JP3437816B2 - Methods for measuring nucleic acids - Google Patents

Description

Detailed Description of the Invention

[0001]

The present invention relates to relates <br/> to measure how the nucleic acid. Specifically, it relates to various methods for measuring various nucleic acids using a nucleic acid probe labeled with a fluorescent dye, and decreases emission of the fluorescent dye before and after hybridization, which occurs when the nucleic acid probe labeled with the fluorescent dye is hybridized with a target nucleic acid. about the various new measuring how the various nucleic acid based on the principle of measuring the amount.

[0002]

2. Description of the Related Art Conventionally, various methods for measuring the amount of nucleic acid using a nucleic acid probe labeled with a fluorescent dye are known.
The method includes the following. (1) Dot brotting method In this method, after a target nucleic acid and the nucleic acid probe are hybridized on a membrane, unreacted nucleic acid probe is washed away, and a nucleic acid probe hybridized with the target nucleic acid is labeled with a fluorescent dye molecule. It is to measure the fluorescence intensity only.

(2) Intercalator method (Glazer et
al., Nature 359: 959, 1992): This method measures the increase in luminescence because a certain fluorescent dye called intercalator emits intense light when it is embedded in the double strand of nucleic acid. Is the way to do it. As the fluorescent dye, for example, ethidium bromide (Experimental Medicine, Volume 15, 7
Issue, pages 46-51, 1997, Yodosha), SYBR R
Green I (LightCycler ^TM System; 1999
Brochure issued by Roche Diagnostics KK on April 5, 2014).

(3) FRET (fluorescence energy transfe)
r) method (Mergney et al., Nucleic Acid Re
s., 22: 920-928, 1994.): This method consists of two nucleic acid probes that hybridize to a target nucleic acid. The two nucleic acid probes are labeled with different fluorescent dyes. One of the two probes is labeled with a fluorescent dye that is capable of sending energy to the fluorescent dye of the other probe through the FRET phenomenon to cause it to emit light.
The two probes are placed so that the fluorescent dyes face each other and
Designed to hybridize at ~ 9 bases apart. Therefore, when the two nucleic acid probes hybridize with the target nucleic acid, the fluorescent dye emits light, and the degree of light emission is proportional to the replication amount of the target nucleic acid.

(4) Molecular beacon method (Tyagi et al.,
Nature Biotech., 14: 303-308, 1996.) The nucleic acid probe used in this method is labeled with a reporter dye at one end and a quencher dye at the other end. And since both ends are complementary to each other in the base sequence,
The nucleotide sequence is designed so that the probe as a whole forms a hairpin stem. When suspended in the liquid due to its structure, the emission of the reporter dye is suppressed by the quencher dye due to Forster resonance energy. However, the hybridization between the target nucleic acid and the hairpin stem structure causes the distance between the reporter dye and the quencher dye to increase, so Forster
The transfer of resonance energy does not occur. for that reason,
The reporter dye emits light.

(5) Davis method (Davis et al., Nu
cleic acids Res.24: 702-706, 1996) Davis uses a fluorescent dye at the 3'end of the oligonucleotide, which has 18 carbon atoms.
A probe was prepared which was bound via a spacer having an individual. This was applied to flow cytometry. It was reported that a 10-fold higher fluorescence intensity was obtained when hybridized than when a fluorescent dye was directly bound to the 3'end. These methods include various methods for measuring nucleic acids and HI.
SH method (fluorescent in situ hybridization assay
s), PCR method, LCR method (ligase chain reactio
n), SD method (strand displacement assays), competitive hybridization method (competitive hybridizatio)
It is applied to n) etc. and has achieved remarkable development.

These methods are generally used at present, but it is necessary to wash out the nucleic acid probe which has not hybridized from the reaction system after the hybridization reaction of the nucleic acid probe labeled with the fluorescent dye and the target nucleic acid. There is an unfavorable procedure that there is.
It is obvious that the removal of such a procedure leads to shortening of measurement time, convenience of measurement, and accuracy of measurement. Therefore, it has been desired to develop a nucleic acid measuring method that does not have such a procedure.

[0008]

In view of the above situation, an object of the present invention is to provide a nucleic acid measuring method using a nucleic acid probe labeled with a fluorescent dye, in a shorter time, in a simpler manner,
It is an object of the present invention to provide a method capable of measuring a target nucleic acid amount more accurately.

[0009]

[Means for Solving the Problems] In order to solve the above problems, the present inventors have made extensive studies on a nucleic acid measuring method using a nucleic acid probe. As a result, when a nucleic acid probe labeled with a fluorescent dye hybridizes with a target nucleic acid, there is a phenomenon that the emission of the fluorescent dye is reduced (fluorescence quenching phenomenon), and the reduction is remarkable with a specific dye, And it was discovered that the degree of the decrease depends on the type or base sequence of the base of the portion to which the fluorescent dye is bound. The present invention has been completed based on such findings.

That is, the present invention provides a nucleic acid measuring method using a nucleic acid probe labeled with a fluorescent dye, wherein when the above nucleic acid probe hybridizes with a target nucleic acid,
Hybridization base pairs at the end portion
Reduces the number of G (guanine) and C (cytosine) pairs
The base sequence of the probe is
A designed nucleic acid probe, and the nucleic acid probe
There upon hybridization to the target nucleic acid, a fluorescent dye, a nucleic acid probe (except to reduce the emission,
"G-tetramer structure-forming oligonucleotide having a first end labeled with a donor fluorophore and a second end labeled with an acceptor"
And "the first probe has a fluorophore and the second probe is complementary to the first probe and has a quencher molecule capable of quenching the fluorescence of the fluorophore") ( Hereinafter, simply referred to as a "nucleic acid probe"), the nucleic acid probe is hybridized with a target nucleic acid, and the amount of decrease in the emission of the fluorescent dye before and after the hybridization is measured to provide a nucleic acid measuring method. Preferred nucleic acid probes used in the above method include the following. Other preferable nucleic acid probes will be described later. When the nucleic acid probe is labeled with a fluorescent dye at its end, and the nucleic acid probe hybridizes to the target nucleic acid, the target is separated by 1 to 3 bases from the end base at which the probe and the target nucleic acid hybridized, the nucleotide sequence of the nucleic acid as G (guanine) are present at least one or more bases, the nucleic acid probe base sequence of the probe is designed.

[0011]

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will now be described in more detail with reference to the preferred embodiments. In the present invention, DN
A, RNA, cDNA, mRNA, rRNA, XTP
s, dXTPs, NTPs, dNTPs, nucleic acid probe, helper nucleic acid probe (or nucleic acid helper probe, or simply helper probe), hybridization, hybridization, intercalator, primer, annealing, extension reaction, thermal denaturation reaction, nucleic acid melting curve, PCR, RT-PCR, RNA-primed PCR, S
PC using tretch PCR, inverse PCR, Alu sequence
R, multiplex PCR, PCR using mixed primers, PN
PCR method using A, hybridization method (hy
bridization assays), HISH (fluorescent in situ)
hybridization assay) method, PCR method (polymerase c)
hain assays), LCR method (ligase chain reactio
n), SD method (strand displacement assays), competitive hybridization method
ion), DNA chip, nucleic acid detection (gene detection) device, SNP (snipping: single nucleotide substitution polymorphism), complex microbial system, etc. are now commonly used in molecular biology, genetic engineering, microbial engineering, etc. Has the same meaning as the term used in. The first feature of the present invention is, in a method for measuring a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye, a decrease in emission of the fluorescent dye before and after hybridization, which occurs when the nucleic acid probe hybridizes with the target nucleic acid. To measure the quantity.

In the present invention, the measurement of the target nucleic acid means quantitative or quantitative detection, or simple detection.
A nucleic acid measurement method using a nucleic acid probe labeled with a fluorescent dye is a hybridization method (hybridization
ssays), HISH method (fluorescent in situ hybridiza
tion assay), PCR method (polymerase chain assay)
s), LCR method (ligase chain reaction), SD method (str
and displacement assays), competitive hybridization methods, etc. In these methods, after adding a nucleic acid probe labeled with a fluorescent dye, the unreacted fluorescent dye of the nucleic acid probe that did not hybridize to the target nucleic acid is removed from the measurement system by a method such as washing, and the target nucleic acid is removed. A fluorescent dye labeled on the hybridized nucleic acid probe is directly emitted from the probe, or an indirect means is applied to the probe (for example, by causing an enzyme to act) to emit light, and the emitted light amount Is a method of measuring.
The present invention is characterized in that a target nucleic acid is measured without performing such a complicated operation.

In the present invention, the target nucleic acid means a nucleic acid for the purpose of quantitative or quantitative detection, or mere detection. With or without purification. Further, the size of the concentration does not matter. Various nucleic acids may be mixed. For example,
Complex microbial system (RNA or gene DN of multiple microorganisms
A specific nucleic acid for quantitative or quantitative detection in a mixed system of A) or a symbiotic microbial system (mixed system of RNA or gene DNA of a plurality of animals and plants and / or a plurality of microorganisms), or mere detection. When the target nucleic acid needs to be purified, it can be performed by a conventionally known method. For example, a commercially available purification kit or the like can be used. Specific examples of the above-mentioned nucleic acid include DNA, RNA,
PNA, 2-O-methyl (Me) RNA, deoxyribo-oligonucleotides,
Riboxy-origonucleotide
s) and the like.

In the present invention, the fluorescent dye can be conveniently used by labeling a nucleic acid probe and used for the measurement / detection of nucleic acid. To
The fluorescent dye labeled on the probe is preferably used as it reduces its luminescence. For example, fluorescein or derivatives thereof {eg, fluorescein isothiocyana
te) (FITC) or its derivatives, Alexa 488, Alexa
532, cy3, cy5, EDANS (5- (2'-aminoethyl) amino-1-na
phthalene sulfonic acid)}, rhodamine
e) 6G (R6G) or its derivatives (eg, tetramethylrhodamine (TMR), tetramethylrhodamine isothiocyanate (tetramethylrhodami)
ne isothiocyanate (TMRITC), x-rhodamine (x-rhod
amine), Texas red (Texas red), Bodepee (BODIP)
Y) FL (trade name; Molecular Probe
s), USA), BODIPY FL / C3 (trade name; Molecular Probes, USA), BODIPY FL / C6 (trade name; Molecular Probes) BODIPY5-FAM (trade name; molecular probe (M)
olecular Probes), USA), BODIPY T
MR (Trade name; Molecular Probe
es, Inc., USA) or a derivative thereof (eg, BODIPY TR (trade name; Molecular Probe (Mole)
cular Probes), USA), DEPY (BODIPY) R6G
(Trade name: Molecular Probe
s), USA), BODIPY 564 (trademark name; Molecular Probes, USA), BODIPY 581 (trademark; molecular
Probes (Molecular Probes, USA) and the like. Among these, FITC, EDANS, 6-joe,
TMR, Alexa 488, Alexa 532, BODIPY FL / C
3 (Trade name; Molecular Probe
s), USA), BODIPY FL / C6 (trade name; Molecular Probes, USA), etc. as suitable ones, and FITC, TMR, 6
-jeo, BODIPY FL / C3 (trade name; manufactured by Molecular Probes, USA), BODIPY FL / C6 (trade name; manufactured by Molecular Probes, USA) Can be mentioned as a more suitable one.

The nucleic acid probe to be hybridized with the target nucleic acid may be composed of oligodeoxyribonucleotides or oligoribonucleotides. In addition, both of them intervene in the chemeric oligonucleotide (chemiric oligonucleoside).
dite). In addition, 2-o-Methyl oligoribonucleotides (olig
Nucleoside at the 5'end of oribonucleotide
side part) is cytidine, and the OH group at the 2′-position of the cytidine is modified with a methyl group). Alternatively, the 2′-o-methyl oligoribonucleotide may be interposed in oligodeoxynuclueotide in order to enhance the affinity with RNA.

A nucleic acid probe in which a modified RNA such as 2'-o-methyl oligoribonucleotide is interposed in an oligodeoxynucleotide is mainly used for measuring RNA. RNA using the probe
In the case of measuring, the RNA solution, which is a sample, is
° C, preferably 90-100 ° C, optimally 93-97 ° C
It is suitable to destroy the higher-order structure of RNA by heat treatment for 1 to 15 minutes, preferably 2 to 10 minutes, optimally 3 to 7 minutes. The base chain of the nucleic acid probe is 3
When the length is 5 bases or less, a helper probe such as (5 ') is added to increase the efficiency of hybridization to the sequence region.
It is preferable to add an oligonucleotide having a nucleotide sequence of AGGCCGGCCCTTGACTTTCC T (3 ′) to the reaction solution. In this case, the helper probe may be an oligodeoxynucleotide body or a 2-o-methyloligoribonucleotide body. However, when using a nucleic acid probe having a length of more than 35 bases, the target RNA only needs to be heat-denatured. When such a nucleic acid probe of the present invention is hybridized with RNA, the fluorescence intensity decreases according to the amount of RNA in the reaction solution, and the final RNA concentration is about 150 pM.
Up to RNA can be measured.

In the measurement of RNA by the conventional hybridization method using a nucleic acid probe, an oligodeoxynucleotide body or an oligoribonucleotide body has been used as a nucleic acid probe. Since RNA itself has a strong higher-order structure, the efficiency of hybridization between the probe and the target RNA was poor, and the quantification was poor. Therefore, the conventional method has the complexity of denaturing RNA and then immobilizing it on a membrane before carrying out a hybridization reaction. On the other hand, since the above-mentioned method of the present invention uses a ribose moiety-modified nucleic acid probe having a high affinity for a specific structure part of RNA, it is possible to carry out a hybridization reaction at a higher temperature than conventional methods. . Therefore, the adverse effect of the higher order structure of RNA can be overcome only by the heat denaturation treatment as the pretreatment and the combined use of the helper probe. Accordingly, the hybridization efficiency is substantially 10 in the method of the present invention.
It becomes 0%, and the quantification is improved. In addition, it is much simpler than the conventional method.

The probe of the present invention has a base number of 5 to 50, preferably 10 to 25, and particularly preferably 15 to 20.
Is. If it exceeds 50, the permeability of the cell membrane will deteriorate when used in the HISH method, and the scope of application of the present invention will be narrowed. If it is less than 5, non-specific hybridization is likely to occur, resulting in a large measurement error.

The base sequence of the probe may be any as long as it specifically hybridizes with the target nucleic acid,
There is no particular limitation. Preferably, when a nucleic acid probe labeled with a fluorescent dye is hybridized with a target nucleic acid, (1) the base sequence of the target nucleic acid is separated by 1 to 3 bases from the terminal base portion of the target nucleic acid hybridized with the probe. The base sequence of the probe is designed such that (guanine) is present in at least one base, and (2) the base pair of the probe-nucleic acid hybrid complex is G (guanine) and C in the terminal portion of the probe. A base sequence in which the base sequence of the probe is designed so as to form at least one or more pairs of (cytosine) is preferable.

The oligonucleotide of the nucleic acid probe in the present invention can be produced by a general method for producing an ordinary oligonucleotide. For example, it can be produced by a microbial method using a chemical synthesis method, a plasmid vector, a phage vector, etc. (Tetrahedron letters, Volume 22, 1859-1862).
Page, 1981; Nucleic acids Research, Volume 14, 6227-
6245, 1986). It is preferable to use a commercially available nucleic acid synthesizer (for example, ABI394 (Perkin
Elmer, USA)).

In order to label the oligonucleotide with the fluorescent dye, any desired one of the conventionally known labeling methods can be used (Nature Biotechnology, vol. 14, 303-3).
08, 1996; Applied and Environmental Microbiol
Ogy, 63, 1143-1147, 1997; Nucleic acids
Research, 24, 4532-4535, 1996). For example, when coupling the fluorophore to the 5'-end, first, as a spacer to a phosphate group of the 5 'end in a conventional manner, for example, - (CH ₂₎ introducing _n -SH. Since these introduction bodies are on the market, you may purchase a commercially available product (Medland Certified Resin Company (Midl
and Certified Reagent Company)). In this case, n is 3-8, preferably 6. A labeled oligonucleotide can be synthesized by binding a fluorescent dye having an SH group reactivity or a derivative thereof to this spacer. The thus-synthesized oligonucleotide labeled with a fluorescent dye can be purified by chromatography such as reverse phase chromatography to obtain the nucleic acid probe used in the present invention.

It is also possible to attach a fluorescent dye to the 3'end of the oligonucleotide. In this case, for example, — (CH ₂ ) _n —NH ₂ is introduced into the OH group at the 3′-position C of ribose or deoxyribose as a spacer. Since these introduced bodies are also commercially available in the same manner as above, a commercially available product may be purchased (Medland Certified Reagent Co.
mpany)). In addition, by introducing a phosphate group, O of the phosphate group is introduced.
As Supesa the H group, for example, - (CH ₂₎ introducing _n -SH. In these cases, n is 3-8, preferably 4-7. A labeled oligonucleotide can be synthesized by binding a fluorescent dye or a derivative thereof having reactivity to an amino group and an SH group to this spacer. The thus-synthesized oligonucleotide labeled with a fluorescent dye can be purified by chromatography such as reverse phase chromatography to obtain the nucleic acid probe used in the present invention. When introducing this amino group, a kit reagent (for example, Uni-link am
inomodifier (CLONTECH, USA), Fluo Reporter Kits F-6082, F-6083, F-6
084, F-10220 (both molecular probe (M
It is convenient to use olecular probes), USA). Then, a fluorescent dye molecule can be bound to the oligoribonucleotide according to a conventional method. It is also possible to introduce a fluorescent dye molecule into the strand of the probe nucleic acid (ANALYTICAL BIOCHEMISTRY 225, 32-38 (1998
Year)). Although the nucleic acid probe of the present invention can be prepared as described above, a preferred probe form is one in which the 3 ′ or 5 ′ end is labeled with a fluorescent dye, and the base at the labeled end is G or C. Is what is. When the 5'-end is labeled and the 3'-end is unlabeled, the OH group at the 3'-position C of ribose or deoxyribose at the 3'-end is a phosphate group, and the 2'-position C of ribose at the 3'-end is O
The H group may be modified with a phosphoric acid group or the like without any limitation.

The nucleic acid probe of the present invention can be used not only for nucleic acid measurement, but also for polymorphism of a target nucleic acid or gene.
It can be preferably used for a method for analyzing or measuring sm) or / and mutation. DN described below
A more convenient method is provided by using it together with the A chip. That is, in the hybridization of the nucleic acid probe of the present invention with the target nucleic acid or gene, the fluorescence intensity changes depending on whether or not a GC pair is formed.
Then, the nucleic acid probe of the present invention is hybridized with the target nucleic acid or gene, and the luminescence intensity is measured to obtain the polymorphism of the target nucleic acid or gene.
hism) or / and mutations can be analyzed or measured. The specific method is described in Examples. In this case, the target nucleic acid or gene may be an amplified product amplified by one of various nucleic acid or gene amplification methods, or may be an extracted product. The target nucleic acid may be of any type. Examples of target nucleic acids to which the present invention can be applied include RNA, DNA, PNA, and artificially modified nucleic acids. However, the guanine base may be present in the chain or at the end. If there is no guanine base in the chain or at the end, the fluorescence intensity does not decrease. Therefore, according to the method of the present invention, G → A, G ← A, C → T, C
← T, G → C, G ← C mutation or substitution, that is,
Single nucleotide polymorphism (SNP)
It is possible to analyze or measure polymorphism (polymorphism analysis) and the like. At present, polymorphism analysis is performed by determining the nucleotide sequence of a nucleic acid or gene using the Maxam-Gilbert method or the dideoxy method.

Therefore, by incorporating the nucleic acid probe of the present invention into a measurement kit for analyzing or measuring the polymorphism and mutation of the target nucleic acid and / or gene, the polymorphism of the target nucleic acid or gene (po
It can be suitably used as a measurement kit for analyzing or measuring lymorphism) and / or mutation.

Polymorphism of the target gene of the present invention
m) or / and when analyzing the data obtained by the method of analyzing or measuring mutation, the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with the nucleic acid probe labeled with a fluorescent dye, Providing a processing step for correcting with the fluorescence intensity value of the reaction system when the above is not hybridized makes the processed data highly reliable. Therefore, the present invention provides a data analysis method for a method for analyzing or measuring polymorphism or / and mutation of a target nucleic acid or gene.

A feature of the present invention is that polymorphism or / and mutation (mu) of the target nucleic acid or gene.
In the measuring device for analyzing or measuring the reaction (tation), the fluorescence intensity value of the reaction system when the target nucleic acid or gene hybridizes with the nucleic acid probe labeled with a fluorescent dye A target nucleic acid or gene polymorphism (polymorphi) having a processing means for correcting the fluorescence intensity value of the system.
sm) or / and a measurement device for analyzing or measuring mutation.

A feature of the present invention is that the target nucleic acid or gene has polymorphism or / and mutation (mu).
When the data obtained by the method for analyzing or measuring It is a computer-readable recording medium in which is recorded a program for causing a computer to execute a process of correcting the fluorescence intensity value of the reaction system when not soybean.

The probe of the present invention has a solid (supporting layer) surface,
For example, it may be fixed to the surface of the slide glass.
In this case, it is preferable that the end not labeled with the fluorescent dye is fixed. This format is currently called a DNA chip. Gene expression monitoring, base sequence determination, mutation analysis (mu
tation analysis), single nucleotide polymorphism (single nucleotide p
olymorphism (SNP) and other polymorphism analysis (polymorphism an
alysis) etc. Of course, it can be used as a nucleic acid measuring device (chip).

For binding the probe of the present invention to, for example, the surface of a slide glass, a slide glass coated with a polycation such as polylysine, polyethyleneimine or polyalkylamine, a slide glass having an aldehyde group introduced, or an amino group is introduced. First, the prepared slide glass is prepared. Then, i) the slide glass coated with a polycation is reacted with a phosphate group of the probe, ii) the slide glass introduced with an aldehyde group is reacted with a probe introduced with an amino group, iii) an amino group The PDC (pyridinium dichromat)
e) It can be achieved by introducing, reacting a probe having an amino group or an aldehyde group introduced (Fodor, PA, et a
l., Science, 251, 767-773 (1991); Schena, M., et al., Pro.
c.Natl.Acad.Sci., USA, 93,10614-10619 (1996); McGa
l, G., et al., Proc.Natl.Acad.Sci., USA, 93,13555-13
560 (1996); Blanchad, AP, et al., Biosens. Bioelectro.
n., 11, 687-690 (1996)).

A device in which nucleic acid probes are arranged and bound in an array on a solid surface is more convenient for nucleic acid measurement. In this case, a large number of different genes can be detected and quantified at the same time by making a device by binding many probes of the present invention having different base sequences individually on the same solid surface.
In this device, for each probe, at least one temperature sensor and a heater are provided on the surface opposite to the side where the solid probe is bonded, and the temperature is adjusted so that the solid region to which the probe is bonded has an optimum temperature condition. It is preferably designed to be adjustable.

In this device, a probe other than the probe of the present invention, for example, two different fluorescent dyes in one molecule, and two fluorescent dyes that interact with each other when not hybridized to a target nucleic acid By action, a nucleic acid probe that is quenched or luminescent, but has a structure designed to fluoresce or quench when hybridized to a target nucleic acid, that is, the molecular beacon (Tyagi et al., Nature Biotech., 14: 303-308,199
Those obtained by combining 6) and the like can also be preferably used. Therefore, such a device is also included in the technical scope of the present invention.

The basic operation of the measuring method using the device of the present invention is as follows.
A solution containing a target nucleic acid such as A, cDNA, or rRNA is simply put on and hybridized. As a result, the amount of fluorescence changes depending on the amount of target nucleic acid, and the target nucleic acid can be detected and quantified from the amount of change in fluorescence. Further, by binding a large number of nucleic acid probes having different base sequences on one solid surface, many nucleic acids can be detected and quantified at one time. Therefore, it is a novel DNA chip because it can be used for exactly the same purpose as a DNA chip.
Nucleic acids other than the target nucleic acid do not change the fluorescence emission amount under the optimum reaction conditions, and therefore the operation of washing unreacted nucleic acid is not necessary. Furthermore, by controlling the temperature for each type of nucleic acid probe with a minute heater, it is possible to control the optimum reaction conditions for each probe, so that accurate quantification is possible. Further, by continuously changing the temperature with a minute heater and measuring the amount of fluorescence during that time, the dissociation curve between the nucleic acid probe and the target nucleic acid can be analyzed. From the difference in the dissociation curves, the properties of the hybridized nucleic acids can be determined and SNP can be detected.

In the conventional device for measuring target nucleic acid, a nucleic acid probe not modified with a fluorescent dye is bound (fixed) to a solid surface, and a target nucleic acid labeled with the fluorescent dye is hybridized to the nucleic acid probe, followed by hybridization. The target nucleic acid which was not treated was washed away, and the fluorescence intensity of the remaining fluorescent dye was measured. To label a target nucleic acid with a fluorescent dye, for example, when targeting a specific mRNA, take the following steps: (1) m extracted from cells
Extract all RNA. (2) Then, using reverse transcriptase, cDNA is synthesized while being modified with a fluorescent dye and incorporating nucleoside. The present invention does not require such an operation.

A large number of various probes are spotted on the device, but the optimum hybridization conditions of the nucleic acid that hybridizes to each probe, such as temperature, are different. Therefore, originally, it is necessary to perform the hybridization reaction and the washing operation for each probe (spot) under optimum conditions. However, because it is physically impossible, all probes should be hybridized at the same temperature,
Further, cleaning is also performed with the same cleaning liquid at the same temperature. Therefore, there are drawbacks such that nucleic acids expected to hybridize do not hybridize, or even if they hybridize, they are easily washed out because the hybridization is not strong. Due to such a cause, the quantification of nucleic acid was low. The present invention does not have this drawback, since this washing operation is not necessary. In addition, by providing a minute heater at the bottom of the spot and controlling the hybridization temperature,
The hybridization reaction can be performed at an optimum temperature for each probe. Therefore, the present invention has significantly improved quantitativeness.

In the present invention, by using the above-mentioned nucleic acid probe or device, the target nucleic acid can be obtained in a short time.
It can be measured simply and specifically. The measuring method is described below. In the measuring method of the present invention, first, the nucleic acid probe is added to the measuring system and hybridized with the target nucleic acid. The method can be performed by a conventional known method (Analytical Biochemistry, Volume 183,
231-244, 1989; Nature Biotechnology, Volume 14,
303-308, 1996; Applied and Environmental Mi
crobiology, 63, 1143-1147, 1997). For example, the hybridization conditions include a salt concentration of 0 to 2
The molar concentration is preferably 0.1 to 1.0, and the pH is 6 to 8, preferably 6.5 to 7.5.

The reaction temperature is preferably within the range of Tm value ± 10 ° C. of the hybrid complex obtained by hybridizing the nucleic acid probe with the specific site of the target nucleic acid. By doing so, non-specific hybridization can be prevented. Tm-10 ° C
When it is less than Tm, non-specific hybridization occurs, and when it exceeds Tm + 10 ° C., hybridization does not occur. The Tm value can be determined in the same manner as the experiment necessary for designing the nucleic acid probe used in the present invention. That is, an oligonucleotide having a complementary base sequence that hybridizes with the nucleic acid probe is chemically synthesized by the above-mentioned nucleic acid synthesizer or the like, and the Tm value of the hybridized product with the nucleic acid probe is measured by a usual method.

The reaction time is 1 second to 180 minutes, preferably 5 seconds to 90 minutes. When the time is less than 1 second, the amount of unreacted nucleic acid probe of the present invention in hybridization increases. Further, there is no particular meaning even if the reaction time is made too long. The reaction time is greatly affected by the nucleic acid species, that is, the length of the nucleic acid or the base sequence. In the present invention, the nucleic acid probe is hybridized with the target nucleic acid as described above.
Then, before and after hybridization, the luminescence amount of the fluorescent dye is measured by a fluorometer and the luminescence decrease amount is calculated. Since the magnitude of the decrease is proportional to the amount of target nucleic acid,
The amount of target nucleic acid can be determined.

Concentration of target nucleic acid in reaction solution: 0.1 to 1
It is preferably 0.0 nM. The concentration of the probe in the reaction solution is preferably 1.0 to 25.0 nM. When creating a calibration curve, 1.
It is desirable to use it in a ratio of 0 to 2.5.

Actually, when measuring an unknown concentration of target nucleic acid in a sample, first, a calibration curve is prepared under the above conditions. Then, the probe is added at a plurality of concentrations, and the decrease in the fluorescence intensity value is measured. Then, the probe concentration that maximizes the measured decrease value of the fluorescence intensity is set as the preferable probe concentration. With the decrease value of the fluorescence intensity measured by the probe having a preferable concentration, the quantitative value of the target nucleic acid is obtained from the calibration curve.

The principle of the nucleic acid measuring method of the present invention is as described above, but various nucleic acid measuring methods such as FISH method, PCR method, LCR method, SD method, competitive hybridization method, TAS method, etc. Applicable to

An example will be described below. a) When applied to the FISH method, that is, the present invention is a mixture of various kinds of microorganisms or other animals or plants, and the cells of a microbial system (complex microbial system, symbiotic microbial system) which cannot be isolated from each other or It can be suitably applied to nucleic acid measurement of cell homogenates and the like. The term "microorganism" as used herein generally refers to a microorganism and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms,
Other examples include mycoplasma, virus, rickettsia, and the like. The nucleic acid having a specific sequence is, for example, a nucleic acid having a nucleotide sequence having specificity for cells of a strain to be investigated for how it is active in these microbial systems. For example, 5 of specific strains
It is a specific sequence of SrRNA, 16SrRNA or 23SrRNA or their gene DNA.

In the present invention, a nucleic acid probe is added to a complex microbial system or a symbiotic microbial system to obtain 5SrRN of a specific strain.
By measuring the amount of A, 16S rRNA or 23S rRNA or their gene DNA, the abundance of the specific strain in the system can be measured. The method of measuring the abundance of a specific strain by adding the nucleic acid probe to a homogenate of a complex microbial system or a symbiotic microbial system and measuring the amount of decrease in the emission of a fluorescent dye before and after hybridization is also a technique of the present invention. Within the target range.

The above measuring method is, for example, as follows.
is there. That is, before adding the nucleic acid probe,
The temperature, salt concentration, and pH of the system or symbiotic microbial system under the above conditions
Adjust to. Features in complex or symbiotic microbial systems
The number of fixed strains is 10 ⁷-10¹²Pieces / ml, preferred
It is 10⁹-10^TenIt is preferable to adjust to
is there. Do it by dilution or concentration by centrifugation etc.
be able to. 10 cells⁷When less than / ml
Fluorescence intensity is weak and measurement error is large. 10¹²Pieces / m
When it exceeds 1, the complex or symbiotic microbial firefly
Since the light intensity is too strong, the abundance of specific microorganisms can be quantitatively determined.
It becomes impossible to measure.

The concentration of the nucleic acid probe to be added depends on the cell number of the specific strain in the complex microbial system or the symbiotic microbial system. Cell count of 1 × 10 ⁸ / ml 0.1-10.
The concentration is 0 nM, preferably 0.5 to 5 nM, more preferably 1.0 nM. If it is less than 0.1 nM, the data will not accurately reflect the abundance of the specific microorganism. However, the optimum amount of the nucleic acid probe cannot be generally determined because it depends on the amount of the target nucleic acid in the cell.

Next, in the present invention, the nucleic acid probe and 5SrRNA, 16SrRNA or 23S of a specific strain are used.
The reaction temperature for hybridization with rRNA or its gene DNA is the same as the above-mentioned conditions. The reaction time is also the same as the above conditions.
Under the above conditions, the nucleic acid probe was used for the 5SrR of the specific strain.
It is hybridized with NA, 16S rRNA or 23S rRNA or its gene DNA, and the decrease in the emission of the fluorescent dye of the complex microbial system or the symbiotic microbial system before and after the hybridization is measured.

The amount of decrease in the luminescence of the fluorescent dye measured as described above is proportional to the amount of the specific strain present in the complex microbial system or the symbiotic microbial system. It is 5S rRNA, 1
This is because the amount of 6SrRNA or 23SrRNA or their gene DNA is proportional to the existing amount of the specific strain.

In the present invention, the components other than the microorganisms in the complex microbial system or the symbiotic microbial system are the same as long as they do not inhibit the hybridization of the nucleic acid probe of the present invention with 5SrRNA, 16SrRNA or 23SrRNA of the specific strain or their gene DNA. Further, it is not particularly limited as long as it does not inhibit the emission of the fluorescent dye of the nucleic acid probe. For example, KH ₂ PO ₄ , K ₂ HPO ₄ , NaH ₂ PO ₄ , Na ₂ HPO ₄
Phosphates such as ammonium sulfate, ammonium nitrate, inorganic nitrogen such as urea, various salts of metal ions such as magnesium, sodium, potassium and calcium ions, sulfates of trace metal ions such as manganese, zinc, iron and cobalt ions, Various salts such as hydrochloride and carbonate, and vitamins may be appropriately contained. If the above inhibition is observed, cells may be separated from a bacterial system in which a plurality of microorganisms are mixed by an operation such as centrifugation, and suspended again in a buffer system or the like.

As the above-mentioned buffer solution, various buffer solutions such as phosphate buffer solution, carbonate buffer solution, Tris / hydrochloric acid buffer solution, Tris / glycine buffer solution, citrate buffer solution and Good's buffer solution can be used. . The concentration of the buffer solution is a concentration that does not inhibit the hybridization, the FRET phenomenon, and the emission of the fluorescent dye. Its concentration depends on the type of buffer. The pH of the buffer solution is 4-12, preferably 5-9.

B) When applied to PCR methods Although any method can be applied as long as it is a PCR method, the case where it is applied to a real-time quantitative PCR method is described below. That is, in a real-time quantitative PCR method, a PC using the specific nucleic acid probe of the present invention is used.
R is performed and the decrease in the emission of the fluorescent dye before and after the reaction is measured in real time. The PCR of the present invention means PCR of various methods. For example, RT-PC
R, RNA-primed PCR, Stretch PCR, reverse PC
It also includes PCR using R and Alu sequences, multiplex PCR, PCR using mixed primers, PCR method using PNA, and the like. The term “quantitative” means not only the original quantitative measurement but also quantitative measurement of the degree of detection.

As described above, the target nucleic acid refers to a nucleic acid whose amount is quantitatively or quantitatively detected or simply detected. With or without purification. Further, the size of the concentration does not matter. Various nucleic acids may be mixed. For example,
Complex microbial system (RNA or gene DN of multiple microorganisms
A mixed system) or symbiotic microbial system (mixed system of RNA or gene DNA of a plurality of animals and plants and / or a plurality of microorganisms)
The specific nucleic acid for the purpose of amplification in. When the target nucleic acid needs to be purified, it can be performed by a conventionally known method.
For example, a commercially available purification kit or the like can be used.

The conventionally known quantitative PCR method is dATP,
In the presence of Mg ion using dGTP, dCTP, dTTP or dUTP, target nucleic acid (DNA or RNA), Taq polymerase, a primer, and a nucleic acid probe or intercalator labeled with a fluorescent dye,
The target nucleic acid is amplified while the temperature is repeated at low temperature and high temperature, and the increase in the emission of the fluorescent dye during the amplification process is monitored in real time (Jikken Igaku, Vol. 15, No. 7, 4).
6-51 pages, 1997, Yodosha).

The quantitative PCR method of the present invention is characterized by amplifying a target nucleic acid using the nucleic acid probe of the present invention, and measuring the amount of decrease in luminescence of a fluorescent dye in the amplification process. In the quantitative PCR of the present invention, the preferred probe of the present invention has a base number of 5 to 50.
And preferably 10 to 25, particularly preferably 15 to
At 20, any substance that hybridizes with the amplification product of the target nucleic acid during the PCR cycle may be used. Further, it may be designed as either a forward type or a reverse type.

For example, the following can be mentioned. (1) When the 5'end portion, preferably the 5'end, is labeled with a fluorescent dye useful in the practice of the present invention and hybridizes with the target nucleic acid at the end portion, the probe and the target nucleic acid hybridize. The base sequence is designed so that at least 1 base or more of G (guanine) is present in the base sequence of the target nucleic acid, apart from 1 to 3 bases 5'side from the base portion at the 5'end. (2) Among the probes of (1) above, a probe having a 3 ′ end labeled with a fluorescent dye.

(3) In the probe of the above (1), the 3'-terminal, for example, the 3'-terminal C or OH group of 3'-position of ribose or deoxyribose is modified with a phosphate group, or A OH group at the 2'-position C of ribose at the 3'-end is modified with a phosphate group or the like. (4) A 3'terminal, preferably a 3'terminal, is labeled with the fluorescent dye of the present invention, and the base at the 3'terminal is G or C, or the OH group at the 2'position of ribose at the 3'terminal Is modified with a phosphate group, etc. (5) The probe of (1) above, wherein the 5'end portion, preferably the 5'end, is labeled with the fluorescent dye of the present invention. (6) The 5'end, preferably the 5'end, is labeled with a fluorescent dye useful in the practice of the present invention, and the 5'end base is G or C.

In the cases of (4) and (6) above, if the 5'end cannot be designed to be G or C from the base sequence of the target nucleic acid, 5 of the oligonucleotide which is the primer designed from the base sequence of the target nucleic acid is used. Even if 5'-guanylic acid or 5'-cytidylic acid is added to the'terminal, the object of the present invention can be suitably achieved. Therefore, in the present invention,
A nucleic acid probe designed such that the base at the 3'or 5'end is G or C includes, in addition to the probe designed from the base sequence of the target nucleic acid, 5'at the 3'or 5'end of the probe. -Guanylic acid or 5'-cytidylic acid is defined as being included in the probe.

In particular, the probe of (1), (2), (3) or (4) above is designed so as not to be used as a primer. Instead of the two probes (labeled with fluorescent dye) used in the real-time quantitative PCR method using the FRET phenomenon, PCR is performed using one probe of the present invention. The probe is added to the reaction system of PCR and PCR is performed. During the nucleic acid extension reaction, the probe that was hybridized to the target nucleic acid or the amplified target nucleic acid is decomposed by a polymerase,
It is decomposed and removed from the hybridized product. At this time, the fluorescence intensity value of the reaction system or the reaction system in which the nucleic acid denaturation reaction is completed is measured. Further, the fluorescence intensity of the reaction system in which the target nucleic acid or the amplified target nucleic acid amplified is hybridized with the probe (reaction system during the annealing reaction or the nucleic acid extension reaction until the probe is removed from the hybridized product by the polymerase) Measure the value. Then, the amplified nucleic acid is measured by calculating the reduction rate of the fluorescence intensity value from the former. Fluorescence intensity when the probe is completely dissociated from the target nucleic acid or the amplified target nucleic acid by a nucleic acid denaturation reaction, or when the probe is decomposed and removed from the hybridized product of the probe and the target nucleic acid or the amplified target nucleic acid by a polymerase during nucleic acid extension. The value is large. However, the probe is sufficiently hybridized with the target nucleic acid or the amplified target nucleic acid. A reaction system in which the annealing reaction is completed or a hybridization product of the probe with the target nucleic acid or the amplified target nucleic acid by a polymerase during the nucleic acid extension reaction is used. The fluorescence intensity value of the reaction system before decomposition and removal is smaller than that of the former. The decrease in fluorescence intensity value is proportional to the amount of amplified nucleic acid. In this case, the Tm of the hybridization product when the probe hybridizes with the target nucleic acid is within ± 15 ° C., preferably ± 5 ° C. of the Tm value of the hybridization product of the primer, (2) It is desirable that the nucleotide sequences of the probes of (3) and (4) are designed. When the Tm value of the probe is less than the Tm value of the primer −5 ° C., especially −15 ° C., the probe does not hybridize, and therefore the emission of the fluorescent dye does not decrease. On the contrary, the Tm of the primer
Above a value of + 5 ° C, especially + 15 ° C, the probe will hybridize to undesired target nucleic acids,
The specificity of the probe is lost.

The probes of (5) and (6) above are added as primers to the PCR reaction system. Other than the present invention, a PCR method using a primer labeled with a fluorescent dye has not been known yet. As the PCR reaction proceeds, the amplified nucleic acid is labeled with the fluorescent dye of the present invention.
Therefore, the fluorescence intensity value of the reaction system in which the nucleic acid denaturation reaction is completed is large, but in the reaction system in which the annealing reaction is completed or during the nucleic acid extension reaction, the fluorescence intensity of the reaction system is smaller than the former fluorescence intensity. .

The PCR reaction can be carried out under the same reaction conditions as in the ordinary PCR method. Therefore, the target nucleic acid can be amplified in a reaction system in which the Mg ion concentration is low (1-2 mM). Of course, the present invention can also be carried out in a reaction system in the presence of a high concentration (2 to 4 mM) of Mg ions used in conventionally known quantitative PCR.

In the PCR method of the present invention, the PCR of the present invention is carried out, and the melting curve of the nucleic acid is analyzed with respect to the amplified product to determine the Tm value. This method is a novel method for analyzing melting curves of nucleic acids. In this method, the nucleic acid probe used in the PCR method of the present invention or the nucleic acid probe used as a primer can be preferably used. In this case, by making the nucleotide sequence of the probe of the present invention complementary to the region containing SNP (snips; single nucleotide substitution polymorphism), a dissociation curve of the nucleic acid of the probe of the present invention can be obtained after completion of PCR. By analysis, SNP can be detected from the difference in the dissociation curves. If a nucleotide sequence complementary to the SNP-containing sequence is used as the probe sequence of the present invention, the Tm value obtained from the dissociation curve between the probe sequence and the SNP-containing sequence shows the dissociation from the SNP-free sequence. It is higher than the Tm value obtained from the curve.

The second feature of the present invention is the invention of a method for analyzing the data obtained by the above real-time quantitative PCR method. The real-time quantitative PCR method is currently a computer-readable recording medium in which a reaction apparatus for performing PCR, a detection apparatus for detecting the emission of a fluorescent dye, a user interface, that is, each procedure of a data analysis method is programmed and recorded. (Also known as: Sequence Det
section software system), and a device that controls them and analyzes the data, and is measured in real time. Therefore, the measurement of the present invention is also performed by such an apparatus.

First, the real-time quantitative PCR will be described below.
The analysis device will be described first. The device used in the present invention may be any device as long as it can monitor PCR in real time. For example, ABI PRISM
^TM 7700 Nucleotide Sequence Detection System (Sequence Detection S
ystem SDS 7700) (Perkin Elmer Applied Biosytems,
USA)), LightCycler ^™ system (Roche Diagnostics KK, Germany) and the like can be mentioned as particularly preferable ones.

The above-mentioned reaction apparatus is an apparatus for repeating the thermal denaturation reaction of the target nucleic acid, the annealing reaction, and the extension reaction of the nucleic acid (for example, the temperature can be repeatedly set to 95 ° C., 60 ° C., 72 ° C.). Is. The detection system is composed of an argon laser for fluorescence excitation, a spectrograph and a CCD camera. Furthermore, a computer-readable recording medium in which each means of the data analysis method is programmed and recorded therein is installed in a computer, controls the above system via the computer, and outputs the data output from the detection system. It is a record of a program for analyzing.

The program for data analysis recorded on a computer-readable recording medium is a process for measuring the fluorescence intensity of each cycle, the measured fluorescence intensity is a function of the cycle, and the amplifcation plot of PCR is displayed on the computer. In the process shown above, the number of PCR cycles at which fluorescence intensity starts to be detected (threshold cyclenum
ber: Ct), the process of preparing a calibration curve for obtaining the copy number of the sample nucleic acid from the Ct value, the data of each process, and the process of printing a plot value. PC
When R progresses exponentially, a linear relationship is established between the Log value of the copy number of the target nucleic acid at the start of PCR and Ct. Therefore, a calibration curve is prepared using a known copy number of the target nucleic acid, and the Ct of the sample containing the unknown copy number of the target nucleic acid is detected to detect PCR of the target nucleic acid.
You can calculate the starting copy number.

The PCR-related invention of the present invention is a method for analyzing the data obtained by the above real-time quantitative PCR method. Each feature will be described below. The first feature is a method for analyzing data obtained by the real-time quantitative PCR method, in which the amplified nucleic acid in each cycle binds to a fluorescent dye, or the amplified nucleic acid is labeled with a fluorescent dye as a nucleic acid probe. Calculation process for correcting the fluorescence intensity value of the reaction system when hybridized by the fluorescence intensity value of the reaction system when the above-mentioned bound one or the hybridized one is dissociated in each cycle, that is, correction This is a calculation process.

The "reaction system when the amplified nucleic acid binds to a fluorescent dye or when the amplified nucleic acid hybridizes with a fluorescent dye-labeled nucleic acid probe" is specifically exemplified by each cycle of PCR. 40 in
A reaction system at the time of nucleic acid extension reaction or annealing having a reaction temperature of 85 ° C., preferably 50 to 80 ° C. can be mentioned. The specific temperature depends on the length of the amplified nucleic acid. Further, "the reaction system when the above-mentioned bound one or the above-mentioned hybridized one is dissociated" means a reaction system for thermal denaturation of nucleic acid in each cycle of PCR, specifically, for example, a reaction temperature of 90 ~ 100 ° C, preferably 94 to 96 ° C.

Any correction calculation process in the correction calculation process may be used as long as it meets the object of the present invention. Specifically, the following [Formula 1] or [Formula 2] is used. It is possible to exemplify the one including the treatment process by. f _n = f _{hyb, n} / f _{den, n} [Equation 1] f _n = f _{den, n} / f _{hyb, n} [Equation 2] [wherein f _n : calculated by [Equation 1] or [Equation 2] Compensated calculation value in n cycles, f _{hyb, n} : _{Reaction in n} cycles when the amplified nucleic acid binds to the fluorescent dye or when the amplified nucleic acid hybridizes with the nucleic acid probe labeled with the fluorescent dye Fluorescence intensity value of the system, f _{den, n} : the above bound at n cycles,
Alternatively, the fluorescence intensity value of the reaction system when the hybridized product is dissociated]. It should be noted that this step includes a step of plotting the correction calculation processing value or the value obtained in this step on a graph for each cycle number and displaying and / or printing on the display of the computer.

The second feature is that the correction calculation processing value by [Equation 1] or [Equation 2] in each cycle is substituted into the following [Equation 3] or [Equation 4], and the fluorescence change ratio between each sample or It is a data analysis method that calculates the rate of change in fluorescence and compares them.

F _n = f _n / f _a [Equation 3] F _n = f _a / f _n [Equation 4] [wherein, F _{n is} calculated by [Equation 3] or [Equation 4] in n cycles. fluorescent change rate or fluorescence change rate, f _n: correction processing value by [equation 1] or [equation 2] f _a: correction processing value by [equation 1] or [equation 2], the change in f _n is Any number of cycles before being observed, but usually 10 to 40 cycles, preferably 15 to 30 cycles, more preferably 20 to 30 cycles are used. It ]. It should be noted that this process includes a process of plotting the calculated value, the comparison value or the value obtained in this process on a graph for each cycle number, and displaying and / or printing on the display of the computer. The correction calculation processing value according to [Equation 1] or [Equation 2] may or may not include those processes.

The third characteristic is: 31) Using the fluorescence change rate or the fluorescence change rate data calculated by [Equation 3] or [Equation 4],
Process of arithmetic processing by [Equation 5], [Equation 6] or [Equation 7], log _b (F _n ), ln (F _n ) [Equation 5] log _b {(1-F _n ) × A}, ln _{{(1-F n) ×} b} [equation 6] _{log b {(F n -1)} × A}, ln {(F n -1) × A} [equation 7]

[Wherein A and b are arbitrary numerical values, preferably integer values, and more preferably natural numbers. Then, when A = 100 and b = 10, {(F _n −1) × A} represents a percentage (%). F _n : Fluorescence change rate or fluorescence change rate in n cycles calculated by [Equation 3] or [Equation 4], 32) An arithmetic processing step of obtaining the number of cycles at which the arithmetic processing value of 31) reaches a constant value 33) A calculation process for calculating the relational expression between the cycle number of a nucleic acid sample of known concentration and the copy number of the target nucleic acid at the start of the reaction, 34) A calculation process for obtaining the copy number of the target nucleic acid at the start of PCR in the unknown sample And a data analysis method including. Then, a process of 31) → 32) → 33) → 34) is preferable.

In each of the steps 31) to 33),
It may include a step of plotting the arithmetically processed value obtained in each step or the value for each cycle number on a graph and displaying and / or printing on a display of a computer. The calculation process value in the process of 34) is the same as that described above, but includes the process because it needs to be printed at least. The correction calculation processing value by [Equation 1] or [Equation 2] and the calculation processing value by [Equation 3] or [Equation 4] are plotted on a graph for each cycle number and displayed on a computer display. And / or they may or may not be printed, so these steps may be added as needed.

The above-mentioned data analysis method is particularly effective when the real-time quantitative PCR method measures the amount of decrease in the emission of the fluorescent dye. A specific example thereof is the above-mentioned real-time quantitative PCR method of the present invention.

The fourth characteristic is real-time quantitative PCR.
In the analyzer described above, the apparatus for measuring and / or analyzing real-time quantitative PCR having a calculation and storage means for executing the data analysis method for the real-time quantitative PCR method of the present invention.

The fifth feature is real-time quantitative PCR.
To program each means of the data analysis method for analyzing PCR using the analysis device described above, and to cause a computer to execute each means of the data analysis method of the present invention in a computer-readable recording medium recording the program. It is a computer-readable recording medium in which a program for enabling the above is recorded.

The sixth feature is that in the method for measuring nucleic acid, the data analysis method, measurement and / or analysis device of the present invention,
It is a novel method for measuring nucleic acid using a recording medium.

The seventh feature is a method for analyzing data obtained by the above-mentioned method for analyzing a melting curve of a nucleic acid of the present invention, that is, a method for obtaining a Tm value of a nucleic acid by carrying out the PCR method of the present invention. is there. That is, for the nucleic acid amplified by the PCR method of the present invention, the process of gradually increasing the temperature from low temperature until the nucleic acid is completely denatured (eg, 50 ° C.).
To 95 ° C.), in this process, a process of measuring the fluorescence intensity at short time intervals (for example, 0.2 ° C. to 0.5 ° C. intervals), a process of displaying the measurement results on the display every hour, that is, The process of displaying the melting curve of nucleic acid, the process of first-order differentiation of this melting curve, and its value (-dF / dT, F:
This is an analysis method including a process of displaying fluorescence intensity, T: time) as a differential value on a display, and a process of obtaining an inflection point from the differential value. In the present invention, the fluorescence intensity increases as the temperature rises. In the present invention, during the nucleic acid extension reaction in each cycle, preferably by adding to the above process a process of dividing the fluorescence intensity value at the end of the PCR reaction using the fluorescence intensity value of the thermal denaturation reaction, More favorable results are obtained.

In the present invention, the method for analyzing the melting curve of the nucleic acid of the present invention is added to the above-described data analysis method of the novel PCR method of the present invention, and the real-time quantitative PCR measurement of the present invention and The analysis device is also within the technical scope of the present invention.

Further, one of the features of the present invention is a computer-readable recording medium having a program recorded thereon, which allows a computer to execute each means of the method for analyzing a melting curve of a nucleic acid of the present invention. Further, the melting curve of the nucleic acid of the present invention is analyzed in a computer-readable recording medium having a program recorded thereon, which allows a computer to execute each means of the data analysis method of the PCR method of the present invention. It is a computer-readable recording medium additionally recorded with a program that allows a computer to execute each means of the method.

The data analysis method, apparatus, and recording medium of the present invention are used in various fields such as medicine, forensics, anthropology, ancient biology, biology, genetic engineering, molecular biology, agriculture, and plant breeding. Available at. Further, it is referred to as a complex microbial system or a symbiotic microbial system, and can be suitably used for microbial systems in which various kinds of microorganisms or other animals and plants are mixed and cannot be isolated from each other. The microorganism referred to here is a microorganism generally referred to and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms, other mycoplasma,
A virus, a rickettsia, etc. can be mentioned.

By using the data analysis method, apparatus and recording medium of the present invention, the copy number of 5SrRNA, 16SrRNA or 23SrRNA of a specific strain or a gene DNA thereof in a complex microbial system or a symbiotic microbial system can be quantified. The abundance of the specific strain in the system can be measured. It ’s 5S rRNA,
16S rRNA or 23S rRNA gene DNA
This is because the copy number of is constant depending on the strain. In the present invention, a real-time quantitative PCR of the present invention is performed using a homogenate of a complex microbial system or a symbiotic microbial system.
The method for measuring the abundance of the specific strain is also within the technical scope of the present invention.

[0087]

EXAMPLES Next, the present invention will be described more specifically with reference to Examples and Comparative Examples. Example 1 Hybridization to the nucleobase sequence of 16S rRNA of Escherichia coli, that is, (3 ') CCGC
A nucleic acid probe having the base sequence of TCACGCATC (5 ') was prepared as follows.

Preparation of nucleic acid probe : (3 ') CCGCTCACGCATC
The 3'-position OH group of a carbon deoxyribose at the 3 'terminus of the deoxyribooligonucleotide with a nucleotide sequence of (5)', - those linked to (CH _{2) 7} -NH _2, Medorando-Sateifaido - Resin Company (Mi
Purchased from dland Certified Reagent Company, USA). In addition, Molecular Probes
Company's Fluo Reporter Kit
s) F-6082 (BODIPY FL propionic acid succinimidyl
In addition to (esters), a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit was allowed to act on the purchased oligonucleotide to synthesize the Bodepee FL-labeled nucleic acid probe used in the present invention.

Purification of synthetic product : The obtained synthetic product was dried to obtain a dried product. 0.5M NaHCO ₃ / Na ₂ CO
_It was dissolved in ₃ buffer solutions (pH 9.0). NA of the lysate
Gel filtration was performed using a P-25 column (Pharmacia) to remove unreacted substances. In addition, reverse-phase HPLC (B gradient:
15 to 65% for 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The collected fractions were lyophilized to obtain a nucleic acid probe in a yield of 23% from the initial oligonucleotide raw material of 2 mM.

The conditions of the above reverse phase chromatography are as follows: Elution solvent A: 0.05N TEAA 5% CH ₃ CN Elution solvent B (for gradient): 0.
05NTEA 40% CH ₃ CN column: CAPCEL PAK C18; 6 × 250 mm Elution rate: 1.0 ml / min Temperature: 40 ° C. Detection: 254 nm

Example 2 Sterilized Nutrient Broth (NB) (manufactured by Difco) 50 ml of liquid medium (composition: NB, 0.08 g / 10)
E. coli JM109 strain was shake-cultured overnight at 37 ° C. using a 200 ml Erlenmeyer flask containing 0 ml).
Next, an equivalent amount of 99.7% ethanol was added to the main culture solution. 2 ml of this ethanol-added culture broth was centrifuged in an Eppendorf centrifuge tube having a volume of 2.0 ml to obtain bacterial cells. 30 mM phosphate buffer (soda salt) (pH: 7.
2) The cells were washed once with 100 μl. 130m of fungus body
The suspension was suspended in 100 μl of the phosphate buffer containing M NaCl. The suspension was sonicated in ice for 40 minutes (output: 33 w, oscillation frequency: 20 kHz, oscillation method: 0.5
Second oscillation, rest for 0.5 seconds) to prepare a homogenate.

After centrifuging the homogenate, the supernatant was collected and transferred to the cell of a fluorometer. It was thermostated at 36 ° C. A solution of the nucleic acid probe preheated to 36 ° C. was added thereto so that the final concentration was 5 nM. Three
E. coli 16S rRNA was hybridized with the nucleic acid probe for 90 minutes while controlling the temperature at 6 ° C. Then, the amount of emission of the fluorescent dye was measured with a fluorometer.

The amount of luminescence of the fluorescent dye before hybridization was 130 mM NaCl instead of the above supernatant.
Containing 30 mM phosphate buffer (soda salt) (pH:
The value measured using 7.2) was adopted. The luminescence amount was measured by changing the ratio between the amount of the nucleic acid probe and the amount of the supernatant (excitation light 503 nm; measured fluorescence color 512 nm). The results are shown in Fig. 1. As can be seen from FIG. 1, the emission of the fluorescent dye decreases as the amount ratio of the supernatant increases. That is, in the present invention, it can be seen that the amount of decrease in emission of the fluorescent dye increases in proportion to the amount of target nucleic acid that hybridizes to the nucleic acid probe.

Example 3 Preparation of nucleic acid probe: E. coli JM109 strain 23SrR
(5 ') CCCACATCGTTTTG which hybridizes to NA
5'of the oligonucleotide having the nucleotide sequence of TCTGGG (3 ')
The 3'-position OH group of a carbon terminal nucleotide, - (CH _{2)
As in} Example 1, the product to which _7- NH ₂ was bound was prepared by Medland Certified Resin Company (Mi.
Purchased from dland Certified Reagent Company, USA). Further, as in Example 1, the molecular probe (Mo
lecular Probes) from Floo Reporter Kit (Fl
uoReporter Kit) F-6082 (BODIPY FL propionic acid su
In addition to the ccinimidyl ester), a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe labeled with Bodpee FL. The obtained synthetic product was purified in the same manner as in Example 1 to obtain a nucleic acid probe labeled with Bodepee FL at a yield of 25% from the initial oligonucleotide raw material of 2 mM.

Example 4 Pseudomonas puusimovirus strain 421Y (Pseudomonas paucucimobi) prepared from the Escherichia coli JM109 strain cell obtained in Example 2 under the same medium and culture conditions as in Example 2
lis) (present name: Sphingomonas puusimovirs)
(FERM P-5122) with E. coli JM1 with OD660 value
09 strains were mixed at the same concentration to prepare a complex microbial system. The obtained mixed solution (the bacterial cell concentration of Escherichia coli JM109 was determined in Example 2
A homogenate was prepared by the same method as in Example 2. Using the nucleic acid probe prepared in Example 3, excitation light was 543 nm and measurement fluorescence color was 569 n.
As a result of conducting the same experiment as in Example 2 except that m is set,
The same result as in Example 2 was obtained.

Example 5 The base selectivity of the target nucleic acid in the fluorescence quenching phenomenon, that is, the base specificity of the present invention was examined. Ten kinds of poly a to j of the target synthetic deoxyribooligonucleotide (30 mer) shown below were prepared with a DNA synthesizer ABI394 (Perkin Elmer, USA).

Furthermore, a probe of the present invention shown below was prepared by labeling the deoxyribooligonucleotide corresponding to the above synthetic DNA with Bodpy FL at the 5'end. A primer DNA corresponding to the above synthetic DNA having-(CH ₂ ) ₆ -NH ₂ bound to the 5'-terminal phosphate group was prepared by Medland Certified Reagent Company, USA. ) Purchased from. In addition, the molecular probe (Molecular Prob
es) from FluoReporter K (FluoReporter K
its) F-6082 (BODIPY FL propionic acid succini
In addition to dyl esters), a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit was allowed to act on the purchased primer DNA to synthesize the probes a to d and f to h of the present invention labeled with the following Bodpee FL. Then, how much the emission of the fluorescent dye was reduced when hybridized with the corresponding synthetic deoxyribooligonucleotide was examined under the following conditions to examine the specificity of the probe of the present invention.

[0098]

[0099]

[0100]

[0101]

(1) Components of Hybridization Solution Synthetic DNA 320 nM (final concentration) Nucleic acid probe 80 nM (final concentration) NaCl 50 mM (final concentration) MgCl ₂ 1 mM (final concentration) Tris-hydrochloric acid buffer solution (pH = 7.2) 100 mM (final concentration) MilliQ pure water 1.6992 ml Final total amount 2.0000 ml (2) Hybridization temperature: 51 ° C. (3) Measurement conditions: Excitation light: 543 nm Measurement fluorescence color: 569 nm

[0103]

[Table 1]

The results are shown in Table 1. As can be seen from Table 1, the nucleic acid probe labeled with the fluorescent dye is the target DN.
When hybridized to A (deoxyribooligonucleotide), G (guanine) is present in the base sequence of the target DNA at a distance of 1 to 3 bases from the terminal base portion where the probe and target DNA hybridized at the end portion. It indicates that it is preferable that the base sequence of the probe is designed so that at least one base is present. In addition, when the nucleic acid probe labeled with a fluorescent dye hybridizes to the target DNA, the base sequence of the probe is such that the base pair of the hybridized product forms at least one pair of G and C at the end portion. It can be seen from Table 1 that it is preferable that

Example 6 A target nucleic acid having the following nucleotide sequence and a nucleic acid probe of the present invention were prepared. The influence of the numbers of G in the target nucleic acid and G in the nucleic acid probe of the present invention was examined in the same manner as in the above-mentioned Examples.

[0106]

[0107]

[0108]

[0109]

[0110]

[Table 2]

As can be seen from Table 2, it is recognized that the number of G's in the target nucleic acid and the number of G's in the probe of the present invention do not significantly affect the decrease in fluorescence intensity.

Example 7 A target nucleic acid having the following base sequence and a nucleic acid probe of the present invention were prepared. The influence of the base species in the target nucleic acid and the base species in the nucleic acid probe of the present invention was examined in the same manner as in the above-mentioned Examples.

[0113]

[0114]

[0115]

[Table 3]

As can be seen from Table 3 and the examples above,
(i) The end of the probe of the present invention labeled with a fluorescent dye is C
And (ii) is labeled with a fluorescent dye when the target nucleic acid is hybridized and forms a GC pair, when the end of the probe of the present invention is composed of a base other than C, it is labeled with a fluorescent dye. It can be seen that the decrease rate of fluorescence intensity is large when at least one G is present at the 3′-end side of the target nucleic acid, based on the base pair of the base at the position where the target nucleic acid exists and the base of the target nucleic acid.

Example 8 Regarding the kinds of dyes labeled on the nucleic acid probe of the present invention,
The investigation was conducted in the same manner as in the above-mentioned example. The probe of the present invention was the probe z of Example 7, and the target nucleic acid was the oligonucleotide z of Example 7. The results are shown in Table 4. As can be seen from the table, suitable fluorescent dyes for use in the present invention are FITC, BODIPY FL,
BODIPY FL / C3, 6-joe, TMR, etc. can be mentioned.

[0118]

[Table 4]

Example 9 Preparation of nucleic acid probe: E. coli JM109 strain 16SrR
It hybridizes specifically with the 16S rRNA base sequence of the KYM-7 strain corresponding to the base sequence from the 1156th base to the 1190th base of NA (5 ′) CAT CCC CAC CTT CC
It has a base sequence of T CCC AGT TGACCC CGG CAG TC (3 ') (35 base pairs). A ribooligonucleotide modified with a group, and the OH group of the phosphate group at the 5 ′ end modified with — (CH ₂ ) ₇ —NN ₂ was bonded to・ Resinto Company (Midl
and Certified Reagent Company, USA). Further, as in Example 1, the molecular probe (Mole
Fluo Reporter Kit (Fluo
Reporter Kits) F-6082 (Bodepy FL / C6 propioic acid succinimidyl ester of propionate
nic acid succinimidyl ester), and a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe labeled with Bodpee FL / C6. The obtained synthesized product was purified in the same manner as in Example 1 to obtain a nucleic acid probe labeled with Bodepee FL / C6 in a yield of 23% from the initial oligonucleotide raw material of 2 mM. This probe was named 35-base chain 2-O-Me probe.

(5 ') AGG CCG GCC CTT GAC TTT CCT
A riboxy oligonucleotide having the nucleotide sequence of (3 ′) was synthesized using a DNA synthesizer in the same manner as described above to obtain a forward type helper probe. On the other hand, (5 ') AUG GGA GUUCAG UAG UAC CCG CAA U
A riboxy oligonucleotide having the nucleotide sequence of GC UGG UCC (3 ') was synthesized using a DNA synthesizer in the same manner as described above to give a backward type helper probe.

The above 16S rRNA was heat-treated at 95 ° C. for 5 minutes and then added to the probe solution under the reaction conditions shown below.
The fluorescence intensity was measured with Elmer) LS-50B. The results are shown in Fig. 2. The 16S rRNA not subjected to the above heat treatment
Was used as a control. It can be seen from FIG. 2 that the decrease in fluorescence intensity is large in the heat-treated experimental section. This result indicates that heat treatment of 16S rRNA at 95 ° C. results in stronger hybridization with the probe of the present invention. Reaction conditions: 16S rRNA: 10.0 nM Probe: 25 nM Buffer: 100 mM succinic acid, 125 mM lithium hydroxide, 8.5% lithium dodecyl sulfite, pH 5.1 Temperature: 70 ° C

Example 10 (Influence of Helper Probe on Hybridization Efficiency) The following probes of the present invention and helper probes that hybridize to the above 16S rRNA were prepared in the same manner as above. Then, under the following conditions, 2'of the present invention
The effect of the -O-Me probe, the effect of the base chain length of the probe, and the effect of the helper probe were examined.
The results are shown in A, B, C and D of FIG. From the figure, it can be seen that the 2'-O-Me probe of the present invention contributes to the hybridization efficiency. In addition, when the base chain of the 2'-O-Me probe is short, the helper probe helps to improve the hybridization efficiency.

1) The same 35-base 2'-O-Me probe as described above, 2) The same base sequence as the same 35-base 2'-O-Me probe as described in 1) above, except that the oligonucleotide is a deoxyribonucleotide. Constituted probe (35 base DN
A probe), 3) has the same nucleotide sequence as the 35-base 2-O-Me probe of 1) above, except for 8 bases from the 5'end and 10 from the 3'end.
A probe with 17 nucleotides deleted
2-O-Me probe), 4) a probe having the same nucleotide sequence as the 33-base-chain DNA probe of 2) above, but with 16 nucleotides deleted from the 3'end (17-base-chain DNA probe),

5) Helper probe obtained by modifying the OH group for the central 8 bases of the Howard type helper probe with a methyl group (Fard type 2-O-Me helper probe) 6) For the central 8 bases of the reverse type helper probe Helper probe in which an OH group is modified with a methyl group (reverse type 2-O-Me helper probe) 7) A helper having the same base sequence as the forward type helper probe, but the oligonucleotide is composed of deoxynucleotides Probe (Fader-type DNA helper probe) 8) Helper probe (reverse-type DNA helper probe) 9) (5 ') having the same base sequence as the reverse-type helper probe but composed of deoxyribonucleotides Ribo-oligonucleotide having a base sequence of GUGACGGUCACUAUUUGACCUCCUUCCACCCC (3 ') (35 bases ribooligonucleotide), 10) (5 ') GUGACGGUCACUAUUUG (3') consisting ribooligonucleotide (17 bases stranded ribonucleic oligonucleotide having a nucleotide sequence),

[0125]     Reaction conditions:       16S rRNA: 10nM       Probe: 25nM       Helper probe: 1 μM       Buffer: 100 mM succinic acid, 125 mM lithium hydroxide,                         8.5% lithium dodecyl sulfite, pH 5.1       temperature:         ・ When using a 35-base chain ribooligonucleotide 2-O-Me probe:           70 ° C         ・ 17-base chain ribooligonucleotide 2-O-Me probe or           33-base chain ribooligonucleotide DNA probe: 65 ° C         ・ 17-base chain ribooligonucleotide DNA probe: 50 ° C

Example 11 (Preparation of calibration curve for rRNA measurement) The above-mentioned rRNA in the range of 0.1 to 10 nM was heated at 95 ° C. for 5 minutes and then added to a reaction solution previously subjected to the following reaction conditions,
After 1000 seconds, decrease the fluorescence intensity with Perkin Elmer LS-5
Measured using 0B. The results are shown in Fig. 4. From the figure, it can be seen that the calibration curve shows linearity at 0.1 to 10 nM. Reaction conditions: 33 base chain ribooligonucleotide 2-O-Me probe: 1.0 to 25 nM buffer: 100 mM succinic acid, 125 mM lithium hydroxide, 8.5% lithium dodecyl sulfite, pH 5.1 temperature: 70 ° C

Example 12 (FISH method) Cellulomonas sp. KYM-7 (FERM P-1680
6) and Agrobacterium sp. KYM-
The probe of the present invention which hybridizes to each rRNA of 8 (FERM P-11358) 35-36 base chain deoxyoligonucleotide 2-O-Me probe was prepared in the same manner as above. The base sequence of each probe is as follows.

35 base chain deoxyoligonucleotide 2-O-for rRNA measurement of Cellulomonas sp. KYM-7
Me probe: (5 ') CAT CCC CAC CTT CCT C CG AGT TGA
CCC CGG CAG TC (3 ') (underlined part is modified with methyl group). Agrobacterium sp.KYM-8
(FERM P-11358) 36-base deoxyoligonucleotide 2-O-Me probe for rRNA measurement: (5 ') CA
T CCC CAC CTT CCT C TC GGC TTA T CA CCG GCA GTC (3 ')
(The underlined portion is modified with a methyl group.).

Cellulomonas sp. KYM-7 and Agrobacterium sp. KYM-8 were mixed and cultivated with the following medium composition under the following culturing conditions, and the cultures were collected at each culturing time. From them, rRNA was prepared using RNeasy Maxikit (QIAGENE). The rRNA was heated at 95 ° C. for 5 minutes, added to a reaction solution that had been subjected to reaction conditions in advance, reacted at 70 ° C. for 1000 seconds, and fluorescence intensity was measured using Perkin Elmer LS-50B. The results are shown in Fig. 5. All r
RNA was measured using RiboGreen RNA Kit (company name: molecular probes, location name: Eugene, Oregon, USA). As can be seen from the figure, the kinetics of rRNA of each strain was consistent with the kinetics of total rRNA. In addition, the total amount of rRNA of each strain was consistent with the total rRNA. This indicates that the method of the present invention is an effective method in the FISH method.

[0130] Medium Composition (g / l): starch, 10.0; aspartic _{acid, 0.1; K 2 HPO 4,} 5.0; KH 2 PO 4, 2.0; MgSO 4 · 7
H ₂ O, 0.2; NaCl, 0.1; (NH ₄ ) ₂ SO ₄ ; 0.1. 100 ml of medium
Was dispensed into a 500 ml conical flask, and the flask was sterilized at 120 ° C. for 10 minutes using an autoclave kettle.

Culture conditions: The above strains were pre-cultured on a slant medium. Cells of 1 platinum loop were taken from the slant medium and inoculated into the sterilized conical flask. 30 ° C, 150
The culture was carried out with stirring at rpm.

[0132] Reaction conditions:   33 base chain deoxyoligonucleotide 2-O-Me probe: 1.0 to 10 nM   Buffer: 100 mM succinic acid, 125 mM lithium hydroxide,                 8.5% lithium dodecyl sulfite, pH 5.1   Temperature: 70 ℃

Example 13 below describes a method for analyzing or measuring polymorphisms and mutations in target nucleic acids or genes. Example 13 Four kinds of oligonucleotides having the nucleotide sequences shown below were synthesized using the DNA synthesizer of Example 5 described above. Further, in the same manner as in Example 5, the nucleic acid probe of the present invention having the following base sequence was synthesized. After the probe and each oligonucleotide were hybridized in a solution, it was examined whether or not single base substitution could be evaluated from the change in fluorescence intensity. The nucleotide sequence of the nucleic acid probe of the present invention,
It is designed to match 100% when there is a G at the 3'end of the target oligonucleotide. The hybridization temperature was set to 40 ° C. at which 100% of all base-pairs of the probe and the target oligonucleotide can hybridize. The concentration of the probe and the target oligonucleotide, the concentration of the buffer solution, the fluorescence measuring device, the fluorescence measuring conditions, the experimental operation, etc. are the same as those in Example 5.

[0134]

The results are shown in Table 5. From the table, the target oligonucleotide No. In 1 to 3, no change in fluorescence intensity was observed, but the target oligonucleotide N
o. 84% reduction was observed in 4.

[0136]

[Table 5]

In the present invention, a method for analyzing data (data in columns A and B in Table 5) obtained by a method for analyzing or measuring polymorphisms and mutations of target nucleic acids or genes (Nos. 1 to 4) In, the fluorescence intensity value of the reaction system when the target nucleic acid or gene is hybridized with a nucleic acid probe labeled with a fluorescent dye (above nucleic acid probe), the fluorescence intensity value of the reaction system when not hybridized Correcting by means the calculation of (AB) / B in Table 3. From the above results, when the target nucleic acid is double-stranded, G → A, G ← A, C → T, C ← T,
It was revealed that the substitution of G → C and G ← C can be detected.

Example 14 FIG. 6 shows a model of the DNA chip of the present invention. First, the probe of the present invention prepared in Example 13, 3′TTTTTT
TTGGGGGGGGC5'BODIPY FL / C6 3'end 3'OH
An amino group is introduced into the slide glass, or a slide glass whose surface is treated with a silane coupling agent having an epoxy group as a reactive group is prepared. A solution containing the above-mentioned probe of the present invention is used as a DNA chip manufacturing apparatus GM.
Spot on the glass slide with S ^™ 417 ARRAYER (TAKARA). The probe of the invention then binds to the glass surface at the 3'end. The slide glass is placed in a closed container for about 4 hours to complete the reaction. Then, the slide glass is alternately immersed twice in a 0.2% SDS solution and water for about 1 minute twice. Further, it is placed in a boron solution (NaBH ₄ 1.0 g dissolved in 300 ml of water) for about 5 minutes. After soaking in water at 95 ° C for 2 minutes, quickly soak the reagent in 0.2% SDS solution and water alternately for about 1 minute twice to wash away the reagent. Dry at room temperature.
Thus, the DNA chip of the present invention is prepared. Further, by providing a minute temperature sensor and a heater as shown in the figure on the lower surface of the glass of each spot, a high performance DNA chip of the present invention can be prepared. A case of measuring a target nucleic acid or gene using this DNA chip will be described. When the target nucleic acid or gene is not hybridized with the probe, or when the hybridization does not form a GC pair at the fluorescent dye-labeled end of the present invention, or the probe is hybridized with the target nucleic acid or gene. When there is at least 1 to 3 bases of G (guanine) in the base sequence of the target nucleic acid or gene, 1 to 3 bases away from the terminal base portion, the fluorescence intensity does not change. However, the fluorescence intensity decreases upon hybridization. This fluorescence intensity is measured by the DNA chip analyzer GMS ^™ 41.
8 It can be measured using an Array Scanner (TAKARA).

Hereinafter, the PCR of the present invention will be described in Examples 15 to 19.
Describe the method. Example 15 Using the 16S rRNA gene in Escherichia coli genomic DNA as a target nucleic acid, (BODIPY FL /
A C6 labeled primer was prepared.

Preparation of primer 1 (Eu800R: reverse type): A deoxyribooligonucleotide having the nucleotide sequence of (5 ') CATCGTTTACGGCGTGGAC (3') was used as a DNA synthesizer ABI394.
(Manufactured by Perkin Elmer, USA), and the phosphate group at the 5'end of the oligodeoxyribonucleotide was treated with phosphatase to give cytosine, and the 5'-position carbon OH group of the cytosine had-(CH ₂ ) _9- NH ₂ conjugate was purchased from Midland Certified Resin Company (USA). In addition, from Molecular Probes, the Fluoro Reporter Kit (FluoReporter
Kits) F-6082 (BODIPY FL propionic acid succinimi
In addition to the dyl ester), a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit was made to act on the purchased oligonucleotide to synthesize the primer 1 labeled with Bodpee FL / C6 of the present invention.

Purification of synthetic product: The synthetic product obtained was dried to obtain a dried product. Add it to 0.5M Na ₂ CO ₃ / NaHCO ₃ buffer (pH
It was dissolved in 9.0). The lysate was subjected to gel filtration with a NAP-25 column (Pharmacia) to remove unreacted substances. Reverse phase HPLC (B gradient: 15-65%, 2
5 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The collected fractions were lyophilized to obtain the primer 1 of the present invention and the first oligonucleotide raw material 2
Obtained in 50% yield from mM.

The conditions of the above reverse phase chromatography are as follows: Elution solvent A: 0.05N TEAA 5% CH ₃ CN Elution solvent B (for gradient): 0.05N TEAA 40% CH ₃ CN column: CAPCEL PAK C ₁₈ ; 6 × 250 mm Elution rate: 1.0 ml / min Temperature: 40 ° C. Detection: 254 nm

Example 16 Preparation of primer 2 (Eu500R / forward: forward type): A fluorescent dye (BODIPY FL / C6) was added to the 5'end of a deoxyribooligonucleotide having the nucleotide sequence of (5 ') CCAGCAGCCGCGGTAATAC (3'). The labeled primer 2 was used in Example 13
Was prepared in a similar manner to the above with a yield of 50%.

Example 17 Escherichia coli JM109 strain was incubated overnight at 37 ° C. in a test tube containing 5 ml of sterilized nutrient broth (NB) (manufactured by Difco) liquid medium (composition: NB, 0.08 g / 100 ml). Cultured with shaking. The culture solution (1.5 ml) was centrifuged with a 1.5 ml capacity centrifuge tube to obtain cells. From this cell, DNeasy Tissue
Genomic DNA was extracted using Kit (Qiagen, Germany). The method followed the protocol of this kit.
As a result, a 17 ng / μl DNA solution was obtained.

Example 18 Using the above-mentioned Escherichia coli genomic DNA, primer 1 and / or primer 2, the LightCycler ^™ system (Ligh) sold by Roche Diagnostics KK
PCR reaction was carried out by a conventional method using the tCycler ^™ System). The operation followed the procedure manual of the system equipment. In the above system, PCR is the present invention instead of the nucleic acid probe (two probes utilizing the FRET phenomenon) described in the procedure manual and a normal primer (a normal primer not labeled with a fluorescent dye). The procedure was performed according to the procedure manual except that the primers 1 and / or 2 were used.

PCR was performed with the following components. E. coli genomic DNA solution 3.5 μl (final concentration 0 to ⁶ ng / 20 μl) (final copy number 0 to 2.4 · 10 ⁶ ) Primer solution 0.8 μl (final concentration 0.08 μM) Taq solution 10.0 μl MilliQ pure Water 5.7 μl Total volume 20.0 μl The target nucleic acid E. coli 16SrDNA was at the concentration of the experimental section shown in the explanation column of FIG. 7, and the primer was
Similarly, the primer 1 and / or of the experimental section shown in the note of FIG.
Or, the experiment was performed with two combinations.

The above Taq solution is a mixed solution of the following reagents. Taq solution 96.0 μl MilliQ pure water 68.2 μl Taq DNA polymerase solution 24.0 μl Taq start 3.8 μl

The Taq solution and the Taq DNA polymerase solution are DN sold by Roche Diagnostics KK
A master hybridization probe (DNA Mast
er Hybridization Probes) kit. Especially Ta
q DNA polymerase solution is 10 x conc. (red cap)
Was diluted 10 times before use. In addition, Taq Start is a Taq DNA sold by Clonetech (USA).
It is an antibody for polymerase, and the activity of Taq DNA polymerase can be suppressed up to 70 ° C. by adding it to the reaction solution. That is, a hot start can be performed.

The reaction conditions are as follows. Denaturation Initial: 95 ° C., 120 seconds Re: 95 ° C., 0 seconds Annealing conditions 57 ° C., 5 seconds Measurements were performed using a LightCycler ^™ system.
At that time, among the detectors of F1 to 3 in the system,
The detector of 1 was used, the gain of the detector was fixed to 10, and the excitation intensity was fixed to 75.

The results are shown in FIGS. 7 and 8. From FIGS. 7 and 8, it can be seen that the cycle number at the time when the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of E. coli 16S rDNA of the target nucleic acid. In the figure, the amount of decrease in the emission of the fluorescent dye is expressed as the decrease value of the fluorescence intensity.
Figure 9 shows E. coli 16SrDN as a function of cycle number.
It is a calibration curve of E. coli 16S rDNA expressing the copy number of A. The correlation coefficient was 0.9973, indicating a very good correlation. As can be seen from the above results, it becomes possible to measure the initial copy number of the target nucleic acid by using the quantitative PCR method of the present invention. That is, the target nucleic acid can be measured.

Example 19 In Example 18, PCR was performed using the probe of the present invention as a primer. In this Example, the probe of the present invention was used instead of the two probes utilizing the FRET phenomenon used in the conventional method. PCR of the present invention was performed under the following conditions. a) Target nucleic acid: 16S-rDNA of E. coli b) Primers used: • Forward primer E8F: (3 ') AGAGTTTGATCCTGGCTC
AG (5 ')-Reverse primer E1492R: GGTTACCTTGTTACGACTT
(5 ') c) Probe used: BODIPY FL- (3') CCTTCCCACATCGTTT
(5 ') d) Using PCR measuring instrument: LightCycler ^TM system e) PCR conditions: denaturation: 95 ° C. for 0 seconds (60 seconds, 95 ° C.) annealing reaction: 50 ° C. for 5 seconds nucleic acid extension reaction: 72 ° C. for 70 seconds Total number of cycles: 70 cycles

F) Fluorescence measurement (measured once after each cycle after annealing reaction and denaturation reaction) g) Composition of reaction solution: Total amount of reaction solution: 20 μl Amount of DNA polymerase (TaKaRa Ex taq): 0.5U Taq start (antibody): 0.3 μl Primer concentration: 0.2 μM (both) Probe concentration: 0.05 μM MgCl ₂ concentration: 2 mM BSA (bovine serum albumin) concentration: 0.25 mg / ml dNTPs concentration: 2.5 mM (each nucleotide about).

The results are shown in FIG. From the figure, it can be seen that the cycle number at the time when the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of E. coli 16SrDNA of the target nucleic acid. As can be seen from the above results, it becomes possible to measure the initial copy number of the target nucleic acid by using the quantitative PCR method of the present invention. That is, the target nucleic acid can be measured.

The data analysis method of the present invention for analyzing the data obtained by using the above-described quantitative PCR method of the present invention will be described in the following examples. Example 20 Human genomic DNA (human β-globin (TaKa
Ra Catalog Item No. 9060) (TaKaRa Corporation)
(Hereinafter, referred to as human genomic DNA) was used as a target nucleic acid to prepare a primer labeled with Bodepee FL / C6 for amplification of the nucleic acid.

Preparation of primer KM38 + C (reverse type):
A deoxyribooligonucleotide having a nucleotide sequence of (5 ') CTGGTCTCCTTAAACCTGTCTTG (3') was added to a DNA synthesizer ABI394.
(Perkin Elmer, USA), and further, the phosphate group at the 5 ′ end of the oligodeoxyribonucleotide was treated with phosphatase to give cytosine, and the 5 ′ carbon OH group of the cytosine was treated with — (CH ₂ ) _9- NH ₂ conjugated was purchased from Midland Certified Resined Company. Further, from Molecular Probes, a reporter kit (FluoReporter Kits) F-6082 (bodepi FL / C6 succinimidyl propionate (BO
DIPY FL propionic acid succinimidylesters),
A kit containing a reagent for coupling the compound to an amine derivative of an oligonucleotide was purchased. The kit was made to act on the purchased oligonucleotide to synthesize the primer KM38 + C labeled with Bodpee FL / C6 of the present invention.

Purification of synthetic product: The obtained synthetic product was dried to obtain a dried product. 0.5M Na ₂ CO ₃ / NaH ₂ CO ₃ buffer solution (pH 9.0)
Dissolved in. The lysate was subjected to gel filtration with a NAP-25 column (Pharmacia) to remove unreacted substances. Furthermore, reverse phase HPLC (B gradient: 15 to 65%, 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The collected fractions were lyophilized to obtain the primer of the present invention KM38 + C.
Was obtained in a yield of 50% from the initial oligonucleotide starting material 2 mM.

The conditions of the above-mentioned reverse phase chromatography are as follows: Elution solvent A: 0.05N TEAA 5% CH ₃ CN Elution solvent B (for gradient): 0.05N TEAA 40% CH ₃ CN column: CAPCEL PAK C18; 6 × 250mm Elution rate: 1.0ml / min Temperature: 40 ℃ Detection: 254nm

Example 21 Preparation of primer KM29 (forward type): (5 ') GGTTGGCC
A deoxyribooligonucleotide having a base sequence of AATCTACTCCCAGG (3 ′) was synthesized in the same manner as in Example 18.

Comparative Experimental Example 1 (Experimental example using data analysis software of the present invention, which does not have an arithmetic processing step of dividing the fluorescence intensity value during the nucleic acid extension reaction by the fluorescence intensity value during the thermal denaturation reaction ). Human genomic DNA and primers described above
Using KM38 + C and primer KM29, a PCR reaction was carried out using a LightCycler ^™ system, and the fluorescence intensity at each cycle was measured. The PCR of this comparative example
Is a novel real-time quantitative PCR method that uses a primer labeled with the above-described fluorescent dye and measures a decrease in fluorescence emission, not an increase in fluorescence emission. The software for data analysis was performed using the system. In the above system, PCR is the primer KM38 of the present invention in place of the nucleic acid probe (two probes utilizing the FRET phenomenon) and the ordinary primer (ordinary primer not labeled with a fluorescent dye) described in the procedure manual. Except for using + C and KM29, the procedure was as instructed for the device.

PCR was performed with the following components. Human genomic DNA 1.0 μl (final concentration 1-10000 copies) Primer solution 4.0 μl (final concentration 0.1 μM) Taq solution 10.0 μl MilliQ pure water 5.0 μl Total volume 20.0 μl Human genomic DNA is shown in the explanation column of FIG. The experiment was conducted at the concentration of the experimental section. The final concentration of MgCl ₂ was 2 mM.

The above Taq solution is a mixed solution of reagents. Taq solution 96.0 μl Milli-Q pure water 68.2 μl Taq DNA polymerase 24.0 μl Taq start 3.8 μl

The Taq solution and the Taq DNA polymerase solution are DN sold by Roche Diagnostics KK
A master hybridization probe (DNA Mast
er Hybridization Probes) kit. In particular, the Taq DNA polymerase solution was used by diluting 10 × conc. (Red cap) 10 times. In addition, Taq Start is Ta sold by Clonetech (USA).
q An antibody for DNA polymerase. By adding this antibody to the reaction solution, the activity of Taq DNA polymerase can be suppressed up to 70 ° C. That is, a hot start can be performed.

The reaction conditions are as follows. Initial denaturation reaction: 95 ° C., 60 seconds Re-denaturation reaction: 95 ° C., 10 seconds Annealing reaction: 60 ° C., 5 seconds DNA extension reaction: 72 ° C., 17 seconds The measurement was performed using a LightCycler ^™ system.
At that time, among the detectors of F1 to 3 in the system,
The detector of 1 was used, the gain of the detector was fixed to 10, and the excitation intensity was fixed to 75.

FIG. 11 shows the results of actually measuring the fluorescence intensity in each cycle by performing PCR as described above. That is, for each copy number of human genomic DNA, fluorescence intensity was measured and printed during denaturation reaction and nucleic acid extension reaction in each cycle. In any cycle, the fluorescence intensity value is constant during the denaturation reaction, but it is 2 during the nucleic acid extension reaction.
It is observed that the fluorescence intensity decreases from around the 5th cycle. Thus, it can be seen that the reductions occur in order of decreasing copy number of human genomic DNA.

In FIG. 11, the fluorescence intensity values at the initial cycle number are not uniform for each copy number of human genomic DNA. Therefore, the following steps were added to the data analysis method used in this experimental example. (B) The process of converting the fluorescence intensity value of each cycle with the fluorescence intensity value of the 10th cycle being 1, that is, the process of calculating by the following [Formula 8], C _n = F _n (72) / F ₁₀ ( 72) [Equation 8] where C _n = converted value of each cycle value, F _n (72) = fluorescence intensity value of 72 ° C. in each cycle, F ₁₀ (72) = fluorescence intensity value of 72 ° C. in the 10th cycle . (C) a step of plotting the converted value obtained in the step (b) for each cycle number and displaying and / or printing on the display,

(D) A step of calculating the rate of change (decrease rate, quenching rate) of the fluorescence intensity according to the following [Equation 9] from the converted value of each cycle obtained in the above step (b), [Equation 9 ] _{F dn = log 10 {100-} C n × 100)} F dn = 2log 10 {1-C n} However, F _dn = change in fluorescence intensity ratio (reduction ratio, extinction ratio), C
_n = value obtained by [Equation 8]. (E) a step of plotting the converted value obtained in the step (d) for each cycle number and displaying and / or printing on a display,

(F) Of the data processed in the step (d), 0.5 is set as a threshold value.
hold) and calculate the number of cycles that has reached the value, (g) create a graph in which the value calculated in the above step (f) is plotted on the X-axis and the copy number before the start of the reaction is plotted on the Y-axis Process, (h) displaying and / or printing the graph created in the process of (g) on a display, (j) calculating the correlation coefficient or relational expression of the straight line drawn in the process of (h) And (i) a step of displaying and / or printing the calculated value or the relational expression calculated in the step (j) on the display.

Using the data analysis software described above, the data obtained in FIG. 11 was processed as follows, following the above. In FIG. 12, the data processed in the above step (b) is printed (step (c) above). That is, the fluorescence intensity value at the 10th cycle was converted as 1, and the converted value was plotted against the number of cycles. In FIG. 13, the data processed in the step (d) is printed (step (e)). That is, the reduction rate (quenching rate) of fluorescence intensity was calculated from each plotted value in FIG. 12, and each calculated value was plotted against each cycle number.

FIG. 14 shows the graph prepared in the step (g) for the data processed in the step (f) (step (h)). That is, the fluorescence intensity decrease rate = 0.5 is the threshold (threshhol
d) and the number of cycles reaching that value is plotted on the X-axis, and the copy number of the human genomic DNA before the reaction is plotted on the Y-axis. The correlation coefficient (R2) of the straight line in this graph was calculated and printed in the process (j) (process (i)), and was 0.9514. Thus, it was impossible to obtain an accurate copy number with this correlation coefficient.

Example 22 (Experimental example in which data processing was performed using the data analysis method of the present invention) PCR was carried out in the same manner as in Comparative Experimental example 1. The data processing was the same as Comparative Experimental Example 1 except that the following process (a) was performed before the process (b) in Comparative Experimental Example 1 and the processes (b) and (d) were changed as follows. The process was similar. (A) The fluorescence intensity value of the reaction system when the amplified nucleic acid in each cycle was hybridized with a nucleic acid primer labeled with a fluorescent dye (that is, the fluorescence intensity value at the nucleic acid extension reaction (72 ° C.)) was amplified. Fluorescence intensity value of reaction system when nucleic acid hybridized with nucleic acid primer is dissociated (that is, fluorescence intensity value during nucleic acid thermal denaturation reaction (95 ° C))
The calculation process of correction by dividing by, that is, the actually measured fluorescence intensity value was corrected by [Formula 1]. f _n = f _{hyb, n} / f _{den, n} [Equation 1] [wherein f _n = correction value of cycle fluorescence intensity, f _{hyb, n} =
The fluorescence intensity value at 72 ° C. in each cycle, f _{den, n} = fluorescence intensity value at 95 ° C. in each cycle] The obtained values are plotted in each cycle number in FIG. 15.

(B) An arithmetic processing step of substituting the corrected arithmetic processing value in [Equation 1] in each cycle into [Equation 3] to calculate the fluorescence change rate (decrease rate or quenching rate) between samples in each cycle. That is, the following [Equation 1
Process of processing with _{0], F n = f n / f} 25 [Equation 10] [wherein, F _n = processing values of each cycle, f _n = [value of each cycle obtained in Equation 1], f ₂₅ = value obtained by [Equation 1] and having the 25th cycle]. [Formula 1
0] is when [a = 25] in [Equation 3].

(D) A step of calculating the logarithmic value of the change rate (decrease rate or quenching rate) of the fluorescence intensity according to [Equation 6] using the calculated value of each cycle obtained in the above step (b).
That is, the process of arithmetic processing by the following [Formula 11], log ₁₀ {(1-F _n ) × 100} [Formula 11] [wherein, F _n = value obtained by [Formula 10]]. [Formula 1
1] is the case where b = 10 and A = 100 in [Equation 6].

The above results are shown in FIGS. FIG. 16 is a graph in which the values processed in the steps (a) and (b) are plotted against the number of cycles and printed.
FIG. 17 is a graph in which the values calculated in the step (d) for the values obtained in FIG. 16 are plotted against the number of cycles,
It is printed.

Next, based on the graph of FIG. 17, processing was performed in the steps (f), (g), and (h). That is,
Based on the graph of FIG. 17, log ₁₀
As the threshold value of (change rate of fluorescence intensity),
0.1, 0.3, 0.5, 0.7, 0.9, 1.2 are selected, and the number of cycles that reaches the value is set on the X axis, and the human genome D
The copy number of NA before the start of the reaction was plotted on the Y-axis to draw a calibration curve. The result is shown in FIG. Correlation coefficients (R ² ) obtained by processing these calibration curves in the steps (j) and (i) are 0.998, 0.999, 0. 999
3, 0.9985, 0.9989, 0.9988. From these correlation coefficients, it was recognized that it is desirable to adopt 0.5 (correlation coefficient 0.9993) as the threshold value. It can be seen that the calibration curve having this correlation coefficient can accurately determine the copy number before the start of the reaction for the nucleic acid sample having the unknown copy number.

Example 23 (Nucleic Acid Melting Curve Analysis and Tm
Example of Value Analysis) 51) For nucleic acids amplified by the novel PCR method of the present invention, 51) a process of gradually increasing or decreasing the temperature from low temperature until the nucleic acid is completely denatured (eg, 50 ° C.)
To 95 ° C.), 52) a process of measuring fluorescence intensity at a short time interval (for example, 0.2 ° C. to 0.5 ° C. interval) in the process 51), 53) a measurement result of the process 52) in time Each step on the display, that is, the step of displaying the melting curve of the nucleic acid, 54) the step of first-derivating the melting curve of the step 53), 55) the differential value of the step 54) (−dF / dT, F: fluorescence intensity, T: time) is displayed on the display, 56) software comprising a process of obtaining an inflection point from the differential value obtained from 55) is prepared, and the data analysis software of the present invention is prepared. Combined in clothing. The novel real-time quantitative PCR reaction of the present invention was performed using the above-mentioned LightCycler ^™ system in which a computer-readable recording medium recording the data analysis software was installed to analyze the nucleic acid melting curve. In the present invention, the fluorescence intensity increases as the temperature rises.

The same PCR as in Example 20 was carried out for 1 copy and 10 copies of the same human genomic DNA as in Example 22.
51), 52), 53), 54) and 5 above.
Figure 1 shows the data printed in the process of 5).
It is 9. FIG. 20 is a diagram showing the nucleic acid melting curves of 1-copy and 10-copy of the 75th amplification product treated in the steps of 51), 52) and 53) of this Example. This curve is differentiated in the process of 54), and the inflection point (Tm value) is determined in the processes of 55) and 56). From FIG. 21, it was revealed that each amplification product was a different product because the Tm values of the amplification products of 1 copy and 10 copies were different.

[0177]

The present invention has the following effects. 1) As described above, when the nucleic acid measuring method of the present invention, the probe and the device of the present invention are used, an operation such as removing an unreacted nucleic acid probe from the measurement system is not performed, so that the target nucleic acid can be obtained in a short time. It can be easily measured. When applied to a complex microbial system or a symbiotic microbial system, the abundance of a specific strain in the system can be measured specifically and in a short time. Also,
The present invention provides a simple method for analyzing or measuring polymorphisms such as SNPs of target nucleic acids or genes or mutations. 2) Further, the quantitative PCR method of the present invention has the following effects. a. Since no factor that inhibits the amplification of the target nucleic acid by Taq DNA polymerase is added, quantitative PCR can be performed under the same conditions as the conventionally known normal PCR with specificity. b. Further, since the specificity of PCR can be kept high, the amplification of the primer dimer is delayed, so that the limit of quantification is reduced by about one order as compared with the conventionally known quantitative PCR. c. Since it is not necessary to prepare a complicated nucleic acid probe, the time and cost required for it can be saved. d. The amplification effect of the target nucleic acid is great, and the amplification process can be monitored in real time. 3) Further, when analyzing the data obtained by the real-time quantitative PCR method, when a calibration line for determining the copy number of nucleic acid is prepared for a nucleic acid sample of unknown nucleic acid copy number by using the data analysis method of the present invention, The correlation coefficient of the line is much higher than that obtained by the conventional method. Therefore, by using the data analysis method of the present invention, an accurate copy number of nucleic acid can be obtained. 4) Further, data analysis software relating to a method for analyzing data obtained by the real-time quantitative PCR method of the present invention, and a computer-readable recording medium recording the procedure of the analysis method as a program,
Further, when a real-time quantitative PCR measuring or analyzing apparatus using the same is used, a calibration line having a high correlation coefficient can be automatically created. 5) In addition, by using the novel method for analyzing a melting curve of a nucleic acid of the present invention, a highly accurate Tm value of a nucleic acid can be obtained. Further, when using the data analysis software according to the method, or a computer-readable recording medium in which the procedure of the analysis method is recorded as a program, and a real-time quantitative PCR measurement or analysis apparatus using the same, Accurate Tm value can be calculated

[Brief description of drawings]

FIG. 1: 335 to 358 counted from the 5 ′ end of 16S rRNA of Escherichia coli using the nucleic acid probe obtained in Example 1.
The figure which shows the fluorescence intensity measurement data at the time of measuring the 1st nucleic acid base sequence.

FIG. 2: Effect of heat treatment on hybridization of 35-base chain 2-o-Me probe to target nucleic acid Dotted line: target nucleic acid was added after heat treatment of rRNA. Solid line: unheated rRNA.

FIG. 3 shows the effect of modifying the number of bases of the probe base chain, the helper probe and the methyl group of the 2′-position OH group of ribose at the 5′-end of the probe on the hybridization between the probe and the target nucleic acid 16S rRNA.

FIG. 4 Calibration curve for rRNA measurement by the method of the present invention

FIG. 5: rR of complex culture system of KYM7 strain and KYM8 strain
Analysis of NA amount over time by FISH method of the present invention

FIG. 6 is a diagram showing the DNA chip of the present invention.

FIG. 7: Quantitative PCR method using Primers 1 and 2 labeled with Bodepee FL: a graph showing the relationship between the number of cycles and the amount of decrease in the emission of fluorescent dye. Symbols in the figure represent the following meanings.

FIG. 8 is a graph showing the relationship between the quantitative PCR method using Primers 1 and 2 labeled with Bodpee FL: the number of cycles and the logarithmic value of the decrease in emission of fluorescent dye. In the figure, the symbol ~ has the same meaning as in FIG. 7.

FIG. 9 is a diagram showing a calibration curve of Escherichia coli 16S rDNA prepared by using the quantitative PCR method of the present invention. n: 10 ⁿ

FIG. 10 shows the case where real-time quantitative PCR was performed using one probe of the present invention instead of two probes labeled with a fluorescent dye used in the real-time quantitative PCR method using the FRET phenomenon. It is a figure which shows the change of the phenomenon rate of fluorescence intensity. The figure below shows the number of cycles at which the phenomenon of fluorescence intensity begins to be significantly observed (thresholdnumbe
(r: Ct value) is calculated and a calibration curve is prepared.

FIG. 11 is a diagram showing a fluorescence decrease curve obtained by real-time quantitative PCR using a primer labeled with Bodpee FL of the present invention when the correction calculation processing of the present invention is not performed. ■: target nucleic acid = 10 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C ●: target nucleic acid = 100 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C ▲: target nucleic acid = 1000 copies; for fluorescence intensity measurement Reaction system temperature = 72 ° C. ◆: target nucleic acid = 10000 copies; reaction system temperature for fluorescence intensity measurement = 72 ° C. □: target nucleic acid = 10 copies; reaction system temperature for fluorescence intensity measurement = 95 ° C. ◯: target nucleic acid = 100 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. Δ: target nucleic acid = 1000 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. ◇: target nucleic acid = 10000 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C

FIG. 12 is a diagram showing a fluorescence decrease curve of real-time quantitative PCR obtained in the same manner as in the case of the curve in FIG. 11 except that the value at the 10th cycle of each curve is corrected to 1. ■: target nucleic acid = 10 copies; fluorescence intensity measurement temperature = 72 ° C ●: target nucleic acid = 100 copies; fluorescence intensity measurement temperature = 72
° C ▲: target nucleic acid = 1000 copies; fluorescence intensity measurement temperature = 7
2 ° C ◆: target nucleic acid = 10,000 copies; fluorescence intensity measurement temperature =
72 ° C. 5: target nucleic acid = 10000 copies; fluorescence intensity measurement temperature =
72 ° C

FIG. 13 is a graph showing plot values of curves shown in FIG.
The figure which shows the curve which calculated the fluorescence intensity reduction rate (change rate) of [Formula 9], and plotted the calculated value. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 14: Human genome DN obtained from the data in FIG.
The figure which shows the calibration straight line of A. y = human β-globin gene copy number x = cycle number (Ct) R ² = correlation coefficient

FIG. 15 is a diagram showing a curve in which measured values of each cycle in FIG. 11 are corrected and calculated by [Equation 1] and plotted with respect to each cycle number. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

16 is a diagram showing a curve obtained by plotting a value obtained by arithmetically processing the arithmetically processed value of each cycle in FIG. 15 by [Formula 3] with respect to the number of cycles. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 17 is a diagram showing a curve obtained by plotting a value obtained by performing arithmetic processing on the arithmetic processing value of each cycle in FIG. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 18 shows Ct value candidates of 0.1, 0.3, 0.5, 0.7, 0.
The figure when 9 and 1.2 are selected appropriately and the calibration straight line corresponding to it is drawn. The correlation coefficient for each calibration curve is shown below. ▲: log ₁₀ (change rate of fluorescence) = 0.1; correlation coefficient = 0.9
98 ■: log ₁₀ (change rate of fluorescence) = 0.3; correlation coefficient = 0.9
99 ●: log ₁₀ (change rate of fluorescence) = 0.5; correlation coefficient = 0.9
993 Δ: log ₁₀ (rate of change in fluorescence) = 0.7; correlation coefficient = 0.9
985 □: log ₁₀ (change rate of fluorescence) = 0.9; correlation coefficient = 0.9
989 ○: log ₁₀ (change rate of fluorescence) = 1.2; correlation coefficient = 0.9
988

FIG. 19: 1 copy and 10 copies of human genomic DNA
2 is a graph showing a fluorescence decrease curve when real-time quantitative PCR was performed using a primer labeled with Bodpee FL of the present invention. However, the correction calculation processing of [Formula 1] was performed. 1: target nucleic acid = 0 copies 2: target nucleic acid = 1 copy 3: target nucleic acid = 10 copies

FIG. 20 is a diagram showing a melting curve of a nucleic acid when a melting curve analysis of the nucleic acid for the PCR amplification product shown in FIG. 19 is performed. 1: target nucleic acid = 0 copies 2: target nucleic acid = 1 copy 3: target nucleic acid = 10 copies

FIG. 21 is a diagram showing a curve showing a Tm value obtained by differentiating the curve of FIG. 20 (valley is a Tm value). 2: target nucleic acid = 1 copy 3: target nucleic acid = 10 copies

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI G01N 33/542 G01N 33/566 33/566 C12N 15/00 ZNAA (31) Priority claim number Japanese Patent Application No. 2000-28896 (P2000-28896) ) (32) Priority date February 1, 2000 (February 2, 2000) (33) Priority claiming country Japan (JP) (Declaration by applicant) Patent application relating to the results of consigned research by the country (Heisei Era) (Applied under the Article 30 of the New Energy and Industrial Technology Development Organization, the development of technologies for utilizing biological resources such as complex biological systems, and the Act on Special Measures for Industrial Vitality Regeneration) (72) Inventor Takahiro Kanagawa 1-chome, Tsukuba City, Ibaraki Prefecture 1-3 Institute of Biotechnology, Industrial Technology, Institute of Industrial Technology (72) Inventor, Yoichi Kamagata 1-3-1, Higashi, Tsukuba, Ibaraki Prefecture Institute of Institute of Biotechnology, Industrial Technology (72) Inventor Kurata Shinya 1-9-8 Higashi-Kanda, Chiyoda-ku, Tokyo Environmental Engineering Co., Ltd. (72) Kazutaka Yamada 1-9-8 Higashi-Kanda, Chiyoda-ku, Tokyo Environmental Engineering Co., Ltd. (72) Toyoichi Yokomaku 1-9-8 Higashi-Kanda, Chiyoda-ku, Tokyo (72) Inventor Osamu Koyama 1-9-8 Higashi-Kanda, Chiyoda-ku, Tokyo (72) Inventor, Kenta Furusho Chiyoda-ku, Tokyo 1-9-8 Higashi-Kanda Environmental Engineering Co., Ltd. (56) Reference JP-A-10-84983 (JP, A) JP-A-10-262700 (JP, A)

Claims (10)

(57) [Claims] 1. A nucleic acid measuring method using a nucleic acid probe labeled with a fluorescent dye, wherein the nucleic acid probe is a target nucleus.
When hybridized to an acid,
The base pair for hybridization is G (guanine
At least one pair of C) and C (cytosine)
The base sequence of the probe is designed to
A nucleic acid probe that reduces its luminescence when the nucleic acid probe hybridizes with a target nucleic acid (provided that the "G-tetramer structure-forming oligonucleotide is a donor Having a first end labeled with a fluorophore and a second end labeled with an acceptor "and" the first probe has a fluorophore and the second probe is complementary to the first probe. , Which has a quencher molecule capable of quenching the fluorescence of the fluorophore.), And hybridizing the nucleic acid probe to the target nucleic acid to measure the decrease in emission of the fluorescent dye before and after the hybridization. A method for measuring a nucleic acid, comprising: 2. A terminal base in which the probe is labeled with a fluorescent dye at the end thereof, and when the nucleic acid probe is hybridized with a target nucleic acid, the probe is hybridized with the target nucleic acid at the end. 2. The nucleic acid measuring method according to claim 1, wherein the base sequence of the probe is designed so that at least 1 base or more of G (guanine) is present in the base sequence of the target nucleic acid 1 to 3 bases away from. 3. The method for measuring nucleic acid according to claim 1, wherein the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end. 4. The method for measuring nucleic acid according to claim 1, wherein the nucleic acid probe is labeled with a fluorescent dye at the 5 ′ end. 5. The nucleic acid measuring method according to claim 1, wherein the 3′-terminal base of the nucleic acid probe is G or C, and the 3′-terminal is labeled with a fluorescent dye. 6. The nucleic acid measuring method according to claim 1, wherein the 5′-terminal base of the nucleic acid probe is G or C, and the 5′-terminal is labeled with a fluorescent dye. 7. The nucleic acid according to claim 1, wherein the nucleic acid probe is phosphorylated on the 3′-terminal hydroxyl group of ribose or deoxyribose or the 3′-carbon hydroxyl group of 3′-terminal ribose. Measuring method. 8. The oligoribonucleotide of the nucleic acid probe is 2-o-methyl oligoribonucleotide (2-o-
The method for measuring nucleic acid according to claim 1, wherein the nucleic acid is methyloligoribonucleotide), PNA, or other chemically modified nucleic acid. 9. The nucleic acid probe oligoribonucleotide is a chimeric oligonucleotide containing ribonucleotides and deoxyribonucleotides.
nucleic acid). 10. The method for measuring nucleic acid according to claim 9 , wherein the ribonucleotide is 2-o-methyloligoribonucleotide.