer ranging from 0 to 30;
In ring A, one carbon atom other than C-2 on ring A may be substituted with nitrogen, oxygen, or sulfur,
Ring A may contain a carbon-carbon double bond or a carbon-nitrogen double bond,
The nucleotide sequences X and nucleotide sequence Y, respectively, -OR ¹ - or -OR ² - via binds to a non-nucleotide structure,
Here, R ¹ and R ² may or may not be present, and when present, R ¹ and R ² are each independently a nucleotide residue or structure (I).

In the formula (I), X ¹ and X ² are each independently, for example, H ₂ , O, S or NH. In formula (I), X ¹ being H ₂ means that X ¹ forms CH ₂ (methylene group) together with the carbon atom to which X ¹ is bonded. The same is true for X ^2.

In formula (I), Y ¹ and Y ² are each independently a single bond, CH ₂ , NH, O or S.

  In the formula (I), in the ring A, l is 1 or 2. When l = 1, ring A is a 5-membered ring, for example, a pyrrolidine skeleton. Examples of the pyrrolidine skeleton include a proline skeleton and a prolinol skeleton, and examples thereof include these divalent structures. When l = 2, ring A is a 6-membered ring, for example, a piperidine skeleton. In ring A, one carbon atom other than C-2 on ring A may be substituted with nitrogen, oxygen or sulfur. Ring A may contain a carbon-carbon double bond or a carbon-nitrogen double bond in ring A. Ring A may be, for example, either L-type or D-type.

In the formula (I), R ³ is a hydrogen atom or a substituent bonded to C-3, C-4, C-5 or C-6 on the ring A. When R ³ is a substituent, the substituent R ³ may be one, plural or absent, and when plural, may be the same or different.

The substituent R ³ is, for example, halogen, OH, OR ⁴ , NH ₂ , NHR ⁴ , NR ⁴ R ⁵ , SH, SR ⁴ or an oxo group (═O).

R ⁴ and R ⁵ are, for example, each independently a substituent or a protecting group, and may be the same or different. Substituents are, for example, halogen, alkyl, alkenyl, alkynyl, haloalkyl, aryl, heteroaryl, arylalkyl, cycloalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkyl, hydroxyalkyl, alkoxyalkyl, aminoalkyl, heterocyclylalkenyl, Heterocyclylalkyl, heteroarylalkyl, silyl, silyloxyalkyl and the like. The same applies hereinafter. The substituent R ³ may be any of these listed substituents.

The protecting group is, for example, a functional group that converts a highly reactive functional group into an inert state, and includes known protecting groups. For example, the description of the literature (JFW McOmie, “Protecting Groups in Organic Chemistry”, Prenum Press, London and New York, 1973) can be used as the protecting group. The protecting group is not particularly limited, and examples thereof include tert-butyldimethylsilyl group (TBDMS), bis (2-acetoxyethyloxy) methyl group (ACE), triisopropylsilyloxymethyl group (TOM), 1- (2- Cyanoethoxy) ethyl group (CEE), 2-cyanoethoxymethyl group (CEM), tolylsulfonylethoxymethyl group (TEM), dimethoxytrityl group (DMTr) and the like. When R ³ is OR ⁴ , the protective group is not particularly limited, and examples thereof include a TBDMS group, an ACE group, a TOM group, a CEE group, a CEM group, and a TEM group. In addition, silyl-containing groups can also be mentioned. The same applies hereinafter.

In the formula (I), L ¹ is an alkylene chain composed of n atoms. A hydrogen atom on an alkylene carbon atom may be substituted with, for example, OH, OR ^a , NH ₂ , NHR ^a , NR ^a R ^b , SH, or SR ^a , or may be unsubstituted. Alternatively, L ¹ may be a polyether chain in which one or more carbon atoms of the alkylene chain are substituted with an oxygen atom. The polyether chain is, for example, polyethylene glycol. When Y ¹ is NH, O, or S, the L ¹ atom bonded to Y ¹ is carbon, the L ¹ atom bonded to OR ¹ is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y ¹ is O, the oxygen atom and the oxygen atom of L ¹ are not adjacent, and the oxygen atom of OR ^{1 and} the oxygen atom of L ¹ are not adjacent.

In the formula (I), L ² is an alkylene chain composed of m atoms. The hydrogen atom on the alkylene carbon atom may be substituted with, for example, OH, OR ^c , NH ₂ , NHR ^c , NR ^c R ^d , SH or SR ^c , or may be unsubstituted. Alternatively, L ² may be a polyether chain in which one or more carbon atoms of the alkylene chain are substituted with an oxygen atom. When Y ² is NH, O, or S, the L ² atom bonded to Y ² is carbon, the L ² atom bonded to OR ² is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y ² is O, the oxygen atom and the oxygen atom of L ² are not adjacent, and the oxygen atom of OR ^{2 and} the oxygen atom of L ² are not adjacent.

N in L ¹ and m in L ² are not particularly limited, and the lower limit is, for example, 0, and the upper limit is not particularly limited. n and m can be appropriately set according to the desired length of the non-nucleotide structure, for example. For example, n and m are each preferably 0 to 30, more preferably 0 to 20, and still more preferably 0 to 15 from the viewpoint of production cost and yield. n and m may be the same (n = m) or different. n + m is, for example, 0 to 30, preferably 0 to 20, and more preferably 0 to 15.

R ^a , R ^b , R ^c and R ^d are, for example, each independently a substituent or a protecting group. The substituent and the protecting group are the same as described above, for example.

  In the formula (I), hydrogen atoms may be independently substituted with halogens such as Cl, Br, F and I, for example.

Nucleotide sequence X and nucleotide sequence Y bind to the non-nucleotide structure, for example, via —OR ¹ — or —OR ² —, respectively. Here, R ¹ and R ² may or may not exist. When R ¹ and R ² are present, R ¹ and R ² are each independently a nucleotide residue or a structure of formula (I). When R ¹ and / or R ² is a nucleotide residue, the structure of linker L is, for example, a non-nucleotide residue consisting of the structure of formula (I) excluding nucleotide residue R ¹ and / or R ² and the nucleotide residue. Formed from a group. When R ¹ and / or R ² has the structure of formula (I), the non-nucleotide structure is, for example, a structure in which two or more non-nucleotide residues having the structure of formula (I) are linked. The structure of formula (I) may include, for example, one, two, three or four. Thus, when including two or more, the structure of a formula (I) may be directly connected, for example, and may couple | bond together through a nucleotide residue. On the other hand, in the absence of R ¹ and R ² , the non-nucleotide structure is formed only from non-nucleotide residues consisting, for example, of the structure of formula (I).

The combination of nucleotide sequence X and nucleotide sequence Y, and —OR ¹ — and —OR ² — is not particularly limited, and examples thereof include any of the following conditions.
Condition 1)
Nucleotide sequence X is linked to the structure of formula (I) via —OR ² — and nucleotide sequence Y is linked to —OR ¹ —.
Condition (2)
Nucleotide sequence X is linked to the structure of formula (I) via —OR ¹ — and nucleotide sequence Y is linked to —OR ² —.

  Examples of the structure of the formula (I) include the following formulas (I-1) to (I-9), in which n and m are the same as in the formula (I). In the following formula, q is an integer of 0 to 0.

    In the formulas (I-1) to (I-9), n, m and q are not particularly limited and are as described above. As specific examples, in formula (I-1), n = 8, in formula (I-2), n = 3, in formula (I-3), n = 4 or 8, and in formula (I-4), n = 7 or 8, in formula (I-5), n = 3 and m = 4, in formula (I-6), n = 8 and m = 4, in formula (I-7), n = 8 and m = 4, in formula (I-8), n = 5 and m = 4, and in formula (I-9), q = 1 and m = 4. An example (n = 8) of the formula (I-4) is represented by the following formula (I-4a), an example (n = 5, m = 4) of the formula (I-8) is represented by the following formula (I-8a) Shown in

  In addition, a proline derivative linker represented by the following formula, which is an example (n = 5, m = 4) of formula (I-8), is shown below.

  Examples of the single-stranded nucleic acid molecule against U11 snRNA include the following nucleic acid molecules. L is a linker represented by the above structure.

SEQ ID NO: 6
GCAUAAUUUUUUGGUAUUUUUCC-L-GGAAAAAUACCAAAAAAUUAUGCUU
SEQ ID NO: 7
CAUAAUUUUUUGGUAUUUGUUCC-L-GGAACAAAUACCAAAAAAUUAUGUU
SEQ ID NO: 8
AUAAUUUUUUGGUAUUUGGUUCC-L-GGAACCAAAUACCAAAAAAAUUAUUU

  A method for synthesizing a single-stranded nucleic acid molecule for U11 snRNA is not particularly limited, and conventionally known nucleic acid production methods can be employed. Examples of the synthesis method include a synthesis method using a genetic engineering technique, a chemical synthesis method, and the like. Examples of genetic engineering techniques include in vitro transcription synthesis, a method using a vector, and a method using a PCR cassette. The vector is not particularly limited, and examples thereof include non-viral vectors such as plasmids and viral vectors. The chemical synthesis method is not particularly limited, and examples thereof include a phosphoramidite method and an H-phosphonate method. As the chemical synthesis method, for example, a commercially available automatic nucleic acid synthesizer can be used. In general, amidites are used in chemical synthesis methods. The amidite is not particularly limited, and examples of commercially available amidites include RNA Phosphoramidites (2'-O-TBDMSi, trade name, Michisato Pharmaceutical), ACE amidite and TOM amidite, CEE amidite, CEM amidite, TEM amidite, etc. can give.

  When a single-stranded nucleic acid molecule for U11 snRNA is composed only of natural unmodified ribonucleotide residues, it is provided as a precursor of the nucleic acid molecule in the form of a vector encoding the nucleic acid molecule in an expressible state. You can also. The expression vector is characterized in that it contains DNA encoding a single-stranded nucleic acid molecule for U11 snRNA under the control of a promoter functional in the target cell, and other configurations are not limited at all. The vector into which the DNA is inserted is not particularly limited, and general vectors can be used. Examples thereof include viral vectors and non-viral vectors. Examples of non-viral vectors include plasmid vectors. Inhibiting the function of U11 snRNA in the target cell by introducing the expression vector into a target cell (mammalian cell expressing a recognition receptor for U11 snRNA) using a gene transfer method known per se Can do.

2. Function inhibitor As described above, the nucleic acid molecule of the present invention can suppress the function of U11 snRNA. Therefore, the nucleic acid molecule of the present invention can be used, for example, to suppress the immunogenicity of U11 snRNA, more specifically, to suppress the expression-inducing action of type I IFN and / or inflammatory cytokine. Examples of the type I IFN include IFNα and IFNβ. Examples of inflammatory cytokines include TNFα, IL-1, and IL-6. In addition, the nucleic acid molecule of the present invention is considered to suppress the recruitment of U11 snRNA to the spliceosome by hybridizing and specifically binding to U11 snRNA. -Can also be used to suppress AC splicing.

3. Pharmaceutical As described above, the nucleic acid molecule of the present invention can suppress the function of U11 snRNA. For this reason, the nucleic acid molecule of the present invention can be used, for example, as a therapeutic agent for diseases involving increased expression of type I IFN and / or inflammatory cytokines. Examples of the disease associated with increased expression of type I IFN include autoimmune diseases. Examples of the autoimmune disease include non-organ-specific autoimmune diseases and organ-specific autoimmune diseases. Non-organ-specific autoimmune diseases include, for example, rheumatoid arthritis, systemic lupus erythematosus, discoid lupus erythematosus, polymyositis, etc., and organ-specific autoimmune diseases include, for example, chronic thyroiditis, primary myxedema, thyroid gland Examples include addiction and pernicious anemia. Examples of the disease associated with increased expression of inflammatory cytokines include inflammatory diseases. Examples of inflammatory diseases include arthritis (such as rheumatoid arthritis and osteoarthritis), myocardial infarction, viral encephalitis, psoriasis, inflammatory bowel disease, pulmonary hypertension, sepsis, type II diabetes, liver fibrosis, nephrosclerosis And endometriosis. In the present invention, “treatment” includes, for example, the meanings of preventing the disease, improving the disease, and improving the prognosis.

  The medicament of the present invention may be used alone with an effective amount of the nucleic acid molecule of the present invention, or may be formulated as a pharmaceutical composition together with any carrier, for example, a pharmaceutically acceptable carrier.

  Examples of pharmaceutically acceptable carriers include excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, citric acid, Fragrances such as menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspensions such as methylcellulose and polyvinylpyrrolide, dispersants such as surfactants, water, Although diluents, such as physiological saline, base wax, etc. are mentioned, it is not limited to them.

  In order to promote introduction of the nucleic acid molecule of the present invention into a target cell, the medicament of the present invention can further contain a reagent for nucleic acid introduction. Since the present invention is considered to act on U11 snRNA released extracellularly when suppressing the immunogenicity of U11 snRNA, when used for the purpose of suppressing immunogenicity, Although it is preferred not to be used in combination with the later-described reagent for transport, when used for the purpose of inhibiting the function of intracellular U11 snRNA, the use of the reagent for transporting the present invention into the cell is preferred. Examples of the nucleic acid introduction reagent include atelocollagen; liposome; nanoparticle; lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, or poly (ethyleneimine) (PEI) Cationic lipids such as can be used.

  In a preferred embodiment, the medicament of the present invention can be a pharmaceutical composition in which the nucleic acid molecule of the present invention is encapsulated in liposomes. Liposomes are fine closed vesicles having an inner phase surrounded by one or more lipid bilayers, and can usually retain a water-soluble substance in the inner phase and a fat-soluble substance in the lipid bilayer. In the present specification, when referred to as “encapsulation”, the nucleic acid molecule of the present invention may be held in the liposome internal phase or in the lipid bilayer. The liposome used in the present invention may be a monolayer membrane or a multilayer membrane, and the particle size can be appropriately selected, for example, in the range of 10 to 1000 nm, preferably 50 to 300 nm. In consideration of deliverability to the target tissue, the particle size can be, for example, 200 nm or less, preferably 100 nm or less.

  Examples of methods for encapsulating water-soluble compounds such as nucleic acids in liposomes include the lipid film method (vortex method), reverse phase evaporation method, surfactant removal method, freeze-thaw method, remote loading method, etc. Without limitation, any known method can be appropriately selected.

  The medicament of the present invention can be orally or parenterally administered to a mammal (eg, human, rat, mouse, guinea pig, rabbit, sheep, horse, pig, cow, monkey). However, it is desirable to administer parenterally.

Formulations suitable for parenteral administration (eg, subcutaneous injection, intramuscular injection, local infusion, intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which include antioxidants , Buffer solutions, antibacterial agents, tonicity agents and the like may be included. Aqueous and non-aqueous sterile suspensions are also included, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives and the like. The preparation can be enclosed in a container in unit doses or multiple doses like ampoules and vials. Alternatively, the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that may be dissolved or suspended in a suitable sterile vehicle immediately before use.
As another preparation suitable for parenteral administration, a spray etc. can be mentioned.

  The content of the nucleic acid molecule of the present invention in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the whole pharmaceutical composition.

  The dosage of the medicament of the present invention varies depending on the purpose of administration, the method of administration, the type of the target disease, the severity, and the situation of the subject of administration (sex, age, weight, etc.). For example, when administered systemically to an adult, Usually, a single dose of the nucleic acid molecule of the present invention is 2 nmol / kg or more and 50 nmol / kg or less, and 1 pmol / kg or more and 10 nmol / kg or less is preferable for local administration. It is desirable to administer such a dose 1 to 10 times, more preferably 5 to 10 times.

  The medicament of the present invention can be used in combination with other therapeutic agents for autoimmune diseases or inflammatory diseases, for example, therapeutic agents for these diseases already on the market. These concomitant drugs can be formulated together with the medicament of the present invention and administered as a single preparation, or can be formulated separately from the medicament of the present invention and used in the same or different route as the medicament of the present invention. They can also be administered simultaneously or with a time difference. In addition, the dose of these concomitant drugs may be an amount usually used when the drug is administered alone, or may be reduced from an amount normally used.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Materials and methods (materials)
1. Mouse
6-12 week old Tlr3 ^{− / −} mice, Tlr7 ^{− / −} and wild type mice with a genetic background of C57BL / 6 were used. These gene-deficient mice were provided by Dr. Shizuo Akira from Osaka University. For C57BL / 6 wild-type mice that are not specifically described, 6-12 week-old individuals purchased from CLEA Japan were used.
DBA1 (used for CIA), DBF1 and DBA / 1 (used for lupus nephritis model) mice were 6-8 weeks old individuals purchased from Charles River Japan. As BXSB / yaa + and − mice (systemic lupus erythematosus spontaneous mouse model mice), individuals who had purchased a disease from around 23 weeks of age and purchased from Japan SLC were used.

2. RNA
SEQ ID NO: 9
AAAAAGGGCUUCUGUCGUGAGUGGCACACGCAGGGCAACUCGAUUGCUGUGCGUGCGGAAUCGACAUCAAGAGAUUUCGGAAGCAUAAUUUUUUGGUAAUUGGGCAGCUGGUGAUCGUUGGUCCCGGCCCUU
SEQ ID NO: 1:
aaaaagggcuucugucgugaguggcacacguagggcaacucgauugcucugcgugcggaaucgacaucaagagauuuuuugggcauaauuuuuugguauuugggcagcuggugaucguuggucccggcgcccuuu
SEQ ID NO: 10
A (M) A (M) AAAGGGCUUCUGUCGUGAGUGGCACACGCAGGGCAACUCGA (M) UUGCUGUGCGUGCGGAAUCGACAUCAAGAGAUUUCGGAAGCAUAAUUUUUUGGUAAUUGGGCAGCUGGUGAUCGUUGGUCCCGGCGCCCUU
SEQ ID NO: 11
A (M) U (M) AC_φ_φ_ACCUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGCGAGGCUUAUCCAUUGCA (M) CUCCGGAUGUGCUGACCCCUGCGAUUUCCCCAAAUGCGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGUCCUCUGUGUGCGCUCUC

3. Antisense nucleic acids, siRNA and single-stranded nucleic acid molecules
The synthesis of a gapmer-type antisense nucleic acid (SEQ ID NO: 42) against U11 snRNA and a negative control nucleic acid molecule (SEQ ID NO: 43) was commissioned to Fasmac Co., Ltd.

4. Medium
Dulbecco's Modified Eagle Medium (DMEM) medium
DMEM (4.5 g / l Glucose) with L-Gln and Sodium Pyruvate, liquid (Nacalai Tesque) was inactivated by fetal calf serum (FCS) at a final concentration of 10%, and syringe filter (FCS) (Pore size 0.2 μm, Corning).
Roswell Park Memorial Institute medium (RPMI) medium
RPMI medium 1640 (Nacalai Tesque), final concentration of 100 μM MEM non-essential amino acid solution (Nacalai Tesque), 100 μM MEM sodium pyruvate solution (Nacalai Tesque), 50 μM 2-mercaptoethanol (2-ME, Nacalai Tesque) ), And FCS were added through a syringe filter (pore size 0.2 μm, Corning).

(Method)
(Flt3-Land cultured dendritic cells; Flt3L-DC)
The tibia of the mouse and the femur of the hind limb were collected, and both ends were cut with scissors for dissection, and the bone marrow cells in the lumen were collected with a phosphate buffered saline (PBS) containing 1% FCS and 2 mM EDTA. The collected bone marrow cells were passed through a cell strainer (40 μm, Corning), suspended in 1 × RBC (red blood cell) lysis buffer (eBioscience), and allowed to stand at room temperature for 1 minute to hemolyze erythrocytes. The cells were cultured for 6 days in RPMI 1640 medium supplemented with a final concentration of 100 ng / ml mouse Flt3-ligand (Peprotech). Meanwhile, the medium was changed once every two days. Suspension cells were used as FLT3L-DC.

(Culture of spleen cells and isolation of plasmacytoid DC (pDC))
The spleen of the mouse was excised and cut with a dissecting scissors, and then allowed to stand at 37 ° C. for 30 minutes in a digestion buffer containing Collagenase D and DNase I. Suspended cells were collected, red blood cells were lysed with 1 × RBC lysis buffer, and the washed cells were used as spleen cells. Spleen cells were stained with APC-conjugated anti-mouse CD220 antibody (clone; RA3-6E2, BD phamagen) and PE-conjugated anti-mouse / human CD11c antibody (clone; HL3, BD phamagen). CD11cint / B220 + cells were sorted as pDC by BD FACSAria (registered trademark) II (BD Bioscience).

(Isolation of peritoneal elucidated cells)
Using a 10 ml syringe equipped with a 27G needle, 10 ml of PBS containing 1 mM EDTA / 1% FCS was injected into the abdominal cavity of the mouse. The fluid in the mouse abdominal cavity was collected after stirring. The cells were collected and washed, and the obtained cells were used as PECs.

(Isolation of CD14 positive monocytes and granulocytes from human peripheral blood)
30 mL of peripheral blood was collected from healthy volunteers. Peripheral blood mononuclear cell (PBMC) layer and granulocyte layer were isolated by centrifuging peripheral blood using Lymphoprep (Axis-Shield) according to standard protocol. Each was suspended in 1 × RBC lysis buffer and allowed to stand at room temperature for 5 minutes to hemolyze erythrocytes.
CD14 positive cells were isolated from PBMC using CD14 microbeads and Macs column LS (both from Miltenyi Biotec) and used as monocytes.

(Introduction of nucleic acids by DOTAP and Lipofectamine 2000)
Arbitrary volume of 0.5 μg / mL RNA and cationic lipid DOTAP {N- [1- (2,3-Dioleoyloxy) propyl] -N, N, N-trimethylammonium methyl-sulfate} (Roche) or Lipofectamine2000 (Thermo Fisher Scientific) was suspended in Hepes buffered saline (HBS) or Opti-MEM (Thermo Fisher Scientific) and allowed to stand at room temperature for 5 minutes. Each solution was gently mixed for complex formation and allowed to stand at room temperature for 20 minutes. Each solution was gently mixed several times with a micropipette and then added to the cell culture solution.

(Gene expression analysis)
RNA was prepared using RNAiso plus (Takara Bio Inc.) according to a standard protocol. Complementary DNA (cDNA) was prepared according to a standard protocol using PrimeScript RT reagent with gDNA Eraser (Takara Bio Inc.).
Quantitative RT-PCR (qRT-PCR) was performed using SYBR Premix Ex Taq (Takara Bio) and Lightcycler480 (Roche Molecular Biochemicals). A PCR reaction was carried out by adding a sense primer and an anti-sense primer having a final concentration of 0.5 μM and a cDNA solution equivalent to 20% of the reaction system volume (diluted 20-fold with distilled sterilized water). After incubation at 95 ° C for 1 minute, a cycle reaction of 95 ° C for 10 seconds, 57 ° C for 5 seconds, and 72 ° C for 10 seconds was performed 60 times or more. A value obtained by correcting the expression level of the target gene with the expression level of Glycerinaldehyde-3-phosphate dehydrogenase (Gapdh) mRNA was defined as a relative gene expression level (Relative expression). The primers (Fasmac) used for qRT-PCR are shown below.

(Enzyme-Linked Immuno Sorbent Assay; ELISA)
Mouse ELISA for mouse interferon / mouse IFN beta ELISA (PBL) was used for ELISA for mouse IFN-α and mouse IFN-β. Mouse IL-1 beta / IL-1F2 DuoSet ELISA (R & D system) was used for ELISA of mouse IL-1β. The cytokine concentration in the cell culture was measured according to a standard protocol.

(Mouse tail vein blood collection)
A mouse was cut just above the tail vein with a razor, and blood was collected. After standing at room temperature for 15 minutes, the mixture was centrifuged (5000 xg, 15 minutes) to isolate serum.

(Measurement of relative amount of U11 snRNA in culture supernatant and serum by qRT-PCR)
RNA was isolated from liquid samples (PBS, culture supernatant and serum) using Nucleospin miRNA plasma (Takara Bio Inc.). A sample obtained by adding 350 ng of external control RNA to 50-250 μl of a liquid sample and diluting to 300 μl with PBS was used as a sample. As the external control RNA, RNA synthesized by in vitro transcription of 134 base lengths of base numbers 1062-1195 of green fluorescent protein (GFP) mRNA was used. For in vitro transcription, RNA was isolated using RNAiso plus according to the standard protocol of in vitro Transcription T7 Kit (for siRNA Synthesis) (Takara Bio Inc.) and then dissolved in DEPC-treated water. It preserve | saved at -80 degreeC until just before use.
Using PrimeScript RT reagent with gDNA Eraser (Takara Bio Inc.), cDNA was prepared from the isolated RNA according to the standard protocol. However, in the reverse transcription reaction of U11 snRNA, an anti-sense primer for U11 snRNA qRT-PCR was used as a reverse transcription primer, and the reaction conditions were 50 ° C. and 20 minutes.
Quantitative PCR was performed in the same manner as gene expression analysis. U11 snRNA was incubated at 95 ° C. for 1 minute, and then subjected to a cycle reaction at 95 ° C. for 10 seconds, 61 ° C. for 5 seconds, and 72 ° C. for 3 seconds 60 times or more.

(Drawing diagrams and statistical analysis)
In the figure, average values and standard deviations are shown by bar graphs and error bars, or measured values are shown by circles and group median and quarter values by black lines. Microsoft Excel for Mac 2016 and R were used for drawing the figure.
R Core Team (2016). R: A language and environment for statistical computing.R Foundation for Statistical Computing, Vienna, Austria.
https://www.R-project.org/.
Aron Eklund (2016) .beeswarm: The Bee Swarm Plot, an Alternative to Stripchart.R package version 0.2.3.
https://CRAN.R-project.org/package=beeswarm
For linear regression analysis of the calibration curve and statistical analysis between groups, use spreadsheet software to perform F test for analysis of variance between groups, Student t test for significance test of mean value between groups, multiple test Used Dunnett's multiple comparison test. When the P value is less than 0.1, it is shown in the upper part between the tested groups. When the ratio was 0.1 or more, NS (Not Significant) was indicated at the upper part of the group.

Results Reference Example 1 Verification of immunogenicity of U11 snRNA and identification of recognition receptors
(1-1) Mouse U11 snRNA full length
To further verify the immunogenicity of U11 snRNA, the entire mouse U11 snRNA was synthesized. For immunogenicity analysis, spleen cells and pDC containing cells that respond to single-stranded RNA, and PECs that express cytoplasmic nucleic acid receptors were used. Specifically, it was performed as follows.

Spleen cells or plasmacytoid dendritic cells (pDC) sorted from spleen cells were stimulated with mouse full length U11 snRNA or polyU at final concentrations of 0.0666, 0.222, 0.666, and 2 μg / ml.
In addition, nucleic acid at a final concentration of 2 μg / ml was complexed with DOTAP or Lipofectaine 2000, and then mouse peritoneal exudate cells (PECs) were stimulated. After 18 hours, the culture supernatant was collected, and the production amounts of IFN-β, IFN-α, and IL-1β were measured by ELISA. (N = 3)
Statistical analysis used Student's or Welch's t test based on analysis of variance F test. In carrying out the multiple test, the P value was corrected by Bonferroni's method, and the significance level was set to *; P <0.05, **; P <0.01.

  The results are shown in FIG. When splenocytes were stimulated with full-length U11 snRNA, it was found that IFN-β production of the same level was induced as compared with polyU which is a typical TLR7 ligand (upper figure 1). In addition, the same study was performed using pDC that highly expresses TLR7 and highly produces IFN-α when stimulated with single-stranded RNA. As a result, it was revealed that U11 snRNA has the ability to induce IFN-α production as in the case of spleen cells (center of FIG. 1). On the other hand, double-stranded RNA exposed in the cytoplasm is known to activate the inflammasome to promote IL-1β maturation and secretion. Thus, when PECs were stimulated with a complex of U11 snRNA and DOTAP, production of IL-1β was not observed (FIG. 1 bottom). However, when PECs were stimulated with a complex of the cationic lipid Lipofectamine 2000 and U11 snRNA used to expose the nucleic acid into the cytoplasm, the amount was slightly less than that of the double-stranded RNA Polyinosinic-polycytidylic acid (polyIC) (invitrogene). However, IL-1β production was observed (bottom of Fig. 1).

(1-2) Full length of human U11 snRNA Similarly, the immunogenicity of the full length of human U11 snRNA was verified. Specifically, it was performed as follows.

  The immunogenicity of human U11 snRNA full length was verified using CD14 positive monocytes isolated from human peripheral blood mononuclear cells. DOTAP was used for stimulation. CD14 positive monocytes were stimulated with a complex of human U11 snRNA full length and DOTAP at a final concentration of 1 μg / ml. After 4 hours, RNA was extracted, and the expression of Il6 mRNA and Tnf mRNA was analyzed by qRT-PCR. (N = 3)

  The result is shown in figure 2. Similarly, the full length of human U11 snRNA was found to have the ability to induce the expression of inflammatory cytokine genes.

(2) Receptor identification Innate immune receptors that recognize full-length U11 snRNA were identified. Since U11 snRNA is a single-stranded RNA and is thought to be highly involved in TLR7, it was analyzed using spleen cells derived from TLR7-deficient mice. Specifically, it was performed as follows.

  Spleen cells collected from TLR7-deficient mice and wild-type littermates were stimulated with a mouse full-length U11 snRNA or a complex of polyU and DOTAP at a final concentration of 1 μg / ml. RNA was extracted after 4 or 8 hours, and the expression of Ifnb1 mRNA was analyzed by qRT-PCR. (N = 3)

  The results are shown in FIG. 3 (in the figure, “WT” indicates a wild type mouse and “tlr7 − / −” indicates a TLR7 deficient mouse). It was found that induction of gene expression of type I IFN by U11 snRNA disappeared in TLR7-deficient spleen cells, as in the case of stimulation with polyU. From the above results, it was suggested that U11 snRNA is dependent on TLR7 for its immunogenicity.

Reference Example 2 Analysis of the molecular mechanism responsible for the immunogenicity of U11 snRNA
We further investigated the possibility that U11 snRNA has strong immunogenicity by not having a modified base. FIG. 4 shows a schematic diagram of secondary structures of human U11 snRNA and human U1 snRNA. The secondary structures of U11 snRNA and U1 snRNA are similar, but U11 snRNA has no modified base other than 5'-trimethylated guanosine cap, and U1 snRNA has 5'SS (Splicing site) and SL (Stem loop) II has 3 2'-O-Me modifications and 2 pseudouridine modifications. Therefore, in order to examine the effect of 2'-O-Me modification on the immunogenicity of U11 snRNA, a mutant of U11 snRNA with a methylation modification at a position similar to U1 snRNA and a methylation modification were reproduced. U1 snRNA was newly synthesized and its immunogenicity was verified using spleen cells. Specifically, it was performed as follows.

Mouse full-length U11 snRNA, U11 snRNA mutant, U1 snRNA, or RNA ligand (poly U or poly C) and DOTAP complex were used to stimulate mouse spleen cells at final concentrations of 0.5 and 1.0 μg / ml. Four hours later, RNA was extracted, and expression of Ifnb1 mRNA, Il6 mRNA, and Tnf mRNA was analyzed by qRT-PCR. (N = 3)
Moreover, pDC fractionated from spleen cells was stimulated using a complex of RNA and DOTAP having a final concentration of 2 μg / ml. After 18 hours, the culture supernatant was collected, and the amount of IFN-α produced was measured by ELISA.

  The results are shown in FIG. With the introduction of methylation modification, the ability of U11 snRNA to induce the expression of inflammatory cytokines and type I IFN genes was markedly attenuated, and became comparable to U1 snRNA with methylation modification. These results indicate that U11 snRNA does not undergo 2'-O-Me modification in order to exert immunogenicity, and DAMPs of U11 snRNA without methylation modification This suggests the physiological significance of

Reference Example 3 Analysis of serum U11 snRNA levels in a mouse disease model
Since it was suggested that U11 snRNA elicits an immune response as an endogenous immunogenic nucleic acid, the relationship between U11 snRNA and disease state was examined using a mouse disease model. Mouse disease models include mouse RA model (collagen-induced arthritis model; CIA), mouse SLE model Graft versus host disease (GVHD) lupus nephritis model, and spontaneous SLE model (BXSB / yaa mouse, Y-linked autoimmune) acceleration; yaa) was used. About these mice, the U11 snRNA concentration contained in the blood was analyzed by qRT-PCR method in the state where the disease developed. Specifically, it was performed as follows.

In the mCIA model, serum was collected from an individual 2 weeks after the second collagen administration. Controls were unsensitized mice. RNA was extracted from serum and the U11 snRNA concentration was measured by qRT-PCR.
In the mGVHD lupus model, serum was collected before spleen cell administration and 4 weeks after administration. RNA was extracted from serum and the U11 snRNA concentration was measured by qRT-PCR.
Male yaa mice have a Yaa (Y-linked autoimmune acceleration) gene mutation on the Y chromosome and spontaneously develop autoimmune disease with aging. The yaa + mouse is a mouse in which the Y chromosome is replaced with the B6-derived Y chromosome by crossing with the B6 strain, does not have a Yaa gene mutation, and does not develop an autoimmune disease. Serum U11 snRNA concentrations collected from male BXSB / yaa + mice and yaa mice at 22-24 weeks of age were measured by qRT-PCR.
Student's t test was used for the above statistical analysis.

  The results are shown in FIG. 6 (in the figure, the P value is shown at the top of the group. “N.S.” indicates “Not significant”) In the mouse RA model (CIA: upper left of Fig. 6), mouse SLE model (upper right of Fig. 6), and spontaneous SLE model (lower left of Fig. 6), higher concentrations in the blood compared to the respective control groups Of U11 snRNA was suggested to exist.

Example 1 Suppression of U11 snRNA immunogenicity by siRNA having a sequence complementary to U11 snRNA and single-stranded nucleic acid molecule
Using siRNA having a sequence complementary to U11 snRNA and a single-stranded nucleic acid molecule, a method for suppressing the ability of U11 snRNA to induce the expression of inflammatory cytokines and type I IFN genes was investigated. Since U11 snRN activates the induction of gene expression via TLR7, the presence of a single U-rich region in the secondary structure of U11 snRNA appears to be important for its immunogenicity . Therefore, the immunogenicity of U11 snRNA is inhibited by inhibiting the region (sm region) that can be a ligand for TLR7 using siRNA and single-stranded nucleic acid molecules that contain a sequence complementary to the sm region of mouse U11 snRNA. Was examined to see if the decrease. The six types of nucleic acid molecules used are shown below.

NI1 (SEQ ID NO: 36 / SEQ ID NO: 37):
GCAUAAUUUUUUGGUAUUUTT / AAAUACCAAAAAAUUAUGCTT
NI2 (SEQ ID NO: 38 / SEQ ID NO: 39):
CAUAAUUUUUUGGUAUUUGTT / CAAAUACCAAAAAAUUAUGTT
NI3 (SEQ ID NO: 40 / SEQ ID NO: 41):
AUAAUUUUUUGGUAUUUGGTT / CCAAAUACCAAAAAAUUAUTT
PH1 (SEQ ID NO: 6):
GCAUAAUUUUUUGGUAUUUUUCC-L-GGAAAAAUACCAAAAAAUUAUGCUU
PH2 (SEQ ID NO: 7):
CAUAAUUUUUUGGUAUUUGUUCC-L-GGAACAAAUACCAAAAAAUUAUGUU
PH3 (SEQ ID NO: 8):
AUAAUUUUUUGGUAUUUGGUUCC-L-GGAACCAAAUACCAAAAAAAUUAUUU
L is a linker represented by the following structure.

The suppression of U11 snRNA immunogenicity by each nucleic acid molecule was specifically examined as follows. Spleen cells were seeded in a 96-well plate at 1.25 × 10 ⁵ cells / 50 μL medium / well, and a U11 snRNA / DOTAP mixture was added at 1.0 μg / ml. When preparing the U11 snRNA / DOTAP mixture, each nucleic acid molecule was added in advance such that the molar ratio of U11 snRNA to each nucleic acid molecule was 1: 1 and 1: 2 (U11 snRNA: nucleic acid molecule). After 4 hours, the cells were collected and analyzed for Ifnb1 mRNA and Il6 mRNA by qRT-PCR.

  The results are shown in FIG. 7 (in the figure, “+” indicates the mass ratio of U11 snRNA to each nucleic acid molecule is 1: 1, and “++” indicates the case of 1: 2. Also, in the figure, the left end "-" Indicates no stimulation, and the second "-" from the left indicates no addition of nucleic acid molecules.) Each nucleic acid molecule containing a complementary sequence suppressed the induction of type I IFN and inflammatory cytokines by U11 snRNA.

Example 2 Suppression of U11 snRNA immunogenicity by antisense nucleic acid having a sequence complementary to U11 snRNA
Using antisense nucleic acids having a sequence complementary to U11 snRNA, a method for suppressing the ability of U11 snRNA to induce the expression of inflammatory cytokines and type I IFN genes was investigated. Specifically, it was performed as follows.

  A gapmer-type antisense nucleic acid (SEQ ID NO: 42) and a negative control nucleic acid molecule (SEQ ID NO: 43) against U11 snRNA containing a part of the stem-loop 3 sequence were synthesized. In the following sequences, “mN” indicates 2′-OMe-RNA, lowercase letters indicate DNA, and “*” indicates phosphorothioate bonds.

Sequence number 42: mU * mC * mU * mC * mU * t * g * a * t * g * t * c * g * a * t * mU * mC * mC * mG * mC *
Sequence number 43: mU * mC * mA * mC * mC * t * t * c * a * c * c * c * t * c * t * mC * mC * mA * mC * mU *

Dendritic cells cultured from mouse bone marrow using FLT3 ligand were stimulated with U11 snRNA synthesized in vitro (mixed with Dopap), and induction of IFNb1 mRNA was analyzed by qRTPCR.
Anti-sense for U11 snRNA was added at a molar ratio of 1: 5 (U11 snRNA: antisense) during stimulation.

  The results are shown in FIG. The antisense nucleic acid having a sequence complementary to U11 snRNA suppressed the induction of IFNβ by U11 snRNA.

  According to the present invention, the function of U11 snRNA can be suppressed. In addition, the nucleic acid molecule of the present invention can be used as a therapeutic agent for a disease involving increased expression of type I IFN and / or inflammatory cytokine.

Claims (21)

  The nucleic acid molecule which suppresses the function of U11 snRNA including the sequence complementary to the partial sequence of continuous 15-30 nucleotides in the nucleotide sequence of U11 snRNA.   The nucleic acid molecule according to claim 1, wherein the partial sequence comprises all or part of the stem-loop 3.   The partial sequence is a sequence represented by nucleotide numbers 55 to 74 or a corresponding sequence in a non-human mammal ortholog or a gene polymorphism thereof in the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1. 2. The nucleic acid molecule according to 2.   The nucleic acid molecule according to claim 1, wherein the partial sequence comprises all or part of an sm binding domain.   In the nucleotide sequence of human U11 snRNA represented by SEQ ID NO: 1, the partial sequence is a sequence represented by nucleotide numbers 83 to 101, 84 to 102, or 85 to 103, or a non-human mammal ortholog or a gene polymorphism thereof. 5. A nucleic acid molecule according to claim 4, which is a corresponding sequence.   The nucleic acid molecule according to any one of claims 1 to 5, which is an antisense nucleic acid against U11 snRNA.   The nucleic acid molecule according to claim 6, which consists of the nucleotide sequence represented by SEQ ID NO: 2, wherein U may be T.   The nucleic acid molecule according to claim 6 or 7, wherein the antisense nucleic acid is a gapmer type.   The nucleic acid molecule according to any one of claims 1 to 5, which is a siRNA against U11 snRNA.   The siRNA comprises a nucleotide sequence represented by any one of SEQ ID NOs: 3 to 5 (provided that U may be T in the sequence) and a complementary sequence thereto. Nucleic acid molecules.   11. The nucleic acid molecule of claim 9 or 10, wherein the siRNA has a 3'-overhang on one or both strands.   A nucleotide sequence X including a sequence Xa complementary to the partial sequence, and a nucleotide sequence Y including a sequence Ya complementary to the sequence Xa are passed through the linker L in the 3 ′ to 5 ′ direction in the direction of X-L-Y. The nucleic acid molecule according to any one of claims 1 to 5, wherein the sequence Xa and the sequence Ya are linked in an orientation capable of forming a double strand in the molecule. The nucleic acid molecule according to claim 12, wherein the linker L is a proline derivative linker represented by the following formula.
  The sequence X has an additional sequence Xb at the 5 ′ end of the sequence Xa, the sequence Y has an additional sequence Yb at the 3 ′ end of the sequence Ya, and the sequence Xb and the sequence Yb are complementary The nucleic acid molecule according to claim 12 or 13.   The nucleic acid molecule according to any one of claims 12 to 14, wherein the sequence X has a 3'-overhang.   16. The sequence Xa according to any one of claims 12 to 15, wherein the sequence Xa is a nucleotide sequence represented by any one of SEQ ID NOs: 3 to 5 (wherein U may be T). Nucleic acid molecules.   The function inhibitor of U11 snRNA containing the nucleic acid molecule of any one of Claims 1-16.   The agent according to claim 17, wherein the function of the U11 snRNA is induction of expression of type I interferon and / or inflammatory cytokine.   The pharmaceutical containing the nucleic acid molecule of any one of Claims 1-16.   The medicament according to claim 19, which is a therapeutic agent for a disease involving increased expression of type I interferon and / or inflammatory cytokine.   The medicament according to claim 20, wherein the disease is an autoimmune disease or an inflammatory disease.