JP2023003669A - Bmpr2 production enhancers, angiogenic agents, agents for improving skin color unevenness due to skin redness decrease - Google Patents

Abstract

To provide borage extract-containing agents for enhancing BMPR2 production, enhancing angiogenesis, improving color unevenness due to declined skin redness.SOLUTION: The invention relates to cosmetics, drugs, quasi drugs and food comprising a borage extract aiming at healthy good complexion by enhancing angiogenesis. The borage extract of the invention has excellent BMPR2 production enhancing effect and exhibits improvement of color unevenness due to declined skin redness by preventing decline of capillary angiogenesis in the dermal papillary layer caused by aging or UV.SELECTED DRAWING: Figure 1

Description

TECHNICAL FIELD The present invention relates to a BMPR2 production promoter, angiogenesis promoter, and an agent for improving uneven skin color by reducing skin redness, which are characterized by containing a borage extract.

Due to aging, ultraviolet rays, etc., the color of the skin becomes uneven. Skin with a uniform skin color, that is, skin without color unevenness, looks youthful and attractive. Therefore, there is a high demand for cosmetics that make the skin tone uniform, and many products that correct the appearance of skin tone, such as foundations and concealers, are on the market. On the other hand, it is also desired to improve the color of the skin itself instead of covering it with make-up cosmetics.

Skin color is mainly associated with the brown color of melanin and the red color of hemoglobin. Skin redness is caused by abnormal expansion of capillaries in the skin due to inflammation or the like. On the other hand, when the angiogenesis of capillaries in the papillary dermis does not occur due to aging, ultraviolet rays, or the like, the healthy complexion is lost. That is, skin redness is caused by non-uniformity caused by partial dilation or disappearance of capillaries in the skin.

In recent years, studies on factors regulating angiogenesis have progressed and are used for treatment. In diseases such as arteriosclerosis obliterans, ischemic cardiomyopathy, congestive heart failure, etc., where improvement of blood circulation is considered essential, tissue damage and necrosis can be reduced by promoting angiogenesis from the tissue surrounding the ischemic area. Alternatively, attempts have been made to protect the functions of organs (Non-Patent Document 1).

Vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) are known as factors that promote angiogenesis, and these growth factors and their genes are being used to treat diseases that require improved blood circulation. However, since these growth factors are proteins, there are problems such as difficulty in oral administration and ensuring the safety of gene therapy using viruses as vectors.

Bone morphogenic protein (BMP) is known as a protein involved in the process of differentiating multipotent mesenchymal stem cells into osteoblasts, mineralization, and bone formation. BMPs belong to the transforming growth factor β (TGFβ) superfamily, and 14 types of ligands (BMP2, BMP4, BMP7, etc.) and 2 types of receptors (BMPR1, BMPR2) have been identified (Non-Patent Document 2). , 3). In addition to cell differentiation and osteogenesis, BMPs have been shown to have a wide range of physiological functions, including being involved as regulatory factors in cell proliferation, organogenesis, organogenesis, and apoptosis (Non-Patent Document 4). ).

Recent studies have focused attention on the BMP family as factors that play an important role in angiogenesis, and it has been found that the ligand BMP4 is involved in angiogenesis in the same way as VEGF and angiopoietin (Non-Patent Document 5). ). In addition, the receptor BMPR2 is present on vascular endothelial cells and mediates signal transduction of BMP2, BMP4 and BMP6 (Non-Patent Document 6). As described above, BMP4 and BMPR2 are known to be involved in angiogenesis, and their application to cardiomyocyte extraction kits (Patent Document 1) is known. However, its application to healthy complexion of the skin by promoting angiogenesis has not been studied.

One of the causes of skin color unevenness is increased redness due to abnormal dilation of capillaries in the skin due to inflammation or the like. This involves an increase in endothelin B receptors present on capillaries. On the other hand, another factor is a decrease in redness due to the failure of angiogenesis of capillaries in the papillary dermis due to aging, ultraviolet rays, or the like. This involves the reduction of BMPR2 present on capillaries.

Borago is a plant belonging to the genus Borago of the family Boraginaceae of the Labiatae order, and is a kind of herb, scientific name: Borago officinalis. It is native to the Mediterranean coast of central Europe. So far, cosmetic compositions, bath agent compositions and cleaning compositions characterized by containing a borage extract (Patent Document 2), skin cosmetics (Patent Document 3), collagen production promoters, MMP inhibitors, etc. agents, melanogenesis inhibitors, cell proliferation promoters, antioxidants, wrinkle-improving agents (Patent Document 4), and the like. However, BMPR2 production promoters, angiogenesis promoters, and color unevenness-improving agents for reducing skin redness, which are characterized by containing a borage extract, are not known. In addition, the effect of borage extract on promoting BMP, VEGF and bFGF production is not known.

WO2016/104614 JP 2001-122730 Japanese Patent Laid-Open No. 9-278641 JP 2020-2053

Osamu Shintani et al., Angiology, 46, 289-295 (2006) Shizuka Yamada et al., Biomedical Engineering, 44(4), 490-495 (2006) Yuji Mishina, Seikagaku, 89(3), 400-413 (2017) Masatake Izumi et al., Journal of Dentistry, 102(10), 764-771 (2002) Yuka Suzuki, PhD (medical) thesis, University of Tokyo, Ko No. 25919, ID 500000536037 Liam A Hurst et al, Nat. Commun. , 8, 14079 (2017)

The problem to be solved by the present invention is to find a plant-derived component that promotes BMPR2 production, and use this as an active ingredient, which has a clear action point and is an excellent BMPR2 production promoter, angiogenesis promoter, and skin redness. An object of the present invention is to provide a color unevenness improving agent by reduction.

The present inventors have made intensive studies to solve the above problems, and as a result, have found that a borage extract has an excellent effect of promoting BMPR2 production. Furthermore, the present inventors have found that a composition containing a borage extract has an excellent effect of promoting BMPR2 production, promoting angiogenesis, and improving color unevenness by reducing skin redness, and have completed the present invention. .

That is, the present invention relates to a BMPR2 production promoter, an angiogenesis promoter, and an agent for improving color unevenness by reducing skin redness, which are characterized by containing a borage extract.

The present invention includes the following inventions.
(1) A BMPR2 production promoter characterized by containing a borage extract.
(2) The BMPR2 production promoter according to (1), which promotes BMPR2 production in vascular endothelial cells.
(3) An angiogenesis promoter characterized by containing a borage extract.
(4) An agent for improving skin unevenness by reducing redness, which is characterized by containing a borage extract.

The borage extract of the present invention was excellent in the effect of promoting BMPR2 production. In addition, the BMPR2 production promoter, the angiogenesis promoter, and the uneven color improvement agent by reducing skin redness, which are characterized by containing this extract, are safe and provide a healthy complexion of the skin by promoting angiogenesis. Excellent adjustment effect.

Fig. 10 is a micrograph showing a comparative study of cell migration after adding a borage extract after irradiating human vascular endothelial cells (HUVEC) with UVA in Experimental Example 3, reseeding the cells in a Boyden chamber.

Fig. 10 is a micrograph showing comparison and examination of angiogenesis by adding a borage extract to the upper part of the model after irradiating UVA to the three-dimensional blood vessel model in which the blood vessel structure was constructed in Experimental Example 4; The dotted line in the figure is the top of the gel, indicating that angiogenesis occurred up to that position. Also, the arrows in the figure indicate that the top of the gel moved in the direction of the arrow.

BMPR2 in the present invention is a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine threonine kinases. Also known as bone morphogenetic protein receptor 2, bone morphogenetic protein receptor type II, bone morphogenic protein receptor type 2, bone morphogenic protein type II receptor, BMR2, PPH1, BMPR3, BRK-3, POVD1, T-ALK, BMPR-II Also called

Vascular endothelial cells in the present invention are cells that coat the lumen of blood vessels in a single layer.

Angiogenesis in the present invention is a phenomenon in which new vascular branches branch from existing blood vessels to construct a vascular network.

In the present invention, uneven skin tone due to reduction in redness of the skin is unevenness in the skin caused by a decrease in a healthy red complexion due to the failure of angiogenesis of capillaries in the papillary dermis due to aging, ultraviolet rays, or the like. is.

The borage used in the present invention is a kind of herb and is native to the Mediterranean coast of central Europe. The height is about 30-60 cm, pale green leaves and stems are covered with white hairs, and blue or white star-shaped flowers bloom in summer. It is also called borage, lapis lazuli, borage, borage, borage, borage, and borage.

Borage (scientific name: Borago officinalis) belonging to the genus Borago of the family Boraginaceae of the Labiatae is used for the borage extract in the present invention, and the part thereof may be a part of a plant such as a flower, fruit, seed, leaf, stem, root, or the like. It is extracted from the whole plant. The extraction method is not particularly limited, and for example, extraction by heating or extraction at room temperature may be used. For extraction, the plant body may be used as it is, or may be subjected to treatments such as drying, pulverization, and shredding.

The extraction method is not particularly limited, but it can be carried out by stirring or column extraction using water, hot water, or a mixed solvent of water and an organic solvent. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, , glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used singly or in combination of two or more. A particularly preferred extraction solvent includes water or a water-ethanol mixed polar solvent. The amount of the solvent to be used is not particularly limited. For example, it may be 10 times or more, preferably 20 times or more, relative to the whole borage plant (dry weight). For convenience of operation, it is preferably 100 times or less. Also, the extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, and the like.

The above extract may be used as an extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization by activated carbon, etc., within the range where the effect of the present invention is exhibited. , deodorization, ethanol precipitation, or the like may be performed before use. Furthermore, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

In the present invention, the above extract may be used as it is, and within the range that does not impair the effect of the extract, oils and fats, waxes, and carbonized oils that are ingredients used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , chelating agents, excipients, film-forming agents, sweeteners, acidulants and the like.

The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods. , bath agents, foundations, powders, lipsticks, ointments, poultices, tablets, capsules, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids , emulsions, suppositories, injection solutions and the like.

For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Furthermore, 0.01 to 5% by weight is most preferred. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to recognize the enhancement of the effect and it is uneconomical.

In the case of internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Furthermore, 20 mg to 2 g is most preferred.

Next, in order to explain the present invention in detail, production examples, formulation examples and experimental examples of the extract used in the present invention will be given as examples, but the present invention is not limited to these. % shown in Production Examples means % by weight, and parts of content shown in Formulation Examples means parts by weight.

Borage extract was prepared as follows. In Production Examples 1 to 4, whole borage was used as an extraction material.

(Production Example 1) Preparation of hot water extract of borage To 10 g of dried borage, 200 mL of water was added and extracted at 95 to 100°C for 2 hours. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.4 g of a hot water extract of borage.

(Production Example 2) Preparation of 50% ethanol extract of borage 10 g of dried borage was immersed in 200 mL of a 50% ethanol aqueous solution at room temperature for 7 days for extraction. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 1.1 g of a 50% ethanol extract of borage.

(Production Example 3) Preparation of ethanol extract of borage 10 g of dried borage was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.4 g of an ethanol extract of borage.

(Production Example 4) Preparation of 1,3-butylene glycol extract of borage 10 g of dried borage was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The resulting extract was filtered to obtain 192 g of a 1,3-butylene glycol extract of borage.

(Prescription example 1) Lotion prescription Content (parts)
1. 50% ethanol extract of borage (manufacturing example 2) 2.0
2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance Appropriate amount 11. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, mixed and filtered to obtain a product.

(Prescription example 2) Cream prescription Content (parts)
1. Hot water extract of borage (Production Example 1) 1.0
2. Squalane 5.5
3. Olive oil 3.0
4. stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. behenyl alcohol 1.5
9. Glyceryl monostearate 2.5
10. Perfume 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 9 are dissolved by heating, mixed, and maintained at 70°C to form an oil phase. Ingredients 1 and 11 to 13 are heated, melted and mixed, and kept at 75°C to form an aqueous phase. Add the water phase to the oil phase to emulsify, cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain the product.

(Comparative Formulation Example 1) A conventional cream was prepared by replacing the hot water extract of borage in the conventional cream formulation example 2 with purified water.

(Prescription example 3) Emulsion formulation Content (parts)
1. Borage ethanol extract (Production Example 3) 0.01
2. Squalane 5.0
3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glyceryl monostearate 2.0
7. Polyoxyethylene cetyl ether (20 E.O.) 3.0
8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Perfume 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. Adjust the total amount to 100 with purified water [Manufacturing method] Components 1 to 8 are dissolved by heating, mixed, and kept at 70°C to form an oil phase. Ingredients 10 to 13 are dissolved by heating, mixed, and kept at 75° C. to form an aqueous phase. Add the water phase to the oil phase to emulsify, cool while stirring, add component 9 at 45°C, and further cool to 30°C to obtain the product.

(Prescription Example 4) Gel formulation Content (parts)
1. 1,3-butylene glycol extract of borage (Production Example 4) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxy vinyl polymer 0.2
10. Potassium hydroxide 0.2
11. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack prescription Content (parts)
1. Hot water extract of borage (Production Example 1) 5.0
2. Polyvinyl alcohol 12.0
3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Perfume appropriate amount 10. Make the total amount 100 with purified water [Manufacturing method] Components 1 to 10 are uniformly dissolved to obtain a product.

(Prescription example 6) Foundation prescription Content (parts)
1. 50% ethanol extract of borage (manufacturing example 2) 1.0
2. stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4. Polyoxyethylene cetyl ether (20 E.O.) 2.0
5. Cetanol 1.0
6. Liquid Lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Carboxymethylcellulose sodium 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengara 1.0
17. Yellow iron oxide 2.0
18. Perfume Appropriate amount 19. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 8 are dissolved by heating and maintained at 80°C to form an oil phase. Ingredient 19 is sufficiently swelled with ingredient 9, then ingredients 1 and 10 to 13 are added and mixed uniformly. Ingredients 14 to 17 pulverized and mixed with a pulverizer are added to this, stirred with a homomixer and kept at 75° C. to form an aqueous phase. The water phase is added to the oil phase with stirring to emulsify. After cooling, add component 18 at 45°C and cool to 30°C with stirring to obtain the product.

(Prescription example 7) Bath agent prescription Content (parts)
1. Borage ethanol extract (Production Example 3) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. [Manufacturing method] Components 1 to 5 are uniformly mixed to obtain a product.

(Prescription example 8) Ointment prescription Content (parts)
1. 1,3-butylene glycol extract of borage (Production Example 4) 5.0
2. Polyoxyethylene cetyl ether (30 E.O.) 2.0
3. Glyceryl monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. The total amount is adjusted to 100 with purified water [Manufacturing method] Components 2 to 5 are dissolved by heating, mixed, and maintained at 70°C to form an oil phase. Ingredients 1 and 6 to 8 are dissolved by heating, mixed, and maintained at 75°C to form an aqueous phase. The water phase is added to the oil phase to emulsify, and the mixture is cooled to 30°C while stirring to obtain a product.

(Prescription example 9) Powder prescription Content (parts)
1. Hot water extract of borage (Production Example 1) 0.5
2. Dry cornstarch 39.0
3. Microcrystalline cellulose 60.5
[Manufacturing method] Components 1 to 3 are mixed to form a powder.

(Prescription Example 10) Tablet prescription Content (parts)
1. 50% ethanol extract of borage (manufacturing example 2) 2.5
2. Dry cornstarch 25.0
3. Carboxymethylcellulose calcium 20.0
4. Microcrystalline cellulose 40.0
5. polyvinylpyrrolidone 7.0
6. Talc 5.5
[Manufacturing method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and tableted. One tablet is 0.52 g.

(Prescription example 11) Tablet candy prescription Content (parts)
1. Borage ethanol extract (Production Example 3) 1.0
2. Dry cornstarch 49.8
3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Perfume 0.1
7. Purified water 1.1
[Manufacturing method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and compressed into tablets. 1 grain is 1.0 g.

(Prescription example 12) Beverage prescription content (parts)
1. Hot water extract of borage (Production Example 1) 0.025
2. Stevia 0.05
3. Malic acid 5.0
4. Perfume 0.1
5. Purified water 94.825
[Manufacturing method] Components 2 and 3 are dissolved in a small amount of water. Components 1, 4 and 5 are then added and mixed.

Next, experimental examples will be given in order to describe the effects of the present invention in detail.

(Experimental Example 1) Effect of borage extract on gene expression encoding BMPR2 protein in human vascular endothelial cells BMPR2 mRNA expression level was measured. Human vascular endothelial cells (HUVEC) were seeded on a 6-well plate and cultured in HuMedia-EG2 (Kurabo) medium at 37° C. and 5% CO ₂ . When the cells became confluent, the borage extract (Preparation Example 1) dissolved in HuMedia-EG2 adjusted to final concentrations of 10 and 100 μg/mL was added. Total RNA extraction was performed 24 hours after the addition. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription of 500 ng of total RNA, PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the prescribed method, and the expression level of BMPR2 mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard. The BMPR2 expression rate was calculated as the ratio of the BMPR2 mRNA expression level of the sample-added group to the BMPR2 mRNA expression level of the control (sample-free) group. The primers used for measuring the expression level of each gene are as follows.

Primer set AACACCACTCAGTCCACCTC for BMPR2 (SEQ ID NO: 1)
TCTCCTGTCAACATTTCTGTATCC (SEQ ID NO: 2)
Primer set CACTCTTCCAGCCTTCCTTCC for β-actin (SEQ ID NO: 3)
GTGTTGGGCGTACAGGTCTTTG (SEQ ID NO: 4)

Table 1 shows the results. BMPR2 mRNA expression level in human vascular endothelial cells was increased by the borage extract. Similar effects were observed in borage extracts obtained by other extraction methods (Production Examples 2, 3 and 4).

(Experimental example 2) Effect of borage extract on changes in gene expression encoding BMPR2 protein induced by UVA irradiation in human vascular endothelial cells Cultured in medium at 37° C., 5% CO ₂ . After reaching a confluent state, HUVECs were washed with PBS(-) and then irradiated with UVA 10 J/cm ² in the presence of PBS(-). After irradiation, the medium was replaced with HuMedia-EG2, and the borage extract (Preparation Example 1) dissolved in HuMedia-EG2 was added to final concentrations of 10 and 100 μg/mL. Extraction of total RNA was performed after culturing for 6 hours after irradiation. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription of 500 ng of total RNA, PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the prescribed method, and the expression level of BMPR2 mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard. The BMPR2 expression rate was calculated as the ratio of the BMPR2 mRNA expression level of the UVA irradiation group and the UVA irradiation + sample addition group to the BMPR2 mRNA expression level of the control (UVA non-irradiation, sample non-addition) group.

Table 2 shows the results. Although the BMPR2 mRNA expression level was decreased by UVA irradiation, the borage extract restored it. Similar effects were observed in borage extracts obtained by other extraction methods (Production Examples 2, 3 and 4).

(Experimental Example 3) Effect of borage extract on migratory ability of human vascular endothelial cells Human vascular endothelial cells (HUVEC) were seeded in a 6-well plate and placed in a HuMedia-EG2 (Kurabo) medium at 37°C and 5% CO. Cultured under _two conditions. After reaching a confluent state, HUVECs were washed with PBS(-) and then irradiated with UVA 10 J/cm ² in the presence of PBS(-). After the irradiation, the medium was replaced with HuMedia-EG2, and the borage extract (Production Example 1) dissolved in HuMedia-EG2 adjusted to a final concentration of 100 μg/mL was added. After culturing for 6 hours after irradiation, cells were detached and seeded in cell culture inserts for migration.
A Boyden chamber assay using a 24-well cell culture insert was used for migration evaluation. That is, a cell culture insert (8 μm pore size, BD) was placed in a dedicated lower well (24 well plate). BMP4 (Cosmo Bio) dissolved in HuMedia-EG2 adjusted to a final concentration of 1 ng/mL was added to the lower well. On the other hand, 5×10 ⁴ HUVECs, which had been irradiated with UVA and then added with borage extract, were seeded in each insert and cultured for 24 hours. After the medium in the insert was removed and the cells on the upper side of the insert were scraped off with a cotton swab, the cells that had migrated to the lower side of the insert were fixed with methanol for 10 minutes and stained with 4% Giemsa solution. After washing and drying, the membrane was cut out from the insert and the number of migrated cells was counted using a microscope. The total number of cells in 8 fields of view per insert was taken as the number of cells that migrated, and the control (non-UVA irradiation, no sample addition) was taken as 100% and evaluated as a conversion value.

Fig. 1 shows the overall image of the cells that migrated to the bottom side of the insert, and Table 3 shows the measurement results of the cell migration rate. UVA irradiation decreased the number of cells that migrated to the bottom side of the insert, but borage extract restored cell migration. In addition, the borage extract itself was found to have a cell migration-promoting effect. Similar effects were also observed for borage extracts (Production Examples 2, 3 and 4).

(Experimental Example 4) Effect of borage extract on angiogenesis First, a substrate for constructing a vascular structure was prepared. A collagen gel was prepared using Cell matrix Type IA (Nitta Gelatin). After crushing the produced collagen gel finely, it was dehydrated by centrifugation to produce collagen gel fragments having a diameter of about 10 to 100 μm. 100 μL of Matrigel (Corning) was added to 1 mL of this collagen gel, well suspended, and then incubated at 37° C. to coat the periphery of the gel with Matrigel.
Next, human vascular endothelial cells (HUVEC) were stained with Cell Tracker ^™ Orange CMRA Dye (Thermo). Stained 5×10 ⁵ cells were added to 100 μL of the above collagen gel, suspended well, and poured into a culture insert (Falcon). 25 μL of collagen was then poured into the insert and allowed to harden to cap and build up the vascular structure.
After irradiating the gel with a vascular structure with UVA 10 J/cm ² , BMP4 (Cosmo Bio) and borage extract (Production Example 1) added to HuMedia-EG2 (Kurabo) were added to the top of the gel, and the final concentration was They were added at 1 ng/mL and 100 μg/mL, respectively, and cultured for an additional 48 hours. The state of the vascular structure after culture was observed using a fluorescence microscope with the culture insert laid down sideways.

An overview of the vascularized gel is shown in FIG. Addition of BMP4 to the top of the gel caused blood vessels to elongate upward, but this was suppressed by UVA irradiation. However, even with UVA irradiation, the addition of the borage extract to the top of the gel at the same time as BMP4 restored blood vessel elongation. Similar effects were also observed for borage extracts (Production Examples 2, 3 and 4).

(Experimental Example 5) Using the cream of Use Test Formulation Example 2 and the conventional cream of Comparative Formulation Example 1, 23 female subjects (ages 20 to 50) with uneven cheek skin color, i.e. uneven skin color, were tested. ) was used for one month. After use, the degree of color unevenness due to redness of the skin was determined by a questionnaire.

As a result, the cream containing the extract of the present invention reduced the degree of color unevenness caused by redness on the cheeks. During the test period, no skin trouble occurred, and there was no problem in terms of safety. Moreover, there was no problem with deterioration of prescription components.

The BMPR2 production promoter, the angiogenesis promoter, and the color unevenness improving agent by reducing skin redness, which are characterized by containing a borage extract, according to the present invention exhibit excellent improvement effects for the purpose of each agent. do. Therefore, it is possible to provide cosmetics, pharmaceuticals, quasi-drugs, and foods for the purpose of adjusting the healthy complexion of the skin by promoting angiogenesis.

Claims (4)

A BMPR2 production promoter comprising a borage extract. The BMPR2 production promoter according to claim 1, which promotes BMPR2 production in vascular endothelial cells. An angiogenesis promoter characterized by containing a borage extract. An agent for improving skin unevenness by reducing redness, characterized by containing a borage extract.

Images