JP4465448B2 - Thermostable enzymes with phosphate group intramolecular transfer activity in sugar phosphate compounds - Google Patents

Description

  The present invention relates to a heat-resistant protein having a phosphate group intramolecular transfer activity in a sugar phosphate compound, a DNA encoding the protein, a recombinant DNA containing the DNA, a transformant having the recombinant DNA, and the transformation The present invention relates to a method for producing a protein having phosphoric acid group intramolecular transfer activity using a saccharide, and a method for producing a phosphoric acid group intramolecular transferase in a sugar phosphoric acid compound using the protein or the transformant.

  Examples of the enzyme having an intramolecular transfer activity of a phosphate group in a sugar phosphate compound include Pseudomonas aeruginosa (see Non-Patent Document 1), Vibrio furnissii (see Non-Patent Document 2), and Sphingomonas paucimobilis. The detailed properties of phosphorylated mannose-phosphate intramolecular transferase and phosphorylated glucose-phosphate intramolecular transferase (PMM / PGM) derived from (see Non-Patent Document 3) have already been reported. PMM / PGM is an essential enzyme for synthesizing mannose monophosphate and glucose monophosphate from mannose hexaphosphate and glucose hexaphosphate, and produces mannose monophosphate and glucose monophosphate using mannose hexaphosphate and glucose hexaphosphate as substrates. To do. In addition, enzymes that undergo intramolecular transfer of sugar phosphate compounds to phosphate groups have been found in humans, rabbits, and pathogenic bacteria, but many of them are derived from cold organisms, so they are extremely unstable at room temperature and above, and the activity is around 80 ° C. It is quickly deactivated by heat treatment. For this reason, treatment such as sterilization of the reaction system is necessary at the time of use, and careful storage at a low temperature is necessary.

Naught LE, Regni C, Beamer LJ, Tipton PA “Roles of active site residues in Pseudomonasaeruginosa phosphomannomutase / phosphoglucomutase” (2003) Biochemistry, 42, 9946-9951. Kim SH, Ahn SH, Lee JH, Lee EM, Kim NH, Park KJ, Kong IS “Geneticanalysis of phosphomannomutase / phosphoglucomutase from Vibrio furnissii and characterization of its role in virulence” (2003) Archives of Microbiology, 180, 240-250. Videira PA, Cortes LL, Fialho AM, Sa-Correia I “Identificationof the pgmG gene, encoding a bifunctional protein with phosphoglucomutase and phosphomannomutase activities, in the gellan gum-producing strain Sphingomonaspaucimobilis ATCC 31461” (2000) Applied and Environmental Mictobiology, 66 (5) , 2252-2258.

  An enzyme having a phosphate group intramolecular transfer activity in a sugar phosphate compound and having heat resistance is extremely useful. That is, if such an enzyme is discovered, it becomes possible to stably produce sugar phosphates, particularly sugar monophosphates, which are the basis of sugar nucleotides which are sugar chain synthesis substrates. In addition, in order to synthesize sugar nucleotides necessary as a substrate for sugar chain synthesis, it is possible to synthesize sugar phosphate compounds, especially sugar monophosphate, at low cost by combining sugar with heat-resistant sugar phosphorylase. It becomes. Enthusiastic enzymes that perform these reactions have been craved.

  Accordingly, an object of the present invention is to provide a novel enzyme having heat resistance and capable of intramolecular transfer of the phosphate group of sugar phosphate using sugar phosphate as a substrate.

In order to solve the above-mentioned problems, the present invention has focused on the hyperthermophilic archaeon Sulfolobus tokodaii that grows at 75-80 ° C., and has obtained a gene encoding a protein having this enzyme activity. Furthermore, the enzyme was produced from the gene using Escherichia coli, and it was confirmed that the enzyme was stably present at high temperature (80 ° C.) and exhibited a transphosphate activity of the sugar phosphate compound phosphate group. As a result, it was found that a sugar phosphate compound phosphoric acid group intramolecular transfer product is produced by using the above, and the present invention has been completed.

That is, the present invention relates to the following (1) to (10).
(1) has the amino acid sequence set forth in SEQ ID NO: 1, or has an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 1, and A protein having phosphoric acid group intramolecular transfer activity in a sugar phosphate compound.
(2) DNA encoding the protein according to (1) above.
(3) DNA having the base sequence described in (2) above.
(4) A DNA that hybridizes with the DNA of SEQ ID NO: 2 under a stringent condition and encodes a protein having a phosphate group intramolecular transfer activity in a sugar phosphate compound.
(5) A recombinant DNA, wherein the DNA according to any one of (2) to (4) above is incorporated into a vector.
(6) A transformant, wherein the recombinant DNA according to (5) is introduced into a host cell.
(7) The phosphoric acid in a sugar phosphate compound, wherein the transformant according to (6) above is cultured in a medium, and a protein having a phosphate group intramolecular transfer activity in the sugar phosphate compound is collected from the culture. A method for producing a protein having intramolecular translocation activity.
(8) Phosphate group intramolecular transfer in a sugar phosphate compound, wherein the protein described in (1) above is allowed to act on sugar hexaphosphate or sugar monophosphate to convert to sugar monophosphate or sugar hexaphosphate, respectively. Body manufacturing method.
(9) It is characterized in that the transformant described in (6) above is allowed to act on sugar hexaphosphate or sugar monophosphate to convert it into sugar monophosphate or sugar hexaphosphate, respectively. A method for producing a phosphoric acid group intramolecular transfer body in a sugar phosphate compound.
(10) The protein encoded by the DNA described in (3) or (4) above is allowed to act on sugar hexaphosphate or sugar monophosphate to convert it to sugar monophosphate or sugar hexaphosphate, respectively. A method for producing a phosphoric acid group intramolecular transfer product in a sugar phosphate compound.

  INDUSTRIAL APPLICABILITY According to the present invention, a novel phosphate group intramolecular transferase of sugar phosphate that can perform the phosphate group intramolecular transfer of sugar phosphate in a test tube and is stable to heat or the like can be provided. As a result, a novel sugar phosphate intramolecular transfer of the phosphate group became possible. On the other hand, sugar phosphate functions as a donor necessary for sugar nucleotide synthesis that functions as a sugar donor for glycosynthesis of glycoproteins, glycolipids, and polysaccharides. In recent years, it has been attracting attention as being closely related to cellular immunity and the like, and the present invention contributes extremely greatly in the development of these studies.

Below, this invention is demonstrated concretely.
The hyperthermophilic archaea used in the present invention is an acidophilic aerobic hyperthermophilic archaeon sulforobes, Toko Daii (JCM registration number JCM10545). The gene region estimated to show this enzyme activity from the whole genome information of this hyperthermophilic archaea was amplified and extracted by PCR reaction, inserted into the protein expression plasmid pET28a, and then transformed into this plasmid using E. coli transformed with that plasmid. Enzyme production was performed. The produced enzyme was isolated and purified by heat treatment and column chromatogram. The purified enzyme was found to be a protein having a molecular weight of about 50,000 and having phosphogroup intramolecular transfer activity of mannose monophosphate, glucose monophosphate and glucose hexaphosphate.
This enzyme was active in 50 mM MOPS buffer (pH 7.6) even after heating at 80 ° C. for 30 minutes or more, and showed high heat resistance.
The amino acid sequence of PMM / PGM (STPMM / PGM) possessed by the acidophilic aerobic hyperthermophilic archaea Sulfolobus and Tokodaii and the base sequence of the gene DNA (ST0242) are shown in SEQ ID NOs: 1 and 2, respectively.

The enzyme in the present invention is not limited to the one having the amino acid sequence shown in SEQ ID NO: 1 above, and is an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted or added in the amino acid sequence. However, the protein having this amino acid sequence includes those showing sugar phosphate compound phosphate group intramolecular transfer activity. In addition, these enzyme gene DNAs of the present invention are not limited to those having the base sequence shown in SEQ ID NO: 2 but include those encoding the amino acid sequence. Furthermore, DNA that hybridizes to the DNA shown in SEQ ID NO: 2 under stringent conditions and encodes a protein having a transphosphate activity of a phosphate group phosphoric acid group is also included .

  In order to obtain the enzyme of the present invention, ordinary genetic engineering techniques can be applied. The enzyme gene DNA is transformed into a protein expression plasmid vector such as pET28a or pHY481, and the transformant is cultured in a medium. The enzyme is purified and isolated from the culture, culture-treated product, or transformant separated and recovered from these cultures by conventional protein purification means. As the host cell, Escherichia coli, Bacillus subtilis and the like can be used.

In the present invention, this enzyme is further used to synthesize a phosphophosphate compound having a phosphate group intramolecularly transferred. In this synthesis, the enzyme is added to a solution containing saccharide hexaphosphate, and the reaction temperature is 60 to 95. Reaction is carried out at 0 ° C. to obtain sugar monophosphate. In addition, the enzyme is added to a solution containing sugar monophosphate and reacted at a reaction temperature of 60 to 95 ° C. to obtain sugar hexaphosphate.
Examples of the sugar hexaphosphate include glucose hexaphosphate, and examples of the sugar monophosphate include mannose monophosphate, glucose monophosphate, and the like.

This reaction formula is shown below for the synthesis of glucose monophosphate from glucose hexaphosphate.

In this reaction, not only the purified enzyme but also a crude enzyme may be used. For example, when a secretory system such as Bacillus subtilis is used as a host, the enzyme is produced and accumulated in the culture solution, and when a non-secretory system such as Escherichia coli is used, it is produced in the bacterial body. Sugar phosphate may be synthesized using a culture solution containing the present enzyme, a processed product thereof, or a cultured product such as a crushed bacterial cell.
Examples of the present invention will be shown below, but the present invention is not limited to the examples.

[Example 1]
Production of sugar phosphate compound phosphate group intramolecular transferase (1) Bacterial culture The acidophilic aerobic superthermophilic archaeon sulforobes, Tokodaii JCM10545 were cultured by the following method.
1.3 g of (NH ₄ ) ₂ SO ₄ , 0.28 g of KH ₂ PO ₄ , 0.25 g of MgSO ₄ .7H ₂ O, 0.07 g of CaCl ₂ .2H ₂ O, 0.02 g of FeCl ₃ .6H ₂ O, 1.8 mg MnCl ₂ 4H ₂ O, 4.5 mg Na ₂ B ₄ O ₇ · 10H ₂ O, 0.22 mg ZnSO ₄ · 7H ₂ O, 0.05 mg CuCl ₂ · 2H ₂ O, 0.03 mg Na ₂ MoO ₄・ 2H ₂ O, 0.03 mg VoSO ₄ xH ₂ O, 0.01 mg CoSO ₄ .7H ₂ O, 1.0 g yeast extract were dissolved in 1 liter of distilled water, and the pH of this solution was adjusted to 3.5 and 10N H ₂ Prepared with SO ₄ solution. After sterilization under pressure, JCM10545 was inoculated. This culture solution was cultured at 80 ° C. for 1-2 days, and then centrifuged to collect bacteria.

(2) Preparation of chromosomal DNA
The chromosomal DNA of JCM10545 was prepared by the following method.
After culturing, the cells are collected by centrifugation at 5,000 rpm for 10 minutes. The cells are washed with 10 mM EDTA (pH 6.0) solution, and then 50 mM Tris / HCl-50 mM EDTA (pH 8.5) solution is added to lyse the cells. Furthermore, 0.5% Na-lauroylsarcosinate and 1 mg / ml protease K are added to each, and then the mixture is incubated at 50 ° C. for 3 hours. After three phenol treatments, the solution is dialyzed against 10 mM EDTA (pH 8.0) solution. After degradation of RNA with RNase at 37 ° C. for 30 minutes, treatment with phenol chloroform solution is followed by dialysis against 10 mM Tris-1 mM EDTA (pH 8.0).

(3) Preparation of shotgun library clones containing chromosomal DNA Fragmentation of the chromosomal DNA obtained in step (2) above by sonication followed by 1 kb and 2 kb long DNA fragments by agarose gel electrophoresis Was recovered. A shotgun library was prepared by inserting this fragment into the HincII restriction enzyme site of plasmid vector pUC118. The terminal base sequence of each shotgun clone was decoded using an automatic base sequence reader 377 manufactured by ABI.

(4) Identification of the STPMM / PGM gene The genome sequence of the acidophilic aerobic hyperthermophilic archaeon Sulfolobus and Tokodaii determined by the above method will be analyzed by a large computer and may contain the functions of phosphomannomutase / phosphoglucomutase enzymes. A gene encoding the protein (ST0242) was identified. The start codon of the ST0242 gene of this hyperthermophilic archaeal sulfoborobus, Tokodaii was ATG, and was identified as a gene encoding a protein of 455 amino acid residues.

(5) Construction of expression plasmid DNA primers were synthesized for the purpose of constructing restriction enzyme (NdeI and XhoI) sites before and after the gene region, and restriction enzyme sites were introduced before and after the gene by PCR.

Upper primer,
5'- TTAATTC CATATG GGTAAGCTTTTTGGTACTGAC -3 '(SEQ ID NO: 3)
(Underlined indicates NdeI site)
Lower primer,
5'- ATATA CTCGAG TCATTTACCCTCTACAATC -3 '(SEQ ID NO: 4)
(Underlined portion indicates XhoI site)

After the PCR reaction combining the upper primer and the lower primer, complete digestion with restriction enzymes (NdeI and XhoI) (2 hours at 37 ° C.), and then the structural gene region fragment was purified.
PET28a (manufactured by Novagen) purified after digestion with restriction enzymes NdeI and XhoI, the above structural gene (ST0242) region fragment, and T4 ligase were used to react at 16 ° C. for 2 hours. A part of the ligated DNA was introduced into competent cells of E. coli DH5α to obtain transformant colonies. From the obtained colonies, the plasmid was purified by QIAprep Spin Miniprep Kit (manufactured by QIAGEN), and the nucleotide sequence was confirmed to obtain an expression plasmid, pET28a / ST0242. When the expression plasmid pET28a / ST0242 is used, STPMM / PGM is produced as a fusion protein with a histidine tag added to the N-terminus.

(6) Recombinant gene expression Thaw E. coli BL21-CodonPlus (DE3) -RIL (Novagen) competent cells and transfer 0.1 ml to a falcon tube. A solution corresponding to 10 ng of the above expression plasmid was added to the solution and allowed to stand in ice for 30 minutes. Then, heat shock was performed at 42 ° C. for 30 seconds, 0.9 ml of SOC medium was added thereto, and the mixture was shaken at 37 ° C. for 1 hour. Incubate. Thereafter, an appropriate amount was sprinkled on an LB agar plate containing kanamycin and cultured at 37 ° C. overnight to obtain transformant E. coli BL21-CodonPus (DE3) -RIL / pET28a / ST0242.

  The transformant was cultured in a kanamycin-containing LB medium (2 liters) with shaking overnight at 37 ° C., and then IPTG (Isopropyl-β-D-thiogalacopyranoside) was added to 1 mM, and further at 30 ° C. for 5 hours. Cultured with shaking. After culture, the cells were collected by centrifugation (6000 rpm, 20 minutes).

(7) Purification of STPMM / PGM enzyme
Bacteria collected from 2 liter culture solution are doubled in 20 mM sodium phosphate buffer (pH 7.4), 2 mg of Lysozyme (Wako) per gram of cell, 0.1 μg DNase I (Takara) Was added to obtain a suspension. After standing for 1 hour on ice, the mixture was sonicated and centrifuged (20,000 xg, 30 minutes) to obtain a supernatant. The obtained supernatant was heated at 80 ° C. for 30 minutes, and then centrifuged (20,000 × g, 30 minutes) to obtain a supernatant. This supernatant was adsorbed onto a HiTrap phenyl sepharose (Pharmacia) column equilibrated with 20 mM sodium phosphate buffer (pH 7.4) 0.5 M NaCl, and the imidazole concentration in the buffer was changed from 0.0 M to 0.5 M. The target protein was eluted by increasing it. Further, it was concentrated with Amicon® Ultra (manufactured by Millipore), and the buffer solution was exchanged with 50 mM MOPS buffer (pH 7.6) to obtain a purified sample.

[Example 2] Phosphorus group intramolecular transfer of glucose monophosphate (1) Phosphoric acid compound phosphoric group intramolecular transfer reaction
50 mM MOPS buffer (pH 7.6), 2 mM MgSO ₄ , 10 μM glucose 1,6-bisphosphate, 1 mM NADP (nicotinamide adenine dinucleotide phosphate oxidation type), 1 unit glucose hexaphosphate dehydrogenase, 0.4 mM glucose monophosphate, 3.5 μg of the purified enzyme obtained in Example 1 was added to 2,000 μl of the enzyme reaction solution consisting of The enzyme reaction solution was kept at 65 ° C. for reaction. By this reaction, the phosphate group of glucose monophosphate is transferred intramolecularly to produce glucose hexaphosphate.

(2) Measurement of sugar phosphate compound phosphate group intramolecular transfer reaction When converting glucose hexaphosphate, which is a reaction product of the reaction using this enzyme, to hexaphosphate gluconolactone by glucose hexaphosphate dehydrogenase, side reaction As nicotinamide adenine dinucleotide phosphate (NADP) changes from oxidized to reduced. The amount of change was measured using an ultraviolet / visible spectrophotometer as a change in absorbance at 340 nm. (See Non-Patent Document 4) The NADP oxidized and reduced forms have completely different absorbance profiles depending on the wavelength. In particular, since the absorbance at 340 nm is completely different, the amount of reduced NADP produced using the absorbance at this wavelength is quantified.
Therefore, for the sample reacted in (1), the reaction in (1) was analyzed using absorbance at 340 nm by an ultraviolet / visible spectrophotometer.

Klingenberg M “Methods of Enzymatic Analysis” (1974) Weinheim-Academic Press, New York, vol. 4, pp. 2045.

[Example 3] Phosphorus group intramolecular transfer of mannose monophosphate (1) Sugar phosphate compound Phosphoric group intramolecular transfer reaction
50 mM MOPS buffer (pH 7.6), 2 mM MgSO ₄ , 10 μM glucose 1,6-bisphosphate, 1 mM NADP, 1 unit glucose hexaphosphate dehydrogenase, 1 unit mannose hexaphosphate isomerase, 1 unit glucose hexaphosphate isomerase, 7.0 μg of the purified enzyme obtained in Example 1 was added to 2,000 μl of an enzyme reaction solution consisting of 0.4 mM mannose monophosphate. The enzyme reaction solution was kept at 65 ° C. for reaction. By this reaction, the phosphate group of mannose monophosphate is transferred intramolecularly to produce mannose hexaphosphate.

(2) Measurement of sugar phosphate compound phosphate group intramolecular transfer reaction Mannose hexaphosphate, which is a reaction product of the reaction using this enzyme, is converted to fructose hexaphosphate by mannose hexaphosphate isomerase, and fructose hexaphosphate is converted to glucose 6 When converted to glucose hexaphosphate by phosphate isomerase and converted to hexaphosphate gluconolactone by glucose hexaphosphate dehydrogenase, nicotinamide adenine dinucleotide phosphate (NADP) changes from oxidized to reduced as a side reaction To do. The amount of change was measured using an ultraviolet / visible spectrophotometer as a change in absorbance at 340 nm. (See Non-Patent Document 4) The NADP oxidized and reduced forms have completely different absorbance profiles depending on the wavelength. In particular, since the absorbance at 340 nm is completely different, the amount of reduced NADP produced using the absorbance at this wavelength is quantified.
Therefore, for the sample reacted in (1), the reaction in (1) was analyzed using absorbance at 340 nm by an ultraviolet / visible spectrophotometer.

[Example 4] Phosphorus group intramolecular transfer of glucose hexaphosphate (1) Phosphoric acid group phosphoric acid group intramolecular transfer reaction
Enzyme consisting of 50 mM MOPS buffer (pH 7.6), 2 mM MgSO ₄ , 10 μl glucose 1,6 bisphosphate, 0.4 mM TTP, 2.5 μg Sulphorobus tokodaiii RmlA (glucose-1-phosphate thymidylyltransferase), 1 mM glucose hexaphosphate 2.5 μg of the purified enzyme obtained in Example 1 was added to 2,000 μl of the reaction solution. The enzyme reaction solution was allowed to react at 80 ° C. for 30 minutes. After the reaction, the reaction was stopped by adding 100 μl of 500 mM potassium dihydrogen phosphate solution. By this reaction, the phosphate group of glucose hexaphosphate is transferred intramolecularly to produce glucose monophosphate.

(2) Measurement of sugar-phosphate compound phosphate group intramolecular transfer reaction
Using HPLC, glucose monophosphate, which is a reactive organism, was converted to TDP-glucose by RmlA, and the amount of TDP-glucose was measured based on the absorption of ultraviolet light at the nucleotide moiety. As shown in FIG. 1, TTP and TDP-glucose which are standard substances have completely different elution positions in HPLC. Therefore, the same analysis was performed on the sample reacted in (1) above by HPLC. As a result, as shown in FIG. 2, since TDP-glucose was surely found, the enzyme surely produced glucose monophosphate having the intramolecular phosphate group of glucose hexaphosphate transferred. Was confirmed.

[Example 5] Properties of enzyme (1) Protein chemical properties The enzyme was completely purified by the above purification process, and showed a single band with a molecular weight of about 50 KDa by SDS-PAGE (Fig. 3). The enzyme was composed of 455 amino acid residues (SEQ ID NO: 1), and the molecular weight predicted from the amino acid sequence was 50,102 Da. Moreover, although the homology with Pseudomonas PMM / PGM is low, the active center, the metal ion bond, and the motif involved in sugar recognition were preserve | saved (FIG. 4).

(2) Phosphate group intramolecular transfer activity of sugar phosphate of STPGM / PMM Using the enzyme purified in Example 1, the intramolecular transfer activity of the phosphate group possessed by glucose monophosphate and maltose monophosphate was obtained in Example 3. Measured according to 4. As a result, as shown in FIG. 5, an activity depending on the concentration of glucose monophosphate as a substrate was detected at 65 ° C. Further, as shown in FIG. 6, since the same activity was detected when mannose monophosphate was used as a substrate, it was confirmed that the enzyme had thermostable PGM / PMM activity. In addition, even when glucose hexaphosphate was used as a substrate, it was confirmed by the method of Example 4 that the intramolecular phosphate group was certainly transferred to the first position.

(2) Metal ion dependence
50 mM MOPS buffer, 10 μM glucose 1,6 bisphosphate, 1 mM NADP oxidized, 1 unit glucose hexaphosphate dehydrogenase, 0.4 mM glucose monophosphate in an enzyme reaction solution of 2,000 μl, 2 mM metal ions, magnesium, cobalt, 3.5 μg of the purified enzyme obtained in Example 1 was added to the enzyme reaction solution changed to manganese, nickel, and calcium. This enzyme reaction solution was allowed to react at 65 ° C. for 10 minutes, and the change in absorbance at 340 nm was measured with an ultraviolet / visible spectrophotometer as in Example 2. As shown in Table 1, the activity of this enzyme showed the highest activity in the presence of magnesium.

It is a figure which shows the separation / elution pattern in HPLC of TTP and TDP-glucose. It is a figure which shows the time-dependent change of TDP-glucose production. It is a figure which shows the polyacrylamide gel electrophoresis pattern of this purified enzyme. Conserved motifs such as active centers It is a figure which shows the time-dependent change of the light absorbency in wavelength 340nm when glucose monophosphate is used as a substrate. It is a figure which shows the time-dependent change of the light absorbency in wavelength 340nm when mannose monophosphate is used as a substrate.

Claims (6)

A protein comprising the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence in which one to several amino acid residues have been deleted, substituted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 1; characterized in that it comprises a 蛋 white matter that have a phosphoric acid group intramolecular transfer activity in phosphate compounds, phosphate glucose six phosphate, mannose six phosphate, or sugar phosphate compound selected from glucose monophosphate and mannose monophosphate Enzyme preparation for group intramolecular transfer . It contains a recombinant DNA that encodes a protein having a phosphate group intramolecular transfer activity in a sugar phosphate compound and that is controlled so that the DNA containing the base sequence described in any one of (1) to (3) below can be expressed. A nucleotide preparation for producing an enzyme preparation for transferring a phosphate group of a sugar phosphate compound selected from glucose hexaphosphate, mannose hexaphosphate, glucose monophosphate and mannose monophosphate;
(1) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 1,
(2) It has an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted or added to the amino acid sequence shown in SEQ ID NO: 1, and has a phosphate group intramolecular transfer activity in a sugar phosphate compound. DNA encoding a protein,
(3) A DNA having the base sequence of SEQ ID NO: 2 or a DNA that hybridizes with the DNA under stringent conditions and encodes a protein having a phosphate group intramolecular transfer activity in a sugar phosphate compound . It is selected from glucose hexaphosphate, mannose hexaphosphate, glucose monophosphate and mannose monophosphate, comprising a transformant introduced with the nucleotide preparation according to claim 2, or a culture solution or processed product thereof. An enzyme preparation for intramolecular transfer of a phosphate group of any sugar phosphate compound. Transformants nucleotides formulations described is introduced to claim 2 and culturing, characterized in that it comprises a protein having a phosphoric acid group intramolecular transfer activity in the sugar phosphate compounds taken from the culture, glucose six An enzyme preparation for intramolecular transfer of a phosphate group of any sugar phosphate compound selected from phosphoric acid, mannose hexaphosphate, glucose monophosphate and mannose monophosphate . A phosphate group molecule in a sugar phosphate compound, wherein the enzyme preparation according to claim 1 , 3 or 4 is allowed to act on sugar hexaphosphate or sugar monophosphate to convert to sugar monophosphate or sugar hexaphosphate, respectively. A method for producing a transfer product , wherein the sugar hexaphosphate is glucose hexaphosphate or mannose hexaphosphate, and the sugar monophosphate is glucose monophosphate or mannose monophosphate . Glucose six phosphate, mannose six phosphate, any sugar phosphate compound selected from glucose monophosphate and mannose monophosphate, characterized in that the action of the enzyme preparation according to claim 1, 3 or 4, wherein the sugar A method of causing intramolecular transition between the 1-position and the 6-position with respect to the phosphate group at the 1-position or 6-position in a phosphoric acid compound .