RU2413766C1 - Thermostable alcoholdehydrogenase from archaea thermococcus sibiricus - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention represents recombinant thermostable alcoholdehydrogenase TsAdh319 from archaea Thermococcus sibiricus, demonstrating activity in reactions of oxidation of alcohols and sugars to respective aldehydes and ketones and in reverse reactions of reduction of aldehydes and ketones at temperatures to 100°C. Alcoholdehydrogenase sequence consists of 234 amino acids and is represented in SEQ ID NO:2. Invention also relates to DNA, coding thermostable alcoholdehydrogenase, including nucleotide sequence SEQ ID NO:1.

EFFECT: thermostable alcoholdehydrogenase TsAdh319 can be used in biotechnical industry for organic synthesis of biologically active substances.

2 cl, 3 dwg, 4 tbl, 5 ex

Description

Application area

The invention relates to the field of biotechnology and relates to thermostable enzymes with activity of alcohol dehydrogenase. A new alcohol dehydrogenase from the archaea Thermococcus sibiricus and a method for its isolation are proposed.

Relevance

Enzymes - biocatalysts are widely used in various industries, agriculture and medicine. Alcohol dehydrogenases belong to the class of oxidoreductases; in the cell they participate in the detoxification and metabolism of ethanol and other alcohols, the synthesis of hormones, and the modification of proteins and polysaccharides. In vitro alcohol dehydrogenases catalyze the reversible oxidation of alcohols or the reduction of aldehydes and ketones.

Recently, alcohol dehydrogenases (EU 1.1.1.1) have attracted the attention of biotechnologists in the pharmaceutical, agrochemical and perfumery industries. Alcohol dehydrogenases are capable of converting prochiral ketones into optically active secondary alcohols, which are necessary further in the organic synthesis of drugs, hormones, and other biologically active substances. In contrast to chemical synthesis, the use of biocatalysts in stereoselective synthesis allows one to obtain a 100% pure optical isomer without impurities of another isomer in high yield and from available starting compounds. Examples include the synthesis of a key intermediate for drugs against Alzheimer's (S) -2-pentanol from 2-pentanone, the synthesis of the prostaglandin precursor (1S, 2R-cis-2-carboxymethyl-3-cyclopenten-1-ol lactone) (Machielsen et al ., 2006; Patel, 2004; Hummel and Kula, 1989).

However, the use of enzymes on an industrial scale requires overcoming a number of difficulties: reversibility of the reaction, the use of an expensive cofactor, and resistance to the action of organic solvents (these are either starting compounds or solvents for substrates) under high temperature conditions. The reversibility of the reaction is successfully overcome by an excess of the starting compounds; two approaches have been developed for cofactor regeneration: a double substrate system (balanced addition of the back reaction substrate) and a double enzymatic system (introducing another cofactor enzyme into the systems). The most unsolved problem remains the stability of the enzyme to organic solvents and high temperature. Therefore, the urgent task facing major research centers and leading biotechnological companies is the search for new alcohol dehydrogenases that have high thermal stability and resistance to organic solvents combined with high specific activity and stereoselectivity.

State of the art

The vast majority of enzymes currently used in the biotechnological industry are isolated from mesophilic organisms; therefore, they are unstable at high temperatures, sensitive to the action of organic solvents and the stage of immobilization on solid carriers. The discovery and study of thermophilic bacteria and archaea, the development of genomic technologies, has determined a new direction in the search for enzymes with the required properties among the proteins of these hyper-resistant microorganisms. With a general increased resistance to temperatures, pH, the presence of organic solvents, enzymes from thermo-, alkali- and acidophilic microorganisms, like their mesophilic analogues, have broad substrate specificity and use NAD (H) and NADP (H) as cofactors. The compact structure and increased rigidity of the protein globule allow immobilization without reducing the enzyme activity, and increase the reaction temperature to 80-90 ° C (Machielsen et al., 2006; Tripp et al., 1998).

Alcohol dehydrogenases catalyze the oxidation of alcohols to the corresponding aldehydes and ketones, as well as the reverse reduction reaction. As a cofactor, NAD, NADP, FAD or F ₄₂₀ / Zn / PQQ can be used. NADP-dependent alcohol dehydrogenases can be divided into four families: short-chain (about 250 a.k.), medium-chain zinc-containing (about 350 a.k.), long-chain iron-containing (350-550 a.k.) enzymes, as well as a family related Aldo-keto reductase. In the amino acid sequences of the enzymes of the first three groups, there is a Rossman motif (Rossmann and Argos, 1981), which provides NADP binding; in the fourth group, this motif is absent (Machielsen et al., 2006; Rondeau et al., 1992).

Representatives of all four groups of NADP-dependent alcohol dehydrogenases were found in the archaea genomes, but only a few enzymes were biochemically characterized. Most of them relate to medium chain zinc-containing enzymes, examples include alcohol dehydrogenases from Sulfolobus solfataricus (Raia et al., 2001; Giordano et al., 2005), Aeropyrum pemix (Hirakawa et al., 2004), Picrophilus torridus (Hess et al. , 2008), Sulfolobus tokodaii (Yanai et al., 2009), Thermoplasma acidophilum (Marino-Marmolejo et al., 2009). Several long-chain iron-containing enzymes have also been characterized, including alkclodehydrogenases from Thermococcus litoralis (Ma et al., 1994), Thermococcus strain AN1 (Li and Stevenson, 1997), Thermococcus hydrothermalis (Antoine et al., 1999) and one aldo-keto reductase from the archaea Pyrococcus furiosus (Machielsen et al., 2006).

Short chain alcohol dehydrogenases have several advantages over zinc and iron-containing enzymes: they are not sensitive to oxygen and the presence of metal acceptors does not reduce their activity. In addition, given the dependence of the resistance of the protein to organic solvents on its size, the smallest size of the protein globule among NAD (P) -dependent alcohol dehydrogenases gives preference to short-chain alcohol dehydrogenases in environments with a high content of organic liquids. The compact structure of such enzymes can also lead to their higher thermal stability, which was confirmed in the present invention. However, to date, only one short-chain alkholdehydrogenase from the thermophilic archaea, AdhA from Pyrococcus furiosus (van der Oost et al., 2001), has been characterized.

The present invention relates to the isolation and characterization of a new short-chain alkaldehydrogenase from the hyperthermophilic archaea Thermococcus sibiricus (Miroshnichenko et al., 2001), isolated from an oil well in Western Siberia.

Disclosure of invention

The analysis of the complete nucleotide sequence of the genome of the archaea T. sibiricus determined by us revealed the presence in the genome of this organism of at least three genes encoding short chain alkaldehydrogenases. One of these genes, Tsib_0319, having the nucleotide sequence of SEQ ID NO1, encodes a 234 amino acid protein with a calculated molecular weight of 26.2 kDa.

By culturing a recombinant E. coli Rosetta-gami strain (DE3) transformed with pET-15b vector containing the nucleotide sequence of SEQ ID NO 1, a new recombinant thermostable short-chain alcohol dehydrogenase TsAdh319 was isolated and purified by metal chelate chromatography and gel filtration the sequence of SEQ ID NO2. The functional characteristic of the enzyme showed that the recombinant alcohol dehydrogenase TsAdh319 uses NADP as a cofactor, has a broad substrate specificity: it oxidizes aliphatic, aromatic alcohols and polyols, while secondary alcohols are oxidized stereoselectively. In the reverse reaction, TsAdh319 can reduce aldehydes and ketones. The enzyme is resistant to high salt concentrations (up to 1 M NaCl), not sensitive to the action of EDTA and the presence of metal ions. The oxidative activity of TsAdh319 increases with temperature from 40 ° C to 100 ° C; the half-inactivation time at 100 ° C is one hour. Thus, among the known short-chain alcohol dehydrogenases, TsAdh319 has the highest temperature optimum and is the most thermostable.

A brief description of the drawings.

Figure 1. Expression of TsAdh319 in E. coli and protein purification.

The results of electrophoretic analysis of protein preparations are presented:

1 - total protein preparation isolated from cells of the Rosetta-gami strain (DE3) containing the plasmid pET_Tsib0319, 15 hours after the induction of TsAdh319 synthesis by adding 1 mM isopropyl-beta-D-thiogalactoside (IPTG) to the medium.

2 - TsAdh319 preparation after the purification step on a Hi-Trap chelating HP column affinity column.

3 - preparation TsAdh319 after the final stage of purification by gel filtration on a Superdex 200 column.

4 - molecular weight marker (PageRuler Unstained Protein Ladder, Fermentas).

Figure 2. The effect of pH on the activity of TsAdh319 alcohol dehydrogenase in the oxidation of 2-propanol (A) and the reduction of methylglyoxal (B).

Figure 3. The effect of temperature on the activity of alcohol dehydrogenase TsAdh319 (A) and the characteristic of its thermal stability (B).

The implementation of the invention

Example 1. Identification of the gene of short-chain alcohol dehydrogenase in the genome of the thermophilic archaea T. sibiricus.

The thermophilic archaea T. sibiricus (Miroshnichenko et al., 2001) was isolated from the water horizon of a high-temperature oil well in Western Siberia. We determined the complete nucleotide sequence of the genome of this microorganism, as a result of which protein-coding genes were identified (Mardanov et al., 2009). Comparison of the amino acid sequences of the predicted T. sibiricus proteins with the amino acid sequences presented in GenBank revealed the presence of at least three short-chain alcohol dehydrogenase genes in the T. sibiricus genome. The amino acid sequence of the product of one of these genes, Tsib_0319, has 85% identity with the AdhA alcohol dehydrogenase sequence from P. furiosus (van der Oost et al., 2001).

Like most known short-chain alkogoldehydrogenases, TSIB_0319 includes two functional domains, the N-terminal NADP - binding domain and the C-terminal substrate-binding domain. Like AdhA from P. furiosus, the N-terminal domain TSIB_0319 contains a conserved motif (Gly8-X-X-X-Glyl2-X-Glyl4), characteristic of NAD (P) binding sites (Kallberg and Persson, 2006). In the C-terminal domain TSIB_0319 and AdhA, catalytic residues Asp59, Tyr150, and Lys154 (AdhA numbering) are included in the active center of short chain alcohol dehydrogenases.

Example 2. Obtaining a strain of E. coli - producer of alcohol dehydrogenase, isolation and purification of the enzyme.

Primers TSIB0319-XhoI (GTTCTCGAGATGAAGGTTGCTGTGATAACAGGG) and TSIB0319-BamHI (GCTGGATCCTCAGTATTCTGGTCTCTGGTAGACGG) were used for PCR amplification of the full-length Tsib_0319 s gene, T. template was used. The resulting fragment was treated with restriction enzymes XhoI and BamHI and cloned at the XhoI and BamHI sites in the expression vector pET-15b, allowing expression of the target protein fused to 6 amino acid residues of histidine at the N-terminus. As a result, the expression vector pET_Tsib0319 was obtained, providing the production of the recombinant enzyme, TsAdh319, containing the N-terminal (His) ₆ tag, polylinker and the sequence TSIB_0319.

For the production of recombinant alcohol dehydrogenase TsAdh319, the E. coli Rosetta-gami strain (DE3) was transformed with the expression vector pET_Tsib0319. The indicated strain containing pET_Tsib0319 was grown in LB medium with the addition of ampicillin (100 mg / l) and chloramphenicol (20 mg / l) on a shaker at 37 ° C until the middle of the logarithmic growth phase (OD ₆₀₀ ~ 0.5), then the synthesis of recombinant protein was induced introducing isopropyl-β-D-thiogalactopyranoside (IPTG) up to 1 mm, and continued to grow the culture for 15 hours at 37 ° C.

Producer strain cells were harvested by centrifugation, resuspended in buffer containing 50 mM Tris (pH 7.5), 200 mM NaCl, 20 mM imidazole, 10% (v / v) glycerol, 10 mM β-mercaptoethanol, 0.1% (v / v) Triton X-100, ImM PMSF, and lysed by sonication. The cell extract was centrifuged for 25 min at 10,000 g, the supernatant was applied to a Hi-Trap chelating HP affinity column (1ml), equilibrated with buffer containing 50 mM Tris (pH 7.5), 500 mM NaCl, 20 mM imidazole with 0.1% addition (v / v) Triton X-100. The recombinant TsAdh319 protein containing (His) ₆ tag was eluted with a linear gradient (20 to 500 mM) of imidazole in the same buffer without the addition of Triton X-100. The active fraction was further concentrated in centrifugal concentrators (Millipore) and the gel was purified by filtration on a Superdex 200 10/300 GL column (Amersham), equilibrated with buffer containing 50 mM Tris (pH 7.5) and 200 mM NaCl. The pure active preparation TsAdh319 was stored at 4 ° C in the same buffer.

The homogeneity of the TsAdh319 preparation and the correspondence of the molecular weight of the recombinant protein to the calculated value of 28.7 kD was confirmed by SDS / PAGE (Fig. 1).

Example 3. Substrate specificity and kinetic characteristics of TsAdh319.

Short chain alcohol dehydrogenases belong to the family of NADP-dependent oxidoreductases, which in the direct reaction oxidize alcohols to aldehydes and ketones, and in the opposite, they reduce aldehydes and ketones to alcohols.

To characterize the substrate specificity of the TsAdh319 enzyme in the direct oxidation reaction, a number of primary, secondary, aromatic alcohols, polyols and sugars were used (Table 1). Reactions were carried out at a temperature of 60 ° C in 50 mM glycine / NaOH buffer pH 10.5 with the addition of 0.3 mM NADP and substrate at a concentration of 250 mM (mono and disaccharides at a concentration of 50 mM). The reaction was initiated by adding 15-35 μg of the enzyme in 2 ml of thermostated reaction mixture. The reaction rate was monitored by reconstructing NADP at a wavelength of 340 nm using a Helios Alfa spectrophotometer (Thermosystems) equipped with a thermostatically controlled cell compartment. The unit of activity was taken as the amount of enzyme required for oxidation (or reduction in the reverse reaction) of 1 μmol NADPH (or NADP) per minute. Under the above conditions, for the direct reaction, linearity was observed in the range of the enzyme concentration of 7–40 μg / ml in the reaction mixture, which made it possible to further analyze the rates of both the direct and reverse reactions according to the Michaelis-Menten scheme. It was found that the enzyme has a broad substrate specificity. In the oxidation reaction, the highest activity was observed with 2-propanol (V _max , 1.1 u / mg) and benzyl alcohol. TsAdh319 was also highly active in the oxidation reactions of D-arabinose and D-xylose at substrate concentrations 5 times lower than in the standard reaction with 2-propanol (Table 1). Oxidation of 2-propanol in the presence of NAD was not observed, which confirmed the specificity of alcohol dehydrogenase to NADP.

Alcohol dehydrogenase TsAdh319 has stereoselectivity, as evidenced by the twice higher rate of enzymatic oxidation of (S) - (+) - 2-butanol compared to (RS) - (±) -2-butanol. An even higher stereoselectivity was shown in the oxidation reaction of monosaccharides (10-fold difference in activity relative to D- and L-arabinose, Table 1).

Table 1. The activity of alcohol dehydrogenase TsAdh319 in oxidation reactions. Substrate Relative activity (%) Methanol 0 2-methoxyethanol 0 Ethanol 36 1-butanol 80 2-propanol one hundred (RS) - (±) -2-butanol 86 (S) - (+) - 2-butanol 196 2-pentanol 67 1-phenylmethanol 180 1.3-butanediol 91 Ethylene glycol 0 Glycerol 16 D-arabinose 200 L-arabinose 17 D-xylose 246 D-Ribose 35 D-Glucose 146 D-mannose 48 D-galactose 0 Cellobiosis 71

The reduction reactions were carried out at a temperature of 60 ° С in 100 mM sodium phosphate buffer pH 7.0 with the addition of 0.3 mM NADPH and substrate at a concentration of 250 mM (monosaccharides at a concentration of 50 mM). The reaction was initiated by the addition of an enzyme (20-40 μg) in 2 ml of a pre-thermostated reaction mixture. The reaction rate was monitored by the oxidation of NADPH at a wavelength of 340 nm. The substrate specificity of TsAdh319 was determined by the reduction of aldehydes, ketones, monosaccharides, etc. (Table 2). The enzyme showed maximum activity in the reduction reaction of dimethylglyoxal (5.6 units / mg) and methylglyoxal (2.2 units / mg). Unlike the direct oxidation reaction, TsAdh319 was not active in the reduction reaction of monosaccharides (Table 2). Table 3 presents the kinetic characteristics of TsAdh319, determined for reactions with the most efficiently used substrates.

Table 2. Alcohol dehydrogenase TsAdh319 activity in reduction reactions. Substrate Relative activity (%) Methylglyoxal one hundred Dimethylglyoxal 270 Glyoxalic acid 36 Acetone 0 Cyclopentanone 0 Cyclohexanone four 3-methyl-2-pentanone 13 D-arabinose 0 D-Xylose 0 D-Glucose 0 Cellobiosis 0

Table 3. Kinetic characteristics of alcohol dehydrogenase TsAdh319. Cofactor or substrate K _m (mM) V _max (u / mg) k _cat (s ^-1 ) NADP ^a 0.022 ± 0.002 0.94 ± 0.02 0.45 ± 0.01 NADPH ^b 0.020 ± 0.003 3.16 ± 0.11 1.51 ± 0.05 2-propanol 168 ± 29 1.10 ± 0.09 0.53 ± 0.04 D-Xylose 54.4 ± 7.4 1.47 ± 0.09 0.70 ± 0.04 Methylglyoxal 17.75 ± 3.38 4.26 ± 0.40 2.04 ± 0.19 ^and 2-propanol was used as a substrate. ^b Methylglyoxal was used as a substrate.

Example 4. The effect of pH, the concentration of salts, metal ions and chelating agents on the activity of TsAdh319 alcohol dehydrogenase.

To determine the pH optimum of the oxidation and reduction reactions (with 2-propanol and methylglyoxal, respectively), phosphate (100 mM, pH range 5.0–8.5) or glycine (50 mM, pH range 8.5–11.0) buffers were used; the reaction was carried out under standard conditions at 60 ° C. It was found (figure 2) that the alkaline pH is required for the alcohol oxidation reaction (more than 10, optimum at pH 11). The reduction reaction has a relatively narrow pH range near neutral (optimum at pH 6.5-8.5). The effect of salts on enzyme activity was characterized under standard reaction conditions in the presence of 200-600 mM NaCl or KCl. It was found that the enzyme activity is not only not inhibited by salts, but that an increase in the concentration of NaCl to 600 mM doubles the rate of oxidation of 2-propanol (Table 4) and the reduction of methylglyoxal, a smaller effect was observed with the addition of KCl.

Table 4. The effect of salts, metal ions and chelating agents on the activity of TsAdh319 alcohol dehydrogenase. added substance concentration (mm) Relative activity (%) - - one hundred NaCl 200 160 400 206 600 227 Kcl 600 147 MgCl ₂ 10 78 CoCl ₂ 10 105 NiSO ₄ 10 one hundred ZnSO ₄ 10 79 FeSO ₄ 10 74 EDTA one one hundred 5 80

To study the possible effect of metal ions on the activity of TsAdh319, the enzyme was preincubated in a buffer containing 10 mM of the corresponding metal salt, and then the enzyme activity was determined in the standard reaction at 60 ° C in the presence of 1 mM metal salt. It was found (Table 4) that the divalent cations Mg ⁺² , Zn ⁺² , Fe ⁺² Ni ⁺² and Co ⁺² do not have a significant inhibitory or activating effect on the activity of TsAdh319 in the oxidation reaction. To assess the effect of chelating agents on the activity of TsAdh319, EDTA was added to the reaction at a concentration of 1 or 5 mM. It was found that EDTA does not have a significant effect on enzyme activity.

Example 5. The temperature optimum and thermal stability of alcohol dehydrogenase TsAdh319.

The temperature dependence of the enzymatic activity of TsAdh319 was determined in the oxidation reaction of 2-propanol. The reaction was carried out in 50 mM glycine / NaOH buffer pH 10.5, 0.3 mM NADP and 250 mM isopropanol at different temperatures; the change in optical density at a wavelength of 340 nm was recorded for 2 min. The reaction was initiated by adding 20 μg of the enzyme to the pre-thermostated reaction mixture. It was found (Figa) that the activity of TsAdh319 in the oxidation reaction of isopropanol continuously increases with increasing temperature from 40 ° C (0.09 units / mg) to 100 ° C (7.3 units / mg). Thus, the temperature optimum of the enzyme exceeds 100 ° C.

To characterize the thermal stability of TsAdh319 alcohol dehydrogenase, an enzyme solution (0.4 mg / ml) in a buffer containing 50 mM Tris (pH 7.5) and 200 mM NaCl was incubated for different times at temperatures of 70, 80, 90, or 100 ° С. After incubation, the activity of TsAdh319 was determined in the standard oxidation reaction of 2-propanol at 60 ° C (Fig.3b). It was shown that the enzyme has high thermal stability: incubation at 70 ° C or 80 ° C not only does not reduce, but even increases the activity of the enzyme. The half-inactivation time of TsAdh319 at a temperature of 90 ° С is 2 hours, and at a temperature of 100 ° С - 1 hour. Thus, among the known short-chain alcohol dehydrogenases, TsAdh319 has the highest temperature optimum and is the most thermostable.

BIBLIOGRAPHY

Claims (2)

1. Recombinant thermostable alcohol dehydrogenase TsAdh319 from the archaea Thermococcus sibiricus, which is active in the oxidation of alcohols and sugars to the corresponding aldehydes and ketones and in the reverse reactions of the reduction of aldehydes and ketones at temperatures up to 100 ° C, consisting of 234 amino acids and containing the amino acid sequence of SEQ ID NO : 2, obtained from a recombinant strain of Escherichia coli. 2. The selected DNA nucleotide sequence encoding the thermostable alcohol dehydrogenase according to claim 1, including the nucleotide sequence of SEQ ID NO: 1.

Images