JP2019512480A - Methods, compositions and devices for information storage - Google Patents

Abstract

The present disclosure is a novel system that stores information using a charged polymer (eg, DNA), where the charged polymer monomer corresponds to a machine readable code (eg, binary code) and the charged polymer comprises a novel nanotip device comprising nanopores. Novel methods and devices for synthesizing oligonucleotides in nanochip format; novel methods for synthesizing DNA in a 3 'to 5' direction using topoisomerases; charged polymers (eg DNA The present invention provides novel methods and devices for reading the sequence of the polymer by measuring the volume fluctuation when passing through the nanopore, and further provides compounds, compositions, methods and devices useful in them.

Description

This application claims the benefit of US Provisional Patent Application Ser. No. 62 / 301,538 filed Feb. 29, 2016 and Ser. No. 62 / 415,430 filed Oct. 31, 2016. Priority is claimed, each of which is incorporated herein by reference in its entirety.

The present invention relates to novel methods, compositions and devices useful for storing and retrieving information using nanopore devices to synthesize and sequence polymers (eg nucleic acids).

  There is a continuing need to store more data than ever on physical media or within physical media using smaller storage devices, although smaller than ever. The amount of data stored has been reported to double in size every two years, and according to one study, the amount of data we create and copy by 2020 is 44 zetabytes per year, or 44 trillion. Reach the gigabyte. In addition, existing data storage media (such as hard drives, optical media and magnetic tapes) are relatively unstable and will fail after long-term storage.

  There is an urgent need for alternative approaches to storing large amounts of data for extended periods of time (eg, decades or hundreds of years).

  It has been proposed to store data using DNA. DNA is extremely stable, can theoretically encode vast amounts of data, and can store data for very long periods of time. See, for example, Bancroft, C., et al., Long-Term Storage of Information in DNA, Science (2001) 293: 1763-1765. Furthermore, DNA as a storage medium is not affected by the security risks of conventional digital storage media. However, there is no practical way to carry out this idea.

  For example, WO 2014/014991 describes a method for storing data on DNA oligonucleotides, where the information is in binary format with one nucleotide per bit, a 96 bit (96 nucleotide) data block, an address of 19 nucleotides Sequences are encoded using flanking sequences for amplification and sequencing. The code is then read by amplifying the sequence using PCR and sequencing using a high speed sequencer (such as an Illumina HiSeq device). Thereafter, the data block array is arranged in the correct order using the address tag, the address array and the adjacent array are removed, and the array data is translated into binary code. Such an approach has significant limitations. For example, a 96 bit data block can only encode 12 characters (using a conventional 1 byte or 8 bits per character or space). The proportion of stored useful information to "housekeeping" information is low, and about 40% of the sequence information is used for the address and flanking DNA. The specification states that 54,898 oligonucleotides are used to encode one book. Ink jet printed high fidelity DNA microchips used to synthesize oligonucleotides limited the size of the oligo (the upper limit was 159 nucleotides described). Furthermore, the reading of the oligonucleotide requires amplification and isolation, which introduces a further possibility of error. C. BANCROFT: "Long-term Storage of Information in DNA", Science (2001) 293 (5536): 1763c-1765; COX JPL: "Long-term data storage in DNA", Trends See also in Biotechnology (2001) 19 (7): 247-250.

  As recognized for over 25 years, the potential information density and stability of DNA make it an attractive medium for data storage, but for writing and reading large amounts of data in this format There is no practical method yet.

  We have developed new approaches for nucleic acid storage using nanofluidic systems that synthesize nucleic acid sequences and nanopore readers that read sequences. Our approach allows the synthesis, storage and readout of hundreds, thousands or millions of bases long. Because of the long sequence, only a relatively small percentage of sequences are used for identification information, such that the information density is much higher than the above-described approach. Furthermore, in some embodiments, the synthesized nucleic acid has a specific position on the nanochip, so the sequence can be identified without identification information. The sequencing performed in the nanochamber is very rapid, the reading of the sequences through the nanopore can be very rapid, and can be up to an order of one million bases per second. Because only two bases are required, this sequencing may be faster and more accurate than the means of sequencing that must distinguish between the four bases (adenine, thymine, cytosine, guanine). In certain embodiments, the two bases are not paired with each other, do not form a secondary structure, and are of different sizes. For example, for this purpose, adenine and cytosine are better than adenine and thymine, which tend to hybridize, or similar sizes adenine and guanine.

  In some embodiments, this system can be used to synthesize long polymers encoding data, which can be amplified and / or released and then sequenced on different sequencers. In another embodiment, the system can be used to provide custom DNA sequences. In yet another embodiment, the system can be used to read DNA sequences.

  The nanochip used in one embodiment comprises at least two separate reaction compartments linked by at least one nanopore, which prevents mixing of at least some components, but DNA or other charged polymers Only a single molecule (eg, RNA or peptide nucleic acid (PNA)) is passed in a controllable manner from one reaction compartment to another. The transition from one compartment of the polymer (or at least the end of the polymer to which the monomer is added) to another compartment prevents passage of the nanopore, for example because it is too large or because it is anchored to the substrate or bulky part The enzyme can be used to perform continuous manipulation / reaction (addition of base, etc.) to the polymer. The nanopore sensor reports back the movement or position of the polymer and its state, eg its sequence, and whether the attempted reaction was successful or not. This allows data to be written, stored and read, eg, where the base sequence corresponds to a machine readable code (eg, a binary code where each base or group of bases correspond to 1 or 0).

Therefore, the present invention especially includes the following embodiments.
A nanotip for the synthesis of a charged polymer (eg DNA) comprising at least two different monomers, wherein the nanotip comprises two or more reaction chambers separated by one or more nanopores, each reaction chamber comprising an electrolyte And one or more electrodes for drawing the charged polymer into the chamber, and one or more reagents that facilitate the addition of the monomer or oligomer to the polymer. The nanotips can optionally be configured with functional elements that guide, carry and / or control the DNA, and are optionally selected to allow smooth flow of the DNA or to bind to the DNA It may be coated or made with a substance and may include nanocircuitry to provide and control the electrode in close proximity to the nanopore. For example, one or more nanopores optionally can each control migration of the polymer through the nanopore and / or can detect changes in potential, current, resistance or capacitance at the nanopore-polymer interface. Or the like, whereby the sequence can be detected as the polymer passes through one or more nanopores. In a particular embodiment, the oligomer is synthesized using a polymerase or a site specific recombinase. In some embodiments, the polymer is sequenced during synthesis to allow for detection and possibly correction of errors. In some embodiments, the polymer thus obtained is stored on the nanotip and can be sequenced when it is desired to access the information encoded in the sequence of the polymer.

-A method of synthesizing a polymer, eg, DNA, using the above-described nanotip.
· Single strands consisting only of nucleotides which essentially do not hybridize, eg adenine and cytosine nucleotides (A and C), eg arranged in an order corresponding to the binary code, eg for use in the method of data storage DNA molecule.
-A double stranded DNA comprising a series of nucleotide sequences corresponding to the binary code, wherein the double stranded DNA further comprises-A method of reading a binary code encoded in DNA, comprising using a nanopore sequencer.
Method of data storage and devices therefor for producing a charged polymer comprising at least two different monomers, eg DNA, using the above nanotip, wherein the monomers are arranged in order corresponding to the binary code.

  Further aspects and ranges of applicability of the present invention will become apparent from the detailed description provided below. Although the detailed description and specific examples show preferred embodiments, it should be understood that they are for the purpose of illustration only and are not intended to limit the scope of the present invention.

The invention will be more fully understood from the detailed description and the accompanying drawings.
FIG. 1 shows a simple two-chamber nanotip design with separation membranes perforated by nanopores and electrodes on both sides of the membrane. FIG. 2 shows how charged polymers, such as DNA, are attracted to the anode. FIG. 3 shows how charged polymers, such as DNA, are attracted to the anode. FIG. 4 shows that by reversing the polarity of the electrodes, the polymer can be retracted. FIG. 5 shows that by reversing the polarity of the electrodes, the polymer can be retracted. FIG. 6 shows a two-chamber nanotip design for DNA synthesis, with polymerase enzyme located in one chamber and deblocked enzyme in the other chamber, none of which can pass through the nanopore. FIG. 7 shows the addition of adenine nucleotides as 3 'blocked dATP (A) flows into the left chamber, with the current set in the “forward” direction to direct DNA into the left chamber. FIG. 8 shows the deprotection of the oligonucleotide, so additional nucleotides can be added. For example, after moving the DNA into the chamber by setting the current in the reverse direction, deprotection occurs. FIG. 9 shows the addition of 3 'blocked dCTP (C). In one embodiment, fluid flow is used to change the contents of the chamber. For example, as shown, previously this chamber had an "A". FIG. 10 shows how multiple separate holding chambers can be provided while the flow chamber becomes a single lane providing the reagents.

FIG. 11 shows DNA by binding DNA to a chamber (upper DNA fragment in the figure) or by conjugating DNA with bulky groups that can not pass through the nanopore (lower DNA fragment in the figure) The method of staying in the chamber is shown. In this system, one end of the DNA can still move to the flow chamber and receive additional nucleotides while the other end remains in the holding chamber. FIG. 12 shows a configuration in which DNA binds to the chamber wall and is controlled by multiple electrodes. FIG. 13 shows how DNA can be retained in the chamber if desired simply by controlling the polarity of the electrodes. FIG. 14 shows an array in which DNA is bound to the surface of the chamber and reagents flow freely on both sides. FIG. 15 shows an alternative design having electrodes on the side adjacent to the separation membrane, which allows for a cheaper product. FIG. 16 shows an arrangement of three compartments, where DNA can be transferred from compartment to compartment by an electrode. This system does not require significant flow of reagents during synthesis. FIG. 17 shows an example of how reagents may be arranged in a three compartment arrangement. FIG. 18 shows the oligonucleotide anchored adjacent to the nanopore, which has electrode elements on both sides of the membrane.

FIG. 19 shows a series of DNA molecules bound along a membrane containing nanopores, each under the control of an electrode adjacent to the nanopore, with flow lanes on either side of the membrane. For example, as shown, the left flow lane provides a flow of buffer wash / 3 'blocked dATP (A) / buffer wash / 3' blocked dCTP (C) / buffer wash, where the DNA molecule is It is directed into the flow chamber only when the desired nucleotide is present. The right lane provides the deblocking reagent to deprotect the 3'end of the nucleotide and allow addition of additional nucleotides. In one embodiment, the deblocking reagent flows while the left lane is being washed with buffer. In another embodiment, the deprotecting agent is very bulky and can not cross the nanopore into the left lane. FIG. 20 schematically illustrates a proof of concept experiment where the bits used to encode the data are short oligomers linked by topoisomerase. FIG. 21 schematically illustrates a proof of concept experiment where the bits used to encode the data are short oligomers linked by topoisomerase. FIG. 22 schematically illustrates a proof of concept experiment where the bits used to encode the data are short oligomers linked by topoisomerase.

FIG. 23 shows a format for the nanopore sequencer, where polymer sequences are read using volume variation. In this capacitance readout scheme, the electrodes form the plates above and below the capacitor, which are separated by a membrane containing nanopores. A capacitor is embedded in the resonant circuit where the direct current can be oscillated to extract the charged polymer from the nanopore. As the polymer, eg DNA, passes through the nanopore, high frequency impedance spectroscopy is used to measure the change in capacitance. A major advantage of this approach, especially when using DNA, is that the frequency of measurements is very high (100 MHz frequency corresponds to 100 million measurements per second, since one measurement is valid for each cycle), and monomer migration through the nanopore It can be much faster than (for example, DNA passes through the nanopore at a rate of the order of a million nucleotides per second in response to current unless it is suppressed in some way).

FIG. 24 shows an arrangement of dual addition chambers suitable for adding two different types of monomers or oligomers, for example for 2 bit or binary coding. The upper part of the figure shows a top view. The lower part shows a side sectional view. The complete device in this embodiment may be assembled from up to three independently fabricated layers and bonded by wafer bonding or may be formed by etching a single substrate. The chip includes an electrical control layer (1), a fluidics including two additional chambers above the storage chamber, and wherein a charged polymer (eg, DNA) is anchored between the nanopore introductions to the first and second additional chambers. It comprises a layer (2) and an electrical ground layer (3).

FIG. 25 illustrates the operation of the dual additional chamber arrangement of FIG. The presence of nanopores at the bottom of each additional chamber is observed (4). The nanopores are made by drilling, for example using FIB, TEM, wet etching or dry etching or by dielectric breakdown. The membrane (5) containing nanopores is, for example, one atomic layer to several tens of nm thick. This film is made, for example, of SiN, BN, SiOx, graphene, transition metal dichalcogenides such as WS ₂ or MoS ₂ . Below the nanopore membrane (5) there is a storage chamber or deblocking chamber (6), which contains reagents for deprotecting the polymer after the monomer or oligomer has been added in one of the addition chambers ( It is envisaged that the monomers or oligomers are added in a terminally protected fashion, so that only one monomer or oligomer is added at a time). The polymer (7) can be moved in and out of the addition chamber by changing the polarity of the electrodes in the electrical control layer (1).

FIG. 26 shows a top view of an arrangement similar to FIGS. 24 and 25, but here there are four additional chambers sharing a common storage or deblocking chamber, with polymer access to each of the four chambers It is moored to position (9). The cross sections of this arrangement are as shown in FIGS. 24 and 25 and the charged polymer can be transferred to each of the four additional chambers by manipulating the electrodes in the electrical control layer (1 in FIG. 24).

FIG. 27 shows a top view of a nanopore chip with multiple sets of FIG. 24 and the dual addition chamber shown in FIG. 25, which allows multiple polymers to be synthesized in parallel. Monomers (dATP and dGTP nucleotides, here designated A and G) are loaded into each chamber through a continuous flow path. The flow cell of one or more common deblocking agents makes it possible to deprotect the polymer after addition of the monomers or oligomers in one of the addition chambers. This also allows the polymer to be separated on demand (eg, using restriction enzymes in the case of DNA, or chemically separated from the surface adjacent to the nanopore) and collected externally. In this particular embodiment, the flow cell of deblocking agent is perpendicular to the fluid loading channel used to fill the loading chamber.

FIG. 28 shows further details of the wiring for the dual additional chamber arrangement. The electrical control layer (1) comprises a wire made of metal or polysilicon. The density of interconnects is increased by three-dimensional stacking with electrical isolation provided by dielectric deposition (eg, by PECVD, sputtering, ALD, etc.). Contact (11) with the top electrode by the additional chamber in an embodiment is made using a through silicon via (TSV) by deep reactive ion etching (DRIE) (cryo or BOSCH treatment). Individual voltage control (12) allows each additional chamber to be processed individually, which allows fine control of multiple polymer arrays in parallel. The right side of the figure shows a top view illustrating the wiring for a plurality of additional cells. The electrical ground layer (3) may be common (as shown) or may be split to reduce cross coupling between cells.

FIG. 29 shows an alternative configuration in which the control electrode (13) of the additional chamber may be arranged to be wound on the side of the chamber instead of at the top of the chamber.

FIG. 30 shows an SDS-PAGE gel confirming that the topoisomerase addition protocol described in Example 3 works, the bands corresponding to the expected A5 and B5 products are clearly visible.

FIG. 31 shows an agarose gel confirming that the PCR product of Example 5 is the correct size. Lane 0 is a 25 base pair ladder; lane 1 is the product of the experiment and the line corresponds to the expected molecular weight; lane 2 is negative control # 1; lane 3 is negative control # 2 Lane 4 is negative control # 4.

FIG. 32 shows an agarose gel that confirms that the restriction enzymes described in Example 5 produce the expected product. The left ladder is a 100 base pair ladder. Lane 1 is NAT1 / NAT9c which has not been disconnected, and Lane 2 is NAT1 / NAT9c which has been disconnected. Lane 3 is NAT1 / NAT9cl not disconnected, and lane 4 is NAT1 / NAT9cl disconnected.

FIG. 33 shows the immobilization of DNA in the vicinity of the nanopore. Panel (1) shows, in the left chamber, the DNA having an origami structure at one end (in an actual nanotip, many such origami structures are initially present in the left chamber). Panel (2) describes a system with an anode on the right, which directs the DNA to the nanopore. The DNA strand can pass through the nanopore, but the origami structure is too large to pass through, so the DNA "sticks in". The DNA can diffuse when the current is turned off (panel 3). When the ends of the DNA strands come in contact with the surface near the nanopore, they can be linked by appropriate chemistry. In panel (4), a restriction enzyme is added, which cuts out the origami structure from the DNA. The chamber is washed to remove the enzyme and any residual DNA. The end result is a single DNA molecule bound near the nanopore, which can travel back and forth through the nanopore.

FIG. 34 shows basic functional nanopores. In each panel, the y-axis is current (nA) and the x-axis is time (seconds). The left panel "RF noise screening" demonstrates the utility of the Faraday cage. Place the chip without nanopore in the flow cell and apply 300 mV. When the lid of the Faraday cage is closed (first arrow), noise reduction is observed. Closing the latch (second arrow) produces a small spike. It can be seen that the current is about 0 nA. After pore creation (middle panel), application of 300 mV (arrow) results in a current of about 3.5 nA. When DNA is applied to the ground chamber and applied at +300 mV, DNA migration (right panel) can be observed as a transient decrease in current. (Note, in this case TS buffer is used: 50 mM Tris, pH 8, 1 M NaCl.) Lambda DNA is used for this DNA transfer experiment.

FIG. 35 shows a simplified diagram illustrating the main features of the DNA origami structure: a large single stranded region, a cube origami structure and the presence of two restriction sites (SwaI and AlwN1) near the origami structure.

FIG. 36 shows an electron microscopy image of the generated DNA origami structure, demonstrating the expected topology. Origami was made in 5 mM Tris base, 1 mM EDTA, 5 mM NaCl, 5 mM MgCl2. It is preferred to have an Mg ⁺⁺ concentration of about 5 mM or a Na ⁺ / K ⁺ concentration of about 1 M in order to maintain the origami structure. Store the Origami structure at 500 nM at 4 ° C.

試験レーン（１）は負の対照である；（２）はＳｗａ１での切断である；（３）はＡｌｗＮ１での切断である；（４）はＳｗａ１／ＡｌｗＮ１での二重切断である。切断は室温で６０分間行い、その後３７℃で９０分間行った。エチジウムブロマイド染色で可視化されたアガロースゲル１／２ｘ ＴＢＥ−Ｍｇ（５ｍＭ ＭｇＣｌ２を含む１／２ｘ ＴＢＥ）。いずれかの酵素での個々の切断はゲルにおいて移動度の効果を示さないが、両方の酵素での切断（レーン４）は、予想されるように異なる長さの２つのフラグメントをもたらす。 FIG. 37 shows restriction enzyme cleavage of DNA origami that confirms correct assembly and function. The leftmost lane gives the MW standard. The restriction sites are tested by cleaving origami with AlwN1 and Swa1. The four test lanes contain the following reagents (unit: microliter):

Test lane (1) is a negative control; (2) is a cut at Swa1; (3) is a cut at AlwN1; (4) is a double cut at Swa1 / AlwN1. The cleavage was performed for 60 minutes at room temperature and then for 90 minutes at 37 ° C. Agarose gel 1 / 2x TBE-Mg (1 / 2x TBE with 5 mM MgCl2) visualized by ethidium bromide staining. While individual cleavage with either enzyme does not show the effect of mobility in the gel, cleavage with both enzymes (lane 4) results in two fragments of different lengths as expected.

FIG. 38 shows the binding of a biotin-labeled oligonucleotide to streptavidin-coated beads as compared to the binding to control BSA-coated beads. The y-axis is a unit of fluorescence. "Before binding" is the fluorescence of the oligo from the test solution prior to binding to the beads. (-) Control is the fluorescence seen after binding to 2 batches of BSA-conjugated beads. SA-1 and SA-2 are the fluorescence seen after binding to two batches of streptavidin conjugated beads. An apparent small amount of binding is observed with BSA-conjugated beads, but much larger binding is seen with streptavidin-conjugated beads.

FIG. 39 shows the binding of biotin-labeled oligonucleotides to streptavidin-coated beads in different buffer systems (MPBS and HK buffer) compared to that of control BSA-coated beads . The left bar "negative control" is the fluorescence of the oligo from the test solution before binding to the beads. The middle column shows the fluorescence of "BSA beads" after binding to BSA beads, the right column shows the fluorescence of "SA beads" after binding to streptavidin beads. In both buffer systems, the fluorescence is reduced by the streptavidin beads compared to the control, which indicates that the biotin-labeled oligonucleotide is well bound to the streptavidin-coated beads in the various buffer systems .

FIG. 40 shows functional conjugated SiO ₂ nanopores, where the surface is coated with streptavidin on one side and the other with BSA. The x-axis is time and the y-axis is current. The dots indicate when the current is reversed. Reversing the current has a short overshoot, after which the current settles to about the same absolute value. The nanopore exhibits a current of about +3 nA at 200 mV and a current of about -3 nA at -200 mV.

FIG. 41 displays the Origami DNA structure inserted into the nanopore. FIG. 42 displays the binding of single stranded DNA to a streptavidin-coated surface adjacent to the nanopore.

FIG. 43 shows experimental results of origami DNA bound to the surface near the nanopore. The current is + or-about 2.5 nA in both directions, which is lower than the original +/- about 3 nA current, reflecting partial occlusion by the origami structure. The x-axis is time (seconds), the y-axis is current (nA), and the circles indicate when the voltage is switched.

Figure 44 shows the insertion of Origami DNA, which results in a slight drop in current. When the current is released, Origami immediately escapes from the nanopore. The x-axis is time (seconds), the y-axis is current (nA), and the circles indicate when the voltage is switched.

FIG. 45 displays the control of migration back and forth of the DNA strand through the nanopore by application of current. On the left side, since the DNA is in the pore, the observed current is lower than when the DNA is not in the pore. When the current is reversed (right side), the current does not change because there is no DNA in the pore.

FIG. 46 shows an experimental result confirming this display. When a positive voltage is applied, the current is about 3 nA, which is equivalent to the current normally observed when the pore is open. When the voltage is reversed, the current is about -2.5 nA. This is lower than the current normally seen when the pore is open and corresponds to the current normally observed when the pore is blocked by a DNA strand. Several successive voltage switches show consistent results, suggesting that the DNA alternates with the arrangement shown in FIG. FIG. 47 shows various conjugation chemistries for linking DNA to the surface adjacent to the nanopore.

  The following description of the preferred embodiments is merely exemplary in nature and is not intended to limit the invention, its application or uses in any way.

  When used everywhere, a range is used as a shorthand to describe every value within the range. Any value within the range may be selected as the end of the range. In addition, all references cited herein are incorporated herein by reference in their entirety. In the case of inconsistencies in the definitions in the present disclosure and the references cited, the present disclosure controls.

  Unless stated otherwise, all percentages and amounts expressed herein and elsewhere in the specification should be understood as referring to percentages by weight. The predetermined amount is based on the effective weight of the substance.

A "nanotip" as used herein refers to a nanofluidic device, which comprises a plurality of chambers containing fluid and optionally channels that allow the flow of fluid, wherein the features of the nanotip (e.g. of elements that separate the chambers from one another) The critical dimension of width is a thickness of 1 atom to 10 microns, eg smaller than 1 micron (eg 0.01 to 1 micron). The flow of material in the nanotip can be regulated by electrodes. For example, because DNA and RNA are negatively charged, they are attracted to positively charged electrodes. See, for example, Gershow, M, et al., Recapturing and Trapping Single Molecules with a Solid State Nanopore, Nat Nanotechnol. (2007) 2 (12): 775-779, which is incorporated herein by reference. . The flow of fluid may optionally be regulated by the gate element and also by flowing, injecting and / or aspirating fluid into or out of the nanotip. This system is capable of accurate multiplex analysis of nucleic acids (DNA / RNA). In certain embodiments, the nanotips can be made of silicon material (eg, silicon dioxide or silicon nitride). Silicon nitride (eg, Si ₃ N ₄ ) is relatively inert chemically and, even with only a few nm thickness, provides an effective barrier to the diffusion of water and ions. Especially desirable for Silicon dioxide (as used in the examples herein) is also useful because silicon dioxide is an excellent surface for chemical modification. Alternatively, in certain embodiments, the nanotips may be made wholly or partially of a material (also referred to as a single layer material) that can form sheets as thin as single molecules (eg, graphene (eg, Heerema, etc.) , SJ, et al, Graphene nanodevices for DNA sequencing, Nature Nanotechnology (2016) 11: 127-136; Garaj S et al., Graphene as a subnanometre trans-electrode membrane, Nature (2010) 467 (7312), 190-193 , The contents of which are incorporated herein by reference) or, for example, molybdenum disulfide (MoS ₂ ) (Feng, et al., Identification of single nucleotides in MoS ₂ Nanopores, Nat Nanotechnol. (2015) 10 (12) ): 1070-1076, the contents of which are incorporated herein by reference or boron nitride (Gilbert, et al. Fabrication of Atomically Precise Nanopores in Hexagonal Boron Nitride, eprint arXiv: 1702.01220 (2017). Yes) Which transition metal dichalcogenide).

In some embodiments, the nanotips comprise such monolayer materials that are relatively rigid and inert (eg, at least as inert and rigid monolayer materials as graphene such as MoS ₂ ). A monolayer material can be used, for example, as all or part of a membrane comprising nanopores. The nanotips can be partially aligned with the metal (eg, the walls can be layered (eg, metal-silicon nitride-metal), and then the nucleic acid can move back and forth through the nanopore by electromotive force and pass through the nanopore The metal is arranged to give a controllable electrode pair in the vicinity of the nanopore, so that it can be sequenced by measuring the change in potential during the process).

  Nanochip nanofluidic devices for sequencing DNA are generally known, for example, Li, J., et al, Solid-state nanopore for detecting individual biopolymers, Methods Mol Biol. (2009) 544: 81-93; Smeets RM, et al. Noise in solid-state nanopores, PNAS (2008) 105 (2): 417-21; Venta K, et al., Differentiation of short, single-stranded DNA homopolymers in solid-state nanopores, ACS Nano Briggs K, et al. Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis, Small (2014) 10 (10): 2077-86; and Chen Z (2013) 7 (5): 4269-36; (2010) 9 (8): 667-75, for example for the teaching of the design and manufacture of nanotips including nanopores, the entire contents of each being incorporated by reference. Incorporated herein.

  A "nanopore" herein is a pore having a diameter of less than 1 micron (e.g. 2 to 20 nm diameter, e.g. on the order of 2 to 5 nm). Single stranded DNA can pass through the 2 nm nanopore; single stranded or double stranded DNA can pass through the 4 nm nanopore. Having a very small nanopore (e.g. 2-5 nm) allows DNA to pass but not larger protein enzymes, thereby allowing controlled synthesis of DNA (or other charged polymers). When using larger nanopores (or smaller protein enzymes), conjugate the protein enzyme to a substrate (eg, a larger molecule such as a larger protein, a surface in a bead or chamber) that prevents the protein enzyme from passing through the nanopore You may Various nanopores are known. For example, biological nanopores are formed by the association of pore-forming proteins in a membrane (such as a lipid bilayer membrane). For example, alpha-hemolysin and similar protein pores are found naturally in cell membranes, which serve as channels for transporting ions or molecules into and out of cells, such proteins serving as nanochannels It can be used for the purpose. Solid-state nanopores are produced in synthetic materials (such as silicon nitride or graphene) by, for example, forming holes in the synthetic membrane using, for example, feedback-controlled low energy ion beam sculpting (IBS) or high energy electron beam irradiation It is formed. Hybrid nanopores can be made by embedding pore forming proteins in synthetic materials. When the metal surface or electrode is at both ends or both sides of the nanopore, a current along the nanopore can be established through the nanopore via the electrolyte medium. The electrodes can be made of any conductive material (eg silver, gold, platinum, copper, titanium dioxide, eg silver coated with silver chloride).

  Methods for forming nanopores in solids (silicon nitride, membranes) are known. In one approach, a silicon substrate is coated with a membrane material (e.g. silicon nitride) and the overall shape of the membrane is made using photolithography and wet chemical etching and of the desired size (e.g. about 25 x 25 microns) to be incorporated into a nanotip Give a silicon nitride film. The first 0.1 micron diameter holes or cavities are drilled into the silicon nitride film using a focused ion beam (FIB). Ion beam sculpting causes the larger pores to shrink (eg, by lateral mass transport on the membrane surface induced by the ion beam), or the cavities become sharp nanopores when the cavities are finally connected Alternatively, nanopores can be formed by either removing the membrane material from the flat side of the membrane, including the cavities from the opposite side, layer by layer by ion beam sculpting. When the ion beam exposure disappears, the ion current transmitted through the pore is suitable for the desired pore size. See, for example, Li, J., et al., Solid-state nanopore for detecting individual biopolymers, Methods MoI Biol. (2009) 544: 81-93. Alternatively, nanopores can be formed using high energy (200-300 keV) electron beam irradiation in a TEM. Pyramidal 20 × 20 nm and larger pores are made in 40 nm thick films using semiconductor processing techniques, electron beam lithography, reactive ion etching of the SiO 2 mask layer and anisotropic KOH etching of Si. The electron beam in the TEM is used to reduce the larger 20 nm pores into smaller ones. TEM makes it possible to observe the shrinking process in real time. With thinner films (e.g. <10 nm thickness), the nanopores can be perforated with a high energy focused electron beam in a TEM. In general, Storm AJ, et al. Fabrication of solid-state nanopores with single-nanometry precision. Nature Materials (2003) 2: 537-540; Storm AJ, et al. Translocation of double-stranded DNA through a silicon oxide nanopore Rev. E (2005) 71: 051903; Heng JB, et al. Sizing DNA Using a Nanometer-Diameter Pore. Biophys. J (2004) 87 (4): 2905-11, each here The contents are incorporated herein by reference.

  In another embodiment, as described in Kwok, et al., "Nanopore Fabrication by Controlled Dielectric Breakdown," PLOS ONE (2014) 9 (3): e92880, which is incorporated herein by reference. In addition, nanopores are created by dielectric breakdown, taking advantage of the relatively high potential difference of the membrane, where they raise the potential until a current is detected.

  With these techniques, and of course depending on the actual technique used and the thickness and composition of the membrane, the overall shape of the nanopore in a solid material such as silicon nitride is the narrowest point (ie The nanopore may be roughly similar to two funnels whose tips are united. The shape of such a pair of cones is conductive, letting the polymer in and out through the nanopore. Imaging techniques (eg atomic force microscopy (AFM) or transmission electron microscopy (TEM), in particular TEM) validate the size, position and shape of the nanomembrane, the holes or cavities in the FIB, and the final nanopore And can be used to measure.

  In some embodiments, one end of the polymer (eg, DNA) is anchored near the nanopore or on the inner wall of the funnel leading to the nanopore. If one end of the polymer is anchored near the nanopore, the polymer will first approach the nanopore by diffusion and then be guided by the electrical gradient so that the gradient induced motion is maximized and the diffusion motion is minimized , Which enhances speed and efficiency. For example, Wanunu M, Electrostatic focusing of unlabelled DNA into nanoscale using a salt gradient, Nat Nanotechnol. (2010) 5 (2): 160-5; Gershow M., Recapturing and trapping single molecules with a solid-state nanopore. Nat. See Nanotechnol. (2007) 2 (12): 775-9; Gershow, M., Recapturing and Trapping Single Molecules with a Solid State Nanopore. Nat Nanotechnol. (2007) 2 (12): 775-779.

  In one embodiment, one end of a polymer (eg, DNA) is attached to a bead and the polymer is passed through a pore. Bonding with the beads prevents the polymer from migrating through the nanopores on the opposite side of the separation membrane of the adjacent chamber to the end. The current is then turned off and a polymer (eg, DNA) is attached to the surface adjacent to the nanopore in the opposite chamber of the separation membrane. For example, in one embodiment, one end of ssDNA is covalently attached to 50 nm beads and the other end is biotinylated. Streptavidin is bound to the area of the chamber opposite the separation membrane at the desired attachment point. DNA is pulled out of the nanopore by potential difference and biotin binds to streptavidin. Binding to the surface adjacent to the beads and / or nanopores can be either covalent or strong non-covalent (such as biotin-streptavidin binding). The beads are then cleaved off with enzyme and washed away. In some embodiments, K. Nishigaki, Type II restriction endonuclease cleavage single-stranded DNAs in general. Nucleic Acids Res. (1985) 13 (16): 5747-5760, which is incorporated herein by reference. Single-stranded DNA is cleaved with an enzyme that cleaves single-stranded DNA. In another embodiment, complementary oligonucleotides are provided to create a double stranded restriction site which can then be cleaved with the corresponding restriction enzyme.

  As the polymer passes through the nanopore, changes in the potential difference or current across the nanopore caused by the partial blockage of the nanopore as the polymer passes through can be detected, and different monomers can be distinguished by their different size and electrostatic potential , Can be used to identify the sequence of monomers within the polymer.

  As described herein, the use of nanotips containing nanopores in methods of producing DNA is not disclosed in the art, but such chips are well known and commercially available for rapid sequencing of DNA. It is done. For example, the MinION (Oxford Nanopore Technologies, Oxford, UK) is small and can be attached to a laptop. MinION measures current as single-stranded DNA passes through the protein nanopore 30 bases per second. The DNA strands in the pore interfere with the ion flow, which results in changes in the current corresponding to the nucleotides in the sequence. Mikheyev, AS, et al. A first look at the Oxford Nanopore MinION sequence r, Mol. Ecol. Resour. (2014) 14, 1097-1102. The accuracy of MinION is insufficient and requires repeated sequencing, but if the DNA being read contains only two easily distinguishable bases (eg A and C), sequencing using the nanotip of the invention Speed and accuracy can be significantly improved.

  In some embodiments, the membrane comprising nanopores can have a three-layer morphology, including metal surfaces on both sides of the insulating core material (eg, a silicon nitride membrane). In this embodiment, for example, a current flowing through the nanopore can be established between the electrodes through the electrolyte via the nanopore, which current can cause the polymer to pass through the nanopore and reverse the polarity so that the polymer can be pulled back. The metal surface is formed, for example, by means of lithography, giving a microcircuit comprising a pair of electrodes at each end of each nanopore. As the polymer passes through the nanopore, the electrodes can measure the change in potential across the nanopore and identify the sequence of monomers within the polymer.

  In some embodiments, the sequence of the polymer is designed to store data. In some embodiments, data is stored in binary code (1 and 0). In some embodiments, each base corresponds to 1 or 0. In another embodiment, the readily recognized sequence of two or more bases corresponds to one and the readily recognized sequence of the other two or more bases corresponds to zero. In other embodiments, the data may be stored in ternary code, quaternary code or other code. In a particular embodiment, the polymer is DNA (eg single stranded DNA), wherein the DNA comprises only two bases and does not comprise any self-hybridizable bases (eg DNA is adenine with guanine, adenine And cytosine, thymidine and guanine, or thymidine and cytosine). In some embodiments, the two bases may be interspersed with one or more additional bases, for example, A and C "split" the sequence, for example by showing breaks in the coding sequence. And T may be included at a frequency that does not result in significant self hybridization. In other embodiments, eg, where the nucleic acid is double stranded, some or all of the available bases may be used.

  The nucleotide base may be naturally occurring or, in some embodiments, described, for example, in Malyshev, D. et al. "A semi-synthetic organism with an expanded genetic alphabet", Nature (2014) 509: 385-388. It may consist of a non-naturally occurring base, as it is, which is incorporated herein by reference, or may contain a non-naturally occurring base.

  In one embodiment, the data is preserved by the addition of a single monomer (eg, a single nucleotide in the case of DNA) to the polymer. In one embodiment, the polymer is DNA and the monomers are adenine (A) and cytosine (C) residues. (I) A and C have large size differences, so they should be easy to distinguish by nanopores, and (ii) A and C do not pair with each other, which may complicate the interpretation of the nanopore signal A and C residues are favored because they do not form any secondary structures and (iii) G is known to form guanine quadruplexes, so less preferred for the same reasons. . Nucleotides are added by terminal transferase (or polynucleotide phosphorylase), but the nucleotides are 3 'blocked such that only single nucleotides are added at one time. Blocking is removed prior to the addition of the next nucleotide.

  In some embodiments, the DNA is placed in a nanochip. In another embodiment, the DNA is removed, eg, optionally converted to double stranded DNA and / or optionally converted to a crystalline form, to enhance long term stability. In yet another embodiment, the DNA can be amplified and the amplified DNA is removed for long-term storage, but the original template DNA (e.g. DNA bound to the wall of the chamber in the nanotip) is a nanotip It can be left inside, it can be read out and / or used as a template to make additional DNA.

Ａを流す＝３’保護されたｄＡＴＰ
Ｃを流す＝３’保護されたｄＣＴＰ In some embodiments, the DNA or other polymer is tethered to the surface adjacent to the nanopore during synthesis. For example, in one embodiment, the 3 'end of the DNA molecule passes from the holding chamber through the nanopore into a flow chamber containing a stream of 3' protected dNTPs with a polymerase or terminal transferase enzyme that adds 3 'protected dNTPs. Single-stranded DNA molecules are attached at their 5 'end to the surface in close proximity to the nanopore so that the nanopore can be retained in the holding chamber excluding the enzyme so as to be withdrawn or not add dNTPs The current in each nanopore can be independently regulated by the electrode for that nanopore. See, for example, the depictions of Figures 12-16 and Figures 18 and 19. In another embodiment, single stranded DNA is constructed by addition to the 5 'end (with a bound 3' end) using topoisomerase, as described in more detail below. By controlling whether each DNA molecule is involved in each cycle, the sequence of each DNA molecule can be precisely controlled, for example as follows:

Run A = 3 'protected dATP
Flow C = 3 'protected dCTP

  The nanopore 1 and nanopore 2 in this scheme are bound to different DNA strands and their position (in or out of the flow chamber) can be controlled separately. The DNA is deprotected by specific enzymes in the holding chamber or by altering the flow in the flow chamber and causing deprotection by enzymatic means, chemical means, photocatalyst means or other means obtain. In certain embodiments, the deblocking reagent is between a cycle of flowing A and a cycle of flowing C, such as when the flow chamber is being washed with buffer, such that the deblocking reagent does not deprotect the base unit nucleotide. Flows to In another embodiment, the deprotecting agent is so bulky that it can not pass through the nanopore into the flow chamber.

  The end result of the above example would be that A and C be added to the DNA of nanopore 1 and C and C be added to the DNA of nanopore 2.

  In another embodiment, the arrangement of the chambers is similar, but with double-stranded DNA anchored to the surface close to the nanopore, each corresponding to a binary code (eg of two or more types) The oligonucleotide fragment is, for example, using a site-specific recombinase (ie, an enzyme that spontaneously recognizes and cleaves at least one strand of a double-stranded nucleic acid in a sequence segment known as a site-specific recombination sequence). For example, it is sequentially added using topoisomerase-charged oligonucleotides described below.

In certain embodiments, it may be desirable to keep the charged polymer (eg, DNA) in an aggregated state after synthesis. There are several reasons for this:
The polymer should be more stable in this form,
Agglomerating the polymer keeps the crowding low and allows the use of longer polymers in small volumes,
Ordered aggregation can reduce the likelihood of the polymer forming knots or tangles,
If any chambers are interconnected, it helps to prevent the polymer from passing through a pore different from the one that is supposed to be when the current is applied,
• Aggregation helps to move the polymer away from the electrode, where the electrochemistry can damage the polymer.

  Human cells are approximately 10 microns but contain 8 billion base pairs of DNA. This DNA stretches over 1 meter. DNA is contained in cells because it is wound around histone proteins. In one embodiment, histones or similar proteins provide similar functions in the nanochips of the invention. In some embodiments, the inner surface of the nanotips is slightly positively charged such that charged polymers (eg, DNA) have a tendency to stick weakly to them.

  In one embodiment, the charged polymer, eg, single stranded or double stranded DNA, is attached to the surface in proximity to the nanopore. This can be achieved in various ways. Generally, the polymer is attached to a relatively bulky structure (eg, a bead, a protein, or a DNA origami structure (described below)) having a large diameter (eg,> 10 nm, eg, 20-50 nm) that can not pass through the nanopore Current is used to pull the charged polymer through the nanopore, anchoring the end of the polymer far from the bulky structure to the surface adjacent to the nanopore and localizing the polymer into the nanopore by breaking up the bulky structure.

  The step of anchoring the end of the polymer far from the bulky structure to the surface adjacent to the nanopore can be accomplished in various ways. In one embodiment, the polymer is single-stranded DNA, and a pre-bound DNA strand (about 50 bp) complementary to a portion of single-stranded DNA is present and pre-bound to single-stranded DNA. DNA strands can be linked via base pairing. If this base pairing is strong enough, it is sufficient to keep tethering even while manipulating the DNA. An advantage of this conjugation method is that the DNA can be removed from the nanopore chip if desired for long-term storage of the DNA. Alternatively, this strand can be conjugated chemistry (e.g., streptavidin-biotin conjugate described in Example 1 below) or "click" chemistry (Kolb, et al. Angew. Chem. Int. Ed. (2001) 40: See, 2004-2021, any of which is incorporated herein by reference, and / or enzymatic conjugation (eg, precovalently attach oligos to distant surfaces, and then using DNA ligase to The bond is covalently attached to the surface.

  When the far end of the strand is attached to the surface adjacent to the nanopore, the bulky structure is cleaved using, for example, an endonuclease that cleaves a restriction site near the bulky structure.

  The bulky structure may be a bead, a bulky molecule (eg, a protein that reversibly binds to a DNA strand), or a DNA origami structure. DNA origami involves the use of base pairing to generate three-dimensional DNA structures. The DNA Origami technology is generally described in Bell, et al, Nano Lett. (2012) 12: 512-517, which is incorporated herein by reference. For example, in the present invention, DNA origami can be used to attach a single DNA molecule to the surface adjacent to the nanopore. In one embodiment, the structure is a "honeycomb cube" (e.g., about 20 nm on each side). This prevents this portion of DNA from passing through the nanopore (as in the package insert). There is a long (single-stranded or double-stranded) DNA that binds to the origami structure. The DNA strand travels through the nanopore until the Origami structure faces the nanopore and inhibits further progression. The current is then turned off and the chains are attached to the surface adjacent to the nanopore.

  In another embodiment, a charged polymer (eg, DNA) with an origami structure is in the central chamber of a three chamber arrangement. Origami prevents DNA from completely entering the other two chambers (or one other chamber in the two chamber example). Thus, in this example, the polymer does not need to be anchored to the surface. This reduces the risk of the polymer knotting and avoids the need to bond one end of the polymer to the surface and cut the bulky part of the other end. The volume of the chamber containing the origami should be as small as possible so that the polymer remains relatively close to the pore, which helps to ensure that the polymer moves quickly when current is applied . While the central chamber containing the polymer segment is not interconnected with the other central chambers (otherwise the various polymers mix), the other chambers (or sets of chambers in the example of three chambers) are mutually Note that you can connect. These other chambers have larger volumes if desired, as the polymer is always near the pore (in fact some of it is inside the pore) as the DNA moves into the other chambers May be

  In some embodiments, the device comprises three chambers in series, where the addition chamber is continuous to allow flow and has a common electrode, but the "deprotection" chamber passes through the nanopore It is fluidly isolated except in flow and has its own electrode.

  In another embodiment, the DNA or other charged polymer is not tethered but can be moved between the synthesis chamber and the deprotection chamber under the control of the electrodes in the chamber, while the polymerase and the deprotection agent connect the chamber Movement between the chambers is restricted because they are bulky so that they can not pass through the nanopore and / or are anchored to the surface in the chambers. See, for example, Figures 1-9 and 16-17.

  The current required to move the charged polymer through the nanopore depends on, for example, the nature of the polymer, the size of the nanopore, the material of the membrane containing the nanopore and the salt concentration, and is optimized for the particular system according to the requirements . In the case of DNA used in the Examples herein, examples of voltages and currents are, for example, 50 to 500 mV (usually 100 to 200 mV) and 1 to 10 nA (eg, about 4 nA) at a salt concentration of 100 mM to 1 M, for example. ).

The movement of charged polymers, for example DNA, through nanopores is usually very fast, for example 1 to 5 μs per base, ie in the order of one million bases per second (1 MHz if the term frequency is employed) This presents a challenge for obtaining an accurate reading that is distinguished from noise in the system. Using this method, (i) the nucleotides need to be repeated in the sequence, eg about 100 times consecutively, in order to bring about a measurable characteristic change, or (ii) alpha hemo Using a pore of a protein such as lysine (αHL) or Mycobacterium smegmatis porin A (MspA), which is relatively large with multiple reading possibilities as the base passes through the polymer It can be tuned to provide a long pore, and in some cases to provide a controlled supply of DNA to one base at a time through the pore, and in some cases as each base passes Use exonuclease to cleave. Various approaches are possible, for example:
A medium or media comprising an electrorheological fluid that reduces the velocity of the polymer from about 1 MHz to about 100 to 200 Hz, for example, the viscosity increases with the application of voltage, thereby slowing the velocity of the polymer through the nanopore Using a fluid system of plasmons whose light viscosity can be controlled by light; or using a molecular motor or a ratchet;
Forming a bulky secondary structure which has to be linearized in order to fit in the nanopore, eg in single stranded DNA, in a polymer, eg an arrangement of “hairpin”, “hammerhead” or “dumbbell” Provide an array, thereby reducing the density of information and providing a signal with a long duration;
Providing multiple reads of the same sequence, eg, using a rapidly changing current to enable multiple reads of the same sequence frame, drawing short molecules of direct current to draw the molecule to the next sequence frame , By reading the entire sequence multiple times, or by reading multiple identical sequences in parallel. Bring together the readings in each case to provide a common reading that amplifies the signal;
-Measuring the change in impedance in high frequency signals induced by the change in capacitance as the monomer (e.g. nucleotide) passes through the nanopore, rather than directly measuring the change in current or resistance;
By enhancing the difference in current, resistance or capacitance between different bases, eg by using non-natural bases which differ in size or are otherwise modified to give different signals, Or by forming larger secondary structures in the DNA, such as “hairpins”, “hammerheads” or “dumbbells” arrangements that provide enhanced signals for large size;
Using an optical reading system, eg, Nam, et al., "Graphene Nanopore with a Self-Integrated Optical Antenna", Nano Lett. (2014) 14: 5584, the contents of which are incorporated herein by reference. Using an integrated light antenna adjacent to the nanopore that acts as a light transducer (or light signal enhancer), such as that described in 5589, to supplement or replace standard ion current measurements. In some embodiments, different monomers are labeled with a fluorescent dye, such as a DNA nucleotide, such that each different monomer fluoresces at a signature intensity as it passes through the junction of the nanopore and its optical antenna. In some embodiments, for example, McNally et al., "Optical recognition of converted DNA nucleotides for sequencing of each molecule", Nano Lett. (2010) 10 (2010) 10 (10), the contents of each being incorporated herein by reference. 6): 2237-2244, and Meller A., "Towards Optical DNA Sequencing Using Nanopore Arrays", J Biomol Tech . (2011) 22 (Suppl): Polymers Nanopores at High Speed as Described in S8-S9 As it passes, the solid phase nanopore removes the fluorescent label, leading to a series of detectable photon bursts.

  In one embodiment, the charged polymer is a nucleic acid, such as single stranded DNA, the sequence of which results in secondary structure. Bell, et al., Nat Nanotechnol. (2016) 11 (7): 645-51, which is incorporated herein by reference, uses a relatively short sequence of detectable dumbbell placement in the solid phase nanopore format to immunize It is described to label the antigen of the assay. The nanopores used by Bell et al. Were relatively large so that the entire dumbbell structure could pass through the pore, but with nanopores smaller than the diameter of the dumbbell configuration, the DNA "unzips" and straightens It becomes chained. More complex arrangements can be used, eg, arrangements in which each bit corresponds to a sequence similar to tRNA (eg, Henley, et al. Nano Lett. (2016) 16: 138-144, which is incorporated herein by reference). See for reference). Thus, the present invention has binary structure having at least two types of secondary structures, wherein the secondary structure is data (e.g., one type of secondary structure is 1 and second secondary structure is 0). Provided), such as single stranded DNA. In other embodiments, secondary structure is used to slow down the nanopore passage of DNA or to provide a break in the sequence to facilitate reading of the sequence.

  In another embodiment, the invention utilizes DNA molecules comprising a series of at least two different DNA motifs, each motif being a specific ligand (eg, a gene regulatory protein for double stranded DNA, or a tRNA for single stranded DNA). And specifically binding information, wherein at least two different DNA motifs encode information (eg in a binary code where one motif is one and the second motif is zero), eg a ligand is a DNA nanopore Enhance the difference in signal (eg, change in current or capacitance) applied to the nanopore as it passes through.

  As discussed above, when different monomers pass through the nanopore, they affect the current through the nanopore primarily by physically blocking the nanopore and changing the conductance of the nanopore. The existing nanopore system directly measures this change in current. The problem with current reading systems is that there is considerable noise in the system, and in the case of DNA, for example, when measuring current fluctuations as different nucleotide units pass through the nanopore, differences between different monomers, eg different bases In order to detect accurately, a relatively long integration time is required with a digit number of one hundredth of a second. Recently, it has been shown that changes in impedance and capacitance can be useful to study cells and biological systems despite the potential for complex interactions of salts and biomolecules. For example, Laborde, et al. Nat Nano. (2015) 10 (9): 791-5 (incorporated herein by reference) is a high-frequency impedance spectroscopy that has low capacitance under physiological salt conditions. Changes have been detected and demonstrated that they can be used to image microparticles and live cells beyond the Debye limit.

  Thus, in one embodiment of the present invention, rather than measuring the fluctuation of the current directly, measuring the capacity fluctuation, for example, induced by the change in capacitance as the monomer (eg, nucleotide) passes through the nanopore The sequence of the charged polymer is identified by measuring the phase change of the radio frequency signal.

  Briefly stated, capacitance exists in any circuit where there is a gap between one electrical conductor and the other electrical conductor. The current fluctuates directly with the capacitance, but not with the capacitance. For example, if current and voltage are plotted over time in an alternating current capacity circuit, both current and voltage will each form a sine wave, but the phases of the waves will be seen to be out of phase. When there is a change in current, there is a change in capacitance, which is reflected in the change in phase of the signal. Radio frequency alternating current produces a signal of constant frequency and amplitude, but the phase of the signal varies with the capacitance of the circuit. In the system of the present application, as the charged polymer is drawn through the nanopore (toward the anode in the case of DNA), rather than alternating current, pulsed direct current (ie polarity is maintained and one electrode is The voltage changes between the two values, but does not exceed the "zero" line so that it remains an anode and the other remains a cathode. If nothing is in the nanopore, the capacitance is a single value, which changes as different monomers of the polymer pass through the nanopore. A range of suitable frequencies is in the range of radio frequencies, for example 1 MHz to 1 GHz, for example 50 to 200 MHz, for example about 100 MHz, for example below the high microwave frequency that can cause significant dielectric heating of the medium. Different frequencies can be applied to different nanopores so that multiple nanopores can be measured simultaneously with one radio frequency input line to reduce the possibility of interference.

  Measuring high frequency changes in impedance (eg, due to changes in capacitance) reduces the effects of 1 / f noise, ie, “pink” noise inherent in the electrical measurement circuit. Increase the signal to noise available for a certain period of time. The use of high frequency signals increases the signal to noise ratio as more measurements are made within a given period of time, a more stable signal that is easily distinguished from impedance changes due to environmental or device fluctuations and fluctuations Bring

  Applying these principles to the present invention, the present invention, in one embodiment, changes in impedance in high frequency signals induced by changes in capacitance as the monomer (eg, nucleotide) passes through the nanopore Provide a way to measure For example, there is provided a method of reading a charged polymer comprising at least two different types of monomers, such as a monomer sequence of a DNA molecule, which may generate radio frequency pulsed direct current, such as 1 MHz to 1 GHz, such as 50 to 200 MHz, for example. Directing the nanopore into the nanopore at a frequency of about 100 MHz, including reading the monomer sequence by measuring the volume fluctuation of the nanopore as the pulsating direct current draws the charged polymer through the nanopore and the charged polymer passes through the nanopore.

  In some embodiments, the invention provides a charged polymer comprising at least two separate monomers, such as a nanotip for sequencing DNA. The nanotip comprises at least a first and a second reaction chamber, each comprising an electrolyte medium, separated by a membrane comprising one or more nanopores, and connected to the circuit (eg in the form of opposite plates) An electrode pair is disposed on either side of the membrane containing one or more nanopores, the electrodes are separated by 1 to 30 microns, eg about 10 microns, and the charged polymer is passed through the nanopores, eg from one chamber to the next Such that when the radio frequency pulsating direct current, for example 1 MHz to 1 GHz, is applied to the electrodes, so that the gap between the electrodes has capacitance, and the phase of the pulsating direct current radio frequency current Changes with the change in capacitance as the charged polymer passes through the nanopore, thereby causing the monolith of the charged polymer to It is adapted to enable detection of over sequence. In certain embodiments, the nanochip comprises a plurality of sets of reaction chambers, wherein the reaction chambers in one set are separated by a membrane having one or more nanopores, the set of reaction chambers being of the reaction chambers Separated by screening layers that minimize electrical interference between the sets and / or separate multiple linear polymers to allow them to be sequenced in parallel.

  For example, in one embodiment, the electrodes form the upper and lower plates of a capacitor embedded in a resonant circuit, and changes in capacitance are measured as DNA passes through the pores between the plates.

  In certain embodiments, the nanochip further comprises a polymer, eg, a reagent for synthesizing DNA, according to, for example, any of the following nanochips 1.

Thus, in one embodiment, the invention provides a method (Method 1) for synthesizing a charged polymer [eg, a nucleic acid (eg, DNA or RNA)] comprising at least two separate monomers in a nanotip, the nanotip comprising ,
One or more monomers [e.g. nucleotides] or oligomers [e.g. oligonucleotides], in buffer, in end-protected form, such that only a single monomer or oligomer can be added in one reaction cycle One or more addition chambers containing reagents for addition to the charged polymer; and
One or more storage chambers, where the buffer contains but does not contain all the reagents necessary for the addition of one or more monomers or oligomers, where the chambers are separated by one or more membranes containing one or more nanopores Has been
The charged polymer can pass through the nanopore but can not pass through at least one of the reagents for the addition of one or more monomers or oligomers)
Including
This method is
a) moving the first end of the charged polymer having the first end and the second end to the addition chamber by electrical attraction, thereby adding the monomer or oligomer in a blocked form to the first end To do,
b) transferring the first end of the charged polymer, together with the added monomer or oligomer in blocked form, to the storage chamber,
c) deblocking the added monomer or oligomer, and
d) repeating steps ac until the desired polymer sequence is obtained, wherein the monomers or oligomers added in step a) are the same or different,
including.

For example, the present invention provides the following.
1.1. Method 1, wherein the polymer is a nucleic acid, eg, the polymer is DNA or RNA, eg, DNA, eg, dsDNA or ssDNA.

1.2 Any of the above methods wherein the second end of the polymer, eg nucleic acid, is protected or attached to a substrate adjacent to the nanopore.

1.3 Any of the above-mentioned methods, wherein an electrical attraction is provided by applying a voltage between the electrodes in each chamber, and the polarity and current between the electrodes can be controlled, for example, to attract nucleic acids to the anode.

1.4 The polymer is a nucleic acid,
(I) the first end of the nucleic acid is the 3 'end and the addition of nucleotides in the 5' to 3 'direction and catalyzed by the polymerase, eg, the polymerase (eg, due to its size or , Because they are anchored to the substrate in the first chamber), and the nucleotides are 3'-protected at the time of addition, and 3'-protected nucleotides at the 3'-end of the nucleic acid After the addition, the 3'-protecting group on the nucleic acid is removed, for example, in a storage chamber; or (ii) the first end of the nucleic acid is the 5 'end and the addition of nucleotides is 3' to 5 '. The nucleotide is 5'-protected at the time of addition, and after adding a 5'-protected nucleotide to the 5'-end of the nucleic acid, the 5'-protecting group is for example in the second chamber. Remove (for example, The phosphate on the nucleotide is a nucleoside phosphoramidite linked via a 5'-protecting group to a bulky group that can not pass through the nanopore, washing away unreacted nucleotide following coupling to nucleic acid, and bulky Separating the 5'-protecting group from the nucleic acid, washing away and allowing the 5'-end of the nucleic acid to be transferred to the storage chamber);
Here, the addition of nucleotides to the nucleic acid is controlled by the movement of the first end of the nucleic acid entering and exiting one or more addition chambers, and this cycle is continued until the desired sequence is obtained.
Any of the above mentioned methods.

1.5 Any of the preceding methods, wherein the sequence of monomers or oligomers in the polymer thus synthesized [e.g. the sequence of nucleotides in the nucleic acid] corresponds to the binary code.
1.6 Any of the preceding methods wherein the polymer thus synthesized is single stranded DNA.
1.7 Sequences of polymers [eg nucleic acids] are confirmed during processing or synthesis by sequencing monomers or oligomers [eg nucleotide bases] as they pass through the nanopore and identifying errors in sequencing , Any of the above methods.

1.8 The polymer so synthesized is a single stranded DNA, and at least 95%, eg at least 99%, eg two of the bases in substantially all sequences do not hybridize to other bases in the strand Any of the above methods, wherein the base is selected from bases, for example selected from adenine and cytosine.

1.9 Multiple polymers [e.g., by individually controlling whether a polymer is present in one or more addition chambers or one or more storage chambers so as to obtain polymers [oligonucleotides] having different sequences. Any of the above methods, wherein the oligonucleotides are independently synthesized in parallel.

1.10 There are at least two addition chambers comprising different monomers or oligomers, eg reagents suitable for adding different nucleotides, eg one or more addition chambers comprising reagents suitable for addition of the first monomer or oligomer, and There are one or more addition chambers containing reagents suitable for the addition of a second different monomer or oligomer, for example, one or more addition chambers containing reagents suitable for the addition of adenine nucleotides, and reagents suitable for the addition of cytosine nucleotides Any of the methods described above, including one or more additional chambers.

1.11 at least one addition chamber is a flow chamber, (i) providing flow chamber reagents suitable for addition of a first monomer or oligomer, (ii) flushing, (iii) a second different monomer or Providing a flow cycle comprising providing a flow chamber reagent suitable for addition of the oligomer, and (iv) washing away, repeating this cycle until the synthesis is complete, the sequence of monomers or oligomers in the polymer being each Any of the above methods, wherein in step (i) or (iii) of the cycle, the first end of the polymer is controlled by introducing or excluding from the flow chamber;

1.12 the polymer is DNA, at least one addition chamber is the flow chamber, (i) providing flow chamber reagents suitable for addition of the first type of nucleotides, (ii) washing away, (iii) Providing a flow cycle comprising providing a flow chamber reagent suitable for addition of a second type of nucleotide, and (iv) washing away, repeating the cycle until the synthesis is complete, the sequence being in the flow chamber Any of the foregoing methods controlled by controlling the presence or absence of the first end (e.g., the 3'-end) of the DNA.

1.13 the polymer is DNA, at least one addition chamber is the flow chamber, (i) providing flow chamber reagents suitable for the addition of the first type of nucleotides, (ii) washing away, (iii) Providing a flow chamber reagent suitable for addition of a second type of nucleotide, and (iv) washing away, (i) providing a flow chamber reagent suitable for addition of a third type of nucleotide, (ii) Providing a flow cycle comprising flushing, (iii) providing a flow chamber reagent suitable for addition of a fourth type of nucleotide, and (iv) flushing, repeating this cycle until the synthesis is complete, The sequence is selected when reagents suitable for the addition of different types of nucleotides are present. Is controlled by controlling the presence or absence of a first end of the DNA (e.g., the 3'-end) in the members, any of the methods described above.

1.14 The polymer is DNA and the nanochip comprises two additional chambers where the flow chamber is a (a) a first flow chamber provides (i) a flow chamber reagent suitable for the addition of a first type of nucleotide Providing a flow cycle comprising: (ii) washing away, (iii) providing a flow chamber reagent suitable for addition of a second different type of nucleotide, and (iv) washing away, the synthesis is complete This cycle is repeated until (b) the second flow chamber provides (i) a second flow chamber reagent suitable for the addition of the third type of nucleotides, (ii) flushing, iii) providing a second flow chamber reagent suitable for the addition of a fourth different type of nucleotide; And (iv) washing away, and repeating this cycle until the synthesis is complete, wherein the nucleotides are selected from dATP, dTTP, dCTP and dGTP, and the sequence is the first of the DNAs. Any of the above methods wherein the terminus (eg, the 3'-terminus) of is controlled by introducing it into the flow chamber when the next desired nucleotide is provided.

1.15 The polymer is DNA, and the nanopore chip has one or more addition chambers for adding dATP, one or more addition chambers for adding dTTP, one or more addition chambers for adding dCTP, and , Any of the above methods comprising one or more additional chambers for adding dGTP.

1.16 Any of the methods described above, wherein the polymers [eg nucleic acids] to be synthesized are each attached via their second ends to the surface adjacent to the nanopore.

1.17 The sequence of the polymer [eg nucleic acid] is determined following each cycle by detecting changes in voltage, current, resistance, capacitance and / or impedance as the polymer passes through the nanopore, Any of the above mentioned methods.

1.18 The polymer is a nucleic acid, and the synthesis of the nucleic acid is a buffer, for example, a buffer for adjusting the pH to 7 to 8.5, for example, about pH 8, such as tris (hydroxymethyl) aminomethane (Tris), a suitable acid And, optionally, a buffer containing a chelator, such as ethylenediaminetetraacetic acid (EDTA), such as a Tris base, a TAE buffer containing a mixture of acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA In a solution containing, for example, 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate (pH 7.9 @ 25 ° C.) Any way.

1.19 Any of the foregoing methods, wherein the polymer is single stranded DNA and further comprising converting the synthesized single stranded DNA to double stranded DNA.

1.20 Any of the above methods, further comprising removing the polymer [eg nucleic acid] from the nanotip after completion of polymer synthesis.

1.21 Any of the methods described above, wherein the polymer is a nucleic acid and further comprising amplifying and recovering a copy of the synthesized nucleic acid using appropriate primers and a polymerase (eg Phi 29).

1.22 Any of the methods described above, wherein the polymer is a nucleic acid, further comprising cleaving the synthesized nucleic acid with a restriction enzyme and removing the nucleic acid from the nanochip.

1.23 Any of the methods described above, wherein the polymer is a nucleic acid, further comprising amplifying the nucleic acid thus synthesized.

1.24 Any of the preceding methods, further comprising removing the polymer [eg nucleic acid] from the nanotip and crystallizing the polymer.

1.25. The polymer is a nucleic acid, for example, as described in, for example, US Pat. No. 8,283,165 B2, which is incorporated herein by reference, a solution containing the nucleic acid may be one or more buffers (eg, borate buffer), antioxidants, wetted By drying with an agent such as a polyol and optionally a chelating agent; or between a nucleic acid and a polymer such as poly (ethylene glycol) -poly (l-lysine) (PEG-PLL) AB block copolymer Or, further comprising stabilizing the nucleic acid by the addition of a protein that binds to a complementary nucleic acid strand or DNA;

1.26
(I) reacting the nucleic acid with a 3′-protected nucleotide in an addition chamber in the presence of a polymerase that catalyzes the addition of the 3′-protected nucleotide to the 3 ′ end of the nucleic acid;
(Ii) withdrawing at least the 3 'end of the thus obtained 3'-protected nucleic acid from the addition chamber, through the at least one nanopore, into the storage chamber, wherein the polymerase (eg, for its size or , Because they are anchored to the substrate in the first chamber) are not allowed to pass through the nanopore;
(Iii) deprotecting the 3'-protected nucleic acid, eg chemically or enzymatically; and (iv) adding an additional 3'-protected dNTP to the oligonucleotide, if it is desired, step (i) Pulling the 3 'end of the oligonucleotide into the same or a different addition chamber so that (iii) is repeated or, if that is not desired, an additional cycle in which the desired 3'-protected dNTP is provided to the addition chamber Until the 3 'end of the nucleic acid remains in the storage chamber; and (v) repeating steps (i) to (iv) until the desired nucleic acid sequence is obtained,
Any of the above mentioned methods, including:

1.27 The polymer is a nucleic acid single-stranded DNA (ssDNA), and one or more nanopores have a diameter that allows ssDNA to pass but not double-stranded DNA (dsDNA), for example, a diameter of about 2 nm. Any of the above mentioned methods.

1.28 The monomer is a 3'-protected nucleotide, such as, for example, from deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP) Any of the methods described above which is a selected deoxynucleotide triphosphate (dNTP), for example dATP or dCTP.

1.29 The polymer is a nucleic acid and the addition of nucleotides to the nucleic acid is catalyzed by a polymerase such as a template independent polymerase such as terminal deoxynucleotide transferase (TdT) or polynucleotide phosphorylase, eg, a polymerase of DNA Any of the above methods which catalyze the incorporation of deoxynucleotides at the 3'-hydroxyl terminus.

1.30 Any of the foregoing, wherein the membrane comprises a plurality of nanopores and a plurality of polymers each attached to the surface adjacent to the nanopore, eg, a plurality of nucleic acids attached to the surface adjacent to the nanopore via the 5 'end the method of.

1.31 A plurality of polymers each attached to the surface adjacent to the nanopore, for example, a plurality of nucleic acids attached at the 5 'end to the surface adjacent to the nanopore are independently synthesized, and each nanopore is associated with an electrode pair, an electrode One electrode of the pair is in close proximity to one end of the nanopore, the other electrode is in close proximity to the other end of the nanopore, and the current provided by the electrode pair causes each polymer to become first and second Any of the methods described above, which can be moved independently between the chambers.

1.32 The polymer is a 3'-protected nucleic acid attached at the 5 'end to the surface adjacent to the nanopore, and the 3' end of the 3'-protected nucleic acid can be, for example, adjacent chambers by using electric power Any of the methods described above, wherein the method is drawn through the nanopore by using an electrical force applied from the inner electrode.

1.33. The method of 1.20, wherein the new 3'-protected dNTP is the same as or different from the first 3'-protected dNTP.

1. The method of 1.20, wherein the 3'-protected dNTPs used in step (i) of the 34 cycles alternate between 3'-protected dATP and 3'-protected dCTP in each cycle.

1.35 Any of the above wherein the polymer is a nucleic acid and deprotection of the nucleic acid is performed by an enzyme which removes the 3'-protecting group on ssDNA but does not remove the 3'-protecting group on the 3 'protected dNTPs Method.

  For example, the invention provides a method of synthesizing a nucleic acid in a nanochip, the nanochip comprising at least a first chamber and a second chamber separated by a membrane comprising at least one nanopore, the synthesis comprising It is carried out in a buffer by the cycle of nucleotide addition to the first end of the nucleic acid having one end and the second end, wherein the first end of the nucleic acid comprises one or more addition chambers (nucleotides are added Is moved by electrical attraction between one or more storage chambers (containing no reagents necessary for the addition of nucleotides) and the chambers are separated by one or more membranes each containing one or more nanopores. And nanopores are large enough to allow the passage of nucleic acids, but allow at least one reagent essential for the addition of nucleotides to pass through. Too small, for example, the method corresponds to one of the methods 1 described.

  In certain embodiments, the sequence of the polymer corresponds to a binary code, eg, the polymer is a nucleic acid, the sequence corresponds to a binary code, and each bit (0 or 1) is represented by a base, eg A or C Ru.

  In certain embodiments, the polymer is DNA.

  In certain other embodiments, each bit is represented by a short sequence of monomers, rather than a single monomer. For example, in one such embodiment, clumps of DNA are synthesized, each clump generating a unique signal through the nanopore, corresponding to 0 or 1. Since this embodiment has certain advantages that it is more difficult to detect a single nucleotide in a nanopore, in particular in a solid phase nanopore, the density of the information in the polymer is correspondingly higher when using lumps Although reduced, errors in reading are less likely to occur.

  For example, using a site-specific recombinase, an enzyme that spontaneously recognizes and cleaves at least one strand of a nucleic acid duplex within a sequence segment known as a site-specific recombination sequence. A strand of nucleotides can be added. In one such embodiment, the site-specific recombinase is a topoisomerase used to link topo-conjugated ds DNA oligonucleotide clusters to the sequence. These oligonucleotides themselves do not have a structure compatible with further ligation until they are cleaved with restriction enzymes. Vaccinia virus topoisomerase I specifically recognizes the DNA sequence 5'- (C / T) CCTT-3 '. Topoisomerase binds to double stranded DNA and cleaves it at the 5 '-(C / T) CCTT-3' cleavage site. Since the topoisomerase cleaves the DNA with only one strand, the cleavage is not complete (although there is a nick in the other strand leads to some double-strand breaks), and upon cleavage, the topoisomerase is a 3 'nucleotide Note that it is covalently linked to the 3 'phosphate of. Thereafter, the enzyme remains covalently linked to the 3 'end of the DNA, and the covalently held strand can be religated at the same bond as was originally cut (as it occurs in DNA relaxation), Alternatively, it can be religated to heterologous acceptor DNA with a compatible overhang to generate a recombinant molecule. In this embodiment, one of at least two different sequences of dsDNA donor oligonucleotides (eg, one “0” and the other “1”) adjacent to the topoisomerase recombination site and the restriction site to generate the topoisomerase linking site Generate one). These cassettes are Topo-charged; ie, they are covalently linked to topoisomerase, which binds them to the topoisomerase linking site on the receiver oligonucleotide. When the DNA strand of the extending receiver is digested with restriction enzyme, it can be ligated to the topo-loaded cassette. Thus, it is only necessary to continuously circulate the elongating DNA from the restriction enzyme to the topo-loaded cassette, each cycle adding another donor oligonucleotide. A related approach is described for cloning, for example, Shuman S., Novel approach to molecular cloning and polynucleotide synthesis using vaccinia DNA topoisomerase. J Biol Chem. (1994); 269 (51); ): 32678-84.

  Similar strategies can be used to add a single base. In the presence of a suitable single-stranded "deprotected" "acceptor" DNA, the topo-loaded DNA is enzymatically and covalently linked ("added") to the acceptor by its topoisomerase, and the topoisomerase is It is removed from the DNA in this process. Type IIS restriction enzymes can cleave all added DNA except for one base (the "added" base). This deprotection-addition process can be repeated to add more bases (bits). As demonstrated in the Examples herein, a combination of topo / IIS restriction enzymes can be used to add a single nucleotide to the 5 'end of target single stranded DNA. The use of type IIS restriction enzyme allows cleavage of DNA at a position different from the recognition sequence (other type IIS restriction enzymes can be found at https://www.neb.com/tools-and-resources/selectioncharts/ found in type-iis-restriction-enzymes). Using inosine (which acts as a "universal base" and pairs with any other base) in this system, this reaction can occur without any sequence requirement on the target DNA. The identity of the nucleotide added to single-stranded target DNA is a 3 'nucleotide to which vaccinia topoisomerase is linked via a 3' phosphate. Since the recognition sequence for vaccinia topoisomerase is (C / T) CCTT, this system was used to add "T" to the target DNA. There is a related topoisomerase, SVF, which can use the recognition sequence CCCTG (https://www.ncbi.nlm.nih.gov/pubmed/8661446). Thus, SVF can be used to add "G" instead of "T". When combined with vaccinia topo, binary data can be encoded in T and G.

  In another approach of single base addition, the 5 'phosphate provides a protecting group, resulting in the addition of a single base in the 3' to 5 'direction. The loading reaction loads the topoisomerase with a single T (or G, or optionally another nucleotide) with a 5 'phosphate group. When the loaded topoisomerase "finds" a 5'-blocked (non-phosphorylated) single-stranded DNA strand, it adds a T to that strand, resulting in a 5 'T-attached DNA . This addition is facilitated by the presence of adapter DNA with a sequence to which topoisomerase and single stranded acceptor DNA can bind (adapter DNA is catalytic-note that it can be reused as a template in repeated reactions) I want to be Because the added nucleotide has a 5 'phosphate, it does not become a substrate for further addition until it is exposed to a phosphatase that removes the 5' phosphate. This process is repeated using vaccinia topoisomerase, which adds a single "T" to the 5 'end of the target single-stranded DNA, and SVF topoisomerase, which adds a single "G", thus T and G binary Can construct sequences encoding information. Other topoisomerases can be used to add A or C, but the efficiency of this reaction is low.

  One of the advantages of using a topoisomerase-mediated strategy is that the monomer is covalently linked to topoisomerase and thus can not "escape" to interfere with other reactions. Using a polymerase, the monomer can flow such that the monomer can diffuse and the polymerase and / or deblocking agent should be specific (eg, selective for A vs. C) or have no opportunity to mix. Provided by

  In one aspect, the invention provides a single nucleotide loaded topoisomerase, ie, a topoisomerase linked to a single nucleotide. Here, for example, topoisomerase is linked via the 3'-phosphate of the nucleotide, which is protected, eg phosphorylated, at the 5'-position.

  In another aspect, the invention provides a method of synthesizing a DNA molecule using topoisomerase-mediated ligation by adding a single nucleotide or oligomer to the DNA strand in a 3 'to 5' direction (Method A) (I) reacting the DNA molecule with the topoisomerase loaded with the desired nucleotide or oligomer, wherein the nucleotide or oligomer is blocked from further addition at the 5 'end, (Ii) deblocking the 5 'end of the DNA thus formed, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained. For example, the following is provided:

A1.1 (i) The DNA molecule was loaded with the 5 'protected form, eg, the 5' phosphorylated form of the desired nucleotide, such that the desired nucleotide of the 5 'protected form is added to the 5' end of the DNA Reacting with topoisomerase, then (ii) deprotecting the 5 'end of the thus formed DNA using a phosphatase enzyme, and steps (i) and (ii) until the desired nucleotide sequence is obtained. A) a method of synthesizing a DNA molecule by adding a single nucleotide in the 3 'to 5' direction, comprising repeating A), or

A1.2 (i) reacting the DNA molecule with the topoisomerase loaded with the desired oligomer, thereby linking the oligomer to the DNA molecule, then (ii) using the restriction enzyme to topoisomerase of the other oligomer Providing the 5 'site for mediated ligation and repeating the steps (i) and (ii) until the desired oligomer sequence is obtained, with the oligomer in the 3' to 5 'direction Method A, which is a method for the synthesis of DNA molecules by addition.

A1.3 Any of the methods described above, including providing a ligase and ATP that seal the nick in the DNA [NB: topoisomerase ligation ligates only one strand].

A1.4 Any of the methods described above, wherein the topoisomerase-loaded donor oligonucleotide comprises a 5 'overhang on the strand complementary to the strand carrying the topoisomerase and comprises a polyinosine sequence [NB: inosine acts as a "universal base" And paired with any other base].

A1.5 Any of the aforementioned methods, wherein the restriction enzyme is an IIS type restriction enzyme capable of separating all the added DNA other than a single base (the "added" base).

A1.6 Any of the aforementioned methods, wherein topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.

A1.7 Add vaccinia topoisomerase (recognizing (C / T) CCTT) to add dTTP nucleotides, and use SVF topoisomerase I (recognize CCCTG) to add dGTP nucleotides, eg to provide a binary code Any of the above mentioned methods

A1.8 Any of the foregoing methods, wherein the DNA is double stranded, the storage chamber further comprises ligase and ATP, and the DNA strand not ligated by topoisomerase is repaired.

A1.9 Any of the above methods, including the use of topoisomerase inhibitors to inhibit the binding and activity of free topoisomerase to DNA oligomers, eg, wherein the inhibitor is selected from novobiocin and coumeramycin.

A1.10 Any of the foregoing methods, wherein the DNA strand thus provided has a sequence comprising thymidine (T) nucleoside and deoxyguanidine (G) nucleoside.

A1.11 Any of the above-mentioned methods, wherein the topoisomerase adds a single base, but the restriction enzyme cleaves at a position which is one nucleotide in the 5 'direction from the base added by the topoisomerase.

A1.12 Any of the methods mentioned above, wherein the DNA strand thus provided has a sequence comprising the sequences of "TT" and "TG" dinucleotides.

A1.13 Any of the aforementioned methods, wherein the DNA is single-stranded
A1.14 Any of the aforementioned methods, wherein the DNA is double stranded.

A1. 15. Any of the above methods wherein the DNA is on a substrate or magnetic bead and can be selectively exposed to or removed from reagents necessary to provide the desired sequence.

A1. Any of the above methods, wherein some or all reagents for addition or deblocking of DNA are supplied by flow and removed by washing away.

A1. 17. Any of the above methods wherein binding to a single nucleotide or oligomer single stranded DNA is facilitated by the presence of adapter DNA having a sequence to which topoisomerase and single stranded acceptor DNA can bind.

A1.18 For example, as described in any of the following method 2, the nanopore is carried out in a system that separates the chamber containing topoisomerase from the chamber containing phosphatase or restriction enzyme, and the nanopore enables the movement of DNA by electrical attraction. Any of the above mentioned methods, which do not allow the transfer of the enzyme.

  One possible concern is that poly G sequences can form G quadruplex secondary structures. By applying the restriction enzyme one base back (to the 5 'of the topo sequence) and following a similar topo / IIS strategy, "TT" or "TG" can be added, each of which can represent a different bit. Although this requires two bases to code one bit, it has the advantage of avoiding poly G sequences. In another embodiment, the other base at the 3 'end of the topo recognition sequence is less efficient than (C / T) CCTT, but (C / T) CCTA, (C / T) CCTC and (C / T) 2.) Enable conjugation using poxvirus topoisomerase using CCTG (https://www.ncbi.nlm.nih.gov/pubmed/17462694). Protein engineering / selection techniques can be used to improve the efficiency of these reactions as well, and similar approaches can be used for the addition of non-standard bases.

  In certain embodiments, the method of synthesizing DNA by this method comprises treating the DNA with ligase and ATP. Topoisomerases ligate only one side of the DNA (the other is essentially nicked). The ligase repairs the nick and ensures that the topoisomerase itself recuts the reaction product and does not cut it off.

  In certain embodiments, the methods involve the use of topoisomerase inhibitors to inhibit the binding and activity of free topoisomerase to DNA oligomers. Suitable inhibitors include novobiocin and coumamycin. It should be noted that complete inhibition is undesirable, as low levels of topoisomerase activity help "relaxation" of coiled DNA and is particularly useful when synthesizing long DNA strands.

Thus, in another embodiment, the present disclosure provides a method of synthesizing DNA in a nanochip (Method 2), the nanochip comprising a topoisomerase loaded oligonucleotide (ie, an oligonucleotide linked to topoisomerase at the 3 'end) Containing one or more additional chambers, and one or more storage chambers containing restriction enzymes or deblocking agents, such as phosphatases, which also contain compatible buffers and separated by a membrane comprising at least one nanopore Where topoisomerase and restriction enzymes are prevented from passing through the nanopore (eg, because they are too large and / or they are tethered to the substrate of the first and second chambers, respectively) ), The synthesis may be single nucleotide or short oligonucleotides It is carried out by a cycle of adding the tide mass to the first end of the nucleic acid having the first end and the second end, wherein the first end of the nucleic acid is electrically attracted to the addition chamber and the storage chamber. For example, in one embodiment:
(I) moving the 5 'end of the receiver DNA (e.g. double-stranded DNA) to the first addition chamber by electric force;
(Ii) providing a topoisomerase loaded donor oligonucleotide in a first addition chamber, wherein the donor oligonucleotide is selected from topoisomerase binding sites, information sequences (eg, at least two different nucleotides or sequences, eg, In binary code, one of the sequences corresponds to "0" and the other to "1"), including a restriction site that when cleaved by a restriction enzyme gives a topoisomerase linking site;
(Iii) taking sufficient time for the donor oligonucleotide to ligate to the receiver DNA, thus extending it;
(Iv) The 5 'end of the thus-extended receiver DNA is transferred by electric force to a storage chamber, eg, as a restriction enzyme cleaves the receiver DNA to provide a topoisomerase linking site, or a single nucleotide In the case of the addition of a deblocking agent, for example a phosphatase, so as to produce a 5 'deblocked nucleotide on the single stranded DNA; and (v) until the desired DNA sequence is obtained. , Repeating the cycle of steps (i) to (iv) and adding oligonucleotides having the same or different information sequences.

For example, the present invention provides the following.
2.1 Method 2 wherein the 3 'end of the receiver DNA is in close proximity to the nanopore and the 5' end of the receiver oligonucleotide comprises a topoisomerase linkage site, the first addition following step (iv) Adding the additional oligonucleotide to the 5 'end of the receiver DNA by flushing the chamber and providing new topoisomerase-loaded donor oligonucleotide to the first addition chamber, where the new donor oligonucleotide is Have a different information sequence than the donor oligonucleotide; if it is desired that a new donor oligonucleotide be added to the receiver DNA, the 5 'end of the receiver nucleic acid is pulled back into the first chamber, and steps (i) to (iii) Repeat, or if it is not desirable To the donor oligonucleotide is provided in the first chamber, to stay the receiver DNA into a second chamber, Method 2.

2.2 Multiple receiver DNA molecules are synthesized independently and in parallel, and it is possible to obtain DNA molecules having different sequences by separately controlling whether or not they are present in the first chamber , Any of the above methods.

2.3 A plurality of receiver DNA molecules bound to the surface adjacent to the nanopore at each 3 'end are independently synthesized, each nanopore is accompanied by an electrode pair, and one electrode of the electrode pair is adjacent to one end of the nanopore With the other electrode in close proximity to the other end of the nanopore so that the current provided by the electrode pair allows each receiver DNA molecule to move independently between the first and second chambers. Any of the above mentioned methods.

The donor oligonucleotides used in step (i) of 2.4 cycles alternate between the donor oligonucleotides containing the first information sequence and the donor oligonucleotides containing the second information sequence at each cycle One of the ways.

2.5 A donor in which the 5 'end of the receiver DNA is returned to the first addition chamber and an oligonucleotide having the same information sequence is added, or the 5' end of the receiver DNA is bound to topoisomerase at the 3 'end By transferring to the second addition chamber with the oligonucleotide (where the donor oligonucleotide in the second addition chamber has a different information sequence than the donor oligonucleotide in the first addition chamber), Method 2, which comprises adding an oligonucleotide to the 5 'end of the receiver DNA.

［ここで、Ｎは任意のヌクレオチドを表し、制限酵素はＡｃｃ１であり、これは、ＤＮＡ（例えば上記の配列中のＧＴＣＧＡＣ）を切断し、適切なオーバーハングを提供できる］
を有する、上述のいずれかの方法。 2.6 Donor oligonucleotides have the following structure:

[Here, N represents any nucleotide, and the restriction enzyme is Acc1, which can cleave DNA (eg, GTCGAC in the above sequence) and provide a suitable overhang].
Any of the above methods, having.

2.7 Any of the methods described above wherein the donor oligonucleotide has a hairpin structure, eg, the NNNNN groups of the upper and lower strands are attached 2.6.

を有する、上述のいずれかの方法。 2.8 At least one of the topoisomerase loaded oligonucleotides has the following structure:

Any of the above methods, having.

を有する、上述のいずれかの方法。 2.9 At least one of the topoisomerase loaded oligonucleotides has the following structure:

Any of the above methods, having.

2.10 Any of the methods described above using topoisomerase loaded oligonucleotides.
2.11 The sequence of the synthesized DNA is determined following each cycle by detecting changes in voltage, current, resistance, capacitance and / or impedance as the oligonucleotide passes through the nanopore. Any way.

2.12 The synthesis of DNA can be carried out in a buffer, for example a buffer of pH 7 to 8.5, for example about pH 8, such as tris (hydroxymethyl) aminomethane (Tris), a suitable acid and optionally a chelator For example, in a solution containing ethylenediaminetetraacetic acid (EDTA), such as a solution containing TBE buffer containing a mixture of Tris base, acetic acid and EDTA, or TBE buffer containing a mixture of Tris base, boric acid and EDTA; Any of the methods described above, occurring in a solution containing 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl, or, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate (pH 7.9 @ 25 ° C.).

2.13 Any of the above methods, further comprising removing the DNA from the nanochip.
Any of the above mentioned methods.

2.14 Any of the above methods, further comprising amplifying the DNA thus synthesized.

2.15 Any of the above methods, further comprising removing the DNA from the nanochip and crystallizing the DNA.

2.16 The solution containing DNA can be combined with one or more buffers (eg, borate buffer), antioxidants, wetting agents such as polyols, and if necessary, as described, for example, in US Pat. No. 8,283,165 B2, which is incorporated herein by reference. Drying with the chelating agent by means of: or the nucleic acid by forming a matrix between the nucleic acid and the polymer, eg poly (ethylene glycol) -poly (l-lysine) (PEG-PLL) AB type block copolymer, etc. Any of the above methods, further comprising stabilizing.

2.17 Any of the methods described above, including providing a ligase and ATP that seal the nick in the DNA [NB: topoisomerase ligation ligates only one strand].

2.18 Any of the above methods, wherein the donor oligonucleotide loaded with topoisomerase contains a 5 'overhang on the strand complementary to the strand carrying the topoisomerase and contains a polyinosine sequence [NB: inosine refers to "universal base Act as "and pair with any other base".

2.19 Any of the aforementioned methods, wherein the restriction enzyme is an IIS type restriction enzyme capable of separating all added DNA other than a single base ("added" base).

2.20 Any of the foregoing methods wherein topoisomerase is selected from vaccinia topoisomerase and SVF topoisomerase I.

2.21 Add dTTP nucleotides using vaccinia topoisomerase (recognizing (C / T) CCTT) and add dGTP nucleotides using SVF topoisomerase I (recognizing CCCTG), for example binary coding information Any of the above methods provided.

2.22 Any of the methods described above, wherein the storage chamber further comprises ligase and ATP and repairs the DNA strand not ligated by topoisomerase.

2.23 Any of the foregoing methods comprising the use of topoisomerase inhibitors to inhibit the binding and activity of free topoisomerase to DNA oligomers, eg, wherein the inhibitor is selected from novobiocin and coumeramycin.

2.24 Any of the foregoing methods wherein the DNA strand thus provided has a sequence comprising thymidine (T) nucleoside and deoxyguanidine (G) nucleoside.

2.25 Any of the above methods, wherein the topoisomerase adds a single base, but the restriction enzyme cleaves at a position which is one nucleotide in the 5 'direction from the base added by the topoisomerase.

2.26 Any of the methods mentioned above, wherein the DNA strand thus provided has a sequence comprising the sequences of "TT" and "TG" dinucleotides.

2.27 A method of synthesizing a DNA molecule by adding a single nucleotide in the 3 'to 5' direction, wherein (i) the desired nucleotide in the 5 'protected form is added to the 5' end of the DNA Reaction of the DNA molecule with the topoisomerase loaded with the desired nucleotide in the 5 'protected form, for example the 5' phosphorylated form, and then (ii) thus formed using a phosphatase enzyme Any of the above methods comprising deprotecting the 5 'end of the DNA and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.

2.28 A method of synthesizing a DNA molecule by the addition of oligomers in a 3 'to 5' direction, wherein (i) the DNA molecule is reacted with topoisomerase loaded with the desired oligomer, thereby Ligating the oligomer to a DNA molecule, then (ii) providing a 5 'site for further oligomeric ligation mediated by topoisomerase using a restriction enzyme, and the desired nucleotide sequence is obtained. Any of the above methods, including repeating steps (i) and (ii) until:
2.29 Any of the above methods, which is a method according to Method A described.

  The products of the synthesis reaction can be detected, surveyed for quality control purposes, and read to extract polymer encoded data. For example, DNA can be amplified and sequenced by conventional means to confirm the robustness of nanopore sequencing.

［ここで、情報配列ＡまたはＢは、３〜１２個、例えば、約８個のヌクレオチドの配列である］
を含む、オリゴヌクレオチドを提供する。 In another embodiment, the present invention relates to topoisomerase binding sites, information sequences (eg selected from at least two different sequences, eg binary code, one sequence corresponding to "0" and the other to "1"). And a restriction site that when cleaved by a restriction enzyme provides a topoisomerase linking site, eg, the following sequence:

[Here, the information sequence A or B is a sequence of 3 to 12, for example, about 8 nucleotides]
And providing an oligonucleotide.

［ここで、情報配列ＡまたはＢは、３〜１２個、例えば、約８個のヌクレオチドの配列であり、＊は、オリゴヌクレオチドに共有結合したトポイソメラーゼ；例えば、トポイソメラーゼはワクシニアウイルストポイソメラーゼＩである］
を提供する。 In another embodiment, the present invention provides an oligonucleotide loaded with topoisomerase, wherein the topoisomerase binding site, information sequence (eg, selected from at least two different sequences, eg, binary code, one sequence is “ 0), the other corresponds to “1”, and an oligonucleotide comprising a restriction site which when cleaved by a restriction enzyme gives a topoisomerase linking site; eg an oligonucleotide loaded with topoisomerase having the following structure:

[Here, the information sequence A or B is a sequence of 3 to 12, for example, about 8 nucleotides, * is a topoisomerase covalently linked to an oligonucleotide; for example, the topoisomerase is vaccinia virus topoisomerase I]
I will provide a.

  In another embodiment, the present invention provides a single-stranded or double-stranded DNA molecule as described above, wherein the single-stranded or coding sequence is essentially non-hybridizable bases, such as adenine and cytosine (A and C). Provides DNA molecules, which are arranged in sequences corresponding to binary code, eg for use in data storage methods. For example, the invention provides that the DNA is single stranded or double stranded and at least 1000 nucleotides long, such as 1000 to 1,000,000 nucleotides, such as 5,000 to 20,000 nucleotides long, DNA (DNA1), the sequence of which corresponds to the binary code; for example:

1.1 DNA 1 in which the DNA is single stranded.
1.2 DNA 1 wherein the DNA is double stranded.

1.3 Any of the above DNAs wherein the nucleotides in the single stranded or coding sequence are selected from adenine, thymine and cytosine nucleotides, for example selected from adenine and cytosine nucleotides, or thymine and cytosine nucleotides.

1.4 Any of the DNAs described above consisting mainly of non-hybridizing nucleotides so as not to form significant secondary structure when in single stranded form.

Any of the above DNAs wherein the 1.5 nucleotides are at least 95%, such as 99%, such as 100%, adenine and cytosine nucleotides.

1.6 added to separate or break up the nucleotides containing the binary code, eg to separate groups of 1s and 0s, or groups of 1s and 0s, so that consecutive 1s or 0s can be read more easily Any of the DNAs described above comprising a nucleotide or nucleotide sequence.

1.7 (a) each bit of the binary code corresponds to a single nucleotide, eg 1 and 0 correspond respectively to A or C; or (b) each bit of the binary code is more than 1 nucleotide For example, any of the DNAs described above corresponding to a series of 2, 3 or 4 nucleotides, such as AAA or CCC.

1.8 Any of the above DNA which has been crystallized.
1.9 The nucleic acid containing solution may be combined with one or more buffer salts (eg, borate buffer), antioxidants, wetting agents such as polyols, and / or the like, as described, for example, in US Pat. No. 8,283,165 B2, which is incorporated herein by reference. Optionally, in a dry form with a chelating agent; and / or in a matrix between the nucleic acid and the polymer, eg, poly (ethylene glycol) -poly (l-lysine) (PEG-PLL) AB type block copolymer; And / or any DNA as described above provided with a complementary nucleic acid or protein that binds to DNA.

1.10 Any of the DNAs described above, prepared according to method 1 described or method 2 described or method A described.

  Nanotips can be made, for example, as shown in FIGS. For example, in one form, each polymer chain is accompanied by two or four additional chambers, and the two additional chamber form is useful for encoding a binary code in the polymer, and the four additional chambers The format is particularly useful for generating custom DNA sequences. Each additional chamber contains individually controllable electrodes. The addition chamber contains reagents that add monomers to the polymer in buffer. The addition chamber is separated from the storage chamber by a membrane comprising one or more nanopores, which may be common to a plurality of addition chambers and which is a deprotecting reagent for deprotecting the protected monomer or oligomer added in the addition chamber And buffer. The nanotips contain a set of multiple additional chambers that allow for the parallel synthesis of multiple polymers.

  High bandwidth and low noise nanopore sensor and detection electronics are important to achieve single DNA base resolution. In certain embodiments, the nanotips are electrically coupled to complementary metal oxide semiconductor (CMOS) chips. For example, as described in Uddin, et al., "Integration of solid-state nanopores in a 0.5 μm cmos foundry process", Nanotechnology (2013) 24 (15): 155501, the contents of which are incorporated by reference. Solid phase nanopores can be incorporated into the CMOS platform in the vicinity of bias electrodes and custom designed amplification electronics.

  In another embodiment, the present disclosure is a charged polymer comprising at least two separate monomers, such as a nanotip (nanotip 1) for synthesizing and / or sequencing DNA, comprising one or more nanopores Containing at least first and second reaction chambers separated by a membrane, each reaction chamber comprising one or more electrodes for drawing charged polymer into the chamber, adding electrolyte medium and optionally monomers to the polymer The present invention provides a nanochip further comprising a reagent for

1.1 Nanotip 1, wherein the diameter of the nanopore is 2-20 nm, eg 2-10 nm, eg 2-5 nm.

1.2 Any of the above-mentioned nanotips, wherein part or all of the walls of the reaction chamber of the nanotips comprise a silicon material, such as silicon, silicon dioxide, silicon nitride or combinations thereof, such as silicon nitride.

1.3 Some or all of the walls of the reaction chamber of the nanotip contain silicon material, such as silicon, silicon dioxide, silicon nitride or combinations thereof, such as silicon nitride, and some or all of the nanopores are produced by ion irradiation Any of the above nanotips being

1.4 Any of the above-mentioned nanochips, wherein some or all of the nanopores are composed of a membrane containing the pore-forming protein α-hemolysin, for example, a lipid bilayer membrane.

1.5 Some or all of the walls of the reaction chamber are coated to minimize interaction with the reagent, for example, with a polymer such as polyethylene glycol or with a protein such as bovine serum albumin Any of the above nanotips.

1.6 Any of the nanotips described above, including an electrolyte medium.
1.7 buffer to bring pH 7 to 8.5, eg about pH 8, such as tris (hydroxymethyl) aminomethane (Tris), a suitable acid, and optionally a chelator such as ethylenediaminetetraacetic acid (EDTA) In a solution comprising a buffer, eg a Tris base, a TAE buffer comprising a mixture of acetic acid and EDTA, or a TBE buffer comprising a mixture of Tris base, boric acid and EDTA; eg 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl Or any of the above-described nanotips comprising an electrolyte medium comprising a buffer such as, for example, a solution containing 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate (pH 7.9 @ 25 ° C.).

1.8 Any of the nanotips described above comprising reagents for attaching monomers to the polymer.

1.9 Synthesis of polymers (for example, "writing" by continuously adding monomers or groups of monomers to polymers) and sequencing (for example, changes in current and / or inductance as monomers pass through the nanopore) Any of the nanotips described above, which are both capable of "reading" by measuring.

1.10 For example, the current can draw the polymer through the nanopore so that the current flowing through the nanopore can be established through the nanopore through the electrolyte medium, and the potential across the nanopore as the polymer passes through the nanopore The membrane comprising one or more nanopores comprises a metal surface on both sides, the metal surface being an insulator, for example a silicon nitride membrane, so that changes in the can be measured and used to identify the sequence of monomers in the polymer. Any of the nanotips described above, wherein the metal surfaces are separated to provide an electrode at each end of each nanopore, for example by means of lithography.

1. 11 Any of the nanotips described above comprising a charged polymer that is DNA.
1.12 Any of the nanotips described above comprising a charged polymer that is single stranded DNA (ssDNA).

1.13 Any of the nanotips described above comprising a charged polymer that is DNA comprising a predetermined restriction site.

1.14 Any of the above nanotips comprising a charged polymer that is DNA, wherein the DNA is a DNA according to DNA 1 above.

1.15 Any of the nanochips described above comprising a charged polymer that is DNA, the DNA comprising at least 95%, such as 99%, such as 100% adenine and cytosine.

1.16 Any of the above nanotips comprising a charged polymer that is DNA, the DNA comprising only adenine and cytosine.

1.17 Any of the nanotips described above, including one or more ports that allow for the introduction and flushing of buffers and reagents.

1.18 buffer, eg buffer to bring pH 7-8.5, eg about pH 8, eg Tris (hydroxymethyl) aminomethane (Tris), suitable acid, and optionally chelator, eg ethylenediaminetetra A buffer containing acetic acid (EDTA), eg a solution containing Tris base, a TAE buffer containing a mixture of acetic acid and EDTA, or a TBE buffer containing a mixture of Tris base, boric acid and EDTA; eg 10 mM Tris pH 8, 1 mM EDTA Any of the above-mentioned nanochips comprising 150 mM KCl or a solution containing, for example, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate (pH 7.9 @ 25 ° C.).

1.19 either freeze-dried or lyophilised for storage and subsequent rehydration, eg any of the above mentioned wherein the structure of the nanotip comprises a hydratable or water-permeable polymer Nanotips.

1.20 For example, a dry form, wherein the structure of the nanotip comprises a hydratable or water-permeable polymer, which, once the writing process is complete, is hydrated prior to use, optionally lyophilized for long-term storage Any of the above nanotips synthesized in.

1.21 Any of the nanotips described above, wherein a charged polymer, eg, DNA, is stabilized with histones.
1.22 Any of the above nanotips, wherein the inner surface is positively charged.

1.23 The electrode is operatively connected to a capacitive circuit capable of applying radio frequency pulsed direct current to the nanopore at a frequency of eg 1 MHz to 1 GHz, eg 50 to 200 MHz, eg about 100 MHz, eg Any of the above nanotips, wherein a pulsating direct current can draw the charged polymer through the nanopore and the monomer sequence can be determined by measuring the nanopore volume variation as the charged polymer passes through the nanopore.

1.24 Any of the nanotips described above comprising a storage chamber or a deblocking agent chamber containing a reagent for deprotecting the polymer after addition of the monomer or oligomer in one of the addition chambers.
1.25 Any of the nanotips described above comprising a plurality of additional chamber pairs.

1.26 Any of the nanotips described above, including the electrical control layer, fluidics layer and electrical ground layer bonded by wafer bonding, for example as described in FIG.

1.27 Any of the nanotips described above, wherein the nanopores are created by drilling using FIB, TEM, wet etching or dry etching.

1.28 Any of the above nanotips, wherein the membrane comprising nanopores is one atomic layer to 30 nm thick.

1.29 Any of the above nanotips, wherein the membrane comprising nanopores is made of SiN, BN, SiOx, graphene, transition metal dichalcogenides such as WS ₂ or MoS ₂ .

1.30 Any of the nanotips described above, including wires made of metal or polysilicon.

1.31 Any of the nanotips described above, wherein the density of interconnects is increased by three-dimensional stacking with electrical shielding provided by dielectric deposition (eg, by PECVD, sputtering, ALD, etc.).

1.32 Contact with the electrode in the addition chamber can be done using deep silicon reactive ion etching (DRIE) through silicon via (TSV), for example using cryo processing or BOSCH processing, or by wet silicon etching Any of the above nanotips.

1.33 Any of the nanotips described above, wherein individual voltage control of the electrodes of each additional chamber allows the electrodes of each additional chamber to be individually controlled and monitored.

1.34 Any of the nanotips described above, wherein each polymer comprises a first addition chamber, a second addition chamber and a deblocking chamber.

1.35 Any of the nanotips described above, wherein there is a flow of fluid in one or more chambers.
1.36 Any of the above nanotips, wherein one or more chambers are fluidically separated.
1.37 Any of the nanotips described above, with fluid flow in the deblocking chamber.
1.38 Any of the nanotips described above, with a common fluid flow in the additional chamber.

1.39 Any of the nanotips described above wherein the wiring between the chambers is common in similar types of chambers (eg, in the first addition chamber, in the second addition chamber, in the removal chamber).

1.40 Any of the nanotips described above, wherein the loading chambers have separate voltage controls and the deblocking chambers have a common electrical ground.

1.41 Any of the foregoing, wherein the deblocking chamber has separate voltage control, the first additional chamber has a common electrical ground, and the second additional chamber has a common electrical ground. Nanotips.

1.42 Any of the above nanotips wherein the nanotips are made by wafer bonding and the chamber is prefilled with the desired reagents prior to bonding.
1.43 Any of the above nanotips, wherein one or more internal surfaces are silanized.

1.44 Any of the nanotips described above comprising one or more ports for the introduction or removal of fluid.

1.45 The electrode in the chamber is restricted from direct contact with the charged polymer, eg the electrode is placed far away from the nanopore so that the charged polymer bound to the surface adjacent to the nanopore can not be reached, or Any of the foregoing, wherein the electrode is protected by a substance that allows water and single atomic ions (eg, Na +, K + and Cl − ions) to pass, but not polymers or monomer reagents that should be added to the polymer. Nanotips.

1.46 Any of the nanotips described above electrically coupled to a complementary metal oxide semiconductor (CMOS) chip.

  For example, in one embodiment, the present invention provides a charged polymer comprising at least two separate monomers, such as a nanotip as described in any of the above nanotips 1 for sequencing of a DNA, such as a nanotip Comprises at least a first and a second reaction chamber comprising an electrolyte medium and separated by a membrane comprising one or more nanopores, each reaction chamber comprising at least one pair of electrodes arranged on opposite sides of the membrane The electrode is operatively coupled to a capacitive circuit capable of providing radio frequency pulsed direct current to the nanopore at a frequency of eg 1 MHz to 1 GHz, eg 50 to 200 MHz, eg about 100 MHz, eg Pulsed direct current can draw the charged polymer through the nanopore, and the charged polymer is It can be read monomer sequence by measuring the capacity variations of the nanopore when passing through.

  In another embodiment, the invention provides a method of reading a charged polymer comprising at least two different types of monomers, such as a monomer sequence of a DNA molecule, the method comprising: pulsating direct current of radio frequency, for example 1 MHz Monomer alignment by applying nanopores at a frequency of ̃1 GHz, eg 50-200 MHz, eg about 100 MHz, and pulsating direct current draws the charged polymer through the nanopore and measures the volumetric variation of the nanopore as the charged polymer passes through the nanopore Including reading.

  In another embodiment, the present invention provides the use of DNA1 as described above in a method for storing information.

  In another embodiment, the present invention provides the use of single stranded DNA in a method for storing information, in which, for example, the sequences do not substantially self-hybridize.

  In another embodiment, the present invention provides a data storage method and device, which is, for example, a charged polymer comprising at least two different types of monomers, eg DNA, according to any of the above methods 1 and / or 2. Using the nanotips, eg, any of the above nanotips 1, the monomers or oligomers are arranged in the order corresponding to the binary code.

  For example, in one embodiment, a nanotip comprising a polymer thus synthesized can activate the nanotip and provide a data storage device because the alignment of the polymer can be detected at any time by passing the polymer through the nanotip. In another embodiment, the polymer is removed from the nanotip or the amplified, amplified polymer is removed from the nanotip and stored until needed, read by a conventional sequencer, eg, a conventional nanopore sequencing device. Be

  In another embodiment, the present invention provides a method of preserving information, comprising synthesizing DNA1 above, eg according to either Method 1 or Method 2 above.

  In another embodiment, the present invention provides a method of reading a binary code, eg, encoded by DNA 1 above, using a nanopore sequencer, eg, using the above nanochip 1, as described herein. Do.

  Any of the above methods wherein the nanotip is eliminated using an enzyme that degrades the charged polymer, for example, a deoxyribonuclease (DNase) that hydrolyzes DNA.

EXAMPLES Example 1 Immobilization of One End of DNA Adjacent to Nanopore and Control of Advancement and Retraction of DNA by Current DNA was separated by nanopore under the condition that the related proteins did not move between chambers. An experimental procedure was developed to verify that current flowed back and forth between the two chambers.

  A nanotip comprising two chambers was made of silicon nitride. The nanopores of <4 nm (dsDNA or ssDNA) and 2 nm (ssDNA only) can be obtained by Briggs K, et al. Automated fabrication of 2-nm solid-state nanopores for nucleic acid analysis, Small (2014) 10 (10): 2077-86 Prepared as described in The two chambers are referred to as the "far" chamber and the "close" chamber, where the far chamber is the chamber to which the 3 'end of the DNA is attached.

  It is shown that ssDNA (2 nm pore) and ssDNA + ds DNA (4 nm pore) pass through the nanopore but not the protein. The passage of the nanopore is detected by the disruption of the current.

Binding of the DNA to the pore surface: 5 'amino-modified DNA, by binding mediated carbodiimide, carboxy coated polystyrene beads (Fluoresbrite ^{(TM) BB Carboxylate Microspheres 0.05μm, Polysciences,} Inc.) is attached to. Label the 3 'of the DNA with biotin. The DNA is of a prespecified length.

Streptavidin binding: As described in Arafat, A. Covalent Biofunctionalization of Silicon Nitride Surfaces. Langmuir (2007) 23 (11): 6233-6244, the binding is on the "far" side of the silicon nitride nanopore conjugate streptavidin. It went to the surface.

Immobilization of DNA close to the nanopore: DNA bound polystyrene beads in buffer are added to the "close" chamber and buffer is added to the "far" chamber (standard buffer: 10 mM Tris pH 8, 1 mM EDTA, 150 mM KCl). Apply voltage (about 100 mV) until current disruption is observed (using Axon Nanopatch 200B patch clamp amplifier). The 50 nm beads can not pass through the nanopore, thus the current is greatly disturbed when the DNA strand passes and the beads are pressed against the end of the nanopore. The current is maintained for 1 to 2 minutes until the DNA irreversibly binds to streptavidin immobilized on the far side by binding of biotin. The current is reversed to confirm that the DNA has been fixed. If the DNA is in or out of the pore, different currents are observed. If you find that the DNA is not immobilized, repeat this process.

Release of beads by endonuclease: Restriction enzyme in restriction enzyme buffer is added to the chamber in which the DNA is bound. In one embodiment, the DNA is single stranded and contains a restriction site that can be cleaved by an enzyme that cleaves single stranded DNA. See, for example, Nishigaki, K., Type II restriction endonuclease cleavage single-stranded DNAs in general. Nucleic Acids Res. (1985) 13 (16): 5747-5760. In an alternative embodiment, complementary oligonucleotides are added to the DNA-bound chamber, hybridized for 30 minutes to create dsDNA, and then restriction enzymes are added. When the beads are released, wash them out. Switch the current back and forth to make sure that the DNA comes in and out of the pore.

Demonstrate control of forward and reverse: Using a standard buffer, the current is forward-looking until signal disruption is observed and returned to "normal" after DNA passes. Reverse current is applied until signal disruption is observed. When the DNA remains in the pore, it is observed that the signal does not return to normal. Repeat forward and reverse current application for several cycles to confirm that the DNA is advancing and retreating through the nanopore.

Example 1a: The inner wall of the nanotip for immobilizing DNA adjacent to the nanopore in a silicon dioxide tip is made of silicon dioxide. Silanize both sides, but attach the oligonucleotides to only one side of the chip wall and then create nanopores.

Silane treatment: The surface of the chip wall can be purchased at 30 ° C with piranha solution (various grades can be purchased, generally containing a mixture of sulfuric acid (H ₂ SO ₄ ) and hydrogen peroxide (H ₂ O ₂ ), organic from the surface Remove the residue) and wash with redistilled water. Stock solutions of (3-aminopropyl) triethoxysilane (APTES) in 50% methanol (MeOH), 47.5% APTES, 2.5% nanopure H 2 O were prepared and aged at 4 ° C. for> 1 hour. The APTES stock solution is then diluted 1: 500 in MeOH, applied to the chip wall at room temperature and incubated. The chip wall is then rinsed with MeOH and dried at 110 ° C. for 30 minutes.

Binding: The chip walls are then incubated for 5 hours at room temperature in a 0.5% w / v solution of 1,4-phenylenediisothiocyanate (PDC) in dimethylsulfoxide (DMSO). Gently wash twice with DMSO and wash twice with redistilled water. The chip wall is then incubated overnight at 37 ° C. with 100 nM amine modified single stranded DNA oligomer (about 50 mers) in double distilled water (pH 8). The chip wall is then washed twice with 28% ammonia solution to inactivate unreacted material and washed twice with redistilled water. One or more nanopores are then created in the wall.

Once the nanotips are complete, the inner wall is coated with DNA oligomers approximately 50 bp in length. This allows ssDNA to be bound to relatively bulky structures (eg, beads, proteins or DNA origami structures with a diameter large enough to not pass through the nanopore), where the sequence complementary to the surface bound DNA is Surface) by pulling a charged polymer through the nanopore using an electrical current (apart from the bulky structure), binding ssDNA to DNA oligomers bound to the complementary surface adjacent to the nanopore, and breaking up the bulky structure It enables to arrange single stranded DNA having a terminal sequence complementary to the DNA bound to the nanopore.

Example 2: DNA synthesis-addition of single nucleotides DNA is moved into the "storage" chamber by applying a suitable current and detecting DNA movement.

The terminal transferase enzyme (TdT, New England Biolabs) and the reversibly blocked dATP * in an appropriate buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, pH 7.9 @ 25 ° C), Add to the "Add" chamber. Also add buffer to the "storage" chamber.

  Nucleotides are added to DNA using dNTPs with reversible blocking at the 3'-OH. Once added to the DNA strand, the next dNTP can not be added until the blocked dNTP is deblocked.

Deblocking can be chemical or enzymatic. Various approaches are used:
a. 3 'O-allyl: allyl, as described in Ju J, Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotides reversible terminators. Proc Natl Acad Sci US A. (2006); 103 (52): 19635-40, By Pd-catalyzed deallylation in aqueous buffer; or Shankaraiah G., et al., Rapid and selective deprotection of allyl ethers and esters using iodine in polyethylene-400. Green Chem. (2011) 13: 2354 It is removed by using iodine (10 mol%) in polyethylene glycol-400 as described in -2358.

b. 3'O-NH2: US8034923 as described, the amine is removed in NaNO ₂ which is buffered.

c. 3'-phosphate. Phosphoric acid is hydrolyzed with endonuclease IV (New England Biolabs). Other possible 3 'modifications that can be removed by endonuclease IV include phosphoglycoaldehyde and deoxyribose-5-phosphate.

d. 3'-O-Ac: Acetic acid is removed by enzymatic hydrolysis as described in Ud-Dean, A theoretical model for template-free synthesis of long DNA sequence. Syst Synth Biol (2008) 2: 67-73 Ru.

The DNA is then moved into the "far" chamber by applying an appropriate current and detecting the movement of the DNA. The buffer is exchanged and the DNA is deprotected by adding deblocking buffer / liquid as described in ad above.
Repeat the process as desired to create the desired sequence.

Example 3 DNA Synthesis: Addition of Oligonucleotide Bulk The 3 'end of double stranded DNA is attached adjacent to a nanopore with an opening of 4 nm. The 5 'end of the DNA has a CG overhang (read 5' to 3 ').

Make oligo cassettes A and B as follows:

The code A and the code B each represent an information sequence. N represents any nucleotide. The 5 'sequence contains the topoisomerase recognition site and the 3' sequence contains the Acc1 restriction site. When the oligo is exposed to topoisomerase, the topoisomerase binds to the 3 'thymidine:

  By applying an appropriate current, the DNA is moved into the "close" chamber to detect DNA movement. The "code A" oligo loaded with topoisomerase is provided to the "addition" chamber. By applying an appropriate current, the DNA is moved to the addition chamber to detect DNA movement, at which time the Code A oligo binds to the DNA. Acc1 is added to the "storage" chamber, where it cleaves a restriction site, resulting in a topoisomerase ligation site.

  Repeat this process until the desired sequence is reached, adding another "code A" or "code B". It should be noted that it is not necessary to continuously add fresh Acc1 to the "storage" chamber; when switching from code A or code B, only the code A or code B oligos in the "addition" chamber need to be washed away.

  Several modifications of the above protocol are required to sequence at the pore that passes only ssDNA. It is already known that the complementary strand "falls off" when dsDNA encounters a small pore (2 nm) through which only ssDNA passes. Thus, if this synthesis is to be done in a 2 nm pore, one must ensure that the correct dsDNA can be remodeled on the other side. For this purpose, "CGAAGGG <code A or B> GTCGACNNNNN" in the near chamber (as a restriction site is created), "CGAAGGG <code A or B> GT" in the far chamber (topo compatible site is generated Can be added).

  Describing the above method in detail, DNA encoded information is "added" sequentially to the growing DNA strand with .gtoreq.2 consecutive additions (representing 2 bits of data), each of which It is proved to include the steps of "addition" and "deprotection". Initial experiments for concept optimization and verification are performed on microtubes.

  In the approach described in this example, one bit of information is encoded in a series of nucleotides. The bits of DNA to be "added" are short ds DNA sequences linked to vaccinia topoisomerase I (topo). In the presence of a suitable "deprotected" "acceptor" DNA, the "bit" of topo-loaded DNA is enzymatically and covalently linked ("addition") to the acceptor by topoisomerase and the topoisomerase of this process is , Then removed from the DNA. The restriction enzyme then cleaves the added bit and "deprotects" it, creating a suitable "acceptor" sequence for adding the next bit.

Topo loading: The general loading scheme is as follows, illustrated in Figure 22 and below, where N is any nucleotide, A, T, G and C are adenine, thymine, guanine and cytosine bases respectively Represents a nucleotide having The N's on top of each other are complementary. Although this example uses the restriction enzyme HpyCH4III, the basic strategy also holds for other restriction enzymes, for example as demonstrated in Example 4.

The following oligonucleotides are ordered from Integrated DNA Technologies (IDT): The terminal "b" of some oligonucleotides represents biotin):
BAB: CGATAGTCTAGGCACTGTTTGCTGCGCCCTTGTCCGTGTCGCCCTTATCTACTTA ACTAGAGATCATACAGCATTGCGAGTACG
B1: b-CACGTACTCGCAATGCTGTATGATCTCTTAAGTAGATA
B2: ATCTACTTAAGAGATCATACAGCATTGCGAGTAC
TA1: b-CACACTCATGCCGCTTGTAGTCACTATCGGAAT
TA2: AGGGCGACACGGACAGTTTGAATCATACCG
TA3b: AACTTAGTATGACGGTATGATTCAAACTGTCCGTGTCGCCCTTATTCCGATAGTGACTACAGCGGCATGAG
TB1: b-CACACTCATGCCGCTGTAGTCACTATCGGAAT
TB2: AGGGCGCAGCAACAGTGCCTAGACTATCG
TB3b: AACTTAGTATGACGATAGTCTAGGCACTGTTTGCTGCGCCCTTATTCCGATAGTGACTACAGCGGCATGAG
FP1: CACGTACTCGCAATGCT
FP2: CGGTATGATTCAAACTGTCCG
FP3: GCCCTTGTCCGTGTC
The oligonucleotides are dissolved in TE buffer at 100 uM and stored at -20C.

The hybridized oligonucleotides are made by mixing the oligonucleotides as described below, heating to 95 ° C. for 5 minutes, and then lowering the temperature at a rate of 5 ° C. for 3 minutes to reach 20 ° C. The hybridized oligonucleotides are stored at 4 ° C or -20 ° C. The oligonucleotide combinations are as follows:

B1 / 2
48 uL B1
48 uL B2
4 uL 5 M NaCl

A5
20 uL TA1
20 uL TA2
5 uL TA3b
4 uL 5 M NaCl
51 uL TE

B5
20 uL TB1
20 uL TB2
5 uL TB3b
4 uL 5 M NaCl
51 uL TE

The following buffers and enzymes are used in this example:
TE: 10 M Tris pH 8.0, 1 mM EDTA, pH 8.0
WB: 1 M NaCl, 10 mM Tris pH 8.0, 1 mM EDTA pH 8.0
1 × Topo: 20 mM Tris pH 7.5, 100 mM NaCl, 2 mM DTT, 5 mM MgCl ₂
1 x RE: 50 mM K-acetic acid, 20 mM Tris-acetic acid, 10 mM Mg-acetic acid, 100 ug / ml BSA pH 7.9 @ 25 C
Vaccinia DNA topoisomerase I (Topo) is purchased from Monserate Biotech (10,000 U / mL) HypCH4III is purchased from NEB Streptavidin coated magnetic beads (s-MagBeads) are purchased from ThermoFisher.

  The acceptor is prepared as follows: 5 uL of s-magbeads are washed once with 200 uL of WB (binding time 1 min). Add 5 uL of B1 / 2 + 195 uL to the beads, incubate for 15 minutes at room temperature, then wash once with 200 uL of WB, then wash once with 200 uL of 1xTopo and resuspend in 150 uL of 1xTopo .

  Topo-loaded A5 (see FIG. 20) is prepared as follows: 4 uL of 10 × topo buffer + 23 uL of water + 8 uL of A5 + 5 uL of topo are incubated for 30 minutes at 37 ° C., 5 uL of s-magbeads (200 uL of Add 1x wash with WB, 1x wash with 200 uL 1x topo, resuspend in 150 uL 1x topo) and allow to bind for 15 minutes at room temperature.

  Load A5 "Attach" to the acceptor: Remove the s-magbeads from the topo load A5, add to the acceptor and incubate at 37 ° C for 60 minutes. An aliquot is removed, diluted 1/200 in TE and stored at -20C.

Deprotection: The material is washed once with 200 uL of WB, once with 200 uL of 1 × RE, and resuspended in 15 uL of 10 × RE and 120 uL of water. Add 15 uL of HypCH4III. The mixture is incubated for 60 minutes at 37 ° C., then washed once with 200 uL of WB and once with 200 uL of 1 × topo to produce a product called “Acceptor-A5”.

  Topo loading B5 (see FIG. 21) is prepared as follows: 4 uL of 10 × topo buffer, 23 uL of water and 8 uL of B5 + 5 uL topo are combined and incubated at 37 ° C. for 30 minutes. The product is added to 5 uL s-magbeads (1x wash with 200 uL WB, 1x wash with 200 uL topo, resuspended in 150 uL 1x topo) and allowed to bind at room temperature for 15 minutes.

  Loaded B5 is "added" to acceptor-A5: s-magbeads are removed from topo-loaded B5, added to acceptor-A5 and incubated for 60 minutes at 37 ° C. Remove aliquots, dilute 1/200 in TE and store at -20 ° C.

Deprotection: The material is washed once with 200 uL of WB, once with 200 uL of 1 × RE, and resuspended in 15 uL of 10 × RE and 120 uL of water. Add 15 uL of HypCH4III and incubate the mixture at 37 ° C. for 60 minutes.

The confirmation that the above reaction worked is as follows: A5 (Acceptor to which A5 was added: step iii, “A5 addition” illustrated) and B5 (Acceptor to which B5 was added-A5: step vi, “B5 addition to illustration ') By PCR amplification of aliquots. "No template" is used as a negative control for A5, A5 is used as a negative control for B5, and oligo BAB is used as a positive control for B5. The size of the product expected for A5 PCR is 68 bp and the size of the product expected for B5 PCR is 57 bp. (Although a B1 / 2 of about 47 bp expected size is also run on the gel, this may be an approximation since it has overhangs and is biotinylated). Thirty cycles of PCR reaction (95/55/68 (1 minute each) are performed as follows:

  SDS-PAGE using 4-20% Tris-glycine gel is used to confirm that oligonucleotides of the expected size are produced. Loading is carried out as described above, but immediately after loading (incubation step of 37 ° C.), mix the loading buffer, heat the sample to 70 ° C. for 2 minutes and allow to cool before pouring on the gel. Stain with coomassie gel. Water is added to the reaction instead of topo as a negative control. FIG. 30 shows the results, clearly showing the bands corresponding to the expected product size for A5 PCR and B5 PCR.

  Thus, it is shown that addition of DNA bits via topoisomerase-loaded DNA cassettes and deprotection performed by restriction enzymes is feasible. In these proof-of-concept experiments, DNA is immobilized by streptavidin-coupled magnetic beads and moves sequentially to different reaction mixtures, but in the form of nanopore chip, creating a separate reaction chamber and using DNA to generate DNA In these different reaction chambers.

  Finally, PCR demonstrates that the sequential addition of DNA sequences corresponding to "bits" of information is performed to create the expected DNA sequence. These reactions work as designed and optimization is minimal.

  The DNA prepared as described in Examples 2 and 3 is recovered and sequenced using a commercially available nanopore sequencer (Minion of Oxford Nanopore) to verify that the desired sequence is obtained.

を形成する制限酵素ＭｌｕＩを使用して実行する。 Example 4-DNA synthesis: addition of oligonucleotide blocks using different restriction enzymes The following synthesis is carried out as in Example 3, but with "ACGCGT"

Run using the restriction enzyme MluI to form

In this example, TOPO is loaded to form a complex with sequence complementarity that allows loaded TOPO to transfer DNA to MluI digested DNA:

  In a process similar to the previous example, using TOPO loaded, an oligomer is added to the 5 'end of the strand being synthesized having a complementary acceptor sequence, thereby releasing TOPO, the strand Is "deprotected" using MluI and this cycle is repeated until the desired sequence of oligomers is obtained.

EXAMPLE 5 Addition of a Single Base Using a Topoisomerase Strategy It has been found that a system of topoisomerase can also be designed to add a single base to a single stranded DNA strand (adding a "cassette" (Compare with Example 3). The DNA bits to be "added" are included in the short DNA sequence linked to vaccinia topoisomerase I (topo). In the presence of a suitable single-stranded "deprotected""acceptor" DNA, topo-loaded DNA is enzymatically and covalently linked ("addition") to the acceptor by topoisomerase, which in this process is It is removed from DNA. Type IIS restriction enzymes can cleave all added DNA except for a single base (the "added" base). This deprotection-addition process is repeated to add more bases (bits).

Topo loading: The general loading protocol is as in Example 3 and is as follows:

As in Example 3, the N's on top of each other are complementary. I is inosine. Biotin is used to remove unreacted products and byproducts. Addition of a single base is carried out as follows.

Deprotection is exemplified as follows using BciVI restriction enzyme (site bold):

The following oligonucleotides are commercially synthesized (B = biotin, P-phosphate, I = inosine):
NAT1 CACGTCAGGCGTATCC ATCC CTTC ACGT ACTCGCAATGCTGTATGGCGAT
NAT1b P-CACGTCAGGCGTATCC ATCC CTTC ACGT ACTCGCAATGCTGTATGGCGAT-B
NAT9cI P-IIIIIAAGGGATGGATACGCCTGACGTG
NAT9x P-ATCGCCATACAGCATTGCGAG
NAT9 ACGTGAAGGGATGGATACGCCTGACGTG
Nat9Acc CACGTAGCAGCAAACAGTGCCTAGACTATCG
Nat1P CACGTCAGGCGTATCC ATCC
FP4 CGATAGTCTAGGCACTGTTTG
The oligonucleotides are dissolved in 100 μM in TE buffer and stored at -20 ° C.

Hybridization: Mix the described oligonucleotides, heat to 95 ° C. for 5 minutes, then lower the temperature 5 ° C. for 3 minutes to reach 20 ° C. to make the following hybridized oligonucleotides. The hybridized oligonucleotides are stored at 4 ° C or -20 ° C.
NAT1b / NAT9cI / NAT9x
8 μL NAT1B
10 μL NAT9cI
10 μL NAT9x
48 μL TE
4 μL 5 M NaCl

NAT1 / NAT9cI
10 μL NAT1
10 μL NAT9cI
80 uL PBS

NAT1 / NAT9
10 μL NAT1
10 μL NAT9
80 uL PBS

Buffers and Enzymes: Use the following buffers:
TE: 10 M Tris pH 8.0, 1 mM EDTA, pH 8.0
PBS: phosphate buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ ), pH 7.4
10 × Cutsmart: 500 mM KAc, 200 mM Tris-Ac, 100 mM Mg-Ac, 1 mg / mL BSA pH 7.9
BciVI is purchased from NEB and Streptavidin coated magnetic beads (s-MagBeads) are purchased from ThermoFisher.

The addition reaction is carried out as follows.
1. Topo loading: Combine reagents as per the table below:

  The reagents are then incubated for 30 minutes at 37 ° C. After binding for 10 minutes at room temperature using Streptavidin magnetic beads (5 uL) in topo buffer, remove byproducts.

2. Reaction: Combine reagents as per the table below:

The reagents are then incubated for 30 minutes at 37 ° C. The addition reaction is expected to proceed as follows:

  Asterisk (*) represents topoisomerase. Note that NAT9cI is phosphorylated but is not displayed for purposes of illustration.

When the loaded topo is present in the acceptor sequence, proceed to the following reaction:

  The expected product is confirmed to be produced by PCR amplification and measurement of the molecular weight of the product on an agarose gel. Bands of the correct size are shown in lane 1 (experimental) and do not show bands in the negative control, see FIG.

B. Deprotection Reaction: Combine reagents as per the table below:

The reagents are incubated for 90 minutes at 37 ° C. For the deprotection reaction, a representative product of the addition reaction is made using purchased oligonucleotides and tested for cleavage by BciVI restriction enzymes:

Since 3 'of the cleavage site is a series of inosines facing "normal" bases, it was not known whether the restriction enzyme cleaves DNA as intended. As a positive control, the equivalent of "suitable" base pair NAT1 / NAT9cI was generated (NAT1 / NAT9c):

  PCR amplification of the product followed by determination of molecular weight on an agarose gel (FIG. 31) shows that the enzyme works as intended. For the positive control, a large band is observed if uncleaved (lane 1), but a smaller band is observed if cleaved. The same pattern is observed with NAT1 / NAT9cI, indicating that the presence of inosine does not abolish or prevent cleavage. It appears that a small amount of uncleaved product remains at NAT1 / NAT9cI, suggesting that under at least these conditions cleavage is not as effective as NAT1 / NAT9c. The cleavage efficiency can be improved by changing the buffer conditions and / or adding more inosine to the 5 'end of NAT9cI.

  The examples above show that a single nucleotide can be added to the 5 'end of target single stranded DNA using a combination of topo / IIS restriction enzymes. The SVF of the related topoisomerase that recognizes the sequence CCCTG (https://www.ncbi.nlm.nih.gov/pubmed/8661446) uses a similar process to add "G" instead of "T" , Thus enabling construction of sequences encoding binary information in T and G.

  As described above, when generating dsDNA using the topoisomerase strategy, nicks in the DNA of the opposite strand can be repaired using ligase with ATP. However, when adding a single nucleotide as in this example, there is no nick to be repaired, and single-stranded DNA is constructed such that it is not necessary to use a ligase.

Example 6-Addition of a single base using the strategy of topoisomerase in combination with a 5 'phosphate linkage Another approach to the addition of a single base is to use a single base pair in the 3' to 5 'direction. Use 5 'phosphate as a blocking group to effect the addition. The loading reaction loads topoisomerase with a single T (or G, or optionally other nucleotide) with a 5 'phosphate group. If the loaded topoisomerase "finds" a 5 'unblocked (non-phosphorylated) single-stranded DNA strand, it adds T to that strand and the 5' T-attached DNA Bring. This addition is facilitated by the presence of adapter DNA having a sequence to which topoisomerase and single stranded acceptor DNA can bind. (Note that adapter DNA is catalytic-it can be reused as a template in repeated reactions.) Since the added nucleotide has a 5 'phosphate, it is exposed to a phosphatase that removes the 5' phosphate. It is not a substrate for further addition until it is This process is repeated using topo to add a single "T" to the 5 'end of the target single stranded DNA, and SVF topoisomerase to add a single "G", thus T and Allows construction of sequences encoding G binary information. This process is shown schematically as follows:

Example 7 Use of DNA Origami for Binding DNA Adjacent to Nanopore DNA strand having large origami structure at one end is captured in nanopore, and surface bound strepto through the biotin portion at the end of DNA Immobilize on avidin. After cleaving the origami structure with restriction enzymes, the immobilized DNA can move back and forth through the pore, as confirmed by current disruption. Fixation allows control of the movement of a single DNA molecule through the pore, which allows "reading" and "writing" of information on DNA.

  As shown in FIG. 35, bulky double-stranded DNA units that are too large to form nanopores are formed, and a single-stranded region serves as two short doubles that serve to anchor the DNA to be added during synthesis. The chain region is linked to the bulky part. The single stranded regions can then be separated and tethered to the surface adjacent to the nanopore to release the origami structure. See FIG.

Nanopores are formed in 3 mm chips with 20 nm SiO 2 with 50 * 50 μm openings. The chip is provided by Nanopore Solutions. Nanopore cassette holders and flow cells are provided by Nanopore Solutions. The amplifier is a Tecella Pico 2 amplifier. This is a usb powered amplifier that uses a usb-computer interface for control. Tecella supplies software to control the amplifier (Windows). The circuit meter is a FLUKE 17B + Digital Multimeter that can detect currents as low as 0.1 uA. The Concentric Technology Solutions TC-5916A Shield Box (Faraday Cage) with USB interface is used to screen for radio frequency noise. Oligonucleotides are obtained from IDT.com. “PS” is propargylsilane-O- (propargyl) -N- (triethoxysilylpropyl) carbamate of http://www.gelest.com/product/o-propargyl-n-triethoxysilylpropylcarbamate-90/ .

  The origami structure is based on a single strand m13 having a "honeycomb-like" cube origami structure of about 20 nm on a side. There are double stranded regions adjacent to the honeycomb, each containing unique restriction sites. One of these sites is used to bind the modified DNA, allowing binding near the nanopore, and once the DNA is bound, the other site is used to separate the origami structure.

Nanopore formation: Allow nanotips to form on the chip using dielectric breakdown as follows:
1. Carefully mount the chip on the cassette Wetting: Carefully pipette 100% ethanol onto the tip. Air bubbles must be removed. However, direct pipetting of the solution on the chip should be avoided, otherwise the chip may crack (SiO2 is only 20 nm).
3. Surface treatment: Remove ethanol and pipette the freshly prepared piranha solution (75% sulfuric acid, 25% hydrogen peroxide (30%)) onto the tip. (Till the piranha solution to room temperature). Leave for 30 minutes.
4. Rinse 4 times with distilled water.
5. Rinse twice with HK buffer (10 mM HEPES pH 8, 1 M KCl).
6. Assemble the cassette into the flow cell.
7. Add 700 μL HK buffer to each chamber of the flow cell.
8. Insert the silver electrode attached to the amplifier and close the Faraday cage.
9. Test resistance at 300mV. The current should not be detected. If detected, the tip is considered broken and must be redone.
10. The electrodes are connected to a 6 V DC current and the current is tested in a circuit meter. The current should be low and not change. Raise the voltage 1.5 V and maintain the voltage until the resistance increases. If resistance does not increase after 5 to 10 minutes, raise the voltage another 1.5 V and try again. Repeat until the resistance increases, at which point the applied voltage should be turned off immediately. (With sufficient voltage, dielectric breakdown occurs and "pores" are created in the SiO2 film. When initially created, the pores are small but they become larger when the voltage is maintained.)
11. Test the pore using an amplifier. Several nA of current should be seen at 300 mV. The higher the current, the larger the pore.

  FIG. 34 shows a basic functional nanopore. In each panel, the y-axis is current (nA) and the x-axis is time (seconds). The left panel "RF noise screening" demonstrates the utility of the Faraday cage. Place the chip without nanopore in the flow cell and apply 300 mV. When the lid of the Faraday cage is closed (first arrow), noise reduction is observed. Closing the latch (second arrow) produces a small spike. It can be seen that the current is about 0 nA. After pore production (middle panel), application of 300 mV (arrows) results in a current of about 3.5 nA. When DNA is applied to the ground chamber and applied at +300 mV, DNA migration (right panel) can be observed as a transient decrease in current. (It should be noted that in this case TS buffer is used: 50 mM Tris, pH 8, 1 M NaCl.) Lambda DNA is used for this DNA transfer experiment.

Silver chloride electrode:
1. Solder the silver wire to the insulated copper wire.
2. Polish the copper wire and soak the silver in fresh 30% sodium hypochlorite for 30 minutes.
3. Silver should obtain a dark gray coating (silver chloride).
4. Rinse the silver wire thoroughly with distilled water and dry.
5. It can be used already.

Silane Treatment of Beads: The method of silane treatment is first developed / tested with SiO ₂ coated magnetic beads (GBioscience). The following protocol is adopted:
1. Pretreat the beads for 30 minutes in fresh piranha solution.
2. Wash 3 times with distilled water.
3. Wash twice with methanol.
4. The APTES stock solution is diluted 1: 500 with methanol.
5. Add diluted APTES to the beads and incubate for 45 minutes at RT.
6. Rinse with methanol.
7. 30 minutes at 100 ° C.
8. Store under vacuum.

Silane treatment of silicon chips The chip with the nanopore is mounted on the cassette.
2. Rinse with methanol and carefully remove air bubbles.
3. Add fresh piranha solution (equilibrated to room temperature) and incubate for 30 minutes.
4. Wash 4 times with distilled water.
5. Wash 3 times with methanol.
6. The APTES stock solution is diluted 1: 500 with methanol and used to wash the chip twice. Incubate for 45 minutes at RT.
7. Rinse twice with methanol.
8. Dry under an air stream.
9. Store overnight under vacuum.

Streptavidin binding of beads: Streptavidin binding is first developed / tested on the silanized beads prepared above.
1. The silane-treated beads are washed with modified phosphate buffered saline (MPBS).
2. Make a fresh solution of 1.25% glutaraldehyde in MPBS (use a 50% stock solution of glutaraldehyde frozen).
3.1. Add 25% glutaraldehyde to the beads and let sit for 60 minutes while gently pipetting up and down every 15 minutes.
4. Wash twice with MPBS.
5. Wash twice with water.
6. Dry under vacuum.
7. Streptavidin (500 μg / mL in MPBS) is added to the beads and incubated for 60 minutes (for negative control beads, bovine serum albumin (BSA) (2 mg / mL in MPBS) is used instead of streptavidin).
8. Streptavidin is removed and BSA (2 mg / mL in MPBS) is added. Incubate for 60 minutes.
9. Wash twice with MPBS.
Store at 10.4 ° C.

Streptavidin Binding of Silicon Chips The silanized chip is rinsed twice with ethanol.
2. The silanized chip is rinsed twice with MPBS.
3. Make a fresh solution of 1.25% glutaraldehyde in MPBS (use a 50% stock solution of glutaraldehyde frozen).
4. Rinse the chip twice with 1.25% glutaraldehyde and allow to sit for 60 minutes while gently pipetting up and down every 15 minutes.
5. Wash twice with MPBS.
6. Wash twice with water.
7. Dry under an air stream.
8. To one half of the chip BSA (2 mg / mL in MPBS) is added, on the other side streptavidin (500 μg / mL in MPBS) is added. Incubate for 60 minutes. The cassette is marked to indicate which half of the chip is streptavidin modified.
9. Rinse both halves of the chip with BSA (2 mg / mL in MPBS). Incubate for 60 minutes.
10. Wash with MPBS.

The buffer used here is prepared as follows:
MPBS: 8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L disodium phosphate, 0.240 g / L potassium phosphate, 0.2 g / L polysorbate-20 (pH 7.2)
PBS: 8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L disodium phosphate, 0.240 g / L potassium phosphate TS: 50 mM Tris pH 8.0, 1 M NaCl
HK: 10 mM HEPES pH 8.0, 1 M KCl
TE: 10 mM Tris, 1 mM EDTA, pH 8.0
Piranha solution: 75% hydrogen peroxide (30%) + 25% sulfuric acid APTES stock solution: 50% methanol, 47.5% APTES, 2.5% nanopure water. Age at 4 ° C. for at least 1 hour. Store at 4 ° C.
PDC stock solution: 0.5% w / v 1,4-phenylene diisothiocyanate in DMSO

Order oligonucleotides (5 'to 3'):
o1 CTGGAACGGTAAATTCAGAGACTGCGCTTCTCCATTCTGGCTTTAATG
o3 GGAAAGCGCAGTCTCTGAATTTAC
N1 CTTACTGGAACGGCTATCGATATCGCAGCAGGACAGA
BN1 Biotin-CTTACTGGAACGGCTATCGATATCGCAGCAGGACAGA
N2 GTCCTGCTGCGATATCGATAGCCTCCAGTAAG

Hybridization of oligonucleotide pairs is carried out as follows:
1. Prepare a stock solution of oligo in TE buffer at a concentration of 100 uM. Dilute oligo to 10 μM with PBS Heat to 85 ° C for 5 minutes in a thermal cycler with a 5 ° C gradient in 4.3 minutes and cool to 25 ° C Store at 5.4 ° C or -20 ° C

Streptavidin binding: The binding of streptavidin to SiO ₂ was developed and tested using SiO ₂ coated magnetic beads, and then the protocol was adapted to the SiO ₂ chip. The binding of biotinylated oligos to streptavidin and BSA conjugated beads is tested. As expected, negligible binding is observed with BSA conjugated beads and strong binding with streptavidin conjugated beads. See FIG. Since it would be more convenient to perform the binding at high salt concentration (transfer of DNA at high salt concentration), the ability of the beads to bind in HK buffer is also tested. Binding in HK buffer is comparable to binding in MPBS buffer (FIG. 39).

An Origami construct is made and confirmed above with FIGS. 35-37 as operable. The oligonucleotides are used to test the biotinylation of the origami structure. From the “Origami” results shown above in FIG. 37, it is already known that the Alw NI site is active. Oligonucleotide pairs that recreate segments of the correct sequence of Origami DNA are used below (o1 / o3). Origami molecules are shown below:

The oligo pair o1 / o3 is as follows.

According to the following reaction, T4 DNA ligase and a biotinylated oligo complementary to the overhang on the 3 'side of the Origami sequence (it is linked to a long ssDNA sequence, the ssDNA sequence is linked to the other side of the Origami Cleaving the DNA with AlwNI in the presence of

In this strategy, AlwN1 cleaves the target DNA. With the addition of ligase, this DNA can be religated but the restriction enzyme will cut again. However, when the (o1 / o3) (right) fragment binds to BN1 / N2, the restriction site is not recreated and this product is not cleaved. Specific binding is confirmed by testing in the presence or absence of restriction enzymes:

  Add all reagents except ligase and incubate the solution for 60 minutes at 37 ° C. The ligase is added and the solution is incubated overnight at 16 ° C. 10 × lig buff represents NEB 10 × T4 DNA ligase buffer. The ligase is NEB T4 DNA ligase. o1 / o3 and n1 / n2 represent annealed oligo pairs as described above. The unit is microliter. Agarose gel analysis confirms that a larger product is formed in the presence of Alw NI, which corresponds to a biotinylated oligonucleotide linked to a long ssDNA arm linked to an origami structure. Similar strategies are optionally used for 3'biotinylation.

  The ability to form and use nanopores to detect voltage-induced migration of DNA through the pore, creation of an origami molecule with a long ss region attached at its end remote from its biotin, streptavidin to silicon dioxide The conjugation and its use to capture biotinylated DNA is demonstrated above. These tools are used to attach single DNA molecules close to the nanopore and control its movement.

  The first step is to bind streptavidin to one surface of the SiO2 nanopore (and BSA on the other side). This is achieved by the above protocol. The resulting pores tend to have lower current than they initially have. After some short 6v pulses the current is brought back close to the original current. The functional nanopore at this point is shown in FIG.

  Next, Origami DNA is inserted. When Origami DNA is added to a suitable chamber and current is applied, Origami enters the chamber. This representative example is shown in FIG. When Origami is introduced at a final concentration of 50 pM, experimental results show that DNA with Origami enters the pore relatively quickly (typically in a few seconds), which results in a decrease in the current through the nanopore (eg, In these examples, the current prior to origami insertion is approximately 3 nA, and approximately 2.5 nA after insertion confirms that it is detectable. If the current flows for a longer time, double insertion can be observed. If higher concentrations are used, insertions occur too early to be observed.

Binding of the inserted DNA to the chip. After the Origami is inserted into the nanopore, allow 15 minutes to re-energize. The end of the origami ssDNA region contains biotin and streptavidin is attached to the surface of the nanopore. Streptavidin binds to avidin with a binding constant close to the covalent bond. During this 15 minutes, the DNA diffuses, allowing the biotin end to find and bind streptavidin. If the DNA is indeed bound to the surface, then the current observed when the voltage is reversed should be slightly less than before. Also, switching the current back and forth should result in a lower current in both directions than seen in the open pore. In the example shown here, the open pores exhibit a current of about 3 nA. FIG. 42 shows a representative example of bound DNA, and FIG. 43 shows experimental results of the voltage for switching the bound origami DNA. Note that the current seen in both directions is about +/- 2.5 nA, which is lower than about +/- 3 nA observed in the open pore. If the DNA is not bound to the surface, switching the voltage will restore the original current (Figure 44).

  To remove the origami structure, remove the buffer in the flow cell chamber containing the origami structure and replace with 1xSwa1 buffer containing 1uL Swa1 / 20L. Replace the buffer in the other flow cell chamber with 1 × Swa1 buffer without Swa1. This is incubated for 60 minutes at room temperature, then washed with HK buffer and energized. The advancement and retraction of DNA shown in FIG. 45 is supported by the experimental data shown in FIG. 46 and shows that the immobilized DNA moves in a controlled manner through the SiO 2 nanopore.

Example 8-Alternative means of attaching a polymer to a surface adjacent to a nanopore The above example biotinylated the DNA and coated the binding surface with streptavidin to bind the DNA to the surface adjacent to the nanopore Describe. Some alternative means of polymer attachment are shown in FIG.
a) DNA hybridization: In one method, the DNA to be elongated in the method of the invention is hybridized to a short oligonucleotide bound in the vicinity of the nanopore. Once synthesis is complete, the synthesized DNA can be easily removed without the need for restriction enzymes, or the duplex formed by the synthesized oligonucleotides and the synthesized DNA provides a substrate for restriction enzymes. it can. In this example, short oligomers are attached to the surface using biotin-streptavidin or linked using 1,4-phenylene diisothiocyanate as follows:

Binding of Biotinylated DNA to SiO2:
A. Silane treatment:
1. Pretreatment: Wash with redistilled H ₂ O (ddH ₂ O) for 30 minutes with nha solution. Preparation of APTES stock solution: 50% MeOH, 47.5% APTES, 2.5% nanopure H ₂ O: Aging> 1 hour 4 ° C.
3. Dilute APTES stock solution 1: 500 in MeOH4. Incubate the chip at room temperature Rinse with MeOH Heat at 7.110 ° C for 30 minutes to dry

Binding:
1. Treat the chip with PDC stock for 5 hours (room temperature) (PDC stock: 0.5% w / v 1,4-phenylenediisothiocyanate in DMSO)
2. Wash twice with DMSO (short)
3. Wash twice with ddH ₂ O (short)
4. 100 nM amino-modified DNA in ddH ₂ O (pH 8), O / N 37 ° C.
Wash twice with 5.28% ammonia solution (inactivation)
6. Wash twice with ddH ₂ O

  Single stranded DNA having a terminal sequence complementary to the bound oligonucleotide is introduced as described above and hybridized to the bound oligonucleotide.

b) Click chemistry: Click chemistry is simple, thermodynamically efficient, does not create toxic or highly reactive by-products, is performed in water or a biocompatible solvent, and specifies the substance of interest Is a general term for reactions often used to attach to biomolecules of The click bond in this case uses the same chemistry as that used for the attachment of the oligonucleotide in a), but here only to attach the polymer extended in the process of synthesis in the method of the invention Is used. Although DNA is a polymer in this example, this chemistry can also be used to attach other polymers functionalized by the addition of compatible azide groups.

Silane treatment:
1. Pretreatment: wash with ddH 2 O for 30 minutes with piranha solution. Preparation of PS (Propargylsilane) Stock Solution: 50% MeOH, 47.5% PS, 2.5% Nano Pure H 2 O: Aging> 1 hour, 4 C
3. Dilute APTES stock solution 1: 500 with MeOH4. Incubate the chip at room temperature Rinse with MeOH Heat at 7.110 ° C for 30 minutes to dry

  DNA terminated with an azide functional group is covalently attached to this surface (as shown in FIG. 47). Oligos terminated with azide are ordered and bound to longer origami DNA as described above for the addition of biotin to DNA.

Claims (20)

A method of synthesizing in a nanotip a charged polymer comprising at least two separate monomers, comprising:
The nanotip is a reagent for adding one or more monomers or oligomers in a buffered form to the charged polymer in a buffer so that only a single monomer or oligomer can be added in one reaction cycle And one or more storage chambers; and one or more storage chambers including a buffer but not all the reagents necessary for the addition of one or more monomers or oligomers, wherein these chambers comprise Separated by one or more membranes comprising one or more nanopores, wherein the charged polymer can pass through the nanopores, but not at least one of the reagents for adding the one or more monomers or oligomers,
The method is
(A) moving the first end of the charged polymer having the first end and the second end to the addition chamber by electrical attraction, whereby the monomer or oligomer is blocked in the first end Additional process,
(B) transferring the first end of the charged polymer having the added monomer or oligomer in a blocked form to a storage chamber,
(C) deblocking the added monomer or oligomer, and (d) repeating steps a to c until the desired polymer sequence is obtained, wherein the monomer or oligomer to be added in step a) is Identical or different,
Method, which includes.   The method of claim 1, wherein the charged polymer is DNA.   A method of synthesizing nucleic acid in a nanotip, the nanotip comprising at least a first chamber and a second chamber separated by a membrane comprising at least one nanopore, the synthesis comprising a first end and a second end Is carried out in a buffer by a cycle of adding a nucleotide to the first end of the nucleic acid having one end of the nucleic acid, wherein the first end of the nucleic acid comprises one or more addition chambers (including reagents capable of adding nucleotides or oligomers) and It moves by electrical attraction between one or more storage chambers (without the reagents necessary to add nucleotides or oligomers), and the chambers are separated by one or more membranes, each containing one or more nanopores. , Nanopores are large enough to allow passage of nucleic acids, but at least one of the essential for nucleotide addition Of those small to allow the passage of reagents, methods.   5. The method of claim 3, wherein the reagent that adds nucleotides to the nucleic acid comprises a polymerase.   5. A method according to claim 3 or 4, wherein the nucleotides are added in 3 'protected form and the storage chamber contains a reagent capable of deprotecting the added nucleotides.   A method of synthesizing DNA in a nanochip, the nanochip comprising one or more addition chambers containing topoisomerase-loaded nucleotides or oligonucleotides, and one or more storage chambers containing restriction enzymes or phosphatases, The chamber also contains a compatible buffer and is separated by a membrane containing at least one nanopore, the nanopore being sufficiently small that topoisomerase and restriction enzyme or phosphatase can not pass through the nanopore, synthesis is carried out at the first end and the first It is carried out by a cycle of adding a nucleotide or oligonucleotide mass to the first end of a nucleic acid having two ends, wherein the first end of the nucleic acid is electrically coupled between the one or more addition chambers and the one or more storage chambers. How to move by dynamic attraction   7. The method of claim 6, wherein a single nucleotide is added in each cycle.   A method of synthesizing a DNA molecule using topoisomerase mediated ligation by adding a single nucleotide or oligomer to the DNA strand in the 3 'to 5' direction, (i) Reacting the DNA molecule with the topoisomerase loaded with the desired nucleotide or oligomer, wherein the nucleotide or oligomer is blocked from further addition at the 5 'end, then (ii) thus formed Deblocking the 5 'end of the DNA, repeating steps (i) and (ii) until the desired nucleotide sequence is obtained.   5 'phosphorylation, such as adding a single nucleotide in the 3' to 5 'direction, such that in step i) the desired nucleotide in the 5' protected form is added to the 5 'end of the DNA 9. The method according to claim 8, wherein the 5 'end of the DNA is thus formed by loading the topoisomerase with the form of the desired nucleotide and dephosphorylating the added nucleotide in step ii).   An oligonucleotide comprising a topoisomerase binding site, an information sequence, and a restriction site which when cleaved by a restriction enzyme gives a topoisomerase linking site.   A topoisomerase linked to a single nucleotide, wherein the topoisomerase is linked via the 3'-phosphate of the nucleotide and the nucleotide is phosphorylated at the 5'-position.   Single-stranded or double-stranded DNA molecule consisting of a single-stranded or coding sequence essentially consisting of non-hybridizing bases.   10. Synthesizing a charged polymer (including nucleic acid or DNA) comprising at least two separate monomers or oligomers according to the method according to any of claims 1-9, the sequence of the monomers corresponding to the machine readable code , How to save information.   14. The method of claim 13, wherein the charged polymer or a copy of the charged polymer is removed from the nanotip after synthesis completion.   14. The method of claim 13, wherein the charged polymer remains on the nanotip after completion of synthesis.   A charged polymer comprising at least two separate monomers, such as a nanotip for synthesizing DNA, comprising at least a first and a second reaction chamber separated by a membrane comprising one or more nanopores, each reaction chamber Comprises one or more electrodes for drawing the charged polymer into the chamber, the first reaction chamber further comprising an electrolyte medium and a reagent for adding the monomer or oligomer to the polymer, said monomer or oligomer being at one time Protected so that only one can be added, the second reaction chamber further comprises an electrolyte medium and a reagent for deprotecting the thus added monomer or oligomer, the nanopore passes through the polymer Large enough to allow for the monomer or oligomer polymer Reagents for addition, and, thus the added monomers or oligomers to permit the passage of reagent for deprotection is smaller, nanotips.   A charged polymer comprising at least two distinct monomers, for example a nanotip for sequencing DNA, comprising at least first and second reaction chambers, comprising an electrolyte medium, a membrane comprising one or more nanopores Separated, and each reaction chamber includes at least one pair of electrodes disposed on the opposite side of the membrane, the electrodes being for example pulsed at 1 MHz to 1 GHz, for example 50 to 200 MHz, of radio frequency pulsed direct current. Operatively connected to a capacitive circuit that can be applied to the nanopore at a frequency of about 100 MHz, for example, a pulsating direct current can draw the charged polymer through the nanopore and the nanopore as the charged polymer passes through the nanopore A nanotip that can determine the monomer sequence by measuring the volume fluctuation of.   A method of reading a charged polymer comprising at least two different types of monomers, such as a monomer sequence of a DNA molecule, comprising: radio frequency pulsed direct current, for example 1 MHz to 1 GHz, for example 50 to 200 MHz, for example about 100 MHz A method, comprising applying to the nanopore, wherein the pulsating direct current draws the charged polymer through the nanopore and the monomer arrangement is determined by measuring the nanopore volume fluctuation as the charged polymer passes through the nanopore.   19. The method of claim 18, wherein the capacity variation is measured by measuring the change in impedance in the radio frequency signal induced by the change in capacitance as the polymer passes through the nanopore.   20. A method according to claim 18 or 19, which is a method of reading a binary code encoded in the sequence of a charged polymer comprising at least two separate monomers.

Images