JP2015073523A - Method for detecting nucleic acid, detection probe, microarray, nucleic acid-detecting kit, nucleic acid-detection probe-capture probe complex, nucleic acid-fixing carrier, and fluid device - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting a nucleic acid, capable of preventing a target nucleic acid from dissociating from a nucleic acid probe without using enzyme, and capable of detecting the nucleic acid with high precision.SOLUTION: A method for detecting a nucleic acid comprises: a step (a) for bringing a nucleic acid sample that comprises a nucleic acid comprising a first portion and a second portion, into contact with a detection probe and a capture probe, wherein the detection probe forms a stem-loop structure, has a sequence that can hybridize to the second portion, has a 5' protruding end or a 3' protruding end, and is labeled with a labeling substance, and wherein the capture probe comprises a sequence that can hybridize to the first portion and comprises a first photoactive base derivative in the sequence; a step (b) for forming a nucleic acid-detection probe-capture probe complex; a step (c) for crosslinking the first photoactive base derivative and the nucleic acid through a light having a first wavelength band; and a step (d) for detecting a labeling substance in the nucleic acid-detection probe-capture probe complex.

Description

  The present invention relates to a nucleic acid detection method, a detection probe, a microarray, a nucleic acid detection kit, a nucleic acid-detection probe-capture probe complex, a nucleic acid-immobilized carrier, and a fluidic device.

  Conventionally, DNA microarrays targeting mRNA are widely used as means for measuring the gene expression level in cells. In the 21st century, it has been reported that miRNA, a short non-coding RNA, regulates gene expression in vivo, and the relationship between abnormal expression of miRNA and various diseases including cancer Is becoming clear. Based on such knowledge, competition for development of DNA microarrays targeting miRNA has been developed.

  Furthermore, the discovery that miRNA circulates in the blood in 2008 (see Non-Patent Document 1) indicates the possibility of diagnosing cancer by simply performing a blood test. The DNA microarray market is expected to expand rapidly in the near future.

  On the other hand, quantitative PCR (qRT-PCR) method using reverse transcription reaction to cDNA is also widely used as a technique for quantifying miRNA. The quantitative PCR method is a method for estimating the amount of miRNA used as a template by converting miRNA into cDNA using reverse transcriptase and amplifying the cDNA. Quantitative PCR is a method that measures the amount of cDNA amplified to a certain amount using a PCR reaction. Therefore, it is more quantitative than a DNA microarray, but parallel processing for multiple samples and various miRNAs is difficult. There is a problem.

An existing DNA microarray targeting miRNA (hereinafter referred to as miRNA target DNA microarray) is a nucleic acid probe having a gene sequence that hybridizes complementary to a target miRNA on a transparent substrate.
Examples of the miRNA quantification method using the miRNA target DNA microarray include the following methods. First, miRNA is extracted from a biological sample, the miRNA is fluorescently labeled, then added to the miRNA target DNA microarray, and hybridized to a nucleic acid probe on a substrate. Next, after miRNA adsorbed nonspecifically on the substrate is washed, the amount of miRNA is estimated using fluorescence intensity as an index.
When preparing miRNA from a biological sample, extract and purify total RNA from the biological sample, fluorescently label the total RNA containing miRNA, and then contact the fluorescently labeled total RNA containing fluorescently labeled miRNA with the miRNA target DNA microarray. Let

  However, since the amount of miRNA in the living body, particularly blood, is as small as 0.01% by mass in the total RNA, if such pretreatment process is complicated, miRNA is adsorbed or decomposed during pipetting. Susceptible to. Furthermore, there is a problem that fluctuation of the fluorescence labeling rate for each measurement lowers the reproducibility of the measurement results.

In addition, since such manual pre-processing is affected by technical differences between researchers and clinical technologists, all pre-processing steps will be performed in the future using μ-TAS (Micro-Total Analysis Systems). It is desired to be fully automated so that can be performed on the chip. Here, μ-TAS means MEMS (Micro Electro
This means a microfluidic device for analyzing nucleic acids on a single chip by providing a minute flow path, reaction chamber, and mixing chamber on the chip using the Mechanical Systems) technology.
However, the fluorescent labeling method has become a bottleneck as described below, and it has not been incorporated into full automation.

The main fluorescent labeling method of miRNA includes a method of directly fluorescently labeling the base portion of miRNA and a method of adding a fluorescently labeled nucleotide to the 3 ′ end of miRNA using an enzyme such as T4 DNA ligase.
However, since all nucleic acids are non-specifically fluorescently labeled in these methods, it is necessary to remove unreacted fluorescent reagents and the like from the pre-fluorescently labeled target miRNA before hybridization to the nucleic acid probe on the substrate. is there. In general, gel filtration chromatography is used for these separations, and it is necessary to accurately separate a miRNA having a short length of about 22 bases from an unreacted fluorescent reagent. For example, in the case of separating using μ-TAS, a process of moving a biological sample over a long distance in a resin-packed region is necessary, and it is extremely difficult to perform such a process in a chip with limited space. . Moreover, even if possible, in order to repeat the experiment continuously, long-time washing is necessary to wash away the unreacted fluorescent reagent, which is not realistic.

In order to solve the above problems, a sandwich type microarray method has been devised that can detect miRNA while omitting the separation process of unreacted fluorescent dye (see Patent Document 1).
Specific examples of the first method of the sandwich type microarray method include the following steps. First, a nucleic acid probe having a sequence complementary to each miRNA 303 comprising the first portion 300 and the second portion 301 is divided into two, and the capture probe 304 (Capture) is divided.
probe) and detection probe 305 (Detect probe). Then, a group of capture probes 304 having a sequence complementary to the first portion 300 of each miRNA 303 is arranged on the substrate 306 to produce a microarray (see FIG. 18).
Next, after each miRNA 303 is brought into contact with the prepared microarray substrate (substrate 306), a solution containing a group of detection probes 305 having a sequence complementary to the second portion 301 of each miRNA 303 is applied to the microarray substrate (substrate 306). By bringing them into contact, the three of miRNA 303, capture probe 304, and detection probe 305 are hybridized (see FIG. 18). Since the detection probe 305 recognizes and binds to the second portion 301 of the miRNA 303, non-specific binding to the capture probe 304 does not occur, and it is necessary to separate the unreacted detection probe 304 by chromatography or the like. Absent.

However, in the first method described in Patent Document 1, by dividing a nucleic acid probe having a sequence complementary to miRNA 303 into two, the sequence complementary to miRNA 303 on one probe is about 10 bases each. Become. As a result, the affinity between the miRNA 303 and the nucleic acid probe decreases, and it is difficult to accurately quantify the miRNA 303 that is present in the blood in a very small amount.
In addition, the biological sample contains about 70 bases of pre-miRNA (a precursor of miRNA). Since pre-miRNA contains the sequence of miRNA of about 22 bases, the first method of Patent Document 1 cannot distinguish between them, and the fundamental problem is that only miRNA having a gene expression control function cannot be accurately quantified. Have

  As a solution to this problem, the second method described in Patent Document 1 further proposes a method of covalently binding miRNA 303 and a nucleic acid probe using ligase (see FIG. 19). However, in the first method shown in FIG. 18, when ligase is used, the detection probe 305 and the capture probe 304 hybridized with the miRNA 303 are covalently bound, and then the miRNA 303 is dissociated and binds to another capture probe 304. As a result, there is a risk that the miRNA 303 of the same molecule is detected multiple times.

  On the other hand, in the second method shown in FIG. 19, two types of bridging probes 307 and 308 (c-bridge 307, d-bridge 308) are used, so that the capture probe 304, the miRNA 303, and the detection probe 309 are combined. The miRNA 303 covalently bonded by ligation and captured on the substrate 306 is prevented from dissociating from the substrate 306.

International Publication No. 2008/052774

Mitchell et al., Proc. Nat. Acad. Sci. 105, 10513-10518, 2008

  However, for example, in the second method described in Patent Document 1, since the signal is detected only when miRNA 303 and all four types of probes collide and five types of molecules form a complex, the quantitative property is poor. The operation is cumbersome and time consuming.

  The present invention has been made in view of the above circumstances, and can prevent the target nucleic acid from dissociating from the nucleic acid probe without using an enzyme such as ligase, and is simple, highly accurate and highly sensitive. , Nucleic acid detection method capable of detecting nucleic acid, and detection probe, microarray, nucleic acid detection kit, nucleic acid-detection probe-capture probe complex, nucleic acid-immobilized carrier, and fluidic device used in the nucleic acid detection method The purpose is to provide.

As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that the problems can be solved by using a nucleic acid probe having a photoreactive base derivative. One embodiment of the present invention provides the following (1) to (7).
(1) The method for detecting a nucleic acid in one embodiment of the present invention comprises:
(A) a nucleic acid sample containing a nucleic acid comprising a first part and a second part;
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
Contacting a capture probe comprising a sequence capable of hybridizing with the first portion, wherein the capture probe comprises a first photoreactive base derivative in the sequence;
(B) hybridizing the second part to the detection probe, hybridizing the first part to the capture probe, and forming a nucleic acid-detection probe-capture probe complex;
(C) hybridizing the first part to the capture probe and crosslinking the first photoreactive base derivative and the nucleic acid with light in a first wavelength band;
(D) detecting a labeling substance in the nucleic acid-detection probe-capture probe complex.
(2) The detection probe in one embodiment of the present invention comprises:
A detection probe used for detecting a nucleic acid comprising a first part and a second part in a nucleic acid sample,
Two stem parts forming complementary strands;
A region between the two stem parts, and a loop part labeled with a labeling substance;
A sequence capable of hybridizing with the second portion, comprising a photoreactive base derivative in the sequence capable of hybridizing with the second portion, and having a 5 ′ protruding end or a 3 ′ protruding end. Features.
(3) The microarray in one embodiment of the present invention comprises:
A capture probe that can form a complex with a nucleic acid and a detection probe and includes a photoreactive base derivative in the sequence is fixed to the substrate.
The nucleic acid includes a first portion that can hybridize with the capture probe and a second portion that can hybridize with the detection probe;
The detection probe has a stem-loop structure, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance.
(4) The nucleic acid detection kit in one embodiment of the present invention comprises:
A nucleic acid detection kit comprising a capture probe and a detection probe,
The capture probe includes a sequence that can hybridize to the first portion when the target nucleic acid is divided into a first portion and a second portion, and includes a photoreactive base derivative in the sequence,
The detection probe includes a sequence that forms a stem-loop structure and can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance, To do.
(5) The nucleic acid-detection probe-capture probe complex in one embodiment of the present invention comprises:
Via a nucleic acid consisting of a first part and a second part,
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
A capture probe containing a sequence capable of hybridizing with the first portion and containing a photoreactive base derivative in the sequence is linked.
(6) The nucleic acid-immobilized carrier in one embodiment of the present invention comprises:
The nucleic acid-detection probe-capture probe complex described above is immobilized on a substrate.
(7) The fluidic device in one embodiment of the present invention is:
A fluidic device comprising a nucleic acid detector having a substrate on which a capture probe is fixed, and an inlet for introducing a detection probe;
The capture probe includes a sequence that can hybridize to the first portion when the target nucleic acid is divided into a first portion and a second portion, and includes a photoreactive base derivative in the sequence,
The detection probe includes a sequence that forms a stem-loop structure and can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance, To do.

  According to the present invention, a nucleic acid can be detected with high accuracy without linking a target nucleic acid and a nucleic acid probe with an enzyme.

It is a mimetic diagram of one mode of a detection method of nucleic acid in this embodiment. It is a mimetic diagram of one mode of a detection method of nucleic acid in this embodiment. It is a schematic diagram explaining one aspect | mode of the detection method of the nucleic acid in this embodiment. It is a schematic diagram explaining one aspect | mode of the detection method of the nucleic acid in this embodiment. It is a schematic diagram explaining one aspect | mode of the detection method of the nucleic acid in this embodiment. It is a schematic diagram of the one aspect | mode of the fluid device in this embodiment. It is a schematic diagram of the one aspect | mode of the fluid device in this embodiment. It is a schematic diagram of the one aspect | mode of the fluid device in this embodiment. It is a schematic diagram of the one aspect | mode of the fluid device in this embodiment. It is a schematic diagram of the one aspect | mode of the fluid device in this embodiment. It is a figure which shows the arrangement | sequence of miRNA used in the Example, and a part of arrangement | sequence of a capture probe and a detection probe. It is a detection result of miRNA in an Example. It is a detection result of miRNA in an Example. It is a detection result of miRNA in an Example. It is a detection result of miRNA in an Example. It is a detection result of miRNA on the board | substrate in an Example. It is a result which shows dissociation from the board | substrate of a detection probe in an Example. It is a schematic diagram of one aspect | mode of the detection method of the conventional nucleic acid. It is a schematic diagram of one aspect of a conventional method for detecting a nucleic acid.

≪Nucleic acid detection method≫
[First embodiment]
The method for detecting a nucleic acid of the present embodiment includes:
(A) a nucleic acid sample containing a nucleic acid comprising a first part and a second part;
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
Contacting a capture probe comprising a sequence capable of hybridizing with the first portion, wherein the capture probe comprises a first photoreactive base derivative in the sequence;
(B) hybridizing the second part to the detection probe, hybridizing the first part to the capture probe, and forming a nucleic acid-detection probe-capture probe complex;
(C) hybridizing the first part to the capture probe and crosslinking the first photoreactive base derivative and the nucleic acid with light in a first wavelength band;
(D) detecting a labeling substance in the nucleic acid-detection probe-capture probe complex.
In this embodiment, the capture probe is fixed to a substrate.
Since the photoreactive base derivative is contained in the capture probe, the capture probe and the nucleic acid can be cross-linked, so that highly accurate detection of the nucleic acid is realized.

In the nucleic acid detection method of the present embodiment, the detection probe further includes a second photoreactive base derivative in a sequence capable of hybridizing with the second portion, and in the step (c), Furthermore, it is preferable that the second portion is hybridized to the detection probe and the second photoreactive base derivative and the nucleic acid are cross-linked by the second wavelength band light.
Since the photoreactive base derivative is contained in the detection probe in addition to the capture probe, the detection probe and the nucleic acid can be cross-linked, so that detection of the nucleic acid is realized with higher accuracy.

The nucleic acid to be detected contained in the nucleic acid sample is not particularly limited, but examples thereof include miRNA and short RNA such as short mRNA in which transcription stops halfway. For example, there are many kinds of miRNAs present in the living body and involved in the control of gene expression.
In this embodiment, the capture probe may be fixed to a solid phase, for example, a substrate. As the solid phase, in addition to the substrate, a carrier can be exemplified as a preferable one. Examples of the solid phase carrier include magnetic beads, gold nanoparticles, agarose beads, and plastic beads. Examples of the solid phase substrate include a glass substrate, a silicon substrate, a plastic substrate, and a metal substrate.

  Hereafter, each process in this embodiment is demonstrated, referring FIG.

Step (a)
A nucleic acid sample containing miRNA3 consisting of a first part 1 and a second part 2 and a sequence 5b that forms a stem-loop structure and can hybridize with the second part 2; A detection probe 5 having a protruding end and labeled with a labeling substance 5a;
A step of contacting a capture probe 4 including a sequence capable of hybridizing with the first portion and including the first photoreactive base derivative 7a in the sequence, wherein the capture probe 4 is fixed to the substrate 6 ing.
As shown in FIG. 1, the miRNA 3 to be detected is divided into two parts, a first part 1 and a second part 2. That is, miRNA3 consists of a first part and a second part.
The capture probe 4 and the detection probe 5 are capable of hybridizing to the first portion 1 and the second portion 2 of the miRNA 3, respectively. Therefore, the length of the first part 1 and the second part 2 is preferably 5 to 17 bases, and more preferably 7 to 15 bases from the viewpoint of the number of bases obtained by dividing the miRNA consisting of about 22 bases into two.
The lengths of the first part 1 and the second part 2 are not limited to the above number of bases as long as the sequence specificity is ensured. The above points are affected by the GC content of the first part 1 and the second part 2, the presence of nucleic acids similar to the target miRNA, and the like.
In the present embodiment, the 5 ′ portion of miRNA 3 is referred to as a first portion 1, and the 3 ′ portion of miRNA 3 is referred to as a second portion 2.

  In the present invention and the present specification, “capable of hybridizing” means that at least a part of the capture probe or detection probe used in the present invention hybridizes to a target nucleic acid (target miRNA), and a complex is complementarily formed. Forming. “Stringent conditions” include, for example, conditions described in Molecular Cloning-A LABORATORY MANUAL THIRD EDITION (Sambrook et al., Cold Spring Harbor Laboratory Press).

In the nucleic acid detection method of this embodiment, the detection probe may include the second photoreactive base derivative 7b in a sequence capable of hybridizing with the second portion.
In the embodiment shown in FIG. 1, the capture probe 4 includes the first photoreactive base derivative 7a in a sequence capable of hybridizing with the first portion, and the detection probe 5 is the second portion 2 of the miRNA 3. The second photoreactive base derivative 7b is included in the sequence 5b that can hybridize with the second photoreactive base derivative 7b.

  The nucleic acid sample is not particularly limited as long as it is a sample containing nucleic acid. For example, in the case where the nucleic acid detection method of the present embodiment is used for diagnosis of cancer, the onset of cancer is confirmed, Or obtained by extracting nucleic acid from samples of blood, lymph, spinal fluid, semen, saliva, urine, etc. of subjects such as those suspected of developing cancer or subjects undergoing cancer treatment It is preferable that Nucleic acid extraction from these samples can be performed by a conventional method such as using trisol, but it is preferable to use a method of extracting short-chain RNA.

  As described above, the amount of miRNA in blood is as extremely small as 0.01% by mass in the total RNA. As the nucleic acid sample, miRNA concentrated by fractionation from total RNA extracted from the sample may be used. In this embodiment, since it is not necessary to label the miRNA itself to be detected with a labeling substance, a nucleic acid sample that has not been fractionated may be used.

The capture probe 4 includes a sequence capable of hybridizing with the first portion 1 of miRNA 3 in the 5 ′ end region.
From the viewpoint of quantifying miRNA 3 with high accuracy, it is preferable that capture probe 4 does not contain a complementary sequence to second portion 2 of miRNA 3 so as not to hybridize with second portion 2 of miRNA 3.
In order for the capture probe 4 fixed to the substrate 6 to hybridize with the miRNA 3, molecular freedom is required. Therefore, the capture probe 4 has a spacer 4 a at the 3 ′ end that binds to the substrate 6. It is preferable. Although it does not specifically limit as length of the spacer 4a, 3-50 base is preferable and 5-25 base is more preferable. However, the base used for the spacer can be replaced with a linker such as PEG having the same length and softness. In such a case, the number of bases used for the spacer 4a may be 0 bases.
The length of the capture probe 4 is not particularly limited as long as it is a length necessary for functioning as a probe. However, in consideration of the number of bases of the first portion 1 and the spacer 4a, 3 to 50 bases are preferable. 40 bases are more preferred.

  The capture probe 4 may be DNA or RNA, and is not limited to natural and non-natural, as long as it has the same function as DNA or RNA, but is not limited to PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), BNA (Bridged Nucleic). Acid) or other artificial nucleic acid may be included. The capture probe 4 preferably contains LNA or BNA from the viewpoint that it has a higher affinity with the target miRNA 3 than DNA or RNA and is not easily recognized by the DNA-degrading enzyme or RNA-degrading enzyme.

  Further, in detecting the miRNA3-detection probe 5-capture probe 4 complex formed on the substrate 6 in the step (d), the capture probe 4 is a different type of label from the labeling substance that labels the detection probe 5. It is preferably labeled with a substance. Examples of the labeling substance for labeling the capture probe 4 are the same as those used for labeling the detection probe 5 described later.

Examples of the substrate 6 used for fixing the capture probe 4 include a glass substrate, a silicon substrate, a plastic substrate, and a metal substrate. Examples of the method for fixing the capture probe 4 on the substrate 6 include a method for fixing the probe at a high density on the substrate using an optical lithography technique and a method for fixing the probe by spotting on a glass substrate or the like.
When using an optical lithographic technique, the capture probe 4 may be synthesized on the substrate 6.
When fixing the capture probe 4 by spotting, it is preferable to provide a solid phase binding site on the capture probe 4 and a solid phase binding site recognition site on the substrate 6.
As a combination of such a solid phase binding site / solid phase binding site recognition site, a solid phase provided by modifying the capture probe 4 with a functional group such as an amino group, a formyl group, an SH group, or a succimidyl ester group. A combination of a binding site and a solid phase binding site recognition site provided by surface-treating the substrate 6 with a silane coupling agent having an amino group, a formyl group, an epoxy group, a maleimide group or the like, or a gold-thiol bond The combination used is mentioned.
Another method for fixing the capture probe by spotting is a method in which capture probes having cyanol groups are discharged onto a glass substrate, arranged, and covalently bonded by a silane coupling reaction.

In the present embodiment, the detection probe 5 includes a sequence 5b that can hybridize with the second portion 2 of the miRNA 3 in the 3 ′ terminal region.
From the viewpoint of quantifying miRNA 3 with high accuracy, it is preferable that the detection probe 5 does not contain a sequence complementary to the first portion 1 of miRNA 3 so as not to hybridize with the first portion 1 of miRNA 3.

The detection probe 5 forms a stem loop structure. With a stem-loop structure, in a single-stranded nucleic acid, when there are complementary sequences in two distant regions within the molecule, a complementary strand (stem structure) is formed by the interaction between the base pairs of the nucleic acid, The arrangement | sequence narrowed in the 2 area | regions says what forms a loop structure. The stem loop structure is also referred to as a hairpin loop structure.
In the present embodiment, the detection probe 5 includes, from the 5 ′ end side, two stem portions 5c and 5d that form complementary strands, a loop portion 5e that is a region between the two stem portions 5c and 5d, and a second Sequence 5b which can hybridize with part 2 of That is, the detection probe 5 has a 3 ′ protruding end. The detection probe has a protruding end, and whether the protruding end of the detection probe is a 5 ′ protruding end or a 3 ′ protruding end depends on whether the capture probe and the substrate are connected via the 5 ′ end of the capture probe. Depending on whether it is bound via the 3 'end.

  Even if the capture probe forms a complex with pre-miRNA (precursor of miRNA) containing the same base sequence region as miRNA, the detection probe has a protruding end, resulting in steric hindrance, and detection probe-miRNA. -No capture probe complex is formed. Therefore, according to this embodiment, since pre-miRNA is not recognized but only target miRNA is recognized, target miRNA can be detected with high precision.

The length of the stem portion in the detection probe 5 is determined by the balance with the length of the loop portion. The length of the stem portion in the detection probe 5 is not particularly limited as long as the detection probe 5 can stably form a stem loop structure, but for example, 3 to 50 bases are preferable, and 5 to 20 bases are more preferable. .
The length of the loop portion in the detection probe 5 is determined by the balance with the length of the stem portion. The length of the loop part in the detection probe 5 is not particularly limited as long as the detection probe 5 can stably form a stem loop structure, but is preferably 3 to 200 bases, more preferably 5 to 100 bases, for example. .
The length of the detection probe 5 is not particularly limited as long as it can form a stem-loop structure and is necessary to function as a probe, but the number of bases of the second portion 2 and the base necessary for forming the stem-loop structure In consideration of the number, 14 to 200 bases are preferable, and 24 to 150 bases are more preferable.

The detection probe 5 may be DNA or RNA, and is not limited to natural and non-natural as long as it has the same function as DNA or RNA, but is not limited to PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), BNA (Bridged Nucleic). Acid) or other artificial nucleic acid may be included. The detection probe 5 preferably contains LNA or BNA from the viewpoint that the affinity with the target miRNA is higher than that of DNA or RNA and it is difficult to be recognized by the DNA-degrading enzyme or RNA-degrading enzyme.
It is preferable that at least one of the capture probe 4 and the detection probe 5 includes LNA or BNA, and it is more preferable that both the capture probe 4 and the detection probe 5 include LNA or BNA.

The detection probe 5 is labeled with a labeling substance 5a. From the viewpoint of steric hindrance when forming the miRNA3-detection probe 5-capture probe 4 complex described later, the labeling substance 5a is preferably bound to the loop portion 5e.
Examples of the labeling substance include fluorescent dyes, fluorescent beads, quantum dots, gold nanoparticles, biotin, antibodies, antigens, energy absorbing substances, radioisotopes, chemiluminescent substances, enzymes, and the like.
Fluorescent dyes include FAM (carboxyfluorescein), JOE (6-carboxy-4 ′, 5′-dichloro2 ′, 7′-dimethoxyfluorescein), FITC (fluorescein isothiocyanate), TET (tetrachlorofluorescein), HEX ( 5'-hexachloro-fluorescein-CE phosphoramidite), Cy3, Cy5, Alexa568, Alexa647 and the like.
Since only a very small amount of miRNA is present in total RNA, it is difficult to label miRNA with high efficiency without fractionation. On the other hand, in this embodiment, since a pre-labeled detection probe is used, miRNA can be quantified with high efficiency.

When the capture probe 4 is labeled with a labeling substance, the combination of the labeling substance that labels the capture probe 4 and the labeling substance that labels the detection probe 5 can cause FRET (Fluorescence Resonance Energy Transfer). There may be no combination or a combination in which FRET may occur.
From the viewpoint that the FRET efficiency varies depending on the sequence or length of the target miRNA, a combination in which FRET cannot occur is preferable. Even when a combination of labeling substances that can cause FRET is used, for example, the end near the substrate of the capture probe is labeled with FAM, and the loop portion farthest from the substrate of the detection probe is labeled with Alexa647, etc. It can also be designed so that FRET does not occur.
Further, from the viewpoint that it is possible to distinguish between the case where the detection probe is coupled to the capture probe and the case where the detection probe is adsorbed to the substrate, a combination that can cause FRET is preferable.
As a combination of labeling substances that may cause FRET, fluorescent dyes having an excitation wavelength of about 490 nm (for example, FITC, rhodamine green, Alexa (registered trademark) Fluor 488, Bodipy FL, etc.) and fluorescent dyes having an excitation wavelength of about 540 nm (for example, , TAMRA, tetramethylrhodamine, Cy3), or a combination of a fluorescent dye having an excitation wavelength near 540 nm and a fluorescent dye having an excitation wavelength near 630 nm (for example, Cy5).

In the present embodiment, the two probes, the capture probe and the detection probe, recognize the first part and the second part of the target miRNA, respectively. For example, when the miRNA is let-7a (5′-UGAGGUAGUAG G UUGUAAUGUUU-3 ′), the first part of let-7a is 5′-UGAGGUAGUAG-3 ′ and the second part is 5′- G. A capture probe and a detection probe containing UUGUAAUGUUU-3 ′ and sequences that can hybridize to each are prepared.

Here, in the detection probe, the sequence capable of hybridizing with the second part of let-7a is 5′-AACTATACAA C- 3 ′, and the first base guanine of the second part of let-7a is changed to adenine. The sequence capable of hybridizing with the second part of let-7f (5'-UGAGGUAGUAG A UUGUAUAGUUU-3 ') is 5'-AACTATACAA T- 3', and these two types of miRNAs and two types of detection probes When the miRNAs are quantified in parallel under the conditions of coexisting with each other, since the sequences of the first portions of let-7a and let-7f are exactly the same, both are the same capture probe on the microarray. 4 and each form a miRNA3-detection probe 5-capture probe 4 complex.
Therefore, in this region, a signal in which both miRNAs are added is detected, which may lead to an erroneous result. This is a fatal problem in Patent Document 1, for example.
The present inventors have found that this problem can be solved by the following two points.

First, in the step (a), the solution preferably includes a plurality of types of detection probes that are labeled with different types of labeling substances.
This is because the detection probe (let-7a) and the detection probe (let-7f) that hybridize with the second part of let-7a and let-7f are labeled with different labeling substances, and the respective signals are quantified individually. It is a method to do. Examples of the labeling substance include a method of labeling both detection probes using Alexa532 or Alexa647, which are fluorescent substances having different wavelengths.

Secondly, in the step (a), the nucleic acid sample contains a plurality of types of miRNAs to be detected, and the 5 ′ of the capture probe does not overlap each other so that the first parts of the plurality of types of miRNAs do not overlap each other. It is preferable to select which side of the end and the 3 ′ end is fixed to the substrate.
This is a method of using, as a capture probe, a probe that hybridizes to a portion having a different sequence among similar miRNAs. Taking let-7a and let-7f as examples, 5′- G UUGUAUAGUUU-3 ′ and 5′- A UUGUAAUGUUU-3 ′ on the 3 ′ end side with different sequences are used as the first part, and 5 ′ 'Terminal 5'-UGAGGUAGUAG-3' is the second part. By reversing the arrangement of the 5 ′ end and the 3 ′ end shown in FIG. 1, a capture probe 4-detection probe 5-miRNA3 complex in which the 5 ′ end side of the complementary probe 4 is immobilized on the substrate can be formed. It becomes possible. In this case, the detection probes 5 for let-7a and let-7b have the same sequence, and the labeled substances to be labeled are also the same.

  Thus, according to the present embodiment, it is possible to strictly distinguish similar miRNAs and quantify target miRNAs with high accuracy.

  Examples of the liquid used for the solution containing the nucleic acid sample containing miRNA3 and the detection probe 5 include a buffer used for normal hybridization.

  In step (b), the second portion 2 is hybridized to the detection probe 5, the first portion 1 is hybridized to the capture probe 4, and the miRNA 3 -detection probe 5 -capture probe 4 complex is formed on the substrate 6. It is a process of forming.

In step (b), since miRNA tends to form a three-dimensional structure, it is preferable to incubate at 95 ° C. for about 5 minutes to thermally denature the miRNA so that it can easily hybridize with the probe.
Hybridization is not particularly limited, and can be performed under normal conditions such as temperature, pH, salt concentration, buffer solution, etc. in consideration of Tm value of each probe. From the viewpoint of quantifying miRNA with high accuracy, hybridization is preferably performed under stringent conditions.
Examples of the stringent conditions include a temperature condition of about 30 ° C. (a temperature condition higher by about 5 ° C. to 10 ° C. than the Tm of the probe sequence), a salt concentration condition of less than 1M, and the like.

In step (c), the first portion is hybridized to the capture probe, the second portion is hybridized to the detection probe, and the first photoreactivity is generated by light in a first wavelength band. In this step, the base derivative and the nucleic acid are cross-linked, and the second photoreactive base derivative and the nucleic acid are cross-linked by the second wavelength band light.
A photoreactive base derivative is a base derivative capable of crosslinking any target nucleic acid and a detection probe and any target nucleic acid and a capture probe by activating the reactivity when irradiated with light of a predetermined wavelength. Means. Examples of photoreactive base derivatives include psoralen-added base, 3-Cyanovinylcarbazole Nucleoside (hereinafter also referred to as ^CNV K), 4-thiothymidine, adenine-reactive group caged product (Kobori et al., Bioorganic & Medicinal Chemistry, 20: 5071-5076 (2012) ), 3-carbonylvinyl phenol nucleoside (CV P) (Yoshimura et al., Nucleic Acids Symposium Series, 48: 81-82 (2004)), p-carbamoylvinyl phenol nucleoside (p- CV P (Ami et al., Org. Biomol. Chem., 5: 2583-2586 (2007))), 5-carboxyvinyldeoxyuridine ( ^CV U) (Ogasawara et al., Chem Bio Chem, 6: 1756-1760 (2005)), carbazole- tethered 5-carbo yvinyl-2'-deoxyuridine ^(YCV U) (Fujimoto et al, Organic Letters, 10: 397-400 ( 2008)), 5-cyanovinyl-1'-α-2'- deoxyuridine (α- C U), β- C U (Ogino et al., Angew Chem. Int. Ed. 45: 7223-7226 (2006)), 5-vinyl-2′-deoxyuridine ( ^V U), 5-heptenyl-2′-deoxyuridine ( ^H U), 5-cyclohexyl vinyl-2 ′. -Deoxyuridine ( ^HV U), 5-t-butylvinyl-2'-deoxyuridine ( ^BuV U) (Ogino et al., Org. Biomol. Chem., 7: 3163-3167 (2009)), ^BTV U, ^PTV U, ^MPTV U , ^NTV U (Ami et al., ChemBioChem 9, 2071-2074 (2008)), N ³ -methyl-5-cyanovinyl-2'-deoxyuridine ( ^MCV U) (Fujimoto et al., Chem. Commun., 3177-3179 (2005)), 7-deaza-2'-deoxyadenosine ( ^VZ A) (Saito et al., Tetrahedron Letters 46: 97-99 (2005)).

The first wavelength band light and the second wavelength band light are not particularly limited as long as the wavelength band light can bridge any target nucleic acid and a detection probe, and any target nucleic acid and a capture probe. The first wavelength band light and the second wavelength band light may be the same wavelength band.
The first photoreactive base derivative included in the detection probe and the second photoreactive base derivative included in the capture probe may be the same compound or different compounds. That is, when the first photoreactive base derivative and the second photoreactive base derivative are the same compound, the first wavelength band light and the second wavelength band light are in the same wavelength band. Any target nucleic acid and detection probe, and any target nucleic acid and capture probe can be exemplified as a crosslinkable case.

  FIG. 1B shows a state in which the first portion 1 is hybridized to the capture probe 4 and the second portion 2 is hybridized to the detection probe. The capture probe 4 includes a photoreactive base derivative 7a in a sequence that can hybridize with the first portion, and the detection probe 5 includes a photoreactive base derivative in the sequence 5b that can hybridize with the second portion. 7b is included. At this time, the first wavelength band light and / or the second wavelength band light is irradiated to the complex, and the first photoreactive base derivative 7a and miRNA3 and the second photoreactive base derivative are irradiated. 7b and miRNA3 are cross-linked, respectively. In FIG. 1, 7a and 7b represent photoreactive base derivatives that are not cross-linked with miRNA3, and 7a 'and 7b' represent photoreactive base derivatives that are cross-linked with miRNA3.

In a method using an enzyme such as ligase for linking a nucleic acid and a detection probe or a nucleic acid and a capture probe, the ligation reaction is performed under conditions where the enzyme functions.
On the other hand, in the nucleic acid detection method of the present embodiment, by using a photoreactive base derivative for linking a nucleic acid and a detection probe, or a nucleic acid and a capture probe, a condition under which the enzyme does not function or a condition for inactivating the enzyme is Even after passing, the nucleic acid can be detected. As an example of the conditions, the above-described miRNA may be incubated at 95 ° C. for about 5 minutes to solve the three-dimensional structure. Another example is a case where a surfactant is contained in the solution when the probe and the nucleic acid are hybridized. Nucleic acid can be detected with higher accuracy by including a surfactant in the solution. Thus, in the nucleic acid detection method of this embodiment, since a photoreactive base derivative is used instead of using an enzyme, various conditions for detecting nucleic acids with high accuracy can be selected widely. In addition, in order to avoid inactivation of the enzyme before the ligation reaction, it is possible to reduce the necessity of strictly storing a series of reagents used in this embodiment, and the quality control of the product can be further improved. It becomes easy.
In the nucleic acid detection method of this embodiment, since a nucleic acid is ligated using a photoreactive base derivative instead of using an enzyme, strict control of the ligation time, which is difficult to control with an enzyme reaction, and for each fine range It is possible to control the ligation reaction. The control of the ligation reaction for each minute range includes, for example, using a filter coated with a gradient in light reflection efficiency at the time of light irradiation and changing the light irradiation dose condition for each extremely small area. It is done.

  In addition, a process (b) and a process (c) may be performed simultaneously. That is, hybridization and cross-linking may be performed simultaneously.

  By dividing the probe into two, the capture probe 4 and the detection probe 5, the affinity between each probe and the target miRNA 3 is slightly reduced. However, as described above, (1) the substrate 6 and the capture probe 4 are combined with the spacer 4a. (2) The affinity between each probe and miRNA 3 is increased by including LNA or BNA in the capture probe 4 and / or the detection probe 5. Thus, the affinity between each probe and the target miRNA 3 can be increased.

  After the hybridization reaction, it is preferable to wash the substrate 6 in order to remove non-specifically hybridized material. The washing method can be performed under normal conditions. From the viewpoint of quantifying miRNA with high accuracy, washing is preferably performed under stringent conditions. For example, the substrate 6 may be washed several times by shaking in a solution having a low salt concentration.

Step (d) is a step of detecting the labeling substance 5a in the miRNA3-detection probe 5-capture probe 4 complex formed on the substrate 6 and detecting miRNA3 in the nucleic acid sample from the detection result. Here, “detecting” includes quantitative detection, quantification, analysis, and the like.
As described above, since the detection probe 5 is labeled with the labeling substance 5a, the labeling substance 5a in the miRNA3-detection probe 5-capture probe 4 complex is quantitatively detected. At that time, it is preferable to prepare a standard curve using a known amount of miRNA diluted serially, and use the standard curve. Such detection results can be used to quantify miRNA3 in the nucleic acid sample.
The method for detecting the labeling substance in step (d) is not particularly limited. For example, the detection method is usually performed when nucleic acid is detected, for example, by measuring the fluorescence intensity of the complex using a nucleic acid microarray automatic detection device. Can be used.

According to the miRNA detection method of the present embodiment, since a bridging probe, which has been conventionally required, is unnecessary, the operation is simplified, and further, there is no need to label the miRNA itself with a labeling substance. The target miRNA can be quantified.
In addition, according to the miRNA detection method of the present embodiment, since a detection probe that forms a stem-loop structure is used, target miRNA can be quantified with high accuracy without recognizing pre-miRNA.

[Second Embodiment]
The method for detecting a nucleic acid of the present embodiment includes:
(A) a nucleic acid sample containing a nucleic acid comprising a first part and a second part;
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
Contacting a capture probe comprising a sequence capable of hybridizing with the first portion, wherein the capture probe comprises a first photoreactive base derivative in the sequence;
(B) hybridizing the second part to the detection probe, hybridizing the first part to the capture probe, and forming a nucleic acid-detection probe-capture probe complex;
(C) hybridizing the first part to the capture probe and crosslinking the first photoreactive base derivative and the nucleic acid with light in a first wavelength band;
(D) detecting a labeling substance in the nucleic acid-detection probe-capture probe complex,
The detection probe contains a second photoreactive base derivative in a sequence capable of hybridizing with the second portion, and in the step (c), the second portion is further hybridized with the detection probe. And the second photoreactive base derivative and the nucleic acid are cross-linked by the second wavelength band light.
That is, in the nucleic acid detection method of the present embodiment, the capture probe that has been immobilized on the solid phase in the first embodiment described above may not be immobilized on the solid phase. Therefore, it is not necessary to perform the step of fixing the capture probe to the substrate, and it can be performed without using the substrate to which the capture probe is fixed, and nucleic acid detection can be performed more easily when there are few types of nucleic acids to be detected. There is an advantage that can be done.

  The detection of the nucleic acid in the present embodiment is performed, for example, by detecting the formation of a ternary complex of a nucleic acid, a complementary probe, and a detection probe in the reaction solution. Therefore, the combination of the labeling substance that labels the capture probe and the labeling substance that labels the detection probe is preferably a combination that can cause FRET.

[Third embodiment]
The nucleic acid detection method according to the present embodiment is the same as the nucleic acid detection method according to the second embodiment described above, and further uses a substrate on which a complex capture probe having a third portion is immobilized. The detection probe further comprises a sequence capable of hybridizing to the third portion,
(C-2) A nucleic acid detection method comprising a step of hybridizing the third portion to a detection probe.

The nucleic acid detection method of this embodiment will be described with reference to FIG.
First, the miRNA 3, the detection probe 5 and the capture probe 4 ′ are brought into contact in the liquid phase (FIG. 2 (a)). Next, the second portion 2 is hybridized to the detection probe 5, the first portion 1 is hybridized to the capture probe 4 ′, and a nucleic acid-detection probe-capture probe complex is formed. The complex is irradiated with light and / or light of the second wavelength band to crosslink the first photoreactive base derivative 7a and miRNA3, and the second photoreactive base derivative 7b and miRNA3, respectively. (FIG. 2 (b)). Then, the capture probe 4 ′ is hybridized to the third portion 8b of the complex capture probe 8 immobilized on the substrate 6 ′, the labeling substance in the nucleic acid-detection probe-capture probe complex is detected, and the detection result MiRNA3 is detected from (Fig. 2 (c), Fig. 2 (d)).

  Of the probe not fixed to the substrate and the probe fixed to the substrate, the probe not fixed to the substrate tends to have a higher efficiency of hybridization with the nucleic acid. Therefore, as shown in this embodiment, after forming a nucleic acid-detection probe-capture probe complex using a capture probe that is not immobilized on the substrate, the complex is captured on the substrate, It is possible to increase the detection efficiency of nucleic acids. The third portion 8b of the complex capture probe 8 is longer than the first portion 1 of the miRNA 3 in order to increase affinity, for example, preferably 15 to 40 bases, from the viewpoint of specifically binding each capture probe. 18 to 25 bases are more preferable.

[Fourth embodiment]
In the method for detecting a nucleic acid of the present embodiment, in the step (c) of the first embodiment described above, the step selectively irradiates a partial region of the substrate with light of the first wavelength band, A step of cross-linking the photoreactive base derivative and the nucleic acid.
An example of the nucleic acid detection method of the present embodiment will be described with reference to FIGS. FIG. 3 is a schematic diagram illustrating an example of a fluidic device used in the nucleic acid detection method of the present embodiment. The fluidic device 201 includes a nucleic acid purification unit 203, a substrate 204 on which the capture probe is immobilized, a channel 206 that connects the nucleic acid purification unit 203 and the substrate 204, and a valve 204f on the channel 206. As shown in FIG. 4, different samples 1 to 3 are arranged in the nucleic acid purification units 203, 203 ′, and 203 ″, respectively. The substrate 204 is divided into three regions A to C. The sample contains miRNA to be detected, and the substrate 204 is in contact with a solution containing the detection probe. First, the valve 204f is opened, and the specimen 1 is fed to the substrate 204 (FIG. 4A). Then, only the region A is irradiated with light to crosslink the photoreactive base derivative and the miRNA to form a nucleic acid-detection probe-capture probe complex (FIG. 4B). Next, the valve 204f ′ is opened, and the specimen 2 is fed to the substrate 204. Then, only the region B is irradiated with light, and the photoreactive base derivative and the miRNA are cross-linked to form a nucleic acid-detection probe-capture probe complex (FIG. 4C).

  In this way, by irradiating only a partial region of the substrate with light, the photoreactive base derivative and the nucleic acid can be cross-linked only in the region of the substrate irradiated with light. Therefore, the capture probe in the region of the substrate that has not been irradiated with light can be maintained in a state where it can be used for nucleic acid detection. Multiple types of sample inspections containing nucleic acids to be detected can be performed sequentially using partial areas of the substrate without replacing the substrate, reducing the cost of substrate usage per inspection Can be made.

As another example, the timing of light irradiation on the substrate in one inspection may be changed for each partial region of the substrate. An example of the nucleic acid detection method of this embodiment will be described with reference to FIG. FIG. 5 shows 201 of the fluidic device. The same specimen 1 is arranged in the nucleic acid purification sections 203, 203 ′, 203 ″.
First, the valve 204f is opened, and the specimen 1 is fed to the substrate 204 (FIG. 5A). Then, only the region A is irradiated with light, and the photoreactive base derivative and the miRNA are cross-linked to form a nucleic acid-detection probe-capture probe complex (FIG. 5B). Then, only region B is irradiated with light to crosslink the photoreactive base derivative and miRNA to form a nucleic acid-detection probe-capture probe complex (FIG. 5 (c)). At this time, the valve 204f ′ may be opened and the specimen 1 may be sent again to the substrate 204.

When the amount of multiple target nucleic acids contained in a sample differs for each nucleic acid, the formation of a complex with a capture probe or a detection probe is completed quickly with a high content of target nucleic acid, and conversely with a low content of target nucleic acid Then, the completion of formation of the complex with the trapping lobe or the detection probe tends to be delayed. For this reason, it becomes difficult to simultaneously perform quantitative detection of target nucleic acids having different contents. On the other hand, in an example of this embodiment, by providing a time difference in the light irradiation to the substrate, hybridization is performed in the region of the substrate with a reaction time corresponding to the content and affinity of the target nucleic acid and the capture probe or the detection probe. It is possible to extend the range of target nucleic acid species that can be detected per substrate.
As a method for selectively irradiating a part of the substrate with light, a known pattern exposure method may be used. For example, a mask is disposed between the substrate and the exposure apparatus, and a reduction projection type exposure apparatus is used. Can be illustrated.

[Fifth embodiment]
The method for detecting a nucleic acid according to this embodiment is the method for detecting a nucleic acid according to the first embodiment described above, further comprising the step (e) of cleaving the bridge between the capture probe and the nucleic acid with a third wavelength band light. ,
Recovering the nucleic acid cleaved from the cross-link with the capture probe; and
It is what has.

In the present embodiment, the photoreactive base derivative is preferably a reversible photolinkable base. A reversible photolinkable base is a photolinkable base capable of reversibly causing photoligation and photodissociation with a nucleic acid, and the reversible photolinkable base is, for example, the wavelength used for photoligation. A base that reversibly photocouples and cleaves the miRNA 3 and the detection probe 5 and / or the capture probe 4 when irradiated with light of a wavelength band different from the band light. The third wavelength band light is a wavelength band light capable of cleaving a bridge between the capture probe and the nucleic acid. Examples of reversible photoligating base derivatives include psoralen added bases, ^CNV K, ^CV U, ^YCV U, α- ^C U, β- ^C U, ^V U, ^H U, ^HV U, ^BuV U, ^VZ A and the like.
As an example of the reversible ^{photolinkable} base, when ^CNV K is used, it can be efficiently crosslinked in a short time.
When ^CNV K is used as the photoreactive base derivative 7, a third photocleavable with light in the first wavelength band and / or light in the second wavelength band to be optically coupled to the complex of the miRNA 3 and the capture probe 4. A reversible crosslinking reaction is possible by irradiating with light in the wavelength band. ^{When CNV} K is used, the first and / or second wavelength band is light of 340 nm or more. As an example, configuration by irradiating a light in the wavelength band of ^340～380Nm, the atoms and ^CNV K constituting a pyrimidine base in mRNA3 forming a purine base and base pair adjacent to the 5 'side of the ^CNV K To form a cross-linked structure. The third wavelength band is light of less than 350 nm. As an example, the crosslinking is released by irradiating light with a wavelength band of 280 to 345 nm. It is assumed that the first and / or second wavelength band and the third wavelength band may partially overlap each other.
By using ^CNV K, high crosslinking efficiency is obtained by irradiating light of a predetermined wavelength band for a short time (for example, 30 seconds), and there is no possibility of damaging the nucleic acid to be irradiated. ^CNV K is excellent in that an efficient reversible crosslinking reaction is possible.

  In step (e), by cleaving the bridge between the capture probe and the nucleic acid, only the capture probe can be left on the substrate, and the substrate on which the capture probe is immobilized can be reused. Moreover, the nucleic acid dissociated from the substrate can be recovered by cleaving the bridge with the capture probe in the step (f). The collected nucleic acid may be analyzed again, and the nucleic acid can be detected with higher reliability by performing reanalysis.

  In the recovery of the nucleic acid, it is preferable that in the step (e), the bridge between the detection probe and the nucleic acid is further cleaved by the third wavelength band light. In addition, the target wavelength can be selectively recovered from the substrate by selectively irradiating a partial region of the substrate with the third wavelength band light.

≪Detection probe, capture probe, microarray, nucleic acid detection kit, nucleic acid-detection probe-capture probe complex, and nucleic acid immobilization carrier≫
The detection probe of the present embodiment is a detection probe used for detecting a nucleic acid composed of a first portion and a second portion in a nucleic acid sample, the two stem portions forming complementary strands, and the 2 A region between two stem parts, comprising a loop part labeled with a labeling substance and a sequence capable of hybridizing with the second part, and photoreactive in the sequence capable of hybridizing with the second part It includes a base derivative and has a 5 ′ protruding end or a 3 ′ protruding end, and is represented by the detection probe 5 described above.
In another embodiment, from the standpoint of individually detecting target nucleic acids, the detection probe may have the loop part label associated with the base sequence of the second part. The photoreactive base derivative contained in the detection probe is preferably photoligated and photocleavable in different wavelength bands. The nucleic acid is preferably miRNA.

  The capture probe of this embodiment is a capture probe used for detecting a nucleic acid consisting of a first portion and a second portion in a nucleic acid sample, and includes a sequence that can hybridize with the first portion. The sequence contains a photoreactive base derivative, and is represented by the capture probe 4 described above. The photoreactive base derivative contained in the capture probe is preferably photoligated and photocleavable in different wavelength bands. The nucleic acid is preferably miRNA.

The microarray of this embodiment can form a complex with a nucleic acid and a detection probe, and a capture probe containing a photoreactive base derivative in the sequence is fixed to the substrate.
The nucleic acid includes a first portion that can hybridize with the capture probe and a second portion that can hybridize with the detection probe;
The detection probe forms a stem loop structure, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance. The detection probe may include a photoreactive base derivative in the sequence capable of hybridizing with the second portion.
The detection probe is represented by the detection probe 5 described above, and the capture probe is represented by the capture probe 4 described above. Examples of the capture probe immobilized on the substrate include those described in the above << Method for detecting nucleic acid >>.

  The nucleic acid detection kit of this embodiment comprises a capture probe and a detection probe. The detection probe may include a photoreactive base derivative in the sequence capable of hybridizing with the second portion. Examples of the capture probe and the detection probe are the capture probe 4 and the detection probe 5 described above.

The nucleic acid-detection probe-capture probe complex of the present embodiment has a nucleic acid comprising a first part and a second part,
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
In a sequence comprising a sequence capable of hybridizing with the first part, and linked to a capture probe comprising a photoreactive base derivative in the sequence, wherein the detection probe is capable of hybridizing with the second part. Includes a photoreactive base derivative. Examples of the complex include the complex formed in the step (b) of the above-described << nucleic acid detection method >>, but the complex is not limited thereto.

  The nucleic acid-immobilized carrier of the present embodiment is one in which the nucleic acid-detection probe-capture probe complex described above is immobilized on a substrate. Examples include those in which the nucleic acid-detection probe-capture probe complex formed in step (b) or step (c) described in the embodiment is immobilized on a substrate.

≪Fluid device≫
[First embodiment]
The fluidic device of the present embodiment (for example, a microfluidic device (microTAS), a millifluidic device (milliTAS), etc.) includes a substrate on which a capture probe is immobilized and a detection probe introduction inlet. A fluidic device comprising:
The capture probe includes a sequence that can hybridize to the first portion when the target nucleic acid is divided into a first portion and a second portion, and includes a photoreactive base derivative in the sequence,
The detection probe includes a sequence that forms a stem-loop structure and can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance. In the fluidic device of this embodiment, it is preferable that the detection probe includes a photoreactive base derivative in a sequence capable of hybridizing with the second portion.
As the substrate on which the capture probe is immobilized, the above-described microarray can be exemplified.
FIG. 6 schematically shows the configuration of the fluidic device of the present embodiment. The fluidic device 11 includes a nucleic acid detection unit 104 having a substrate 104c on which a capture probe is immobilized and a detection probe introduction inlet 104a. The nucleic acid detection unit 104 may further include a sample introduction inlet 102b for introducing a nucleic acid sample.

According to this embodiment, since the photoreactive base derivative is contained in the capture probe, the nucleic acid can be quantified with higher accuracy.
In addition, according to this embodiment, since a nucleic acid is ligated using a photoreactive base derivative instead of using an enzyme, strict control of a nucleic acid ligation time, which is difficult to control by an enzyme reaction, and a fine range Each ligation reaction can be controlled. As described above, according to this embodiment, the temperature control is not required for the nucleic acid ligation reaction, and the ligation reaction can be easily controlled. The degree of freedom can be increased. In addition, the configuration of the fluid device necessary for strict control of the ligation reaction can be simplified.

[Second Embodiment]
The fluid device of the present embodiment is a device that detects a nucleic acid contained in an exosome in a sample as an example. As shown in FIG. 7, the fluid device 101 is modified with a compound having a hydrophobic chain and a hydrophilic chain. An exosome purification unit 102, a nucleic acid purification unit 103, and a nucleic acid detection unit 104 having the above-described layers are provided.

Abnormal cells such as cancer cells express specific proteins, nucleic acids, miRNA, and the like inside the cell membrane. The exosome secreted into the body fluid also expresses the miRNA derived from the secretory cell. Therefore, it is expected to establish a technique capable of examining abnormalities in a living body by analyzing a nucleic acid present in the membrane of an exosome in a body fluid without performing a biopsy test. The biopsy test refers to a clinical test for examining a disease diagnosis or the like by collecting tissue at a lesion site and observing the lesion site with a microscope.
Therefore, as an example, the fluidic device of this embodiment includes an exosome purification unit 102, a exosome purification unit 102, and a nucleic acid having a layer modified with a compound having a hydrophobic chain and a hydrophilic chain, as shown in FIG. A first flow path 105 that connects the purification section 103 and a second flow path 106 that connects the nucleic acid purification section 103 and the nucleic acid detection section 104 are provided.

In addition, from the viewpoint of preventing secondary infection due to the sample used for analysis, the fluid device 101 of this embodiment includes waste liquid tanks 107, 108, and 109 as shown in FIG. 7 as an example.
In FIG. 7, three waste liquid tanks are shown, but one or two waste liquid tanks may be combined.

The exosome purification unit 102 preferably includes an exosome fixing unit 102d having an inlet and a layer modified with a compound having a hydrophobic chain and a hydrophilic chain. As shown in FIG. 7, the exosome purification unit 102 preferably includes a sample introduction inlet 102b and a crushing liquid introduction inlet 102c (not shown), and more preferably a washing liquid introduction inlet 102a.
As shown in FIG. 7, in the analysis of exosomes, first, in the exosome purification unit described above, the sample is injected into the sample introduction inlet 102b, the valve 102f of the channel 102i is opened, and the sample is introduced into the exosome fixing unit 102d by suction. To do.

The sample is obtained from the environment surrounding the cell to be detected and is not particularly limited as long as it contains an exosome secreted by the cell. Blood, urine, breast milk, bronchoalveolar lavage fluid, amniotic fluid, Examples include malignant exudates and saliva. Among these, blood or urine that can easily detect exosomes is preferable. Furthermore, in blood, plasma is preferable because of easy detection of exosomes. Such samples also include cell culture fluids containing exosomes secreted by cultured cells.
The exosome in the sample introduced into the exosome fixing part 2d is captured by a compound having a hydrophobic chain and a hydrophilic chain.
Next, the exosome fixed to the exosome fixing part 102d is crushed. As shown in FIG. 7, the valve 102g on the flow path 102j (not shown) is opened, the crushed liquid is injected into the inlet 102c for introducing the crushed liquid, and the crushed liquid is introduced into the exosome fixing part 102d by suction. Examples of the crushing liquid include conventionally known ones used for cell lysis.
By passing the disruption solution through the exosome fixing part 102d, the exosomes captured on the exosome fixing part 102d are crushed and the nucleic acid encapsulated in the exosome is released. The nucleic acid released from the exosome is sent to the nucleic acid purification unit 103 through the first channel 105 via the valve 105a.

As shown in FIG. 7, the nucleic acid purification unit 103 preferably includes a nucleic acid recovery solution introduction inlet 103b and a nucleic acid immobilization unit 103c, and more preferably includes a nucleic acid washing solution introduction inlet 103a (not shown). .
The nucleic acid immobilization part 103c is not particularly limited as long as it can immobilize a nucleic acid, but an example thereof is a silica membrane that immobilizes a nucleic acid.

The exosome holds proteins and nucleic acids derived from the secretory cell. Examples of the nucleic acid include miRNA. In the present embodiment, the nucleic acid fixed by the nucleic acid fixing part 103c is preferably miRNA.
As the exosome disruption solution passes through the nucleic acid fixing part 103c, the nucleic acid is captured on the nucleic acid fixing part 103c.
Next, the nucleic acid fixed to the nucleic acid fixing part 103c is eluted. As shown in FIG. 7, the valve 103f of the flow path 103g is opened, the nucleic acid recovery liquid is injected into the nucleic acid recovery liquid introduction inlet 103b, and the nucleic acid recovery liquid is introduced into the nucleic acid immobilization part 103c. Next, the nucleic acid is recovered from the nucleic acid fixing unit 103c. The nucleic acid passes through the second channel 106 and is sent to the nucleic acid detection unit 104.

  Therefore, as described with reference to FIG. 6, the nucleic acid sample introduced from the sample introduction inlet 102b may be introduced directly into the nucleic acid detection unit 104. As another example, refer to FIG. As described above, the nucleic acid sample introduced from the sample introduction inlet 102b may be extracted from the exosome in the exosome purification unit, purified in the nucleic acid purification unit, and then introduced into the nucleic acid detection unit 104.

As shown in FIG. 8, the nucleic acid detection unit 104 may include a substrate 4c on a flow path including valves 4g and 4h. By providing a valve in the flow path of the nucleic acid detection unit 4 in this way, the nucleic acid detection unit 4 itself can be used as a solution mixer capable of quantifying the solution in the flow path.
It is preferable to supply the nucleic acid to the solution mixer 104 by closing the valves 104g and 104h in FIG. By doing so, the solution containing the nucleic acid is quantified in the flow path of the solution mixer.

  After the nucleic acid is sent to the solution mixer 104, the valve 104d is opened, the detection probe solution is injected into the detection probe introduction inlet 104a, and the detection probe solution is sent to the solution mixer 104. The detection probe solution is sent to the solution mixer 104 by closing the valves 104g and 104h in FIG. By doing so, the detection probe solution is quantified in the flow path of the solution mixer.

  Next, the valves 104d, 104e, 104f, and 112a are closed, the valves 104g and 104h are opened, and the nucleic acid and the detection probe solution are circulated and mixed in the solution mixer. As an example, opening and closing of a pump valve (not shown) is continued for about 10 minutes. By circulating the liquid, a complex (miRNA3-detection probe 5-capture probe 4 complex) is efficiently formed on the substrate in a short time. And light is irradiated to the board | substrate 4c in which the composite_body | complex was formed, and a photoreactive base derivative and miRNA are bridge | crosslinked.

  Next, it is preferable to wash the substrate on which the capture probe is immobilized to remove nonspecifically adsorbed substances on the substrate. By washing, the target miRNA and the detection probe crosslinked with the photoreactive base derivative can be arranged on the substrate 4c with higher purity. Therefore, it is preferable that the solution mixer 104 further includes a cleaning liquid introduction inlet 104b (not shown). The valve 104e (not shown) is opened, the cleaning liquid is injected into the cleaning liquid introduction inlet 104b, and introduced into the substrate.

Subsequently, the intensity | strength of the label | marker substance of the composite_body | complex formed on the board | substrate is measured. Since the intensity of the labeling substance reflects the abundance of the nucleic acid, according to the present embodiment, the amount of the nucleic acid contained in the sample can be quantified.
The measurement of the intensity of the labeling substance is performed by a control unit such as a microscope, a light source, a personal computer (not shown) as an example.

According to this embodiment, since the photoreactive base derivative is contained in the detection probe and the capture probe, the nucleic acid can be quantified with higher accuracy.
Furthermore, according to this embodiment, the analysis of exosomes, which conventionally required one day or more, can be quickly performed in only about one hour.

[Third embodiment]
The fluidic device of this embodiment is schematically shown in FIG. The fluidic device 101 ′ is a modification of the fluidic device 101 described above. The fluidic device 101 ′ can be suitably used for the nucleic acid detection method of the second embodiment of the above << Nucleic acid detection method >>. In this method, since the capture probe does not need to be immobilized on the solid phase, the detection probe 5 and the capture probe 4 are injected into the detection probe and the capture probe introduction inlet 104a ′, and introduced into the nucleic acid immobilization part 103c. -Form a detection probe 5 -capture probe 4 complex. Light is irradiated to the nucleic acid fixing part 103c to crosslink the photoreactive base derivative and the miRNA.

[Fourth embodiment]
The fluidic device of this embodiment is schematically shown in FIG. The fluidic device 101 ″ is a modification of the fluidic device 101 ′ described above. The fluid device 101 ′ can be suitably used for the nucleic acid detection method of the third embodiment of the above-mentioned << Nucleic acid detection method >>. In this method, a nucleic acid-detection probe-capture probe complex is formed using a capture probe that is not immobilized on the substrate, and then the complex is captured on the substrate. Accordingly, the fluidic device 101 ″ includes the substrate 104c ′ on which the complex capturing probe 8 is immobilized. The detection probe 5 and the capture probe 4 ′ are injected into the detection probe and capture probe introduction inlet 104a ′, and introduced into the nucleic acid immobilization part 103c to form a miRNA3-detection probe 5-capture probe 4 ′ complex. Light is irradiated to the nucleic acid fixing part 103c to crosslink the photoreactive base derivative and the miRNA. Thereafter, the miRNA3-detection probe 5-capture probe 4 ′ complex is sent to the substrate 104c ′, the labeling substance in the complex is detected, and miRNA3 can be detected from the detection result.

  EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited to a following example.

[Detection of miRNA in liquid phase]
MiR-141 and miR-200a were selected as target miRNAs to be detected. Both sequences are almost identical, but there is a difference of 2 bases. The materials shown below were outsourced to Tsukuba Oligo Service Co., Ltd., and synthesized according to the phosphoramidite method using an automatic nucleic acid synthesizer.
(Example 1)
As a target miRNA, RNA having the sequence of miR-141 was synthesized. In addition, two types of nucleic acid probes, a capture probe and a detection probe having a complementary sequence thereto, were designed and synthesized.
The sequences of the target miRNA, capture probe, and detection probe used are shown below.
(1) Target miRNA: miR-141 [Sequence: 5′-UAACACUGUCUGUGUAAGAUGGG-3 ′] (SEQ ID NO: 22mer)

(2) Capture probe-141 / 200a (Capture probe-141 / 200a) [sequence: 5′-X1- ^CNV K-X2-fS-3 ′] X1 and X2 represent the following sequences, and S represents a thiol group. And f represents 6-FAM (6-carboxyfluorescein).
X1: ACCAGACA (8mer)
X2: TGTTAACAACAACAACAACAACAACA (SEQ ID NO: 26mer)

(3) Detection probe-141 (Detect probe-141) [sequence: 5′-X3-Cy5-X4- ^CNV K-X5-3 ′]
X3, X4, and X5 represent the following sequences.
X3: CTCAACTGGGTGTGTGG (SEQ ID NO: 17 mer)
X4: GTCGGCATTCAGTTGAGCCA (SEQ ID NO: 4: 21mer)
X5: CTTT (4mer)
A hybridization reaction solution containing a target miRNA, a supplementary probe, and a detection probe with the composition shown in Table 1 was prepared.

The hybridization reaction solution described above was allowed to hybridize at room temperature for 1 hour while shaking on a shaker at a speed of 1000 rpm, and then the reaction solution was irradiated with 365 nm ultraviolet light (8 mW / cm ² ) for 60 minutes, miRNA and ^CNV K were covalently bound.

(Example 2)
As the target miRNA, RNA having the miR-200a sequence was synthesized. In addition, two types of nucleic acid probes, a capture probe and a detection probe having a complementary sequence thereto, were designed and synthesized.
The sequences of the target miRNA, capture probe, and detection probe used are shown below. In the detection probe-141 and the detection probe-200a, both base sequences are different by two bases, and the types of fluorescent labels are different.
(1) Target miRNA: miR-200a [sequence: 5′-UAACACUGUGUGGUAACGAUGU-3 ′] (SEQ ID NO: 5: 22mer)
(2) Capture probe-141 / 200a (Capture probe-141 / 200a) [sequence: 5′-X1- ^CNV K-X2-fS-3 ′]
X1 and X2 represent the following sequences, S represents a thiol group, and f represents 6-FAM (6-carboxyfluorothein).
X1: ACCAGACA (8mer)
X2: TGTTAACAACAACAACAACAACAACA (SEQ ID NO: 26mer)

(3) Detection probe-200a (Detect probe-200a) [sequence: 5′-X6-Cy3-X7- ^CNV K-X8-3 ′]
X6, X7, and X8 represent the following sequences.
X6: CTCAACTGGGTGTGTGG (SEQ ID NO: 6: 17mer)
X7: GTCGGCAATTCAGTTGAGACA (SEQ ID NO: 7: 21mer)
X8: CGTT (4mer)
Using these target miRNA, supplementary probe, and detection probe, a hybridization general-purpose solution was prepared in the same manner as in Example 1, followed by hybridization operation and ultraviolet irradiation.

  FIG. 11 shows the sequence of the target miRNA used in Example 1 and Example 2, and the sequence of the detection probe and the capture probe corresponding thereto.

(Comparative Example 1)
Hybridization and ultraviolet irradiation were performed in the same manner as in Example 1 except that miR-200a was used as the target miRNA and detection probe-141 was used as the detection probe.
(Comparative Example 2)
Hybridization and ultraviolet irradiation were performed in the same manner as in Example 1 except that miR-141 was used as the target miRNA and detection probe-200a was used as the detection probe.
(Comparative Example 3)
Hybridization was performed in the same manner as in Example 1 except that ultraviolet irradiation was not performed after hybridization.
(Comparative Example 4)
Hybridization was performed in the same manner as in Example 2 except that ultraviolet irradiation was not performed after hybridization.

(Measurement of formation rate of miRNA-C-probe-D-probe complex)
The samples obtained in Examples 1 and 2 and Comparative Examples 1 to 4 were electrophoresed on a denaturing acrylamide gel containing urea, and miRNA-C-probe-D-probe complex (Tertiary) was obtained from the intensity of the fluorescent image band. (complex) formation rate was examined. The photograph which synthesize | combined the fluorescence image of 6-FAM and Cy5 on a denaturation PAGE gel is shown in FIG. The fluorescence image was observed with a fluorescence imager (Molecular Imager FX, BioRad), and the excitation wavelength and the fluorescence filter were Cy3: 532 nm, 555 nm LP, Cy5: 635 nm, 690 nm BP, 6FAM: 488 nm, 530 nm BP, respectively. In addition, in the lanes of Example 2, Comparative Example 2, and Comparative Example 4 using the detection probe-200a labeled with Cy3, the tertiary complex and D-probe bands were slightly detected because of the fluorescence of Cy3-D-probe. Is considered to be leaking into the 6-FAM filter.

  FIG. 13 shows a fluorescence image obtained by observing the modified PAGE gel after electrophoresis with a Cy5 filter. A band considered to be miRNA-D-probe was seen slightly above the upper band of miRNA-C-probe.

  Then, the photograph which synthesize | combined the fluorescence image of 6-FAM and Cy3 is shown in FIG. The D-probe band was detected in the lanes of Example 1, Comparative Example 1 and Comparative Example 3 using the Cy5-labeled detection probe-141 because the Cy5-D-probe fluorescence was slightly in the Cy3 filter. It is thought that it is leaking.

Moreover, the fluorescence image observed with the Cy3 filter is shown in FIG.
The band of the miRNA-C-probe complex in FIG. 15 is a leakage of 6-FAM-C-probe fluorescence. In the lane of Example 2, a band of the miRNA-D-probe complex was seen slightly above.

  The complex formation rate was determined from the concentration of each band. The results are shown in Table 2. The middle (●) was calculated using D-probe fluorescence as an index, and the lower (*) was calculated using C-probe fluorescence as an index. The% in the table is the mol% with respect to the amount of the target miRNA, the complementary probe, and the detection probe in the hybridization reaction solution.

From comparison with Examples 1-2 and Comparative Examples 1-2, a ternary complex of C-probe-D-probe-miRNA is formed only when the sequences of miRNA and D-probe are completely complementary. It was shown that. The formation rate of the triplet complex after irradiation for 60 minutes was 7.0% for miR-141 and 5.3% for miR-200a. When the miRNA and D-probe sequences differ by 2 bases, no ternary complex was formed (the ternary complex formation rate was 0.2% or less of the detection limit). Thus, the supplemental probe and detection probe having a ^{CNV K,} is found to have sequence specificity, the use of the supplemental probe and detection probe having a ^{CNV K,} made the connection between the target nucleic acid and the nucleic acid probe with an enzyme It was shown that the nucleic acid can be quantified with such high accuracy that a difference between two bases can be detected.

  From the comparison with Examples 1-2 and Comparative Examples 3-4, in the case where ultraviolet rays were not applied (Comparative Examples 3-4), even if the sequences of miRNA and D-probe were completely complementary, they were completely on the modified PAGE gel. A ternary complex was not formed, and it was proved that the formation of the ternary complex was dependent on ultraviolet irradiation.

(Example 3)
Hybridization was performed in the same manner as in Example 1 except that ultraviolet irradiation was performed for 10 minutes after hybridization. The formation rate of the ternary complex of C-probe-D-probe-miRNA was 2.7%.
Example 4
Hybridization was performed in the same manner as in Example 2 except that ultraviolet irradiation was performed for 10 minutes after hybridization. The formation rate of the C-probe-D-probe-miRNA ternary complex was 2.5%.

[MiRNA detection on solid phase]
<Production of microarray>
First, the capture probe-141 / 200a was dissolved with the composition shown in Table 3 below.

  After standing at room temperature for 1 hour, DTT was removed using a NAP-5 column, equilibrated in 3 × SSC buffer, and the labeling rate of the fluorescent label was determined from the absorbance of the eluate. The label rate of Capture probe-141 / 200a was 87%.

  The capture probe-141 / 200a solution obtained by equilibrating in the above 3 × SSC buffer was mixed with Silane-PEG-Maleimide (MW 5000, manufactured by NANOCS) and allowed to stand at room temperature for 1 hour. Then, DTT was added to a final concentration of 10 mM, and the mixture was allowed to stand for 1 hour to obtain a probe-PEG solution. The composition of the probe-PEG solution is shown below.

  A solution containing a capture probe is prepared with the composition shown in Table 5 below, and the capture probe-141 / 200a shown in Table 5 is included on a glass substrate using an inkjet apparatus (LaboJet-500Bio manufactured by MicroJet). The solution was discharged.

The obtained substrate was kept at 25 ° C. under high humidity conditions (15 μl, in a chamber with 50 ° C. water) for 2 hours, and the capture probe-141 / 200a was reacted with the silanol group of the glass substrate. Slowly drop 100% acetone on the top, leave it for 1 minute, wash with ultrapure water, soak in 2x SSC, 0.1% SDS for 10 minutes, wash further, wash again with ultrapure water, and air dry. Thus, a microarray having a capture probe-141 / 200a immobilized on a glass substrate was obtained. The fixation density of the capture probe calculated from the fluorescence intensity of 6-FAM on the substrate was 2920 ± 359 copy / μm ² .

<Hybridization of miRNA>
(Example 5)
A 1.5x hybridization buffer containing the detection probe-141 was prepared with the composition shown in Table 6 below.

  Next, with the composition shown in Table 7 below, the target miRNA and the 1.5x hybridization buffer were mixed to prepare a mixture of hybridization buffer containing the target miRNA.

The obtained mixture containing the target miRNA and the detection probe was incubated at 95 ° C. for 5 minutes, then 300 μl each was dispensed into the holes of the PDMS chamber, covered with the microarray, and the mixture was applied to the microarray substrate. The mixture was contacted and incubated at room temperature for 15 minutes while shaking on a shaker at a speed of 1000 rpm. At this time, the substrate was irradiated with 365 nm ultraviolet rays (30 mW / cm ² ) for 15 minutes at the same time. The substrate is then immersed in a solution of 2 × SSC, 0.1% SDS, 25 ° C. for 10 minutes, further immersed in a solution of 0.2 × SSC, 25 ° C. for 10 minutes, and again in a solution of 0.2 × SSC, 25 ° C. for 10 minutes. Dipped for a minute and washed.

(Comparative Example 5)
Hybridization was performed in the same manner as in Example 5 except that the target miRNA (miR-200a) was used instead of the target miRNA (miR-141).

(Measurement of formation rate of miRNA-C-probe-D-probe complex)
The substrates after hybridization in Example 5 and Comparative Example 5 were dried and observed with a fluorescence microscope. The observation results are shown in FIG. The binding density of D-probe calculated from the fluorescence intensity of Cy5 in the image shown in FIG. 16 is 1.5 ± 0.25 copy / μm ^{2 in} the presence of miR-141 and 0.064 in the presence of miR-200a. It was ± 0.097 copy / μm ² (detection sensitivity or less), and there was a difference of at least 24 times. From this, it was shown that the nucleic acid probe having ^CNV K maintained the sequence specificity. As described above, by using the supplemental probe having immobilized ^{CNV K} in the detection probe and the substrate having a ^{CNV K,} without connection with the target nucleic acid and a nucleic acid probe with an enzyme, it can detect differences in two bases It was shown that nucleic acid can be quantified with such high accuracy.

[D-probe dissociation on a microarray substrate]
(Example 6)
Advantages of ^CNV K, include that by 312nm UV cleavable crosslinking between ^CNV K and bases. Using a UV irradiation device (manufactured by ATTO) on the microarray substrate after hybridization of the target miRNA and detection probe in Example 5 above, a microarray substrate is placed 1 cm above the glass surface of the device, and the substrate is irradiated with 312 nm UV light. Irradiated for 5 minutes. At this time, after ^CNV K was cleaved by ultraviolet irradiation, irradiation was performed in the presence of an 8M urea aqueous solution so that D-probe was easily dissociated from C-probe. The microarray substrate was washed with ultrapure water and then observed with a fluorescence microscope. FIG. 17 shows fluorescence images of the supplementary probe and the detection probe before and after 312 nm ultraviolet irradiation. No detection probe bound prior to irradiation was observed after irradiation.
On the other hand, the capture probe fixed on the glass substrate seemed darker than before the ultraviolet irradiation because the added fluorescent dye 6-FAM slightly absorbed 312 nm light and partly faded. It was observed that only the capture probe remained on the substrate. Therefore, the target miRNA and the detection probe were dissociated after quantification of the target miRNA, and it was confirmed that the DNA microarray on which the capture probe was immobilized could be reused.

  From the above results, according to the present embodiment, since the photoreactive base derivative is contained in the detection probe and the capture probe, the nucleic acid can be quantified with higher accuracy.

DESCRIPTION OF SYMBOLS 1 ... 1st part, 2 ... 2nd part, 3 ... miRNA, 4 ... Capture probe, 4a ... Spacer, 5 ... Detection probe, 5a ... Capture probe, 5b ... Array, 5c, 5d ... Stem part, 5e ... Loop part, 6, 6 '... substrate, 7a, 7a' ... first photoreactive base derivative, 7b, 7b '... second photoreactive base derivative, 8 ... complex capture probe, 8b ... third portion,
DESCRIPTION OF SYMBOLS 11,101 ', 101', 101 '' ... Fluid device, 102 ... Exosome refinement | purification part, 102a ... Inlet for washing | cleaning liquid introduction, 102b ... Inlet for sample introduction, 102c ... Inlet for crushing liquid introduction, 102d ... Exosome fixing | fixed part, 102e , 102f, 103f, 104d, 104f, 105a, 110a, 111a, 112a ... valve, 102h, 102i, 103g, 110, 111, 112 ... flow path, 103, 203 ... nucleic acid purification unit, 103b ... inlet for introduction of nucleic acid recovery solution , 103c ... Nucleic acid immobilization part, 104, ... Nucleic acid detection part, solution mixer, 104a ... Detection probe introduction inlet, 104c ... Substrate, 105 ... First flow path, 106 ... Second flow path, 107 ... First Waste liquid tank, 108 ... second waste liquid tank, 109 ... third waste liquid tank, 110 ... third flow 111, fourth channel, 112, fifth channel,
201 ... fluid device, 203, 203 ', 203 "... nucleic acid purification unit, 204 ... substrate, 204f, 204f', 204f" ... valve, 206 ... flow path

Claims (23)

(A) a nucleic acid sample containing a nucleic acid comprising a first part and a second part;
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
Contacting a capture probe comprising a sequence capable of hybridizing with the first portion, wherein the capture probe comprises a first photoreactive base derivative in the sequence;
(B) hybridizing the second part to the detection probe, hybridizing the first part to the capture probe, and forming a nucleic acid-detection probe-capture probe complex;
(C) hybridizing the first part to the capture probe and crosslinking the first photoreactive base derivative and the nucleic acid with light in a first wavelength band;
(D) detecting a labeling substance in the nucleic acid-detection probe-capture probe complex;
A method for detecting a nucleic acid, comprising:   The detection probe contains a second photoreactive base derivative in a sequence capable of hybridizing with the second portion, and in the step (c), the second portion is further hybridized with the detection probe. The method for detecting a nucleic acid according to claim 1, wherein the second photoreactive base derivative and the nucleic acid are cross-linked by second wavelength band light.   The nucleic acid detection method according to claim 1 or 2, wherein the capture probe is fixed to a substrate.   The method for detecting a nucleic acid according to any one of claims 1 to 3, wherein in the step (a), the solution includes a plurality of types of detection probes labeled with different types of labeling substances.   In the step (a), the nucleic acid sample contains a plurality of types of nucleic acids to be detected, and the 5 ′ end and 3 ′ of the capture probe are not overlapped so that the first parts of the plurality of types of nucleic acids do not overlap each other. The method for detecting a nucleic acid according to any one of claims 1 to 4, wherein which of the ends is fixed to the substrate is selected.   The step (c) is a step of selectively irradiating a part of the substrate with light of the first wavelength band to crosslink the photoreactive base derivative and the nucleic acid. The method for detecting a nucleic acid according to any one of the above.   The method for detecting a nucleic acid according to claim 1, wherein the first wavelength band light and the second wavelength band light have the same wavelength band.   The method for detecting a nucleic acid according to claim 1, wherein the first photoreactive base derivative and / or the second photoreactive base derivative is a reversible photoligating base. Cleaving a cross-link between the capture probe and the nucleic acid with a third wavelength band light; and
Recovering the nucleic acid cleaved from the cross-link with the capture probe; and
The method for detecting a nucleic acid according to any one of claims 1 to 8, which comprises:   The nucleic acid detection method according to any one of claims 1 to 9, wherein the first photoreactive base derivative and / or the second photoreactive base derivative undergoes photoligation and photocleavage in different wavelength bands.   The method for detecting a nucleic acid according to any one of claims 1 to 10, wherein the first photoreactive base derivative and / or the second photoreactive base derivative is 3-Cyanovinylcarbazole Nucleoside.   The method for detecting a nucleic acid according to any one of claims 1 to 11, wherein the nucleic acid is miRNA.   The method for detecting a nucleic acid according to any one of claims 1 to 12, wherein the capture probe and / or the detection probe includes LNA (Locked Nucleic Acid) or BNA (Bridged Nucleic Acid). A detection probe used for detecting a nucleic acid comprising a first part and a second part in a nucleic acid sample,
Two stem parts forming complementary strands;
A region between the two stem parts, and a loop part labeled with a labeling substance;
A sequence capable of hybridizing with the second portion, comprising a photoreactive base derivative in the sequence capable of hybridizing with the second portion, and having a 5 ′ protruding end or a 3 ′ protruding end. Feature detection probe.   The detection probe according to claim 14, wherein the label of the loop part is associated with the base sequence of the second part.   The detection probe according to claim 14 or 15, wherein the photoreactive base derivative undergoes photoligation and photocleavage in different wavelength bands.   The detection probe according to any one of claims 14 to 16, wherein the nucleic acid is miRNA. A capture probe that can form a complex with a nucleic acid and a detection probe and includes a photoreactive base derivative in the sequence is fixed to the substrate.
The nucleic acid includes a first portion that can hybridize with the capture probe and a second portion that can hybridize with the detection probe;
The detection probe has a stem-loop structure, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance. A nucleic acid detection kit comprising a capture probe and a detection probe,
The capture probe includes a sequence that can hybridize to the first portion when the target nucleic acid is divided into a first portion and a second portion, and includes a photoreactive base derivative in the sequence,
The detection probe includes a sequence that forms a stem-loop structure and can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance, Nucleic acid detection kit. Via a nucleic acid consisting of a first part and a second part,
A detection probe that forms a stem-loop structure and includes a sequence that can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance;
A nucleic acid-detection probe-capture probe complex comprising a sequence that can hybridize to the first portion, and a capture probe that includes a photoreactive base derivative in the sequence.   21. A nucleic acid-immobilized carrier, wherein the nucleic acid-detection probe-capture probe complex according to claim 20 is immobilized on a substrate. A fluidic device comprising a nucleic acid detector having a substrate on which a capture probe is immobilized and an inlet for introducing a detection probe;
The capture probe includes a sequence that can hybridize to the first portion when the target nucleic acid is divided into a first portion and a second portion, and includes a photoreactive base derivative in the sequence,
The detection probe includes a sequence that forms a stem-loop structure and can hybridize with the second portion, has a 5 ′ protruding end or a 3 ′ protruding end, and is labeled with a labeling substance, Fluid device.   The fluidic device according to claim 22, wherein the nucleic acid is a nucleic acid encapsulated by an exosome in a sample.