CN101173276A - Compositions and methods for rapidly generating recombinant nucleic acid molecules - Google Patents

Compositions and methods for rapidly generating recombinant nucleic acid molecules Download PDF

Info

Publication number
CN101173276A
CN101173276A CNA2007101667135A CN200710166713A CN101173276A CN 101173276 A CN101173276 A CN 101173276A CN A2007101667135 A CNA2007101667135 A CN A2007101667135A CN 200710166713 A CN200710166713 A CN 200710166713A CN 101173276 A CN101173276 A CN 101173276A
Authority
CN
China
Prior art keywords
nucleic acid
acid molecule
topoisomerase
site
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2007101667135A
Other languages
Chinese (zh)
Inventor
J·D·切斯纳特
J·卡利诺
L·利昂
K·马丹
M·格里森
J·范
M·A·布拉施
D·切奥
J·L·哈特里
D·R·N·伯德
G·F·坦普尔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Invitrogen Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Invitrogen Corp filed Critical Invitrogen Corp
Publication of CN101173276A publication Critical patent/CN101173276A/en
Pending legal-status Critical Current

Links

Images

Abstract

The present invention provides compositions and methods for recombinational cloning. The compositions include vectors having multiple recombination sites and/or multiple topoisomerase recognition sites. The methods permit the simultaneous cloning of two or more different nucleic acid molecules. In some embodiments the molecules are fused together while in other embodiments the molecules are inserted into distinct sites in a vector. The invention also generally provides for linking or joining through recombination a number of molecules and/or compounds (e.g., chemical compounds, drugs, proteins or peptides, lipids, nucleic acids, carbohydrates, etc.) which may be the same or different. The invention or prepared according to the methods of the invention, and also provides kits comprising the compositions, host cells and nucleic acid molecules of the invention, which may be used to synthesize nucleic acid molecules according to the methods of the invention.

Description

Utilize the method and composition of many recognition sites synthetic nucleic acid molecule
It is 01822539.x that the application is based on application number, and the applying date is December 7 calendar year 2001, and denomination of invention is divided an application for the Chinese patent application of " utilizing the method and composition of many recognition sites synthetic nucleic acid molecule ".
Background of invention
Invention field
The present invention relates to biotechnology and biology field.Particularly, the present invention relates to connect the multiple nucleic acid molecule that contains one or more recombination sites and/or one or more topoisomerase enzyme recognition sites.The present invention also relates to utilize the recombinant clone method to clone the nucleic acid molecule of these connections, for example use the method for topoisomerase and/or recombinant protein.The present invention also relates to utilize recombination site and/or topoisomerase enzyme recognition site to connect the combination of multiple peptide and peptide and nucleic acid molecule.Other molecule also can be connected by recombination site according to the present invention and/or topoisomerase enzyme recognition site with combination of compounds with compound or molecule.These peptides, nucleic acid and other molecule and/or compound (or its combination) also can by recombining reaction and/or by the topoisomerase ligation with one or more carriers according to the present invention or structure is connected or combination.
Correlation technique
Site-specific recombinase
Site-specific recombinase is the protein that exists in the multiple biology (for example virus and bacterium), has been characterized as being to have endonuclease and ligase enzyme characteristic.Special base sequence in these recombinases (in some cases with bonded protein) identification nucleic acid molecule, and exchange is positioned at the nucleic acid fragment of these sequence flanks.Recombinase and bonded protein be commonly referred to as " recombinant protein " (referring to, Landy for example, A., Current Opinion in Biotechnology3:699-707 (1993)).
Described from different biological a large amount of recombination systems.Referring to, people such as Hoess for example, Nucleic Acids Research 14 (6): 2287 (1986); People such as Abremski, J.Biol.Chem.261 (1): 391 (1986); Campbell, J.Bacteriol.174 (23): 7495 (1992); People such as Qian, J.Biol.Chem.267 (11): 7794 (1992); People such as Araki, J.Mol.Biol.225 (1): 25 (1992); Maeser and Kahnmann, Mol.Gen.Genet.230:170-176 (1991); People such as Esposito, Nucl.Acids Res.25 (18): 3605 (1997).Wherein many intergrase families that belong to recombinase (people such as Argos, EMBO is (1986) J.5:433-440; People such as Voziyanov, Nucl.Acids Res.27:930 (1999)).Perhaps, wherein studying maximum is intergrase/(Landy of att system from phage, A.Current Opinions inGenetics and Devel.3:699-707 (1993)), from Cre/LoxP system (Hoess and the Abremski (1990) of phage P1, " nucleic acid and molecular biology ", the 4th volume, editor: Eckstein and Lilley, Berlin-Heidelberg:Springer-Verlag; Pp.90-109) with from the FLP/FRT system (people such as Broach, Cell29:227-234 (1982)) of yeast saccharomyces cerevisiae 2 μ circular plasmids.
Recombination site
No matter above-mentioned reaction is called as reorganization, swivel base is still integrated, and is by recombinase, transposase or intergrase catalysis, and they all have the principal character of specific recognition sequence on the nucleic acid molecule that participates in reaction, be commonly referred to " recombination site ".These recombination sites be integrate or the reorganization initial period by nucleic acid moiety or fragment on recombinant protein identification and the bonded related nucleic acid molecule.For example, the recombination site of Cre recombinase is loxP, and it is the sequence of 34 base pairs, is made up of the inverted repeats (as the recombinase binding site) of two 13 base pairs that are positioned at 8 base pair core sequence flanks.Referring to Sauer, B., the Fig. 1 among the Curr.Opin.Biotech.5:521-527 (1994).Other example of recognition sequence comprises attB, attP, attL and the attR sequence that can be discerned by recombinant protein.(Int.attB is a kind of sequence of about 25 base pairs, the core type Int binding site that contains two 9 base pairs, overlap with one 7 base pair, and attP is a kind of sequence of about 240 base pairs, contain core type Int binding site and arm type Int binding site, and the site of accessory protein integration host factor (IHF), FIS and excisionase (Xis).See Landy, Curr.Opin.Biotech.3:699-707 (1993)).
The conventional nucleic acid clone
The clone of nucleic acid fragment has been conventional now in many research laboratories, is the steps necessary of many genetic analyses.Yet, these clones' purpose difference, generally can consider two purposes: (1) is at first from big DNA or RNA fragment (karyomit(e), YACs, PCR fragment, mRNA etc.) cloning nucleic acid, this carries out in the known carrier of relative minority such as pUC, pGem, pBlueScript, (2) these nucleic acid fragments carry intravital subclone to specialization, to carry out functional analysis.Plenty of time and energy spend in nucleic acid fragment from initial cloning vector to the process that the carrier of specialization more shifts.This transfer is called as subclone.
Clone's basic skills knows most year during this period of time few of change.Typical clone's scheme is as follows:
(1) with one or both digestion with restriction enzyme purpose nucleic acid;
When (2) knowing, gel-purified purpose nucleic acid fragment;
(3) suitably the time,, prepare carrier by with suitable digestion with restriction enzyme, with Phosphoric acid esterase processing, gel-purified etc.
(4) connect nucleic acid fragment and carrier, remove not enzyme with suitable contrast and cut and the carrier background that is connected certainly;
(5) carrier that obtains is imported in the e. coli host cell;
(6) bacterium colony of picking selection, cultivating in a small amount, culture spends the night;
(7) preparation nucleic acid a small amount of prepared product; With
(8) at (usually behind the diagnostic digestion with restriction enzyme) on the sepharose or by the isolating plasmid of pcr analysis.
The specialization carrier that is used for the subclone nucleic acid fragment is a functional diversities.Include but not limited to: the carrier of express nucleic acid molecule in different biologies; The adjusting nucleic acid molecule is expressed; Provide and help protein purification or allow proteinic mark in the spike cell; Be used to modify clone's nucleic acid fragment (for example producing disappearance); Be used for synthesising probing needle (for example ribose probe); For nucleic acid sequencing prepares template; Be used for the identification of protein coding region; Be used for the fusion of different proteins coding region; Produce a large amount of purpose nucleic acid, or the like.A concrete research generally includes subclone purpose nucleic acid fragment in several different specialization carriers.
Known in this field, simple subclone can be finished (for example, nucleic acid fragment is little, and the site of restriction site and subcloning vector is compatible) in one day.Yet other many subclones spend the time in several weeks possibly, and particularly those are about impure etc. the subclone of unknown nucleotide sequence, long segment, virulent gene, improper, the high background in restriction site position, enzyme.One of the longest subclone type the most tediously long, consuming time comprises, in order to make up the clone of hope, adds several nucleic acid fragments successively on carrier.This class clone's a structure that example is a gene targeting vector.Gene targeting vector generally comprises two nucleic acid fragments, wherein each all the part with target gene is identical, be positioned at a selected marker flank.In order to make up this carrier, must clone each fragment successively, that is, at first a gene fragment is inserted in the carrier, insert selected marker and second target fragment then.Each fragment for the clone may need a large amount of digestion, purifying, connection and separating step.Therefore, the subclone nucleic acid fragment is regarded as the least possible trival matters of carrying out usually.
Once described several promotion nucleic acid fragment clones' method, for example, following reference is described.
Ferguson, people such as J., Gene 16:191 (1981) disclose and have been used for the segmental carrier family of subclone yeast nucleic acid.This class vector encoded kalamycin resistance.Can partly digest the segmental clone of longer yeast nucleic acid, and be connected in the subcloning vector.If initial cloning vector provides amicillin resistance, then needn't purifying before transforming, because will carry out the kantlex screening.
Hashimoto-Gotoh, people such as T., Gene 41:125 (1986) discloses a kind of subcloning vector that contains unique cloning site at the Streptomycin sulphate sensitivity genes; In the streptomycin resistance host, have only the plasmid that the dominance sensitivity genes contains insertion or disappearance to survive in Streptomycin sulphate screening back.
Although these methods have improvement, adopt traditional subclone of restriction enzyme and ligase enzyme to be still consuming time and relative insecure.Expended a large amount of work, and if at two days or the more days later subclones of in candidate's plasmid, finding hope, then must use the alternative conditions whole process repeated.
Recombinant clone
In the past at U.S. Patent number 5,888, the cloning system of recombinating at the recombination site of determining has been described in 732,6,143,557,6,171,861,6,270,969 and 6,277,608, be incorporated herein by reference.In brief, the Gateway that in the application that the application and associated uses are partly mentioned, describes TMCloning system adopt contain at least one, the carrier of at least two different loci specificity recombination sites preferably, these sites are based on phage system (for example att1 and att2), by wild-type (att0) site mutation.There is unique specificity in each mutational site to the homology spouse att site (for example attB1 and attP1 or attL1 and attR1) of same type, not with the recombination site of other mutation type or not with wild-type att0 site cross reaction.Utilize Gateway TMSystem, by being positioned at the selected marker (for example ccdB) of recombination site flank on the displacement receptor plasmid molecule (being sometimes referred to as destination carrier), clone and subclone are positioned at the nucleic acid fragment of recombination site flank.Then by transforming the responsive host's strain of ccdB and just selecting the clone that screening is wished according to the mark on the acceptor molecule.In other biology, can use similarly negative selection strategy (for example using virulent gene), as the thymidine kinase in Mammals and the insect (TK).
The specific residue of the sudden change in the core area of att site can produce a large amount of different att sites.As at Gateway TMMiddle att1 and att2 site of using, each other sudden change may produce a new att site, this site has unique specificity, promptly only with the homology spouse att site reorganization that contains identical sudden change, and not with other any sudden change or wild-type att site cross reaction.There is description in new sudden change att site (for example attB 1-10, attP 1-10, attR 1-10 and attL 1-10) in the patent application series number of submitting on May 28th, 1,999 60/136,744, be incorporated herein by reference.Have unique specificity other recombination site (be first site can with the reorganization of corresponding site, but not with have the reorganization of not homospecific second site or do not recombinate substantially) can be used for implementing the present invention.The example of suitable recombination site includes but not limited to: loxP site and derivative, and as loxP511 (referring to U.S. Patent number 5,851,808), frt site and derivative, dif site and derivative, psi site and derivative, cer site and derivative.The invention provides utilize these recombination sites in conjunction with or connect multiple nucleic acid molecule or segmental novel method, more specifically, with multiple fragment cloning to one or more carriers that contain one or more recombination sites (as any Gateway TMCarrier comprises destination carrier) in.
Summary of the invention
The present invention partly relates to the nucleic acid molecule that comprises one or more (for example 1,2,3,4,5 etc.) recombination site (for example one or more att site, one or more lox site etc.) and/or one or more (for example 1,2,3,4,5 etc.) topoisomerase enzyme recognition site (recognition sites of for example one or more IA type topoisomerases, IB type topoisomerase, II type topoisomerase etc.), and with the nucleic acid molecule of topoisomerase (for example locus specificity topoisomerase) cutting.The present invention also relates to comprise the nucleic acid molecule of one or more recombination sites and/or one or more topoisomerases.More specifically, the present invention relates to combination or connect at least a first kind of nucleic acid molecule and at least a second kind of nucleic acid molecule, first kind of nucleic acid molecule comprises at least a first kind of nucleic acid molecule that contains at least one recombination site, and second kind of nucleic acid molecule comprises at least one topoisomerase enzyme recognition site and/or at least one topoisomerase.With these at least the first kind of molecule with after second kind of molecule is connected, can produce at least a the third (chimeric) molecule, it comprises: (1) at least one recombination site and (2) at least one topoisomerase enzyme recognition site and/or at least one topoisomerase.These nucleic acid molecule can be (for example relaxed type, superhelix types etc.) linear or closed hoop.These recombination sites, topoisomerase enzyme recognition site and topoisomerase endonuclease capable are positioned at any position on the multiple nucleic acid molecule of the present invention, comprise in the end and/or nucleic acid molecule that is located on or near nucleic acid molecule.And, can use the arbitrary combination of identical or different recombination site, topoisomerase enzyme recognition site and/or topoisomerase according to the present invention.
The present invention partly comprises nucleic acid molecule and comprises the composition (for example reaction mixture) of nucleic acid molecule that wherein this nucleic acid molecule comprises: at least one topoisomerase (for example covalently bound topoisomerase) such as (for example 1,2,3,4,5,6,7,8) of (1) at least one recombination site such as (for example 1,2,3,4,5,6,7,8) and (2) or at least one (for example 1,2,3,4,5,6,7,8 etc.) topoisomerase enzyme recognition site.In a particularly embodiment, the topoisomerase of above-mentioned nucleic acid molecule or topoisomerase enzyme recognition site and recombination site can be positioned at inside or be located on or near one or two end.For example, one or more (for example 1,2,3,4,5,6,7,8 etc.) at least one topoisomerase or at least one topoisomerase enzyme recognition site and one or more at least a recombination site can be located on or near one 5 ' and hold, be located on or near one 3 ' and hold, be located on or near two 5 ' and hold, be located on or near two 3 ' and hold, be located on or near one 5 ' end and one 3 ' and hold, be located on or near one 5 ' end and two 3 ' and hold or be located on or near one 3 ' to hold and two 5 ' ends.The present invention also provides preparation and uses nucleic acid molecule of the present invention and method for compositions.
Aspect special, the invention provides following nucleic acid molecule: (1) dissimilar topoisomerase (for example IA type topoisomerase, IB type topoisomerase, II type topoisomerase etc.) adheres to (for example covalent attachment) with it, and/or (2) contain the two or more topoisomerase enzyme recognition sites that can be discerned by dissimilar topoisomerases, and preparation and use the method for compositions that comprises these nucleic acid molecule.In many embodiments, these nucleic acid molecule also comprise one or more (for example 1,2,3,4,5,6,7,8 etc.) recombination site.
The present invention also provides the method that connects two or more nucleic acid fragments, and wherein at least a nucleic acid fragment contains at least one topoisomerase or topoisomerase enzyme recognition site and/or one or more recombination site.In addition, when the nucleic acid fragment that uses in the method for the present invention contained more than one (for example 1,2,3,4,5,6,7,8 etc.) topoisomerase on identical or different nucleic acid fragment, these topoisomerases can be same types or dissimilar.Similarly, when the nucleic acid fragment that uses in the method for the present invention contained more than one topoisomerase enzyme recognition site on identical or different nucleic acid fragment, these topoisomerase enzyme recognition sites may be by same type or dissimilar topoisomerase identification.In addition, when the nucleic acid fragment that uses in the method for the present invention contained one or more recombination site, perhaps these recombination sites can recombinate with the one or more recombination sites on the identical or different nucleic acid fragment.Therefore, the invention provides the method for utilizing the method for using any topoisomerase or topoisomerase enzyme recognition site to connect nucleic acid fragment.The present invention also provides the method for the arbitrary combination of arbitrary combination that utilize to use (1) topoisomerase or topoisomerase enzyme recognition site and/or (2) recombination site to connect other method of nucleic acid fragment.The present invention also provides the nucleic acid molecule of producing by aforesaid method, and these molecules and the purposes that comprises the composition of these molecules.
Generally speaking, the present invention partly provides and connects the method that a plurality of (for example 2,3,4,5,6,7,8,9,10 etc.) contain the nucleic acid fragment of difference in functionality or structural element.Therefore, the present invention partly provides the method that the nucleic acid fragment that makes the nucleic acid molecule product have different choice with a plurality of (for example 2,3,4,5,6,7,8,9,10 etc.) links together.In many cases, method of the present invention causes the formation of nucleic acid molecule, has effective interaction (for example, effectively interact/being connected between expression control sequenc and the open reading frame) between the characteristic of each nucleic acid fragment that wherein links together and/or the element.Can give (1) function of product molecule and the example of structural element and (2) characteristic includes but not limited to: multiple clone site (for example, the nucleic acid district of containing at least two restriction endonuclease restriction enzyme sites), packaging signal (for example, adenovirus packaging signal, Alphavirus packaging signal etc.), restriction endonuclease restriction enzyme site, open reading frame (for example intein encoding sequence, affinity purification marker coding sequence etc.), expression control sequenc (for example promotor, operator gene etc.), or the like.Nucleic acid fragment can be given other element and the characteristic of product nucleic acid molecule and describe in this paper other parts.The present invention also provides the nucleic acid molecule of producing by aforesaid method, and these molecules and the purposes that comprises the composition of these molecules.
In addition, the present invention partly comprises the method that connects two or more nucleic acid fragments such as (for example 2,3,4,5,6,7,8 kind), that wherein at least a (for example 1,2,3,4,5,6,7,8 kind etc.) nucleic acid fragment comprises is one or more (for example 1,2,3,4,5,6,7,8 etc.) topoisomerase and/or one or more topoisomerase enzyme recognition site, at least a nucleic acid fragment comprises one or more recombination sites.In a particularly embodiment, the method that the invention provides at least two kinds of connections (for example 2,3,4,5,6,7,8 kind etc.) nucleic acid molecule (for example, the method of utilizing reorganization and/or mediating) by one or more topoisomerases, wherein one of nucleic acid fragment comprises one or more topoisomerases or topoisomerase enzyme recognition site, but do not contain recombination site, and other nucleic acid fragment comprises one or more recombination sites, but does not contain topoisomerase or topoisomerase enzyme recognition site.Therefore, method of the present invention can be used for connecting or chimeric nucleic acid molecule by connecting the nucleic acid fragment preparation, wherein the product nucleic acid molecule comprises: (1) one or more (for example 1,2,3,4,5,6,7,8 etc.) topoisomerase and/or one or more (for example 1,2,3,4,5,6,7,8 etc.) topoisomerase enzyme recognition site and (2) one or more (for example 1,2,3,4,5,6,7,8 etc.) recombination site.The present invention also provides the nucleic acid molecule that utilizes these method preparations, the method that comprises the composition of these nucleic acid molecule and use these nucleic acid molecule.
The present invention also provides the composition that comprises one or more nucleic acid fragments described herein and/or nucleic acid molecule.These compositions can comprise one or more and be selected from other following composition: one or more other nucleic acid molecule (may comprise recombination site, the topoisomerase enzyme recognition site, topoisomerase etc.), one or more Nucleotide, one or more polysaccharases, one or more reversed transcriptive enzymes, one or more recombinant proteins, one or more topoisomerases, one or more damping fluids and/or salt, one or more solid carriers, one or more polyamine, one or more carriers, one or more restriction enzymes etc.For example, composition of the present invention includes but not limited to comprise a kind of mixture (for example reaction mixture) of nucleic acid fragment, this nucleic acid fragment comprises at least one topoisomerase enzyme recognition site and at least one topoisomerase, and this topoisomerase can be discerned one of at least one topoisomerase enzyme recognition site of this nucleic acid fragment at least.Composition of the present invention also comprises at least a nucleic acid fragment, this nucleic acid fragment comprises: (1) at least one topoisomerase enzyme recognition site, or at least a topoisomerase adheres at least a nucleic acid fragment and (2) one or more other compositions of (for example covalent attachment).The example of this other composition includes but not limited to: topoisomerase; Other nucleic acid fragment can comprise or may not contain one or more topoisomerases or topoisomerase enzyme recognition site; Damping fluid; Salt; Polyamine (for example spermine, spermidine etc.); Water; Or the like.Nucleic acid fragment contained in the composition of the present invention also can comprise one or more recombination sites and/or one or more recombinases.
Unite the nucleic acid molecule or the fragment of use by method production of the present invention or with method of the present invention, and nucleic acid molecule of the present invention or its fragment, comprise herein special those molecules or the fragment of describing, and have the molecule or the fragment of basic sequence identity with molecule described herein or fragment.The molecule or the fragment that have " basic sequence identity " with specific molecular or fragment are meant, this molecule or fragment and given (or " reference ") molecule or fragment at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, identical at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.Contain with for example the nucleic acid molecule or the fragment of the nucleotide sequence of at least 65% " identical " are meant with reference to nucleic acid molecule or fragment, be up to 35 point mutation with reference to nucleotide sequence Nucleotide except this nucleic acid molecule or fragment can comprise per 100, this nucleic acid molecule or segmental nucleotide sequence are identical with canonical sequence.In other words, in order to obtain to contain and polynucleotide with reference to the identical nucleotide sequence of nucleotide sequence at least 65%, be up to 5% Nucleotide in the canonical sequence and can lack or be replaced into another kind of Nucleotide, perhaps can in canonical sequence, insert the highest Nucleotide that accounts for total nucleotide several 35% in the canonical sequence.These sudden changes of canonical sequence may occur in 5 ' or the 3 ' end position (or this two place) with reference to nucleotide sequence, the perhaps arbitrary position between these terminal positions, between the single Nucleotide that intersperses among canonical sequence, or be present in the canonical sequence with the form of one or more adjacent groups.
A practical problems is, any specific nucleic acid molecule or fragment and a kind of given with reference to molecule or fragment whether at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% is identical, can determine with known computer program is conventional, as FASTA (Heidelberg, Germany), BLAST (Washington, DC) or BESTFIT (Wisconsin sequence analysis software bag, the 8th edition, for Unix, Genetics ComputerGroup, University Research Park, 575 Science Drive, Madison, WI53711), it adopts a kind of local homology algorithm (Smith and Waterman, Advances inApplied Mathematics 2:482-489 (1981)) to find the best homologous fragment between the two sequences.When using FASTA, BLAST, BESTFIT or other any sequence alignment program to determine a kind of particular sequence and canonical sequence according to the present invention when (for example) 65% is identical, parameter is arranged so that in total length and lists calculating percentage identity with reference to nucleotides sequence, and allows the highest homology breach that accounts for canonical sequence Nucleotide sum 35%.
Usually further make the phosphate covalent attachment of topoisomerase molecule and nucleic acid molecule with the nucleic acid molecule of topoisomerase (for example locus specificity topoisomerase) cutting.The present invention also comprises the method for addressing the described nucleic acid molecule of this paper other parts in the preparation, and the recombination method of using these molecules.
In specific embodiments, nucleic acid molecule of the present invention is a carrier.In other embodiments, the present invention includes the host cell that contains nucleic acid molecule of the present invention, and the method for preparing and utilize these host cells (for example) production expression products (for example protein, polypeptide, antigen, antigenic determinant, epi-position etc. or its fragment).
In specific embodiments, nucleic acid molecule of the present invention comprises two or more recombination sites, contains one or more (for example 1,2,3,4,5 etc.) topoisomerase enzyme recognition site between recombination site.In other particular, nucleic acid molecule of the present invention can comprise two or more topoisomerase enzyme recognition sites, contains one or more (for example 1,2,3,4,5 etc.) recombination site between two or more topoisomerase enzyme recognition sites.
In other particular, nucleic acid molecule of the present invention comprises two recombination sites, contains two topoisomerase enzyme recognition sites between these two recombination sites.Therefore, if cutting makes these molecule linearizings between the topoisomerase enzyme recognition site, then the topoisomerase enzyme recognition site will be positioned at the far-end (i.e. two ends of close linear molecule) of recombination site in the linear molecule of Chan Shenging.The present invention also provides the linear nucleic acid molecule that contains one or more recombination sites and one or more topoisomerase enzyme recognition sites.In specific embodiments, one or more topoisomerase enzyme recognition sites are positioned at the far-end of one or more recombination sites.The example of these molecules has been described in following examples 8.
The location of the recombination site of first kind of nucleic acid molecule and topoisomerase enzyme recognition site may make topoisomerase mediation this molecule with cause second kind of nucleic acid molecule being connected of second kind of nucleic acid molecule between two or more recombination sites.An example is that linear first kind of nucleic acid molecule can contain a recombination site that is located on or near each end, also can comprise a topoisomerase enzyme recognition site that is positioned at one of two recombination sites far-end.In this case, can design first kind of nucleic acid molecule of linearizing and a kind of topoisomerase incubation, make topoisomerase and first kind of nucleic acid molecule covalently bound, wherein this topoisomerase is located on or near the end of first kind of nucleic acid molecule and the far-end of adjacent/nearest recombination site.This end of first kind of nucleic acid molecule can be a flush end, perhaps can contain 5 ' or 3 ' overhang.When with suitable second kind of nucleic acid molecule at least one chain-ordering complementary molecule of the topoisomerase enzyme modification end of first kind of nucleic acid molecule (for example with) incubation, one of second kind of nucleic acid molecule one end or two chains can be covalently bound with one of first kind of nucleic acid molecule one end or two chains.In addition, if wish it is the circular nucleic acid molecule, then can pass through topoisomerase, ligase enzyme or other method second terminal the connection with second end with first kind of nucleic acid molecule of second kind of nucleic acid molecule.The result of aforesaid method produces a kind of nucleic acid that contains to insert segmental nucleic acid molecule between two recombination sites.The object lesson of method has been described in following examples 8.Utilize the method for the covalently bound nucleic acid molecule of topoisomerase to describe in more detail in this paper other parts.
Make nucleic acid insert fragment after between one or more recombination sites, promptly can will insert fragment and adjacent nucleic acid is transferred in other nucleic acid molecule by recombinant clone.Therefore, the present invention also provides the method for addressing the described nucleic acid molecule of this paper other parts in the production.
The contained recombination site of nucleic acid molecule of the present invention is different with the purposes of this molecule with distance (according to few nucleotide) between the topoisomerase enzyme recognition site, but may be 0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,20,25,30,40,50,60,80,100,150,200,300,500,700,900,1000 etc. or more Nucleotide.And the distance (according to few nucleotide) between contained recombination site of nucleic acid molecule of the present invention and the topoisomerase enzyme recognition site can be in following scope: 0-10 Nucleotide, a 10-30 Nucleotide, a 20-50 Nucleotide, a 40-80 Nucleotide, a 70-100 Nucleotide, a 90-200 Nucleotide, a 120-400 Nucleotide, a 200-400 Nucleotide, a 200-1000 Nucleotide, 200-2000 Nucleotide etc.
The present invention generally also be provided for connecting or in conjunction with of the present invention two or more (for example, more than 3 kinds or 3 kinds, more than 4 kinds or 4 kinds, more than 5 kinds or 5 kinds, etc.) materials and methods of nucleic acid fragment or molecule.On the one hand, for will these molecules of bonded, at least a fragment or molecule can comprise at least one recombination site, and at least a fragment or molecule can comprise at least one topoisomerase enzyme recognition site.Being used to connect can be in vivo or external carrying out according to these methods of multiple nucleic acid molecule of the present invention.Therefore, the present invention relates to produce method novel or the unique sequences combination, and relate to the sequence that produces by these methods.The nucleic acid molecule that produces by method of the present invention can be used to well known to a person skilled in the art any purpose.On the one hand, at least a (normally two or more) nucleic acid molecule that utilizes that method of the present invention connects or fragment comprise at least one, at least two recombination sites preferably, although each molecule (for example can comprise a plurality of recombination sites, more than 3 or 3, more than 4 or 4, more than 5 or 5, etc.).On the other hand, this nucleic acid molecule can comprise at least one topoisomerase enzyme recognition site and/or at least one topoisomerase.Again on the other hand, this molecule can comprise: at least one topoisomerase enzyme recognition site of (1) at least one recombination site and (2) and/or at least one topoisomerase.These recombination sites can be positioned at every kind of nucleic acid molecule or segmental different positions with topoisomerase enzyme recognition site (can be identical or different), the nucleic acid that the present invention uses can have different sizes and different forms, comprises annular, superhelix, linearity etc.The nucleic acid molecule that the present invention uses also can comprise one or more carriers or make the molecule can be as one or more sequences (as replication orgin) of carrier in host cell.On the one hand, being used for nucleic acid molecule of the present invention or fragment is linear molecule, its at least one end place of this molecule or near contain at least one recombination site, preferably the place, two ends of this molecule or near comprise at least one recombination site.On the other hand, when containing a plurality of recombination site on the purpose nucleic acid molecule, can not recombinate basically in these sites, perhaps can not reorganization each other on this molecule.In this embodiment, preferably contain corresponding binding partner recombination site on one or more other nucleic acid molecule that will utilize method of the present invention to connect.For example, the first kind of nucleic acid molecule that uses among the present invention can comprise at least one first kind and second kind of recombination site, second kind of nucleic acid molecule can comprise at least one the third and the 4th kind of recombination site, wherein can not recombinate each other with second kind of site for first kind, can not recombinate each other in the third and the 4th kind of site, although first kind can be recombinated with the third and/or second kind and the 4th kind of site.
The nucleic acid molecule (for example " starting molecule ") that will utilize method of the present invention to connect can be used for producing one or more all or part of hybrid molecules (for example " product nucleic acid molecule ") that contains starting molecule.Starting molecule can be from any source or any nucleic acid molecule of producing by any method.These molecules can perhaps can be (for example derivative nucleic acids) or synthetic generations of non-natural from natural origin (as cell, tissue and the organ from any animal or non-animal-origin).Being used for fragment of the present invention or molecule can be by well known to a person skilled in the art any method production, include but not limited to: amplification, as pcr amplification, separate from natural origin, chemosynthesis, the shearing or the restrictive diges-tion of large nucleic acids molecule (as genome or cDNA), transcribe, reverse transcription etc., and can utilize and well known to a person skilled in the art that any method adds recombination site and/or topoisomerase enzyme recognition site and/or topoisomerase on these molecules, comprise the connection of the linker that contains recombination site and/or topoisomerase enzyme recognition site and/or topoisomerase, primer amplification or nucleic acid that utilization contains recombination site and/or topoisomerase enzyme recognition site and/or topoisomerase synthesize, contain the insertion or the integration of the nucleic acid molecule (for example transposon or integration sequence) of recombination site and/or topoisomerase enzyme recognition site and/or topoisomerase, or the like.On the one hand, the nucleic acid molecule that the present invention uses is a molecule colony, as nucleic acid library or cDNA library.
After utilizing as described here the method reorganization to connect nucleic acid molecule, can utilize the method for attachment of topoisomerase mediation and/or the method for attachment of reorganization mediation described herein that these nucleic acid molecule are connected with other nucleic acid molecule.
Be used for recombination site of the present invention and can be any recognition sequence on a kind of nucleic acid molecule that participates in recombinant protein catalysis or promoted recombining reaction.In embodiment of the present invention of using an above recombination site, these recombination sites can be identical or different, can recombinate each other, perhaps may not recombinate each other or not recombinate substantially.The recombination site that the present invention relates to also comprises mutant, derivative or the variant of wild-type or naturally occurring recombination site.Preferred recombination site is modified and is comprised the site that can improve reorganization, and this raising is selected from: (i) help integrating reorganization; (ii) help the excision reorganization; (iii) reduce needs to host's factor; (iv) improve the efficient that integration altogether or product form; (v) improve the specificity that integration altogether or product form.The preferred modification comprises the modification that can improve the reorganization specificity, remove one or more terminator codons and/or avoid hair clip to form.The also modification that can wish recombination site makes when by modifying that recombination site takes place to translate or when transcribing, and transcribes or translation product (for example mRNA or protein) can comprise the amino acid change of hope.Can comprise att site, frt site, dif site, psi site, cer site and lox site by recombination site used according to the invention, or its mutant, derivative and variant (or its combination).The recombination site that the present invention relates to also comprises the part of these recombination sites.
Every kind of initial nucleic acid molecule is except one or more recombination sites and/or one or more topoisomerase enzyme recognition site and/or one or more topoisomerase, also can comprise multiple sequence (or its combination), include but not limited to: (for example be suitable for as the sequence of primer sites, a kind of primer such as sequencing primer or amplimer can be hybridized with it, it is synthetic to start nucleic acid, the sequence of amplification or order-checking), transcribe or translation signals or adjusting sequence, as promotor and/or operator gene, ribosome bind site, topoisomerase enzyme recognition sequence (or site), the Kozak sequence, initiator codon, transcribe and/or the translation termination signal, as terminator codon (can be suppressed tRNA molecule optimal inhibition) by one or more, tRNA (for example suppressing tRNA), replication orgin, selected marker, can be used for producing the gene or the Gene Partial (for example N end or carboxyl terminal) of fusion rotein, as GST, GUS, GFP, open reading frame (orf) sequence, with may be other any aim sequence of wishing or in multiple Protocols in Molecular Biology, use, comprise the sequence that is used for homologous recombination (for example gene targeting).
The present invention also relates to produce the method for covalently bound recombinant nucleic acid molecules, method is that nucleic acid molecule (in addition with two or more (for example 2,3,4,5,6,7,8,9,10 kind etc.), be equal to ground, also can be called " nucleotide sequence " at this), for example double-stranded (" ds ") or strand (" ss ") nucleic acid molecule contact with at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) topoisomerase.Those skilled in the art are to be understood that, all nucleic acid molecule or the nucleotide sequence mentioned herein, that method for example disclosed herein, composition and test kit adopt or produce by their, can be strand or double chain acid molecule or nucleotide sequence, no matter whether these molecules or sequence be called strand and/or two strands at this.
One such aspect, method of the present invention allows with the direction of hope and/or these nucleotide sequences that are linked in sequence, when wishing, can further operate or in multiple mensuration or method, use, comprise that what for example be used for carrying out transcribes or transfection method, translation reaction or other protein expression method, recombining reaction etc. in external or body.On the other hand, more than 3 kinds or 3 kinds, more than 4 kinds or 4 kinds, 5 kinds or 5 kinds are with first-class identical or different nucleotide sequence, or its colony or library can connect according to a kind of method of the present invention.On the other hand, can utilize method of the present invention to connect each end of a kind of nucleic acid molecule, form covalently closed circle or supercoiled molecule.
The nucleotide sequence that will connect can come from any source, can be nucleic acid molecule naturally occurring and chemical or that be re-combined into, as cDNA, genomic dna, carrier, oligonucleotide etc.In addition, nucleotide sequence can but do not need to contain one or more function sequences, as gene regulatory elements, replication orgin, splice site, polyadenylation site, open reading frame, their can encode for example flag sequence, detectable or selected marker, cellular localization territory or other peptide or polypeptide, or the like.Like this, the present invention can make multiple nucleotide sequence (can be identical or different) connection, is included in when wishing with predetermined order or direction or with this order to be connected with direction.
The nucleic acid molecule that will connect (for example two strands or single stranded nucleic acid molecule) can be any form, for example, be strand or two strands, linearity, ring-type or supercoiled, its characteristic is that every kind of nucleic acid molecule that will connect all is a kind of substrate of topoisomerase, and perhaps can modify becomes this substrate.This topoisomerase can be preferably can be by the covalently bound a kind of nucleic acid molecule of phosphodiester bond at least one chain and any topoisomerase of at least one chain of another kind of nucleic acid molecule.This topoisomerase can be a kind of locus specificity topoisomerase, perhaps can have lax specificity, preferably the cleavage site place or near and the chain formation stabilized complex (for example covalent complex) of this nucleic acid molecule.
Method of the present invention is following carrying out usually: under a kind of two chains of nucleic acid molecule one end and condition that two chains of an end of at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) other nucleic acid molecule are connected, make the nucleic acid molecule (for example two strands or single stranded nucleic acid molecule) of topoisomerase contrectation connection.Like this, method of the present invention produces a kind of covalently bound recombinant nucleic acid molecules (can be strand or double-stranded), and this molecule does not contain otch in the site that the substrate nucleic acid molecule connects.The present invention also provides the recombinant nucleic acid molecules of preparation by this method.Aspect some, these recombinant nucleic acid molecules also comprise one or more recombination sites of the present invention.
A kind of method of the present invention can utilize the composition of various combination to carry out.For example, this method can followingly be carried out: two or more substrate nucleic acid molecule that will be covalently bound (for example single stranded nucleic acid molecule or double chain acid molecule) contact with at least a topoisomerase, wherein one or two chains of this topoisomerase cutting nucleic acid molecule form stabilized complex at cleavage site one end and Nucleotide.The nucleic acid molecule that carries the terminal of topoisomerase or carry topoisomerase contacts with each other then, every chain of substrate nucleic acid molecule is connected, thereby produce one or more covalently bound recombinant nucleic acid molecules.Preferably, the topoisomerase mediation forms phosphodiester bond in each connection site.This method also can followingly be carried out: individually or in the presence of excessive topoisomerase contact two or more carry the nucleic acid molecule of topoisomerase, the nucleic acid molecule (can be strand or two strands) that one or more nucleic acid molecule that carry topoisomerase (can be strand or two strands) and one or more contain a topoisomerase cleavage site and a kind of topoisomerase is contacted.The present invention also provides the recombinant nucleic acid molecules by these method preparations.Aspect these, these recombinant nucleic acid molecules also comprise one or more recombination sites of the present invention.In different embodiments, topoisomerase may have lax relatively specificity, therefore its can in conjunction with and cut multiple different nucleotide sequence, perhaps topoisomerase may be a kind of locus specificity topoisomerase, its energy in conjunction with and cut a kind of specific nucleotide sequence.Topoisomerase also may be an I type topoisomerase, and a chain of cutting double chain acid molecule perhaps may be an II type topoisomerase, two chains of cutting double chain acid molecule.When topoisomerase was II type topoisomerase, the result of cutting produced linear double chain acid molecule, contains topoisomerase at one or two end.In this regard, will form outstanding sequence with the chain that contains the chain complementary double chain acid molecule that combines topoisomerase.
An advantage implementing method of the present invention is that the ligation of carrying out with topoisomerase can take place in wide temperature range as quick as thought.Another advantage is that the recombinant nucleic acid molecules that the method according to this invention produces does not contain otch in the site that two kinds of nucleic acid molecule connect.Like this, in step subsequently, can directly use covalently bound recombinant nucleic acid molecules, for example, as the substrate of amplified reaction such as polymerase chain reaction (PCR).
For example, a kind of method of the present invention can followingly be carried out: can contact and the topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: 1) first kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein in first end or second end or this two ends, first kind of nucleic acid molecule 3 ' end place or near contain a topoisomerase enzyme recognition site; 2) at least a second kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein in first end or second end or this two ends, at least the second kind of double chain nucleotide sequence 3 ' end place or near contain a topoisomerase enzyme recognition site; 3) a kind of locus specificity topoisomerase.One 5 ' hydroxyl may be comprised with the chain complementary chain that contains the topoisomerase enzyme recognition sequence, after the topoisomerase cutting, 5 ' outstanding sequence may be also comprised.
A kind of method of the present invention also can followingly be carried out: can contact and the topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: a kind of nucleic acid molecule (can be strand or two strands) that 1) has first end and second end, wherein first end and second end all 3 ' end place or near contain a topoisomerase enzyme recognition site and 2) a kind of locus specificity topoisomerase.For example, this topoisomerase can be an IB type topoisomerase, as cowpox topoisomerase or yeast saccharomyces cerevisiae topoisomerase.This method provides a kind of method for preparing covalently closed circle or superhelix double chain acid molecule.
A kind of method of the present invention also can followingly be carried out: can contact and at least a topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: 1) first kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein first kind of nucleic acid molecule 5 ' end place of first end or second end or these two ends or near contain a topoisomerase enzyme recognition site; 2) at least a second kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein at least the second kind of double chain nucleotide sequence 5 ' end place of first end or second end or these two ends or near contain a topoisomerase enzyme recognition site; With 3) at least a locus specificity topoisomerase.For example, topoisomerase can be an IA type topoisomerase, as intestinal bacteria topoisomerase I or topoisomerase II I, or eucaryon topoisomerase II I.After a kind of nucleic acid molecule cutting, topoisomerase is preferably held stable bond with 5 '.Contain the topoisomerase enzyme recognition site or in conjunction with topoisomerase 3 ' end can comprise one 3 ' hydroxyl, perhaps can be comprised one 3 ' hydroxyl by modification.After with the topoisomerase cutting, the nucleic acid molecule after the cutting can comprise 3 ' outstanding sequence.
Method can be carried out with two or more locus specificity topoisomerases as described here, wherein first kind, second kind or other nucleic acid primer 3 ' end of an end or 5 ' end place or near correspondingly contain topoisomerase enzyme recognition site corresponding to one of two or more topoisomerases.Use two or more topoisomerases and corresponding topoisomerase enzyme recognition site can help nucleic acid molecule (can be strand or two strands) with predetermined order, direction or be connected.Therefore, will be appreciated that when with a kind of topoisomerase method of the present invention being described, this method can be carried out with two or more topoisomerases similarly.In some cases, use at least a topoisomerase although mention, but unless otherwise noted, also can carry out these methods, as long as the substrate nucleic acid molecule contains suitable topoisomerase enzyme recognition site with a kind of, two kinds, three kinds or more kinds of topoisomerase.Similarly consideration is relevant with the nucleic acid primer that carries topoisomerase, because these topoisomerases may be identical or different.
In another embodiment, method of the present invention can followingly be carried out: can contact and all topoisomerases all can reach under its active condition at all the components, contact following ingredients: 1) first kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein first kind of nucleic acid molecule 3 ' end place of first end or second end or these two ends or near contain a topoisomerase enzyme recognition site, 5 ' end place or near also contain a topoisomerase enzyme recognition site; 2) at least a second kind of nucleic acid molecule (also can be strand or two strands), it has first end and second end; With 3) at least two kinds of locus specificity topoisomerases such as (for example 2,3,4,5,6,7,8,9,10 kind).With after the topoisomerase cutting, the 5 ' end or the 3 ' end of one or two end can comprise a kind of outstanding sequence, perhaps may be flush ends at first kind of nucleic acid molecule substrate end, and perhaps an end can contain an overhang and second end may be a flush end.When having outstanding sequence, it has enough complementarity with the outstanding sequence of second kind of (or other) nucleic acid molecule usually, so that two kinds of molecules specific hybridization each other.
After the method for attachment connection of the present invention of nucleic acid molecule by the topoisomerase mediation, the nucleic acid molecule of generation can be used for recombining reaction then, as the described reaction of this paper other parts.
It is only to contain the topoisomerase enzyme recognition site at first end or second end that the quantity of useful in this embodiment different topology isomerase depends in part on first kind of nucleic acid molecule, still all contain the topoisomerase enzyme recognition site at two ends, and then, when nucleic acid molecule when two ends contain the topoisomerase enzyme recognition site, whether depend at least 3 ' recognition site or 5 ' recognition site be different.In addition, also can carry out this method, make one or more at least the second kind of nucleic acid molecule also can 3 ' end place of first end or second end or these two ends or near contain a topoisomerase enzyme recognition site, and/or its 5 ' end place or near contain a topoisomerase enzyme recognition site, wherein being located on or near 3 ' end of other nucleic acid molecule or 5 ' end or the topoisomerase enzyme recognition site at two ends may be identical or different with the topoisomerase enzyme recognition site in first kind of nucleic acid molecule.Like this, the quantity of different topology isomerase further depends on the quantity of the different substrate nucleic acid molecule that the method according to this invention connects.
An advantage utilizing the locus specificity topoisomerase to carry out method of the present invention is that first kind of nucleic acid molecule, second kind of nucleic acid molecule and one or more other nucleic acid molecule (can be strand or two strands) can be covalently bound with predetermined direction.Another advantage is that the terminal special primer of covalently bound recombinant nucleic acid molecules of wishing by utilization carries out amplified reaction, can be at external selection function product.Equally, the covalently bound recombinant nucleic acid molecules (can be strand or two strands) that the method according to this invention is produced can directly further use in the program, transfectional cell for example, perhaps transcribe/translation reaction as increase (for example PCR), recombining reaction (for example, recombining reaction) as described here, in-vitro transcription reaction or link coupled of template.Therefore, need not further operate, covalently bound recombinant nucleic acid molecules promptly can be used for various objectives.
In one aspect of the invention, first kind of nucleic acid molecule and other nucleic acid that uses in the method for the invention can derive from least the first group of nucleic acid molecule, for example, derive from cDNA library or combinatorial library, as the synthetic oligonucleotide combinatorial library, second kind of nucleic acid molecule and other nucleic acid that uses in the method for the invention can derive from least the second group of nucleic acid molecule.According to this method, first kind of nucleic acid molecule with a kind of method of producing the combination colony of covalently bound recombinant nucleic acid molecules (can be strand or two strands) is provided being connected of second kind of nucleic acid molecule.According to this method, one or more target nucleic acid molecules also can be connected with the recombinant nucleic acid molecules of this colony, produce other colony.These combination molecule colonies can further operate or analyze, for example, and by protein expression and the fusion rotein that screens feature with hope.
In one embodiment, implement a kind of method of the present invention, other nucleic acid that makes kind of the nucleic acid molecule of winning (can be strand or two strands) and use in the method for the invention comprises a kind of open reading frame, for example, a kind of isolating cDNA or gene coded sequence, second kind of nucleic acid molecule (can be strand or two strands) comprises a kind of regulatory element, as promotor, it can be effectively covalently bound with 5 ' end of encoding sequence, makes encoding sequence to transcribe thus.Second kind of nucleic acid molecule and other nucleic acid that uses in the method for the invention also can comprise two or more regulatory elements, as promotor (for example GAL4 promotor), operator gene (for example tet operator gene, gal operon operator gene, lac operon operator gene etc.), internal ribosome entry site and ATG initial methionine codon, they effectively connect each other, can the method according to this invention hold effectively covalently bound with 5 ' of the first kind of nucleic acid molecule that comprises encoding sequence.This method can further comprise contact the third nucleic acid molecule (can be strand or two strands), and it comprises for example polyadenylation signal, and it can be effectively covalently bound with 3 ' end of encoding sequence.This method can be used to produce the expression type nucleic acid molecule, and they can be transcribed, translate as functional unit or transcribe and translate.In addition, the method according to this invention can effectively be connected the nucleic acid molecule of encoded detectable label thing (for example epi-position mark) and first kind or second kind (or other) nucleic acid molecule.For example, the end at the nucleic acid molecule covalently bound by topoisomerase contains the recombinant nucleic acid molecules (can be strand or two strands) that complementary 5 ' outstanding sequence can help producing the nucleotides sequence column direction that has hope in this construct.
In another embodiment, implement a kind of method of the present invention, make that at least the first kind of nucleic acid molecule or at least the second kind of nucleic acid molecule and other nucleic acid that uses in the method for the invention are one of nucleotide sequence colonies, for example, cDNA library, nucleotide sequence combinatorial library or diversified nucleotide sequence colony.In another embodiment, a kind of method of the present invention comprises that also covalently bound double-stranded recombinant nucleic acid molecules (for example at or two recombinant nucleic acid molecules that chain is covalently bound) the contact PCR primer that makes generation is right, and all or part of of the covalently bound recombinant nucleic acid molecules that increases.Except producing a large amount of products, amplified reaction can screen the construct of the covalently bound double-stranded recombinant nucleic acid molecules that comprises hope, particularly when will covalently bound nucleic acid molecule comprising complementary outstanding sequence.Therefore, method of the present invention provides a kind of in-vitro screening method that is suitable for high throughput analysis.
A kind of method of the present invention also can be undertaken by the contact following ingredients: 1) first kind of nucleic acid molecule (can be strand or two strands), it has first end and second end, wherein at first end or second end or place, these two last two ends, first kind of nucleic acid molecule contains one and 3 ' end bonded topoisomerase (" carrying topoisomerase "); 2) at least the second kind of nucleic acid molecule (can be strand or two strands) that carries topoisomerase.Preferably, the nucleic acid molecule that carries topoisomerase contains one 5 ' hydroxyl at the end that contains in conjunction with topoisomerase, although 5 ' hydroxyl also can produce with Phosphoric acid esterase.Method of the present invention can only be carried out with first kind of nucleic acid molecule and second kind of nucleic acid molecule, perhaps when wishing, may comprise the third, the 4th kind or more kinds of nucleic acid molecule (can be strand or two strands), wherein all nucleotide sequences are all definite.First kind or second kind (or other) nucleic acid molecule can contain 3 ' end or the covalently bound topoisomerase in two ends with nucleotide sequence one end independently, and unless otherwise noted, first kind and second kind (or other) nucleic acid molecule may be identical or different.In these areas, at least a nucleic acid molecule that uses in the method described herein can comprise at least one recombination site.And then the nucleic acid molecule that produces by aforesaid method can be used for recombining reaction, as the described recombining reaction of this paper other parts.
Method of the present invention also can be undertaken by the contact following ingredients: the first kind of nucleic acid molecule (can be strand or two strands) that 1) has first end and second end, wherein in first end or second end or this two ends, first kind of nucleic acid molecule contains one and 5 ' holds covalently bound topoisomerase (promptly carrying 5 ' end of topoisomerase); With 2) at least a second kind of nucleic acid molecule (can be strand or two strands) that carries topoisomerase, it comprises at least one 5 ' end that carries topoisomerase.The nucleic acid molecule that carries topoisomerase can contain one 3 ' hydroxyl at the end that contains in conjunction with topoisomerase, perhaps can produce 3 ' hydroxyl by enough Phosphoric acid esterases.As disclosed herein, this method can only be carried out with first kind of nucleic acid molecule and second kind of nucleic acid molecule, perhaps when wishing, may comprise the third, the 4th kind or more kinds of nucleic acid molecule (can be strand or two strands), wherein every kind of nucleotide sequence is all determined, comprises comprising the 5 ' end that at least one carries topoisomerase.First kind or second kind (or other) nucleic acid molecule can contain 5 ' end or the covalently bound topoisomerase in two ends with nucleic acid molecule one end independently, and unless otherwise noted, first kind and second kind (or other) nucleic acid molecule may be identical or different.In these areas, at least a nucleic acid molecule that uses in the method described herein can comprise at least one recombination site.And then, can be used for recombining reaction by nucleic acid molecule above-mentioned and that the described method of this paper other parts produces, as the described recombining reaction of this paper other parts.
A kind of method of the present invention also can be undertaken by the contact following ingredients: the first kind of nucleic acid molecule that 1) has first end and second end, wherein in first end or second end or this two ends, first kind of nucleic acid molecule contains with 5 ' of first end or second end or these two ends holds covalently bound first topoisomerase, with with 3 ' end covalently bound second topoisomerase (that is, one or two end contain carry 5 ' of topoisomerase hold and carry topoisomerase 3 ' end); With 2) at least a second kind of nucleic acid molecule, it preferably will contain with 5 ' end of the covalently bound end of an end of the first kind of nucleic acid molecule that contains topoisomerase and 3 ' end place or can make it to contain hydroxyl.This method also can followingly be carried out, wherein contain and carry that 3 ' of topoisomerase is held or the 5 ' end or the 3 ' end of end that carry 5 ' end of topoisomerase contains a topoisomerase enzyme recognition site respectively, wherein this method also comprises and makes these compositions contacts can reach its active a kind of topoisomerase at the topoisomerase enzyme recognition site.In these areas, at least a nucleic acid molecule that uses in the method described herein can comprise at least one recombination site.And then, can be used for recombining reaction by nucleic acid molecule above-mentioned and that the described method of this paper other parts produces, as the described recombining reaction of this paper other parts.
This method of the present invention can only be carried out with first kind of nucleic acid molecule and second kind of nucleic acid molecule, perhaps when wishing, can comprise the third, the 4th kind or more kinds of nucleic acid molecule, wherein these nucleic acid molecule are defined as first kind of nucleic acid molecule, second kind of nucleic acid molecule or its combination.First kind or second kind (or other) nucleic acid molecule independently can but be not must contain with 5 ' end, the 3 ' end or 5 ' and 3 ' of second end (being undetermined end) to hold covalently bound one or more topoisomerases.In addition, one or more such nucleic acid molecule also can comprise one or more recombination sites.Unless otherwise noted, nucleic acid molecule can be identical or different for first kind and second kind (perhaps other).
The invention still further relates to a kind of method of producing covalently bound double-stranded recombinant nucleic acid molecules, comprise: 1) utilize the part of a kind of PCR primer the first kind of nucleic acid molecule that increase, wherein right at least one primer of this primer coding topoisomerase enzyme recognition site and the randomly complement of one or more recombination sites, thereby produce first kind of nucleic acid molecule with first end and second end of amplification, wherein first end or second end or this two ends 3 ' end place or near contain a topoisomerase enzyme recognition site; With 2) at the end of the first kind of nucleic acid molecule that contains a topoisomerase enzyme recognition site of topoisomerase endonuclease capable cutting amplification, end with at least the second kind of nucleic acid molecule that contains a topoisomerase enzyme recognition site, and can reach it and connect under the active condition, contact following ingredients: a) Kuo Zeng first kind of nucleic acid molecule; B) at least a second kind of nucleic acid molecule, it has first end and second end, wherein first end or second end or this last two ends 3 ' end place or near contain a topoisomerase enzyme recognition site or its cleaved products, and contain or can make it to contain a hydroxyl at 5 ' end of same end; And c) a kind of locus specificity topoisomerase.The PCR primer of the complement of coding topoisomerase enzyme recognition site can contain a hydroxyl at its 5 ' end, and perhaps first kind of nucleic acid molecule with this primer amplification can contact with a kind of Phosphoric acid esterase, produces a hydroxyl at its 5 ' end.The PCR primer of the complement of coding topoisomerase enzyme recognition site also can comprise a kind of nucleotide sequence at its 5 ' end, make in the cutting of locus specificity topoisomerase with behind first kind of nucleic acid molecule of primer amplification, this nucleic acid molecule contains 5 ' outstanding sequence, this sequence with will the method according to this invention give prominence to the sequence complementation with 5 ' of first kind of nucleic acid molecule covalently bound second kind (or other) nucleic acid molecule.In these areas, at least a nucleic acid molecule that uses in the method described herein comprises at least one recombination site.And then, by on address the nucleic acid molecule that the described method of this paper other parts produces and also can be used for recombining reaction, as the described reaction of this paper other parts.
The present invention also relates to a kind of method of producing covalently bound double-stranded recombinant nucleic acid molecules, comprise: 1) utilize the part of a kind of PCR primer the first kind of nucleic acid molecule that increase, wherein right at least one primer of this primer coding topoisomerase enzyme recognition site and the randomly complement of one or more recombination sites, thereby produce first kind of nucleic acid molecule with first end and second end of amplification, wherein first end or second end or this two ends 5 ' end place or near contain a topoisomerase enzyme recognition site; With 2) at the end of the first kind of nucleic acid molecule that contains a topoisomerase enzyme recognition site of at least a topoisomerase endonuclease capable cutting amplification with contain the end of at least the second kind of nucleic acid molecule of a topoisomerase enzyme recognition site, and can reach it and connect under the active condition, contact following ingredients: a) Kuo Zeng first kind of nucleic acid molecule; B) at least the second kind of nucleic acid molecule, it has first end and second end, wherein first end or second end or this two ends 5 ' end place or near contain a topoisomerase enzyme recognition site or contain at 3 ' end place of same end or can make it to contain a hydroxyl; And c) at least a locus specificity topoisomerase.First kind of nucleic acid molecule of amplification contains a hydroxyl at 3 ' end place of the end that contains the topoisomerase enzyme recognition site usually, perhaps can make it to contain this 3 ' hydroxyl.The PCR primer of coding topoisomerase enzyme recognition site also comprises a kind of nucleotide sequence at its 5 ' end (being 5 ' end of topoisomerase enzyme recognition site), make behind first kind of nucleic acid molecule with locus specificity topoisomerase cutting amplification, this nucleic acid molecule contains a kind of 3 ' outstanding sequence, this sequence with will the method according to this invention give prominence to the sequence complementation with 3 ' of first kind of nucleic acid molecule covalently bound second kind (or other) nucleic acid molecule.In these areas, at least a nucleic acid molecule that uses in the method described herein comprises at least one recombination site.And then, by on address the nucleic acid molecule that the described method of this paper other parts produces and also can be used for recombining reaction, as the described reaction of this paper other parts.
The invention still further relates to a kind of method of producing covalently bound double-stranded recombinant nucleic acid molecules, comprise: 1) utilize the part of a kind of PCR primer the first kind of nucleic acid molecule that increase, wherein at least one right primer of this primer comprises a topoisomerase enzyme recognition site, with topoisomerase enzyme recognition site complementary nucleotide sequence and recombination site randomly, thereby produce first kind of nucleic acid molecule with first end and second end of amplification, wherein Kuo Zeng first kind of nucleic acid molecule 5 ' end place of first end or second end or these two ends or near contain a topoisomerase enzyme recognition site, 3 ' end place or near contain a topoisomerase enzyme recognition site; With 2) at i) at least a topoisomerase endonuclease capable the amplification first kind of nucleic acid molecule end 5 ' end place or near cutting topoisomerase enzyme recognition site, and can reach it connects active, ii) at least a topoisomerase endonuclease capable the amplification first kind of nucleic acid molecule end 3 ' end place or near cutting topoisomerase enzyme recognition site, and can reach it and connect under the active condition, contact following ingredients: a) Kuo Zeng first kind of nucleic acid molecule; B) at least a second kind of nucleic acid molecule, it has first end and second end, and wherein second kind of nucleic acid molecule contains in first end or second end or this two ends or can make it to contain one 5 ' hydroxyl and one 3 ' hydroxyl; And c) at least two kinds of locus specificity topoisomerases.Therefore, the invention provides a kind of nucleic acid molecule, it 5 ' end place of one or two end or near contain a topoisomerase enzyme recognition site, 3 ' end place or near contain a topoisomerase enzyme recognition site.In addition, the present invention also provides this nucleic acid molecule, it 5 ' end or 3 ' end or these two ends carry topoisomerase.In these areas, at least a nucleic acid molecule that uses in the method described herein comprises at least one recombination site.And then, by on address the nucleic acid molecule that the described method of this paper other parts produces and also can be used for recombining reaction, as the described reaction of this paper other parts.
The invention still further relates to a kind of oligonucleotide, its contain one or more IA type locus specificity topoisomerases at least one recognition site, with at least a nucleotide sequence of recognition site complementary of one or more IB type locus specificity topoisomerases and at least one recombination site randomly.This oligonucleotide for example can be used as the primer of primer extension reaction, perhaps can be used as carry out amplified reaction such as PCR primer to one of.This oligonucleotide, be called Oligonucleolide primers herein, can be of primer centering, can be used to produce the double-strandednucleic acid amplified production, this product 5 ' end place of an end or near contain an IA type topoisomerase enzyme recognition site, 3 ' end place of same end or near contain an IB type topoisomerase enzyme recognition site.Oligonucleolide primers is to containing a kind of nucleotide sequence, this sequence encoding (or being complementary to) other any purpose nucleotide sequence or peptide, for example, restriction enzyme enzyme recognition site, peptide-labeled, (when wishing) one or more other IA types or IB type topoisomerase enzyme recognition site, thus allow to select one or more topoisomerases convenient or that be easy to obtain to implement method of the present invention.Oligonucleolide primers can also its 5 ' end (be IA type topoisomerase enzyme recognition site or 5 ' end, or with 5 ' end of IB type topoisomerase enzyme recognition site complementary nucleotide sequence) comprise a kind of nucleotide sequence, make behind first kind of nucleic acid molecule with locus specificity topoisomerase cutting amplification, this nucleic acid molecule contains 3 ' or 5 ' outstanding sequence respectively, this sequence respectively with will the method according to this invention and 3 ' or 5 ' outstanding sequence complementation of first kind of nucleic acid molecule covalently bound second kind (or other) nucleic acid molecule, perhaps can following design oligonucleotides primer, make behind the nucleic acid molecule of the consequent amplification of cutting, produce a kind of flush end nucleic acid molecule that carries topoisomerase.
The invention still further relates to a kind of oligonucleotide, it contains at least one topoisomerase enzyme recognition site or complementary nucleotide sequence and at least one recombination site with it.This oligonucleotide can use as mentioned above, for example, and as a right member of primer.
Oligonucleotide length of the present invention be generally 15-20,15-30,15-50,20-30,20-50,30-40,30-50,30-80,30-100,40-50,40-70,40-80,40-100,50-60,50-80,50-100,15-80,15-100 or 20-100 (etc.) individual Nucleotide.
The present invention also provides a kind of primer right, and it comprises at least a aforesaid Oligonucleolide primers, and wherein one of primer is as the forward primer of amplified reaction, and another primer is as reverse primer.The second primer of this primer centering can but be not must comprise IA type topoisomerase enzyme recognition site, with IB type topoisomerase enzyme recognition site complementary nucleotide sequence or these two kinds, and can comprise other any purpose nucleotide sequence and/or at least one recombination site.In one embodiment, this primer is to comprising two kinds of Oligonucleolide primers of the present invention, wherein an Oligonucleolide primers can be used as forward primer, the second Oligonucleolide primers is as reverse primer, this primer is to for example can be used for producing a kind of amplified nucleic acid molecule product that contains topoisomerase enzyme recognition site and/or one or more recombination sites at the two ends of two ends, wherein is positioned at this terminal IA type or IB type or this two kinds of topoisomerase enzyme recognition sites are identical or different.
Therefore, the invention still further relates to a kind of nucleic acid molecule, it has first end and second end, 5 ' end place of first end or second end or these two ends or near contain an IA type topoisomerase enzyme recognition site, 3 ' end place or near contain an IB type topoisomerase enzyme recognition site.In addition, the present invention also provides aforesaid a kind of nucleic acid molecule, wherein this nucleic acid molecule is a kind of molecule that carries topoisomerase, as desired, comprises a kind of IA type topoisomerase of stable bond or IB type topoisomerase or these two kinds in one or two end.These nucleic acid molecule also can comprise one or more recombination sites.
In one embodiment, first kind of nucleic acid molecule and other nucleic acid that uses in the method for the invention comprise a kind of expression type nucleotide sequence, the following molecule of this sequence encoding, as: polypeptide is (for example, can be the polypeptide that contains intein), antisense base sequences, intervening rna (i.e. " RNAi ") molecule, ribozyme, transfer RNA (tRNA) (is tRNA, include but not limited to suppress tRNA), triple helical nucleotide sequence etc., second kind of (or other) nucleic acid molecule comprises a kind of transcription regulatory element, as promotor (for example GAL4 operator gene), operator gene (tet operator gene for example, the gal operon operator gene, lac operon operator gene etc.), enhanser, silencer, translation initiation site or polyadenylation signal, a kind of translation adjusting element of perhaps encoding, as initial methionine, terminator codon, the cellular compartment territory, homeodomain etc., the perhaps combination that effectively connects.Second kind of (or other) nucleic acid molecule and other nucleic acid that uses in the method for the invention, may be second kind of the amplification for preparing (or other) nucleic acid molecule as first kind of nucleic acid molecule of amplification, also can comprise one or more multiple clone site (" MCS "), detectable label, for example enzyme, enzyme substrates, fluorescent chemicals, luminophor, chemiluminescence compound, radionuclide, paramagnetic compound and vitamin H; Perhaps can comprise a kind of marker, can be the oligonucleotide mark, perhaps can be peptide-labeled, for example polyhistidine tag, V5 epi-position or myc epi-position.
In another embodiment, implement method of the present invention with first kind of nucleic acid molecule of coding one peptide species (polypeptide that for example contains intein) or its structural domain and a kind of transcription activating domain of coding or DNA in conjunction with second kind of the territory (or other) nucleic acid molecule.This method can be used for producing covalently bound double-stranded recombinant nucleic acid molecules, and its coding can be used for carrying out double cross and measures the chimeric polyeptides that system, particularly high-throughput double cross are measured.In another embodiment, first kind of nucleic acid molecule comprises nucleotide sequence colony, can be cDNA library, nucleotide sequence combinatorial library, diversified nucleotide sequence colony etc.
Method of the present invention provides a kind of method of producing covalently bound double-stranded recombinant nucleic acid molecules, and this molecule can be used for site-specific ground insertion in target gene group dna sequence dna.Target gene group dna sequence dna can be any genome sequence, particularly gene, the preferably part or all of known gene of nucleotide sequence.This method can be with two groups of PCR primers to carrying out with a kind of nucleic acid molecule.This nucleic acid molecule has first end and second end, the peptide species of encoding, for example a kind of selected marker, wherein this nucleic acid molecule comprises a topoisomerase enzyme recognition site or its cleaved products at 3 ' end of each end, randomly, 5 ' end at each end contains a hydroxyl, and wherein 5 ' end preferably comprises outstanding sequence different from each other.Similarly, this nucleic acid molecule can 5 ' end place of one or two end or near comprise topoisomerase enzyme recognition site or its cleaved products, randomly contain a hydroxyl at 3 ' end place of one or two end, one of them or two 3 ' ends can comprise outstanding sequence; Perhaps 5 ' of one or two end of this nucleic acid molecule end and 3 ' end all can comprise a topoisomerase enzyme recognition site or its cleaved products (seeing Figure 11).In these areas, at least a nucleic acid molecule that uses in the method described herein comprises at least one recombination site.And then, by on address the nucleic acid molecule that the described method of this paper other parts produces and also can be used for recombining reaction, as the described recombining reaction of this paper other parts.
Two groups of PCR primers of common following selection are right, make at suitably archaeal dna polymerase such as Taq polysaccharase and comprise in the presence of the template of sequence to be amplified that this primer amplification is positioned at and is used to insert the target site upstream (and adjacent) of polypeptide (for example selected marker) and the genomic dna sequence part of downstream (and adjacent).It is right also can to design several groups of PCR primers, make amplified production at least in end that will be covalently bound with selected marker, be included in 5 ' end or 3 ' end or place, this two ends or near, contain a topoisomerase enzyme recognition site, the ad hoc approach of the present invention that is suitable for implementing.Therefore, first group of PCR primer is to comprising, for example: 1) article one primer, it with 5 '-3 ' direction comprise be complementary to will with the nucleotide sequence of the covalently bound selected marker end of amplified production 5 ' outstanding sequence, with topoisomerase enzyme recognition site complementary nucleotide sequence and with 3 ' sequence complementary nucleotide sequence of target gene group dna sequence dna; With 2) the second primer, it comprises the nucleotide sequence that is positioned at the target gene group DNA of article one primer complementary 3 ' sequence upstream.Second group of PCR primer is to comprising: 1) article one primer, it from 5 '-3 ' nucleotide sequence that comprises 5 ' the outstanding sequence that is complementary to selected marker end that will be covalently bound, with the nucleotide sequence of 5 ' sequence of topoisomerase enzyme recognition site complementary nucleotide sequence and target gene group dna sequence dna, wherein 5 ' the sequence of target gene group DNA is positioned at the downstream with the right article one primer complementary target gene group DNA3 ' sequence of first group of PCR primer; With 2) the second primer, 3 ' the sequence complementary nucleotide sequence that it comprises with target gene group DNA is positioned at the downstream of the 5 ' sequence of the contained target gene group of article one primer DNA.
After comprising the nucleic acid molecule of selected marker, pcr amplification product and at least a topoisomerase contacts, utilize method of the present invention to produce covalently bound double-stranded recombinant nucleic acid molecules.The double-stranded recombinant nucleic acid molecules that produces can be used for carrying out genomic homologous recombination, for example knocks out the function of a kind of gene in the cell, perhaps makes the cell of the double-stranded recombinant nucleic acid molecules that contains generation have a kind of new phenotype.This method can further be used for producing the stable transgenic nonhuman's biology that keeps the recombinant nucleic acid molecules that produces in its genome.
The present invention also relates to the prepared according to the methods of the invention composition, and relate to the composition that can be used for implementing this method.These compositions can comprise one or more reactants of use in the method for the invention and/or one or more double-stranded recombinant nucleic acid molecules that the method according to this invention is produced.These compositions can comprise that for example: one or more contain the nucleic acid molecule of one or more topoisomerase enzyme recognition sites; One or more carry the nucleic acid molecule of topoisomerase; One or more comprise the nucleic acid molecule of one or more recombination sites; One or more primers, it can be used for preparing the nucleic acid molecule that contains a topoisomerase enzyme recognition site at one or two end with the one or both ends of the amplified production of this primer preparation; One or more topoisomerases; One or more substrate nucleic acid molecule comprise, for example: nucleotide sequence coded mark, marker, regulatory element etc.; One or more covalently bound double-stranded recombinant nucleic acid molecules that the method according to this invention is produced; One or more comprise or can be used for comprising the cell of nucleic acid molecule, primer or recombinant nucleic acid molecules as disclosed herein; One or more are used to carry out the polysaccharase of primer extension or amplified reaction; One or more reaction buffers; Or the like.In one embodiment, a kind of composition of the present invention comprises two or more different nucleic acid molecule that carry topoisomerase and/or two or more different recombination site.Said composition can also comprise at least a topoisomerase.A kind of composition of the present invention also can comprise a kind of locus specificity topoisomerase and a kind of covalently bound double-stranded recombinant nucleic acid molecules, wherein this recombinant nucleic acid molecules contains at least one topoisomerase enzyme recognition site of locus specificity topoisomerase on every chain, wherein topoisomerase enzyme recognition site on chain and complementary strand upper topology isomerase recognition site are in about 100 Nucleotide, usually in about 5,10,20 or 30 Nucleotide.
The arbitrary combination that can comprise starting molecule (or its part) by the product molecule of method production of the present invention, and can be arbitrarily size and any type of (for example annular, linearity, superhelix etc.), this reorganization of depending on the position of recombination site on initial nucleic acid molecule or fragment, the molecule and site in proper order.
(external or body in) can further be operated, analyze or be used to spawn molecule of the present invention in the combination of multiple standards Protocols in Molecular Biology or these technology.These technology comprise that order-checking, amplification, nucleic acid are synthetic, protein or peptide are expressed (for example expressing fusion protein, antibody expression, hormone expression etc.), protein-protein interaction (2-heterozygote or oppositely 2-heterozygote analyze), homologous recombination or gene targeting and combinatorial library analysis and operation.The present invention also relates to (preferably by reorganization) clone's nucleic acid molecule of the present invention in one or more carriers, perhaps nucleic acid molecule of the present invention is transferred in the carrier by adding some function carrier sequence (for example replication orgin).On the one hand, reorganization and/or topoisomerase mediation is connected external realization, further operation or analyze and directly carry out external.Therefore, further analyzing and operate the ability that will not be subjected to import molecule of the present invention and/or keep this molecule in host cell in host cell limits.Therefore, directly in external further operation or analyze molecule of the present invention and can reach short time and higher flux, although analyzed in vitro or operation also can be carried out, perhaps can directly carry out (in host cell) in vivo after going down to posterity by host cell.
Nucleic acid synthesis step according to the present invention can comprise:
(a) purpose nucleic acid molecule or template are mixed with one or more primers and one or more Nucleotide, form a kind of mixture; With
(b) this mixture of incubation under the condition of a kind of nucleic acid molecule of all or part of complementary that is enough to synthetic and this molecule or template.
The synthetic molecule can be used as further synthetic all or part of complementary nucleic acid molecule with first kind of synthetic molecules of template then.Therefore, can prepare a kind of double chain acid molecule (for example DNA).Preferably, under the condition of the second kind of nucleic acid molecule of all or part of complementary that is enough to synthetic and first kind of nucleic acid molecule, in the presence of one or more primers and one or more Nucleotide, carry out this second synthesis step.Generally speaking, in the presence of one or more polysaccharases (preferably can be thermally-stabilised or have a liking for the archaeal dna polymerase of temperature), carry out the synthetic of one or more nucleic acid molecule, although in these building-up reactionss, also can use reversed transcriptive enzyme.Therefore, the nucleic acid molecule as the template of synthesizing other nucleic acid molecule can be RNA, mRNA, DNA or non-natural or deutero-nucleic acid molecule.The initial nucleic acid molecule that utilization contains this primer sites mixes one or more primer sites in the product molecule, can help according to nucleic acid of the present invention synthetic.Therefore, utilize method of the present invention, can add primer sites in the position of one or more hope of product molecule, this depends on the position in starting molecule inner primer site and add the order of starting molecule in the product molecule.
Order-checking step according to the present invention can comprise:
(a) nucleic acid molecule that will be to be checked order mixes with one or more primers, one or more Nucleotide and one or more terminators, forms a kind of mixture;
(b) this mixture of incubation under the condition of all or part of complementary molecule colony that is enough to synthetic and the molecule of waiting to check order; With
(c) separate this colony, the nucleotide sequence of all or part of of mensuration testing molecule.
These order-checking steps are preferably carried out in the presence of one or more polysaccharases (for example archaeal dna polymerase and/or reversed transcriptive enzyme) and one or more primers.The preferred terminator that is used to check order comprises deutero-Nucleotide, as dideoxy nucleotide (ddATP, ddTTP, ddGTP, ddCTP and derivative thereof).The initial nucleic acid molecule that utilization contains this primer sites mixes one or more sequencing primers site to the product intramolecularly, can help according to nucleic acid sequencing of the present invention.Therefore, utilize method of the present invention, can add the sequencing primer site in the position of one or more hope of product molecule, this depends on the position in starting molecule inner primer site and add the order of starting molecule in the product molecule.
Protein expression step according to the present invention can comprise:
(a) obtain a kind of nucleic acid molecule to be expressed, it comprises one or more expression signals; With
(b) under the control of this expression signal, express all or part of of this nucleic acid molecule, thereby produce peptide or protein by this molecule or its part coding.
In this article, expression signal can effectively be connected with sequence to be expressed.Preferably (in the body) expression in host cell of expressed protein or peptide is although also can utilize technology well-known in the art to express external.After protein or peptide are expressed, randomly isolated or purified protein or peptide prod.And, expressed protein or peptide can use in the multiple proteins analytical technology, comprise the interaction of 2-hybrid, protein function analysis and agonist/antagonist-protein interaction (for example stimulating or arrestin matter function by medicine, compound or other peptide).The present invention produces, and particularly expresses new, the unique hybrid protein or the peptide (for example fusion rotein) that produce by combination molecule of the present invention and can be used for treatment usually.The initial nucleic acid molecule that utilization contains these sequences mixes one or more to the product intramolecularly and transcribes or translation signals or regulate sequence, initiator codon, termination signal, donor splicing site/receptor sequence (for example intron sequences) etc. and help according to protein expression of the present invention.Therefore, utilize method of the present invention, can add expressed sequence in the position of one or more hope of product molecule, this depends on the position of these sequences in starting molecule and the order of adding starting molecule in the product molecule.
Can comprise according to homologous recombination of the present invention:
(a) mix at least a first kind of nucleic acid molecule of the present invention (preferably a kind of product molecule) and at least a target nucleic acid molecule that comprises one or more recombination sites and/or one or more topoisomerase enzyme recognition sites, wherein first kind of molecule and target molecule contain one or more homologous sequences; With
(b) make first kind of molecule and target nucleic acid molecule reorganization by homologous recombination.Figure 37 shows an example of the nucleic acid construct that can be used for homologous recombination.The present invention comprises that also preparation can be used for the method for nucleic acid molecule of homologous recombination and the nucleic acid molecule by the preparation of these methods, and the method according to this invention is carried out the cell of homologous recombination.
This homologous recombination can be in external generation, but (for example in host cell) finished preferably in vivo.Preferably, homologous recombination make the nucleic acid molecule of the present invention (first kind of nucleic acid molecule) that contains recombination site all or part of transfer to one or more positions of the target nucleic acid molecule that contains homologous sequence.For product and/or the undesirable product of selecting to wish, just selecting or the negative selection of selecting (for example using selected marker) to help this homologous recombination.One preferred aspect, nucleic acid molecule of the present invention comprises at least a selected marker and at least two kinds and target molecule homologous sequence.Preferably, first kind of molecule comprises at least two kinds of homologous sequences, and it is positioned at least a selected marker flank.
The present invention helps the structure of gene target nucleic acid molecule or carrier, this molecule or carrier can be used for knocking out or suddenly change aim sequence or gene (or the sequence of change existence, for example mutant nucleotide sequence is converted into wild-type sequence), the external cause of disease in particularly gene or sequence in host or the host cell (as animal, plant, people, insect bacterium etc.), or these hosts or the host cell such as the sequence of virus.This gene target preferably can comprise the sequence on these host cell gene groups of target.This gene target can carry out in external or body.Therefore, one preferred aspect, the present invention relates to a kind of target or the method for suddenly change a kind of sequence or gene, comprising:
(a) obtain at least a nucleic acid molecule of the present invention, it comprises one or more recombination sites and/or one or more topoisomerase enzyme recognition site (preferably one or more selected markers), and wherein this molecule comprises one or more and target gene or aim sequence homologous sequence (one or more homologous sequences are preferably located in the flank of one or more selected markers on the molecule of the present invention); With
(b) cause under the condition of homologous recombination in the one or more site that are enough between target sequence or goal gene and molecule of the present invention, make this molecule contact one or more target genes or aim sequence, thereby make in all or part of insertion target sequence or gene of molecule of the present invention.
This targeted approach may cause disappearance, deactivation or the part deactivation of sequence or target gene, make the expression product (generally being protein or peptide) of this sequence normal expression not produce or produce with higher or lower level, perhaps contain the protein sequence that changes, can cause higher or lower activity, or produce the expression product of deactivation or part deactivation.Preferably be present in selected marker thing on the molecule of the present invention and help the material standed for (for example host cell) of selecting the homologous recombination incident to complete successfully.Therefore, the invention provides the method for a kind of production host cell, tissue, organ and animal (for example transgenic animal), wherein contain the modifying factor or the sequence of producing by targeted approach of the present invention.Modification sequence or gene preferably comprise at least one recombination site and/or at least a selected marker that produces by method of the present invention.
Therefore, more specifically, the present invention relates to a kind of target or the method for suddenly change a kind of sequence or gene, comprising:
(a) obtain at least a nucleic acid molecule of the present invention, its comprise one or more recombination sites, flank for at least a selected marker and randomly one or more topoisomerase enzyme recognition site of target gene or one or more sequences of aim sequence homologous;
(b) cause under the condition of homologous recombination in the one or more site that are enough between target sequence or goal gene and this molecule, make this molecule contact one or more target genes or aim sequence, thereby make in all or part of insertion (at least a selected marker and/or at least one recombination site are inserted) target sequence or gene of molecule of the present invention; With
(c) randomly select to comprise all or part of sequence or gene of molecule of the present invention, or select a kind of host cell, it contains all or part of this gene or the sequence that comprises molecule of the present invention.
In another aspect of this invention, the recombination site of introducing target sequence according to the present invention can be used for cutting or excise all or part of of the molecule that inserts in the target sequence.Therefore, the present invention allows these sequences of excision in external or body, thereby target gene or sequence are activated once more.In certain embodiments, identify with separates the sequence that contains the change of introducing as mentioned above after, can excise the selected marker that exists on the molecule of the present invention.
The present invention also provides in one or more carriers clone's initial or product nucleic acid molecule of the present invention or product molecule of the present invention is converted into the method for one or more carriers.On the one hand, the reorganization starting molecule is cloned in one or more carriers one or more product molecules and these product molecules (preferably by reorganization).On the other hand, starting molecule can directly be cloned in one or more carriers, makes a large amount of starting molecules connect in carrier, thereby produces a kind of carrier that contains product molecule of the present invention.On the other hand, starting molecule can directly be cloned in one or more carriers, makes starting molecule not connect (being that starting molecule suppressed by vector sequence separates) in carrier.On the other hand, the combination of product molecule and starting molecule can be cloned in one or more carriers with random order, thereby produces a kind of carrier, and it comprises the new product molecule that is produced by initial starting molecule and product molecular combinations.
Therefore, the present invention relates to a kind of cloning process, comprising:
(a) obtain at least a nucleic acid molecule of the present invention, it comprises one or more recombination sites and/or one or more topoisomerase enzyme recognition site; With
(b) all or part of of this molecule transferred in one or more carriers.The present invention also comprises by the carrier of these method preparations, the method that comprises the composition of these carriers and use these carriers.
These carriers comprise one or more recombination sites and/or one or more topoisomerase enzyme recognition site usually, and this molecule is preferably realized by reorganization between one or more sites on the carrier and the one or more sites on the molecule of the present invention to carrying intravital transfer.On the other hand, by comprising necessary carrier sequence (for example replication orgin), product molecule of the present invention can be converted into the molecule that can be used as carrier.Therefore,, utilize the starting molecule that contains these sequences, these carrier sequences can be mixed the product intramolecularly according to the present invention.These carrier sequences can make an addition to the position of one or more hope of product molecule, and this depends on the position of this sequence in starting molecule and the order of adding starting molecule in the product molecule.The product molecule that contains the carrier sequence can be linear forms, perhaps can pass through in the intramolecular recombination site reorganization of product, or carry out the ligation of topoisomerase mediation, is converted into annular or superhelix shape.The cyclisation of this product molecule is finished by the recombination site that reorganization is located on or near product molecule two ends usually.
The carrier sequence that the present invention uses can comprise one or more elements and/or function sequence and/or site (or its combination), comprise one or more order-checkings site or amplimer site, one or more multiple clone site, one or more selected markers (for example, virulent gene, antibiotics resistance gene, selected marker etc.), one or more transcribe or translate site or signal, one or more transcribing or the translation termination site, one or more topoisomerase enzyme recognition sites, one or more topoisomerases, one or more replication orgin, one or more recombination sites (or its part) etc.The carrier sequence that the present invention uses also can comprise terminator codon, and terminator codon can be suppressed, thereby makes the expressing fusion protein of hope described herein.Therefore, according to the present invention, can utilize the carrier sequence to import one or more elements, function sequence and/or site in any nucleic acid molecule of the present invention, these sequences can be used to further operation or analyze be cloned into these years of intravital any nucleic acid molecule.For example, the primer sites that has of carrier (be preferably located in to be cloned into and carry the segmental two ends of intravital insertion) allows order-checking or amplification to be cloned into all or part of that carries intravital product molecule.In addition, carrier is contained transcribes or regulates sequence and can make and be cloned into all or part of coded peptide, polypeptide or the protein expression that carries intravital product molecule.Equally, contained gene, Gene Partial or the sequence mark (as GUS, GST, GFP, His mark, epi-position mark etc.) of carrier allows generation to contain and is cloned into the gene fusion colony of carrying intravital product molecule, perhaps allows to produce by carrier contained sequence mark and a large amount of peptides, polypeptide or the fusion rotein of being cloned into the common coding of year intravital product sequence.These genes, Gene Partial or sequence mark can with the terminator codon combined utilization that randomly is suppressed, carry the gene that intravital insertion sequence and carrier provide or the fusion rotein of flag sequence coding to express controllably by being cloned into.In a kind of construct, carrier can comprise one or more recombination sites, one or more terminator codon and one or more flags sequence.In some embodiments, flag sequence can be adjacent with recombination site.In order in goal gene, to add flag sequence controllably, randomly, terminator codon can be mixed in flag sequence or the recombination site sequence.In this class embodiment, goal gene can insert in the carrier by recombinant clone, makes the encoding sequence of mark and goal gene in same reading frame.When terminator codon was not suppressed, in order to make the genetic expression that contains natural N end, goal gene can contain translation initiation signal, for example Shine-Delgarno sequence, Kozak sequence and/or IRES sequence.Goal gene also can contain a terminator codon at 3 ' end of encoding sequence.In certain embodiments, can contain a kind of flag sequence at the N of goal gene end and C end.Randomly, the flag sequence that is positioned at N end may contain a terminator codon, and goal gene may contain a terminator codon, and the mark that is positioned at the C end can contain a terminator codon.Terminator codon can be identical or different.In certain embodiments, the terminator codon of N end mark is different from the terminator codon of goal gene.In this class embodiment, can provide inhibition tRNA corresponding to one or both terminator codons.When containing two kinds of termination codon period of the day from 11 p.m. to 1 a.m, in identical carrier, different carriers or host cell gene group, may contain each independently and suppress tRNA.Suppressing tRNA does not need all to provide in an identical manner, and for example, a kind of can containing on the carrier of goal gene, another kind can be in the host cell gene group.Like this, the nucleic acid molecule of one aspect of the present invention can comprise an inhibition type terminator codon that separates two coding regions.According to the position of expression signal (for example promotor), the expression that suppresses tRNA causes the inhibition of terminator codon, thereby produces a kind of fusogenic peptide, for example holds a kind of fusogenic peptide that contains a kind of affinity labelling sequence at the N of marking protein end and/or C.Terminator codon need be do not suppressed, the expression that N holds and/or C holds the aim sequence of flag sequence can be realized not containing.Therefore, the present invention can effectively make up the carrier that contain goal gene or sequence (for example one or more open reading frame or " orfs ") by recombinating, and is used for as required expressed fusion protein controllably.Preferably, be cloned into one or more years intravital initial nucleic acid molecule of the present invention or the product molecule comprise at least a open reading frame (orf).This initial or product molecule also can comprise function sequence (for example primer sites, transcribe or translate site or signal, termination site (for example terminator codon that can randomly suppress), replication orgin etc.), preferably comprise the sequence that regulatory gene is expressed, comprise transcriptional regulatory sequences and as the sequence of internal ribosome entry site (IRES).Preferably, initial at least or one of product molecule and/or carrier comprise the sequence that can be used as promotor.This initial or product molecule and/or carrier also can comprise transcription termination sequence, selected marker, restriction enzyme enzyme recognition site etc.
In some embodiments, carrier comprises the identical selected marker of two copies, and the flank of each copy is recombination site and/or topoisomerase enzyme recognition site.In other embodiments, carrier comprises two kinds of different selected markers, and its flank is two recombination sites.In some embodiments, one or more selected markers can be negative selected markers.
In particular aspects, the invention provides a kind of cloning process, comprise and produce at least a first kind of nucleic acid molecule that comprises at least the first and second recombination sites, with at least a second kind of nucleic acid molecule that comprises at least the third and fourth recombination site, wherein first and second recombination sites can be with the 3rd or quadruple group site reorganization, carry out recombining reaction then, make two kinds of nucleic acid molecule be reassembled as one or more product nucleic acid molecule, and the product cloned nucleic acid molecule is arrived in one or more carriers.In these embodiments, recombination site is positioned at the flank of first kind and/or second kind nucleic acid molecule.And clone's step is finished to the intravital recombining reaction that carries that comprises one or more recombination sites by the product molecule usually.On the one hand, clone's step is included between the site of product nucleic acid molecule carries out recombining reaction, this product nucleic acid molecule in first time recombining reaction with contain and can not react with the carrier of the recombination site of unreacted site reorganization.
In certain embodiments, can utilize conventional coupling technology that recombination site and/or topoisomerase enzyme recognition site and molecules of interest are adhered to.For example, can synthesize the oligonucleotide that comprises recombination site and/or topoisomerase enzyme recognition site, make it to comprise one or more identical or different reactive funtion parts of possibility.Suitable reactive funtion part includes but not limited to: amino, epoxy group(ing), vinyl, thiol group etc.The synthetic of oligonucleotide that comprises one or more reactive funtion parts belongs to conventional in the art.After synthetic, the oligonucleotide that comprises one or more reactive funtion parts can be attached to one or more reactive groups that exist on molecules of interest or the compound.Oligonucleotide can directly adhere to by one or more reactive funtion parts and one or more reactive functional group reactions.In certain embodiments, can utilize a kind of suitable linking group to realize this adhering to, this linking group can with one or more reactive funtion parts reactions of existing on the oligonucleotide, and with molecules of interest on one or more reaction-ity group reactions of existing.In other embodiments, directly adhere to and adhere to and to adopt by linking group.It will be appreciated by those skilled in the art that the reactive funtion part on the oligonucleotide can be identical or different with the reactive funtion part on molecules of interest and/or the compound.Be suitable for oligonucleotide and molecules of interest link coupled reagent and the visible Hermanson of technology, " biological coupling technology ", Academic Press Inc., San Diego, CA, 1996.
The present invention also relates to be used to implement the composition of method of the present invention, comprise the test kit of these compositions and the composition that is used to implement method of the present invention that produces.
Composition of the present invention, method and test kit can and be implemented with the site-specific recombination system preparation of phage-λ.In addition, these compositions, method and test kit also can be used GATEWAY TMRecombinant clone system and/or TOPO The directed TOPO of cloning system and/or pENTR Cloning system preparation and enforcement, these systems can (Carlsbad California) obtains from Invitrogen Corporation.
In others, the invention provides the isolated nucleic acid molecule that comprises one or more (for example 1,2,3,4,5 etc.) recombination site and/or one or more (for example 1,2,3,4,5 etc.) topoisomerase enzyme recognition site.A kind of like this molecule of the present invention contains two or more recombination sites at a topoisomerase enzyme recognition site flank.The such molecule of another kind of the present invention contains two or more recombination sites and two and a plurality of topoisomerase enzyme recognition sites, and wherein each recombination site all can be positioned at the flank of a topoisomerase enzyme recognition site.The nucleic acid molecule of this aspect can be linear, cyclic according to the present invention, perhaps has any in multiple geometry and the structure, as spiral, superhelix etc.The recombination site that uses easily in the nucleic acid molecule aspect this according to the present invention includes but not limited to: mutant, variant and the derivative of att site (including but not limited to attB site, attP site, attL site, attR site etc.), lox site (including but not limited to loxP site, loxP511 site etc.), psi site, dif site, cer site, frt site and these recombination sites, they keep the ability of recombinating.The topoisomerase enzyme recognition site that uses easily in the nucleic acid molecule of the present invention aspect this is preferably by following enzyme identification and combination: I type topoisomerase ((includes but not limited to: the intestinal bacteria topoisomerase I as IA type topoisomerase, intestinal bacteria topoisomerase II I, the eucaryon topoisomerase II, the contrary gyrase of archeal, yeast topoisomerase II I, fruit bat topoisomerase II I, human topoisomerase III, the traE albumen of streptococcus pneumoniae topoisomerase II I and plasmid RP4) and IB type topoisomerase (include but not limited to: eukaryote nuclear I type topoisomerase and poxvirus are (as from vaccinia virus, rabbit fibroma virus, ORF virus, fowlpox virus, MCV separates with amsacta moorei entomopoxvirus or produces)) and II type topoisomerase (include but not limited to: bacteria gyrase, DNA of bacteria topoisomerase I V, eukaryotic DNA topoisomerase II (as calf thymus II type topoisomerase) and the phage-coded DNA topoisomerase of T even number).
The present invention also provides the carrier that comprises these isolated nucleic acid molecule (can be expression vector).The representative carrier of this aspect includes but not limited to according to the present invention: pcDNAGW-DT (sc), pENTR-DT (sc), pcDNA-DEST41, pENTR/D-TOPO, pENTR/SD/D-TOPO, pcDNA3.2/V5/GWD-TOPO and pcDNA6.2/V5/GWD-TOPO.The present invention also provides the host cell that comprises these isolated nucleic acid molecule of the present invention or carrier.
In related fields, the invention provides the in vitro method of cloning nucleic acid molecule.The method of this aspect can comprise one or more steps according to the present invention, comprising:
(a) obtain a kind of nucleic acid molecule to be cloned (can be linear molecule (can be flush end or be not) in certain embodiments,, can randomly comprise one or more genes or open reading frame) as the PCR product;
(b) nucleic acid molecule that will body outer clone mixes with a kind of carrier (can be a kind of expression vector), this carrier comprises at least one flank topoisomerase enzyme recognition site and at least one second recombination site at least one first recombination site, wherein first and second recombination sites can not be recombinated each other, and mix with at least a topoisomerase; With
(c) can make nucleic acid molecule to be cloned insert in the carrier this mixture of incubation under the condition between first and second topoisomerase enzyme recognition site, thereby be created in the first kind of product molecule that comprises this nucleic acid molecule between first and second recombination site.The present invention also comprises the nucleic acid molecule by method for preparing.
The method of this aspect can comprise another one or a plurality of step according to the present invention, comprise, for example: help first and the 3rd and second and quadruple group site between under the condition of recombinating, make first kind of product molecule contact at least a carrier, this carrier comprises at least one third and fourth recombination site that can not recombinate each other, thereby produces at least a second kind of product molecule.According to the present invention, first kind of producing by these methods and/or second kind of product molecule can be inserted in a kind of host cell.The carrier that the present invention uses this aspect can comprise at least a other nucleotide sequence, is selected from: selected marker, cloning site, restriction site, promotor, operon, replication orgin, gene or portion gene (being gene fragment or element).
Recombination site that uses in the method for this aspect of the present invention and topoisomerase enzyme recognition site include but not limited to that this paper other parts are described.In ad hoc approach, in the presence of at least a recombinant protein, second kind of product nucleic acid molecule combines with carrier, and this recombinant protein can be but be not limited to: Cre, Int, IHF, Xis, Fis, Hin, Gin, Cin, Tn3 resolvase, TndX, XerC or XerD.In these embodiments, recombinant protein is Cre, Int, Xis, IHF or Fis.
The present invention also provides the test kit that comprises these isolating nucleic acid molecule of the present invention, randomly can comprise one or more other compositions, it is selected from: one or more topoisomerases, one or more recombinant proteins, one or more carriers, one or more have polypeptide, one or more host cells of polymerase activity.
According to known in the art, according to following accompanying drawing of the present invention and description, and according to claims, those skilled in the art will understand other preferred embodiment of the present invention.
The accompanying drawing summary
Fig. 1 is a kind of synoptic diagram of basic recombinant clone reaction.
Fig. 2 utilizes the present invention by carrying out the synoptic diagram of two kinds of nucleic acid fragments of LR recombining reaction clone.
Fig. 3 utilizes the present invention to clone the synoptic diagram of two kinds of nucleic acid fragments, comprising: utilize LR reaction junction fragment, utilize the BP recombining reaction that junction fragment is inserted in the destination carrier then.
Fig. 4 utilizes the present invention to clone the synoptic diagram of two kinds of nucleic acid fragments, comprises and carries out the BP reaction, carries out the LR reaction then.
Fig. 5 is the synoptic diagram of two kinds of nucleic acid fragments that contains clone's attB site, its cloning process comprises: carry out the BP reaction first time, on a bar segment, produce an attL site, on another bar segment, produce an attR site, attached by these fragments of LR reaction bonded.In the modification of this method, P1, P2 and/or P3 can be oligonucleotide or linear nucleotide fragments.
Fig. 6 is the synoptic diagram that utilizes LR reaction two kinds of nucleic acid fragments of clone in two different loci of destination carrier.
Fig. 7 is the synoptic diagram that utilizes BP reaction two kinds of nucleic acid fragments of clone in two different loci of destination carrier.
Fig. 8 A and Fig. 8 B show that this sequence all contains an element at each end by the covalently bound double chain nucleotide sequence of method production of the present invention." PCR " is meant polymerase chain reaction; " TOPO " is meant topoisomerase; Topoisomerase is shown the circle that links to each other with sequence; " P1 " and " P2 " is meant the PCR primer.The topoisomerase enzyme recognition site is represented with black matrix.
Fig. 9 A-9C shows the end of PCR product, represents cytomegalovirus promoter element (" CMV "), green fluorescent protein element (" GFP ") and Trobest polyadenylation signal (" BGH ") element.Be used for the primer of PCR product of design of graphics 9A, 9B and 9C with " F " numeral (seeing Fig. 9 D).Shown one or two the terminal part that comprises topoisomerase enzyme recognition site (CCCTT).Outstanding sequence represented in black matrix.In Fig. 9 A and 9B, a kind of (Fig. 9 B) or two kinds (Fig. 9 A) outstanding sequence itself is a palindromic sequence.Sequence shows that with conventional direction the top chain is 5 '-3 ' direction from left to right, and end chain is 3 '-5 ' direction from left to right.On the sequence or under bracket in numeral SEQ ID NOs.
Figure 10 A and 10B show construct (Figure 10 A) and experimental result (Figure 10 B), and this experiment is used for detecting the double-stranded recombinant nucleic acid molecules that utilizes covalently bound coded polypeptide and carries out the ability that double cross is measured.Figure 10 A shows the amount of the every kind of construct that is used for transfection." p " expression plasmid form before the quantity of reactant or the volume, " l " expression is linear, " PCR " expression pcr amplification reaction mixture.Figure 10 B shows and every kind of betagalactosidase activity level (" LacZ activity ") that the transfection sample is relevant.The active expression positive that improves of LacZ interacts.
Figure 11 A-11F representative is used to produce the composition of the covalently bound double-stranded recombinant nucleic acid molecules of chain and the different embodiments of method.Note the otch in of molecule shown in Figure 11 B-11F or two chains.
Figure 12 A-12D shows the different embodiments of the compositions and methods of the invention be used to produce covalently bound double-stranded recombinant nucleic acid molecules.Topoisomerase is shown as filled circles, is connected with the substrate nucleic acid molecule is terminal, perhaps discharges after ligation.As shown in the figure, the substrate nucleic acid molecule contains 5 ' overhang, although they also can contain 3 ' overhang similarly or may be flush ends.In addition, shown in nucleic acid molecule show and to contain bonded topoisomerase (carrying topoisomerase) with it, show that contain with it one or more ends of bonded topoisomerase also can be expressed as and contain a topoisomerase enzyme recognition site, in this case, ligation also needs to add in due course one or more locus specificity topoisomerases.
Figure 12 A shows first kind of nucleic acid molecule, and it contains with the 5 ' end and 3 ' of an end holds the topoisomerase be connected, also shows being connected of first kind of nucleic acid molecule and second kind of nucleic acid molecule.
Figure 12 B shows first kind of nucleic acid molecule, it contains 3 ' end bonded topoisomerase with an end, with second kind of nucleic acid molecule, 3 ' the end bonded topoisomerase that it contains with an end further shows owing to contact the covalently bound double-stranded recombinant nucleic acid molecules that the end that contains the substrate nucleic acid molecule that carries topoisomerase produces.
Figure 12 C shows first kind of nucleic acid molecule, it contains 5 ' end bonded topoisomerase with an end, with second kind of nucleic acid molecule, 5 ' the end bonded topoisomerase that it contains with an end further shows owing to contact the covalently bound double-stranded recombinant nucleic acid molecules that the end that contains the substrate nucleic acid molecule that carries topoisomerase produces.
Figure 12 D shows a kind of nucleic acid molecule, and it contains the topoisomerase that is connected with 3 ' end with 5 ' end of two ends, further shows and carries the nucleic acid molecule of topoisomerase and be connected (one at an end) of two kinds of nucleic acid molecule.Be positioned at 5 ' hold and/or be positioned at 3 ' end topoisomerase can be identical or different.
Figure 13 shows the generation of the double-stranded recombinant nucleic acid molecules of expression type and the amplification of the double-stranded recombinant nucleic acid molecules of expression type.The double-stranded recombinant nucleic acid molecules of expression type is produced by three kinds of nucleic acid molecule, comprises the nucleotide sequence that contains promotor, contains the nucleotide sequence of encoding sequence and contains the nucleotide sequence of polyadenylation signal.Mix complementary 5 ' and/or 3 ' at the double chain nucleotide sequence end that will connect and give prominence to the generation that sequence helps nucleic acid molecule.The following generation of the double-stranded recombinant nucleic acid molecules of expression type: 5 ' end at first end contains IA type topoisomerase, contains first kind of second kind of nucleic acid molecule of nucleic acid molecule contact and the third double chain nucleotide sequence of IB type topoisomerase at 3 ' end of second end.The double-stranded recombinant nucleic acid molecules of this expression type is with first kind of primer and second kind of primer amplification, first kind of primer can be hybridized by double-stranded recombinant nucleic acid molecules with second kind of promotor upstream, and second kind of primer can be hybridized with the third double-stranded recombinant nucleic acid molecules in polyadenylation signal downstream.
Figure 14 shows an example of the method for preparing double chain acid molecule, and this molecule contains 5 ' end bonded topoisomerase (for example IA type topoisomerase) with molecule one end, and wherein the same end of this molecule also comprises 3 ' overhang (seeing this figure (4)).
Figure 15 shows two embodiments of the present invention, and wherein strand or double-stranded DNA nucleotide sequence are connected with the single stranded RNA nucleotide sequence.
Figure 16 is that proof is utilized TOPO-Gateway TMOr standard Gateway TMCloning process carries out the synoptic diagram of flexibility of PCR clone's inlet point.
Figure 17 utilizes Gateway TMSystem and directed TOPO-Gateway TMExpression vector is produced the synoptic diagram of cloning by expression.
Figure 18 is the collection of illustrative plates of multiple clone site among plasmid pcDNAGW-DT (sc) and the pENTR-DT (sc).
Figure 19 is the physical map of plasmid pcDNAGW-DT.
Figure 20 is the physical map of plasmid pcDNA-DEST41.
Figure 21 is the physical map of plasmid pENTR-DT.
Figure 22 shows the physical map (Figure 22 A) and the nucleotide sequence (Figure 22 B) of TOPO cloning site among the plasmid pENTR/D-TOPO.Physical map shows the carrier of the superhelix form of transforming, and nucleotide sequence shows the carrier that contains an initiator codon and open reading frame (atgnnnnnn...).Restriction site is mark in addition, shows actual restriction enzyme site.The Regional Representative that frame goes out enters the attL sequence among the clone, and it will be transferred in the destination carrier after reorganization.The sequence of pENTR/D-TOPO shown in Figure 22 B also can be downloaded from InvitrogenCorporation website http://www.invitrogen.com./content/vectors/pentr_dtopo_seq.txt.
Figure 23 shows the physical map (Figure 23 A) and the nucleotide sequence (Figure 23 B) of TOPO cloning site among the plasmid pENTR/SD/D-TOPO.Physical map shows the carrier of the superhelix form of transforming, and nucleotide sequence shows the carrier that contains an initiator codon and open reading frame (atgnnnnnn...).Restriction site is mark in addition, shows actual restriction enzyme site.The Regional Representative that frame goes out enters the attL sequence among the clone, and it will be transferred in the destination carrier after reorganization.The nucleotide sequence of pENTR/SD/D-TOPO shown in Figure 23 B also can be downloaded from Invitrogen Corporation website http://www.invitrogen.com./content/vectors/pentrsd_dtopo_seq.tx t.
Figure 24 shows plasmid pcDNA3.2/V5/GWD-TOPO Physical map (Figure 24 A) and nucleotide sequence (Figure 24 B-C).Physical map shows the carrier of the superhelix form of transforming, and nucleotide sequence shows the carrier that contains an initiator codon and open reading frame (atgnnnnnn...).
Figure 25 shows plasmid pcDNA6.2/V5/GWD-TOPO Physical map (Figure 25 A) and nucleotide sequence (Figure 25 B-C).Physical map shows the carrier of the superhelix form of transforming, and nucleotide sequence shows the carrier that contains an initiator codon and open reading frame (atgnnnnnn...).
Figure 26 shows that a kind of typical case of pENTR/SD-dTopo, pENTR-dTopo and pcDNAGW-dTopo transforms strategy.
Figure 27 is the photo of the Western engram analysis of the HLA that expresses in the COS cell and CAT.The gene of pcr amplification coding CAT (26kDa) and HLA (41kDa), Topo is cloned in the pENTR-dTopo, transfers to pcDNA-DEST40 interior (being respectively the 2nd road and the 5th road) or directly is cloned into pcDNAGW-dTopo interior (being respectively the 3rd road and the 6th road).These constructs are used for rotaring redyeing COS cell, and lysate utilizes the V5-HRP antibody coupling matter to detect the protein of reorganization V5 mark by the Western trace.The 1st road and the only celliferous contrast of the 4th road representative.
Figure 28 shows HLA and the CAT gel photograph at expression in escherichia coli.The gene of pcr amplification coding HLA (41kDa) and CAT (26kDa), Topo is cloned in the pENTR/SD-dTopo, transfers in the pET-DEST42 (being respectively the 3rd road and the 6th road), or directly is cloned in the pET101-dTopo (being respectively the 4th road and the 7th road).These constructs are used for transforming BL21 (DE3) cell, add IPTG to 1mM at 37 ℃ of following 3 hours abduction deliverings.Cell pyrolysis liquid is electrophoresis on NuPage, uses SafeStain TMDyeing.The representative of the 2nd road and the 5th road is from the not inductive cell pyrolysis liquid of separately pET-DEST42 nutrient solution.
Figure 29 is a kind of topoisomerase and the recognition site bonded synoptic diagram of holding near target nucleic acid molecule 3 '.Topoisomerase in conjunction with after, downstream sequence (restriction enzyme site 3 ') can separate, and keeps a kind of nucleic acid molecule, it contains and newly-generated 3 ' holds covalently bound topoisomerase.
Figure 30 shows the protein expression result (Western blot) of Mammals expression cassette, the following structure of this expression cassette: pcr amplification Expression element and goal gene (CAT or V5), then with or for the second time PCR carry out the TOPO ligation.The protein expression data are from the expression cassette of transfection suspension TRex-CHO cell (Figure 30 A), adhesion TRex-CHO cell (Figure 30 B) and adhesion TRex-293 cell (Figure 30 C).For Western blot, use anti--V5 or anti--CAT antibody in the detection.The arrow indication is the position corresponding to V5 or the proteic band of CAT.
Figure 31 is the photo of the sepharose that contains the PCR product of ethidium bromide staining, shows that the compatible expression cassette of Gateway contains the insertion fragment of expection size.The following structure of the expression cassette that Gateway is compatible: at first produce CAT and insert fragment, utilize the TOPO ligation to import attB1 and attB2 linker then by PCR.Utilize among the DNA product insertion pDONR 222 of BP reaction with purifying.Behind transformed into escherichia coli, bacterium colony is carried out PCR, and on the sepharose of ethidium bromide staining, check the PCR product.
Figure 32 is the synoptic diagram that the pENTR carrier of topoisomerase is carried in the explanation preparation, comprise making the pDONR carrier carry topoisomerase, and the method according to this invention is carried out the BxPGATEWAY cloning reaction.
Figure 33 is the synoptic diagram that the pEXP carrier of topoisomerase is carried in explanation preparation, comprise making the pDEST carrier carry topoisomerase, and the method according to this invention carries out the LxRGATEWAY cloning reaction, and the enzyme simple stage property end to the pEXP carrier adds the TOPO linker then.
Figure 34 shows the synoptic diagram of method of the present invention.The first step for example produces the nucleic acid molecule that will assemble by PCR.In second step, utilize method of the present invention (for example, comprising at least one chain and the another kind of nucleic acid fragment covalently bound method of topoisomerase of utilizing) to assemble the nucleic acid molecule of the first step with a kind of nucleic acid fragment.In the 3rd step, the nucleic acid molecule of the assembling that second step produced can directly use or use the back of can increasing.This paper other parts have been described the example of the purposes of assembling molecule.
Figure 35 shows a kind of synoptic diagram of method, and this method connects two kinds of nucleic acid fragments with topoisomerase, makes the nucleic acid fragment and the reorganization of another kind of nucleic acid fragment of connection then by the single-point reorganization.The first step is utilized the method for any topoisomerase mediation of connection nucleic acid molecule described herein, and the nucleic acid fragment that contains the attL1 recombination site of topoisomerase transformation is connected with another kind of nucleic acid fragment, is called insertion fragment (being labeled as " I ") at this.Allowing under the condition of recombinating between two recombination sites, then at LR CLONASE TMExistence under, the nucleic acid fragment contact of topoisomerase assembling contains the another kind of nucleic acid fragment of a promotor (being labeled as " P ") and an attR1 recombination site.Reorganization causes forming the nucleic acid molecule that contains the insertion nucleic acid fragment that effectively is connected with promotor.In addition, an attB1 recombination site is between the promotor and insertion fragment of end product.Recombination site shown in this figure is attL and attB site, but also can use any suitable recombination site.
Figure 36 shows the synoptic diagram utilize topoisomerase and recombination method reorganization and/or to be connected the method for 5 kinds of different IPs acid fragments and cyclisation product.The first step, utilize the method for any connection nucleic acid molecule of topoisomerase mediation described herein, the attL1 that contains of topoisomerase transformation is connected with another kind of nucleic acid fragment with the nucleic acid fragment of attL2 recombination site with negative selected marker (being labeled as " NM "), is called at this and inserts fragment (being labeled as " I ").Allowing under the condition of recombinating between a plurality of recombination sites, at LR CLONASE TM(under existence CA), the nucleic acid fragment of topoisomerase assembling contacts other two kinds of nucleic acid fragments then for InvitrogenCorporation, Carlsbad, and they all contain at least one attR recombination site.In some such methods, for example, the carrier that TOPO transforms and one or more nucleic acid fragments (for example one or more PCR products) descended the about 5-30 of incubation (preferably about 10) minute in room temperature (for example about 20-25 ℃); Then at about 20 minutes these reaction solutions of thermal treatment of about 80 ℃ of following incubations, use this reaction mixture according to working instructions (Invitrogen Corporation) in standard LR reaction then, difference is that the incubation time lengthening of LR reaction was by about 3 hours.Recombining reaction causes the formation of product molecule, and wherein promotor is connected in (1) and inserts molecule and (2) replication orgin (being labeled as " ori ").This product molecule is connected with a kind of nucleic acid fragment then, and the latter through the topoisomerase transformation, is contained a kind of positive selected marker (being labeled as " PM ") at two ends.In addition, last topoisomerase Connection Step causes forming the circular nucleic acid molecule.Recombination site shown in the figure is attL and attB site, but also can use any suitable recombination site.
Figure 37 shows that a kind of preparation is used to carry out the synoptic diagram of method of the nucleic acid molecule of homologous recombination.In this case, utilize the method that comprises the covalently bound various segmental nucleic acid chains in topoisomerase mediation ground, three kinds of nucleic acid fragments are connected to each other.Two kinds of two attL sites all containing a positive selective marker and be positioned at the negative selectable marker flank in these nucleic acid fragments.Therefore, the nucleic acid molecule that the first step produces contains a kind of nucleic acid fragment, is called as the insertion fragment herein.Insert segmental each end and contain two recombination sites that (1) positive selective marker and (2) are positioned at the negative selectable marker flank.There is down LR CLONASE at two kinds of nucleic acid fragments (contain the zone that has homology with chromosomal loci, wherein the designing nucleic acid end product is used for integrating (being labeled as " HR1 " and " HR2 ")) TMEnd product nucleic acid molecule shown in catalytic reorganization causes forming.It will be appreciated by those skilled in the art that and in the method shown in this figure, can use any suitable recombination site.
Figure 38 demonstration utilizes topoisomerase to connect 4 kinds of nucleic acid fragments, produces a kind of at the synoptic diagram that contains the linear nucleic acid molecule of recombination site (being labeled as " L1 " and " L2 ") near the end.After the nucleic acid chains of topoisomerase mediation connected, the tie point place did not have otch.In second step, allowing under the condition of recombinating between the recombination site, at LR CLONASE TMExistence under, the nucleic acid fragment of topoisomerase assembling contacts another kind of nucleic acid fragment, the latter is contained a replication orgin (being labeled as " ori "), a positive selective marker (being labeled as " PM "), an attR1 recombination site and an attR2 recombination site.Reorganization causes forming a kind of circular nucleic acid molecule as shown in the figure.Recombination site shown in this figure is attL and attB site, but also can use any suitable recombination site.
Figure 39 shows that utilizing topoisomerase and recombination site one to go on foot is connected the synoptic diagram that two kinds of nucleic acid fragments produce a kind of circular nucleic acid molecule.One of nucleic acid fragment contains an attL1 recombination site (being labeled as " L1 "), a promotor (being labeled as " P ") and the topoisomerase molecule covalently bound with an end.Another nucleic acid fragment contains an attR1 recombination site (being labeled as " R1 "), an open reading frame (being labeled as " ORF "), a replication orgin (being labeled as " ORI "), a positive selective marker (being labeled as " PM ") and the topoisomerase molecule covalently bound with an end.Therefore, when allowing under the condition that the nucleic acid chains of recombinating between attL and the attR recombination site and the nucleic acid chains topoisomerase mediates is connected, at LR CLONASE TMExistence under, these two kinds of nucleic acid fragments are connected to each other, and form a kind of ring molecule of structure shown in having.Recombination site shown in this figure is attL and attB site, but also can use any suitable recombination site.
Figure 40 shows that the two kinds of nucleic acid fragments of method connection that utilize the topoisomerase mediation produce a kind of synoptic diagram of circular nucleic acid molecule.This ring molecule contains an open reading frame (being labeled as " ORF ") between attL1 and attL2 recombination site (being labeled as " L1 " and " L2 ").The product of topoisomerase assembling is recombinated with the another kind of ring molecule that contains attR1 and attR2 recombination site then, produces the third circular nucleic acid molecule, and it contains open reading frame between attB1 and attB2 recombination site.In addition, open reading frame also can effectively be connected with promotor.Recombination site shown in this figure is attL and attB site, but also can use any suitable recombination site.
Detailed Description Of The Invention
Definition
In the following description, be widely used in a large amount of terms of using in the recombinant nucleic acid technology.In order to know and more as one man to understand this specification sheets and claims, comprise the scope of these term definitions, provide following definition.
Gene: as used herein, gene is a kind of nucleotide sequence, and it contains the required information of polypeptide, protein or function RNA (for example ribozyme, tRNA, rRNA, mRNA etc.) expression.It comprises promotor and structure gene open reading frame sequence (orf) and other sequence relevant with protein expression.
Structure gene: as used herein, structure gene is meant a kind of nucleotide sequence, and it can be transcribed into messenger RNA(mRNA), is translated as the peculiar aminoacid sequence of specific polypeptide then.
The host, as used herein, the host is any protokaryon or eukaryote, it is the acceptor of rf expression vector, cloning vector or any nucleic acid molecule.Nucleic acid molecule can contain, still be not limited to: structure gene, transcriptional regulatory sequences (as promotor, enhanser, repressor etc.) and/or replication orgin.Term " host ", " host cell ", " recombinant host " and " recombinant host cell " can exchange use as used herein.About these hosts' example, see people such as Maniatis, " molecular cloning: laboratory manual ", Cold Spring Harbor Laboratory, ColdSpring Harbor, New York (1982).
Transcriptional regulatory sequences: as used herein, transcriptional regulatory sequences is a kind of functional nucleotide fragment contained on the nucleic acid molecule, and it can be any configuration or geometrical shape, is used for regulating one or more structure genes and is transcribed into messenger RNA(mRNA).The example of transcriptional regulatory sequences includes but not limited to: promotor, operator gene, enhanser, repressor etc.Transcriptional regulatory sequences also can be regulated the transcribing of nucleic acid molecule of encoding function RNA (for example ribozyme, tRNA, rRNA, mRNA etc.).
Promotor: as used herein, promotor is an example of transcriptional regulatory sequences, particularly is the nucleotide sequence that is described as being positioned at the gene 5 ' district of initiator codon near-end usually.Transcribing at the place, promoter region of adjacent nucleic acid fragment starts.Inhibitor reduces the transcription rate of inhibition type promotor.Inductor improves the transcription rate of inducible promoter.The transcription rate of constitutive promoter is not by specific regulating, though it may change under common metabolism condition effect.
Insert fragment: as used herein, inserting fragment is the nucleic acid fragment of wishing, it is the part of larger nucleic acid molecule.
Target nucleic acid molecule: as used herein, target nucleic acid molecule is a kind of purpose nucleic acid fragment, the nucleic acid of Compounds and methods for effect preferably of the present invention.These target nucleic acid molecules preferably contain one or more genes or Gene Partial.
Insert donor: as used herein, inserting donor is to carry to insert one of segmental two kinds of parental generation nucleic acid molecule of the present invention (for example RNA or DNA).Insert donor molecule and comprise the insertion fragment that two ends are recombination site.Inserting donor can be linearity or cyclic.In one embodiment of the invention, inserting donor is a kind of circular nucleic acid molecule, randomly is supercoiled, also comprises recombination signal cloning vector sequence (see figure 1) in addition.When utilizing a group to insert fragment or a group nucleic acid fragment preparation insertion donor, produce a group and insert donor, and can be used according to the invention.
Product: as used herein, product is the sub-molecule of wishing, it is included in A and the D sequence (see figure 1) that produces after the recombination event in the second time in the recombinant clone process.Product contains and remains to be cloned or the nucleic acid of subclone.According to the present invention, when using a group to insert donor, all or part of of the insertion fragment colony that inserts donor will be contained in the product molecule colony of generation, preferably contain the typical initial molecule of a group of inserting donor.
Recognition sequence: as used herein, recognition sequence (in addition, and considerably, be also referred to as " recognition site " at this) be a kind of specific sequence, protein, chemical compound, DNA or RNA molecule (for example restriction endonuclease, topoisomerase, modification methylase or recombinase) can be discerned and combination with it.In the present invention, recognition sequence typically refers to recombination site (also can be described as the recombinase recognition site in addition) or topoisomerase enzyme recognition site.For example, the recognition sequence of Cre recombinase is loxP, and it is a kind of sequence of 34 base pairs, is made up of the inverted repeats (as the recombinase binding site) of two 13 base pairs that are positioned at 8 base pair core sequence flanks.Referring to Sauer, B., Fig. 1 of Current Opinion in Biotechnology 5:521-527 (1994).Other example of this class recognition sequence has can be by attB, attP, attL and the attR sequence of recombinase (intergrase) identification.AttB is a kind of sequence of about 25 base pairs, contains the overlap of the core type Int binding site and 7 base pairs of two 9 base pairs.AttP is a kind of sequence of about 240 base pairs, contains core type Int binding site and arm type Int binding site, and accessory protein integration host factor (IHF), FIS and excisionase (Xis) site.Referring to Landy, Current Opinion in Biotechnology 3:699-707 (1993).These sites also can the transformation according to the present invention, to improve the product output of method of the present invention.When these engineering sites lack P1 or H1 territory and when making recombining reaction irreversible (for example attR or attP), these sites can be called as attR ' or attP ', represent that the structural domain in these sites is modified in some way.The example of topoisomerase enzyme recognition site includes but not limited to: sequence 5 '-GCAACTT-3 ', can be discerned by intestinal bacteria topoisomerase II I (I type topoisomerase); The CCTT-3 ' of sequence 5 '-(C/T), be a kind of can be by the topoisomerase enzyme recognition site of most of poxvirus topoisomerases (comprising vaccinia virus DNA topoisomerase I) specific combination; And as described, well known in the art other sequence of this paper other parts.
Recombinant protein: as used herein, recombinant protein comprises that excision or protein, enzyme, cofactor or the participation integrated relate to the related protein of the recombining reaction of one or more recombination sites, they can be that wild-type protein is (referring to Landy, or its mutant, derivative (for example containing recombinant protein sequence or its segmental fusion rotein), fragment and variant Current Opinion inBiotechnology 3:699-707 (1993)).
Recombination site: as used herein, recombination site is a kind of recognition sequence that participates on the nucleic acid molecule of integration/recombining reaction that recombinant protein causes.Recombination site is discontinuous kernel acid moieties or the fragment on the related nucleic acid molecule, can be by site-specific recombinant protein identification and combination in the initial period of integrating or recombinating.For example, the recombination site of Cre recombinase is loxP, and it is the sequence of 34 base pairs, is made up of the inverted repeats (as the recombinase binding site) of two 13 base pairs that are positioned at 8 base pair core sequence flanks.Referring to Sauer, B., Fig. 1 of CurrentOpinion in Biotechnology 5:521-527 (1994).Other example of recognition sequence comprises attB described herein, attP, attL and attR sequence, and mutant, fragment, variant and derivative, they can be by recombinant protein (Int) and accessory protein integration host factor (IHF), FIS and excisionase (Xis) identification.Referring to Landy, Current Opinion inBiotechnology 3:699-707 (1993).
Recombinant clone: as used herein, recombinant clone is a kind of method, as U.S. Patent number 5,888,732,6,143,557,6,171,861,6,270,969 and 6,277,608 described (its content is quoted as a reference fully at this), also as described here, the colony of the fragment of nucleic acid molecule or these molecules exchanges in external or body, inserts, replaces, replaces or modifies thus.Preferably, this cloning process is a kind of in vitro method.
Suppress box: as used herein, suppressing box is a kind of nucleic acid fragment, and it contains selected marker contained in suppressor gene or the subcloning vector.
Selected marker: as used herein, selected marker is a kind of nucleic acid fragment, and it can make people select a kind of molecule (for example replicon) usually under given conditions or contain its cell.These marks a kind of activity of may encoding for example, but is not limited to: RNA, peptide or proteinic generation perhaps can provide binding site for RNA, peptide, protein, inorganic and organic compound or composition etc.The example of selected marker includes but not limited to: (1) coding provides the nucleic acid fragment of the product of toxic compounds (for example microbiotic) resistance; (2) be coded in the nucleic acid fragment of the product (for example tRNA gene, auxotrophy mark) that lacks in the recipient cell; (3) but the nucleic acid fragment of the product of coding suppressor gene its lytic activity; (4) nucleic acid fragment of the coding product (for example phenotypic markers thing, as beta-galactosidase enzymes, green fluorescent protein (GFP) and cell surface protein) that is easy to identify; (5) can be in conjunction with the nucleic acid fragment of the product that is unfavorable for cell survival and/or function; (6) can suppress the active nucleic acid fragment of described any nucleic acid fragment of above 1-5; (7) can be in conjunction with the nucleic acid fragment of the product that can modify a kind of substrate (for example restriction endonuclease); (8) can be used for separating or identify the nucleic acid fragment of the molecule (for example specific protein binding site) of wishing; (9) a kind of nucleic acid fragment that may not have the specific nucleotide sequence of the function pcr amplification of molecule subgroup (for example for) of coding; (10) nucleic acid fragment when lacking, provides resistance or susceptibility to specific compound directly or indirectly; And/or (11) are coded in the nucleic acid fragment of deleterious product in the recipient cell.
Screening scheme: as used herein, screening scheme is any method that allows the product of screening from contain the mixture that enters clone or carrier, destination carrier, donor carrier, cloning by expression or carrier, any intermediate (for example being total to intasome and replicon) and/or by product, enrichment or evaluation hope.The screening scheme of a preferred embodiment is included in the recombinant clone process and connects or unconnected at least two kinds of compositions.A kind of composition is a selected marker.Another kind of Composition Control selected marker is in external or intravital expression, or the survival of carrying the cell (or nucleic acid molecule, for example replicon) of the plasmid that contains selected marker.Generally speaking, this controlling elements is the repressor or the inductor of selected marker, but also can use the control selected marker to express or active other method.Be to use and prevent system or activator to depend on that mark is used for just selecting or being used for the definite arrangement of negative selection and different IPs acid fragment, those skilled in the art are known.In some preferred embodiments, screening scheme causes the product of only selection or one or more hope of enrichment.As definition herein, the selection of nucleic acid molecule comprises: (a) select or enrichment exist the nucleic acid molecule of wishing and (b) do not select or enrichment to exist be not the nucleic acid molecule of the nucleic acid molecule of wishing.
In one embodiment, screening scheme (can carry out conversely) will adopt one of three kinds of forms, will illustrate with Fig. 1.Herein with the explanation of selected marker and repressor, first selects to contain fragment D and the molecule that lacks fragment C.Second does not select to contain the molecule of fragment C and the molecule of selecting to contain fragment D.The possible embodiment of second kind of form comprises a kind of nucleic acid fragment that carries a kind of gene, and the cell that this gene pairs will import the vitro reactions product is poisonous.Virulent gene can be the nucleic acid that is expressed as virulent gene product (toxic protein or RNA), perhaps may itself have toxicity.(in the later case, virulent gene can be regarded as and comprises classical definition " inherited character ").
The example of this class virulent gene product is well-known in this area, include but not limited to: restriction endonuclease (for example DpnI), apoptosis-related genes (for example member of ASK1 or bcl-2/ced-9 family), reverse transcription virus gene, comprise human immunodeficiency virus (HIV) gene, defensin, as NP-1, inverted repeats or pairing palindrome nucleotide sequence, phage splitting gene, as from φ X174 or phage T4; The antibiotics sensitivity gene, as rpsL, antimicrobial sensitivity genes, kill and wound the eukaryote transcription vector gene of gene, generation bacterium toxicity gene product as pheS, plasmid, as GATA-1, with at the gene that does not have to kill and wound under the situation of inhibit feature the host, for example kicB, ccdB, φ X174E (Liu, people such as Q, Curr.Biol.8:1300-1309 (1998)) with to replicon stability and/or duplicate other gene of negative impact.In addition, virulent gene also can be in external selection, for example, and a kind of restriction site.
The several genes of the coding restriction endonuclease that effectively is connected with inducible promoter is well-known, can use in the present invention.Referring to, for example U.S. Patent number 4,960,707 (DpnI and DpnII); 5,000,333,5,082,784 and 5,192,675 (KpnI); 5,147,800 (NgoAIII and NgoAI); 5,179,015 (FspI and HaeIII); 5,200,333 (HaeII and TaqI); 5,248,605 (HpaII); 5,312,746 (ClaI); 5,231,021 and 5,304,480 (XhoI and XhoII); 5,334,526 (AluI); 5,470,740 (NsiI); 5,534,428 (SstI/SacI); 5,202,248 (NcoI); 5,139,942 (NdeI); 5,098,839 (PacI).Referring to Wilson, G.G., Nucl.Acids Res.19:2539-2566 (1991); And Lunnen, people such as K.D., Gene 74:25-32 (1988).
Second kind of form, fragment D carries a kind of selected marker.Virulent gene can be removed the transformant that has the carrier donor, is total to intasome and by product molecule, and selected marker can be used for selecting to contain the cell of product and not select only to contain the cell that inserts donor.
The third form is chosen in the cell that contains Segment A and D with cis on a part, but is not chosen in trans this two kinds of segmental cells that contain on the differing molecular.For example a kind of selected marker, it is split into the fragment of two kinds of non-activities, respectively on Segment A and D.
These fragments make that with respect to the arrangement of recombination site they constitute a kind of functionally selected property mark when these fragments gather together by recombination event.For example, recombination event can connect a kind of promotor and a kind of structure nucleic acid molecule (for example a kind of gene), can syndeton two kinds of fragments of nucleic acid molecule, perhaps can connect the nucleic acid molecule of the required different dimerization gene product of coding survival, perhaps can connect a kind of part of replicon.
Site-specific recombinase: as used herein, site-specific recombinase is a class recombinase, and generally have following at least 4 kinds of activity (or its combination): (1) discerns one or both specific nucleic acid sequences; (2) cut this sequence; (3) with the relevant topoisomerase enzymic activity of chain exchange; (4) the ligase enzyme activity that the nucleic acid chains of cutting is sealed again.Referring to Sauer, B., Current Opinions in Biotechnology 5:521-527 (1994).The different high degree of specificity that are two kinds of mating partners of the reorganization of conservative property locus specificity and homologous recombination and swivel base.The chain exchanging mechanism is included in and does not take place under the DNA synthetic situation, the cutting of specific nucleic acid sequence be connected (Landy, A. (1989) Ann.Rev.Biochem.58:913-949) again.
Carrier: as used herein, carrier is a kind ofly to provide the biology of usefulness or the nucleic acid molecule of biochemical property (preferably DNA) for inserting fragment.Example comprises: plasmid, phage, autonomously replicating sequence (ARS), kinetochore and can duplicate or in other sequence external or that duplicate, maybe the nucleic acid fragment of hope can be transported to the sequence of the position of wishing in the host cell in host cell.Carrier can contain one or more restriction endonuclease recognition sites, can cut with a kind of mode enzyme of measuring in this site sequence, and do not lose the basic biological function of carrier, and in order to duplicate and to clone, a kind of nucleic acid fragment can be gone in this site in montage.Carrier can also provide primer sites, for example is used for PCR, transcribes and/or translation initiation and/or regulatory site, recombination signal, replicon, selected marker etc.Obviously, for a kind of fragment cloning is gone in the cloning vector used according to the invention, the method of the nucleic acid fragment that the insertion that can use does not need to use reorganization, swivel base or Restriction Enzyme is yet wished (for example, but be not limited to: the segmental UDG clone of PCR (U.S. Patent number 5,334,575, this complete quoting as a reference), the TA clone PCR clone (Invitrogen Corporation, Carlsbad CA) (are also referred to as direct connection clone) etc.).Cloning vector can also contain one or more selected markers that is suitable for identifying the cloning vector cell transformed.
Subcloning vector: as used herein, subcloning vector is a kind of cloning vector, comprises a kind of ring-type or linear nucleic acid molecule, and this molecule preferably comprises a kind of suitable replicon.In the present invention, subcloning vector (the fragment D among Fig. 1) also can contain function and/or regulatory element, wishes these elements are mixed in the end product, to act on or to contain clone's nucleic acid insertion fragment (Segment A among Fig. 1).Subcloning vector also can contain a kind of selected marker (preferably DNA).
The carrier donor: as used herein, the carrier donor is one of two kinds of parental nucleic acid molecules of the present invention (for example RNA or DNA), and it carries and comprises and will become the nucleic acid fragment of nucleic acid carrier of a part of the product of hope.The carrier donor comprises subcloning vector D (perhaps, do not contained cloning vector if insert the fragment donor, it also can be called as cloning vector) and flank is the fragment C (see figure 1) of recombination site.Fragment C and/or D can contain the element that helps selecting the sub-molecule of product of wishing, and be as above described for screening scheme.Recombination signal can be identical or different, can be subjected to the effect of identical or different recombinase.In addition, the carrier donor also can be linearity or cyclic.
Primer: as used herein, primer is a kind of strand or double chain oligonucleotide, and the covalent bonding by nucleotide monomer in the amplification of a kind of nucleic acid molecule (for example a kind of dna molecular) or polymerization process extends.On the one hand, primer can be sequencing primer (for example, a universal sequencing primer thing).On the other hand, primer can comprise recombination site or its part.
Template: as used herein, template is a kind of two strands or single stranded nucleic acid molecule that will increase, synthesize or check order.For double chain DNA molecule, preferably before these molecular clonings, synthetic or order-checking, carry out the chain sex change and form first chain and second chain, perhaps duplex molecule can be directly as template.For single-stranded template, hybridize under proper condition with at least a portion complementary primer of template, one or more polypeptide (for example archaeal dna polymerase and/or reversed transcriptive enzyme) with polymerase activity can synthesize a kind of molecule of all or part of complementary with template then.In addition, for double-stranded template, one or more transcriptional regulatory sequences (for example one or more promotors) can with one or more polysaccharase combined utilization, produce all or part of complementary nucleic acid molecule with template.New synthetic molecule can be identical with primary template length or shorter according to the present invention.Mispairing in the synthetic or extension process of new synthetic molecules mix or the chain slippage can to produce one or more base mismatch right.Therefore, the synthetic molecule does not need and the template strictly complementary.In addition, also can use a group nucleic acid-templated in synthetic or amplification procedure, producing generally is a group nucleic acid molecule of primary template colony.
Mix: as used herein, the meaning of mixing is a part that becomes nucleic acid (for example DNA) molecule or primer.
The library: as used herein, the library is the set of nucleic acid molecule (ring-type or linearity).In one embodiment, the library can comprise multiple (being two or more) nucleic acid molecule, their may or may not come from biology, organ, tissue or the cell in common source.In another embodiment, a kind of all or part of or integral part (" genome " library) of nucleic acid content of biology represented in the library, or one group of nucleic acid molecule (cDNA library or deutero-fragment) of all or part of or integral part of the representative nucleic acid molecule of expressing in cell, tissue, organ or biology.The library also can comprise the stochastic sequence of preparations such as de novo synthesis by one or more sequences, mutagenesis.These libraries may or may not be contained in one or more carriers.
Amplification: as used herein, amplification is to utilize one or more polypeptide with polymerase activity (for example one or more nucleic acid polymerases or one or more reversed transcriptive enzymes) to improve any in vitro method of nucleotide sequence copy numbers.Nucleic acid amplification mixes in DNA and/or RNA molecule or the primer Nucleotide, thereby forms and a kind of new nucleic acid molecule of template complementary.Nucleic acid molecule that forms and template thereof can be as the templates of synthetic other nucleic acid molecule.As used herein, an amplified reaction can be made up of many wheels nucleic acid replication.Dna amplification reaction comprises, for example, and polymerase chain reaction (PCR).A PCR reaction can be by sex change of 5-100 round-robin dna molecular and synthetic the composition.
Nucleotide: as used herein, Nucleotide is the combination of base-sugar-phosphoric acid.Nucleotide is the monomer unit of nucleic acid molecule (DNA and RNA).Term Nucleotide comprises ribonucleotide triphosphate ATP, UTP, CTP, GTP and deoxyribonucleoside triphosphate such as dATP, dCTP, dITP, dUTP, dGTP, dTTP or derivatives thereof.These derivatives comprise, for example: [(S] dATP, 7-denitrogenation-dGTP and 7-denitrogenation-dATP.Term Nucleotide also refers to bi-deoxyribose ribonucleoside triphosphote (ddNTPs) and derivative thereof as used herein.The illustrative example of bi-deoxyribose ribonucleoside triphosphote includes but not limited to: ddATP, ddCTP, ddGTP and ddTTP.According to the present invention, " Nucleotide " is mark or can detect ground mark with well-known technology not.But the mark marker comprises, for example: radio isotope, fluorescent marker, chemiluminescent labels, bioluminescence marker thing and enzyme labelling thing.
Nucleic acid molecule: as used herein, nucleic acid molecule is the adjacent nucleotide sequence (riboNTPs, dNTPs or ddNTPs, or its combination) of random length, and the fragment of its codified full-length polypeptide or its random length perhaps can be non-coding.Term " nucleic acid molecule " and " polynucleotide " can exchange use as used herein.
Oligonucleotide: as used herein, oligonucleotide is a kind of synthetic or natural molecule, comprises covalently bound nucleotide sequence, is connected by a phosphodiester bond between the 5 ' position of 3 ' position of the pentose of a Nucleotide and the pentose of adjacent nucleotide.
Polypeptide: as used herein, polypeptide is the adjacent amino acid sequence of random length.Term " peptide ", " oligopeptides " or " protein " can exchange with term " polypeptide " and use as used herein.
Hybridization: term hybridization is meant the base pairing of two kinds of complementary single stranded nucleic acid molecules (RNA and/or DNA) as used herein, produces a kind of duplex molecule.As used herein, even the base pairing of two kinds of nucleic acid molecule is not exclusively complementary, also can hybridize.Therefore, as long as use felicity condition well-known in the art, mismatched bases can not stop the hybridization of two kinds of nucleic acid molecule.In some aspects, can be in " stringent condition " hybridization down." stringent condition " is meant that 42 ℃ are incubated overnight in comprising the solution of following ingredients as used herein: 50% methane amide, 5 * SSC (150mM NaCl, the 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5 * Denhardt ' s solution, 10% T 500 and 20mg/ml sex change shear salmon sperm DNA, washs filter paper with 0.1 * SSC down at about 65 ℃ subsequently.
As used herein, at other term of recombinant nucleic acid technology and molecule and the use of cytobiology field, those skilled in the art should be known.
General introduction
The present invention relates to be used for method, composition and the test kit of reorganization and/or topoisomerase mediation ground two or more nucleic acid fragments of connection or molecule or other molecule and/or compound (or its combination).The present invention also relates to preferably the nucleic acid of these connections or other molecule and/or compound to be connected with one or more carriers or structure by recombination site (can comprise recombinant protein recognition sequence, topoisomerase enzyme recognition sequence etc.) or its part.Therefore, the present invention relates generally to connect multiple nucleic acid or other molecule and/or compound by the amino acid joint that comprises one or more topoisomerase enzyme recognition sites and/or one or more recombination site or its part.According to starting materials, the connection product that the present invention produces can comprise multiple identical or different nucleic acid or other molecule and/or compound.These starting materialss include but not limited to: any nucleic acid (or derivatives thereof is as peptide nucleic acid(PNA) (PNAs)), chemical compound, detectable label molecule (as fluorescence molecule and chemiluminescent molecule), medicine, peptide or protein, lipid, carbohydrate and other molecule and/or the compound that comprise one or more recombination sites or its part.By the reorganization of these recombination sites and/or the ligation that mediates according to topoisomerase of the present invention, these initial molecules and/or the compound of any amount or any combination can connect, and form connection product of the present invention.In addition, the disappearance of some part of connection product of the present invention or composition or displacement also can realize by reorganization.
In some embodiments, for example by the method for attachment of recombinant clone method of the present invention and/or topoisomerase mediation, the fragment of connection can be inserted in different IPs acid molecule such as the carrier.Therefore, in some embodiments, the present invention relates to the structure of nucleic acid molecule (RNA or DNA), method comprises: the ligation by the mediation of recombining reaction and/or topoisomerase is in conjunction with two or more nucleic acid fragments, and inserts in a kind of carrier by two or more fragments that recombinant clone will connect.The nucleic acid molecule that connects will by recombining reaction and another kind of nucleic acid molecule further combined with embodiment in, the selection of time of twice recombination event (being that segmental connection and fragment are to a year intravital insertion) is unimportant.That is to say, for the present invention, two or more nucleic acid fragments are to link together before inserting carrier, still for example a recombination site on each fragment at first with carrier on the recombination site reaction, recombination site on the nucleic acid fragment reacts each other and connects these fragments then, and these are unimportant.And nucleic acid fragment can be cloned into and be carried intravital any one or a plurality of position, and does not need to insert adjacent to each other, though in some embodiments, it is preferred carrying intravital two or more segmental connections.According to the present invention, recombinant clone allows to select effectively and evaluation contains the segmental molecule of bind nucleic acid (particularly carrier).Therefore, two or more purpose nucleic acid fragments can in conjunction with, and randomly insert and be suitable for further operating in a kind of carrier of bind nucleic acid molecule.
In other embodiments, all comprise at least one recombination site such as (for example 1,2,3,4,5,6,7,8) and randomly comprise at least two kinds of at least one topoisomerase enzyme recognition site such as (for example 1,2,3,4,5,6,7,8) nucleic acid fragments such as (for example 2,3,4,5,6,7,8 kind), contact with suitable recombinant protein and/or topoisomerase, to realize all or part of connection of two kinds of molecules, this depends on the position of intramolecularly recombination site.In some such embodiments,, be arranged in the flank of each end of molecule topoisomerase enzyme recognition site at least one of in two recombination sites as in comprising the nucleic acid molecule of at least two recombination sites.The recombination site (or topoisomerase enzyme recognition site) that is positioned at another recognition site (for example another recombination site or topoisomerase enzyme recognition site) " flank " is meant, two sites are each other in about 20 Nucleotide, perhaps each other in about 20,19,18,17,16,15,14,13,12,11,10,9,8,7,6,5,4,3,2,1,0 Nucleotide.Every kind of nucleic acid fragment can comprise multiple sequence, include but not limited to: (for example be suitable for as the sequence of primer sites, primer such as sequencing primer or amplimer can be hybridized, thereby initial nucleic acid is synthetic, the sequence of amplification or order-checking), transcribe or translation signals or adjusting sequence, as promotor, ribosome bind site, Kozak sequence and initiator codon, termination signal, as terminator codon, replication orgin, recombination site (or its part), topoisomerase enzyme recognition site (or its part), selected marker, with gene that produces fusion rotein or Gene Partial (for example N end or carboxyl terminal), as GST, GUS, GFP, 6 Histidines, epi-position haptens etc., and combination.Be used to clone these segmental carriers and also can comprise these function sequences (for example promotor, primer sites etc.).After the fragment combination that comprises these sequences, be preferably in after these sequence clones go in one or more carriers, can operate these molecules with several different methods, comprise the order-checking of target sequence or amplification (promptly, at least one primer sites that use is introduced by integration sequence), the sudden change of target sequence (promptly, within the target sequence or on insertion, disappearance or displacement) with by target sequence or its part marking protein (that is, the contained translation of fragment and/or carrier and/or transcribe the expression of signal).
The present invention also relates to utilize disclosed recombinant clone method to produce combinatorial library.Therefore, one or more nucleic acid fragments of connection can comprise a kind of nucleic acid library.This library can comprise, for example, and corresponding to the nucleotide sequence of series arrangement of coding a kind of peptide, polypeptide or protein sequence.This arrangement can be connected with the another kind of nucleic acid fragment of being made up of a kind of sequence, perhaps, second kind of nucleic acid fragment also can be the library corresponding to the arrangement of another kind of peptide, polypeptide or protein sequence, make two kinds of segmental connections can produce a kind of library, it represents all possible combination of all arrangements of two kinds of peptides, polypeptide or protein sequences.A large amount of examples of the purposes of combinatorial library known in this field.Referring to, for example, people such as Waterhouse, Nucleic Acids Research, 1993, Vol.21, No.9,2265-2266, people such as Tsurushita, Gene, 1996, Vol.172 No.1,59-63, Persson, Int Rev Immunol 1993 10:2-3 153-63, people such as Chanock, Infect Agents Dis 1993 Jun 2:3 118-31, people such as Burioni, Res Virol 1997Mar-Apr 148:2 161-4, Leung, Thromb Haemost 1995 Jul 74:1 373-6, Sandhu, Crit Rev Biotechnol 1992 12:5-6 437-62 and United States Patent (USP) 5,733,743,5,871,907 and 5,858,657, all be incorporated herein by reference.
Recombination site
Being used for recombination site of the present invention and can being can be as any nucleotide sequence of the substrate of recombining reaction.These recombination sites can be the recombination sites of wild-type or naturally occurring recombination site or modification or sudden change.The example that is used for recombination site of the present invention includes but not limited to: phage recombination site (as attP, attB, attL and attR and mutant or derivative) and from the recombination site (comprising the lox site, as loxP and loxP511) of other phage such as phi80, P22, P2,186, P4 and P1.There is description in new sudden change att site (for example attB 1-10, attP 1-10, attR 1-10 and attL 1-10) in the patent application series number of submitting on May 28th, 1,999 60/136,744, be incorporated herein by reference.Have unique specificity other recombination site (promptly first kind of site can site corresponding with it reorganization, and not with have the reorganization of not homospecific second kind of site) those skilled in the art are known, and can be used for implementing the present invention.
The corresponding recombinant protein that is used for these systems can be used according to the invention, and they contain specified recombination site.Provide other system that can be used for recombination site of the present invention and recombinant protein to comprise FLP/FRT system, resolvase family (for example Tn3 resolvase, Hin, Gin and Cin) and IS231 from yeast saccharomyces cerevisiae and other Bacillus thuringiensis transposable element.Be applicable to that other recombination system of the present invention comprises psi, dif and the cer recombination site in XerC and XerD recombinase and the intestinal bacteria.Other suitable recombination site is found in the U.S. Patent number 5,851,808 that Elledge and Liu are given in promulgation, is incorporated herein by reference.Be used for preferred recombinant protein of the present invention and mutant or modify recombination site comprising U.S. Patent number 5,888,732,6,171,861,6,143,557,6,270,969 and 6,277,608 is described and total, common unsettled U.S. Patent number 09/438,358 (11/12/99 submits to), 09/517,466 (03/02/00 submits to), 09/695,065 (10/25/00 submits to) and 09/732,914 (12/11/00 submits to) are described, and its disclosure is all this complete quoting as a reference, and with from Invitrogen Corporation (Carlsbad, CA) GATEWAY of Huo Deing TMClone technology is relevant.
The topoisomerase enzyme clone
The present invention also relates to utilize one or more topoisomerases to produce the method for recombinant nucleic acid molecules by two or more nucleotide sequences.First aspect the invention provides a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain.This method be intended to at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) topoisomerase (for example IA type, IB type and/or II type topoisomerase) connect first kind with at least a second kind of nucleotide sequence, make a chain rather than two chains covalently bound (referring to, Figure 11 for example).Second aspect the invention provides a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains.This method be intended to at least a topoisomerase connect first kind with at least a second kind of nucleotide sequence, make that (that is, double-stranded recombinant nucleic acid molecules does not contain otch in the link position place to connect in two chains terminal covalently bound endways; See, for example Fig. 5).The third aspect, the invention provides the method for the covalently bound recombinant nucleic acid molecules of chain of a kind of production, wherein the substrate nucleotide sequence that connects according to the present invention comprises at least a strand nucleotide sequence, it can with second kind of (or more) strand nucleotide sequence or with a kind of nucleic acid molecule covalently bound (seeing, for example Figure 15).
A kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain can followingly be carried out: the first kind of nucleic acid molecule (for example IA type or II type topoisomerase enzyme recognition site) that contains locus specificity topoisomerase enzyme recognition site or its cleaved products at 5 ' or 3 ' end contacts with second kind of (or other) nucleic acid molecule, randomly contact, make that second kind of nucleotide sequence can be covalently bound with first kind of nucleotide sequence with a kind of topoisomerase (for example IA type, IB type and/or II type topoisomerase).As disclosed herein, method of the present invention can be with multiple nucleotide sequence, generally be that nucleic acid molecule carries out, wherein at least a nucleotides sequence is listed in one or two 5 ' end and contains locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase) or its cleaved products (for example, seeing Figure 11 A-11F).
For example, a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains can followingly be carried out: can contact and the topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: first kind of nucleic acid molecule with first end and second end, wherein in first end or second end or this two ends, first kind of nucleic acid molecule 3 ' end place or near contain a topoisomerase enzyme recognition site (or its cleaved products); At least a second kind of nucleic acid molecule with first end and second end, wherein in first end or second end or this two ends, at least the second kind of double chain nucleotide sequence 3 ' end place or near contain a topoisomerase enzyme recognition site (or its cleaved products); With at least a locus specificity topoisomerase (for example IA type and/or IB type topoisomerase).The covalently bound double-stranded recombinant nucleic acid that the method for this aspect is produced according to the present invention, its characteristic is not contain otch at the nucleic acid molecule link position place of every chain.In one embodiment, this method is following carries out: first kind of nucleic acid molecule contacts with second kind of (or other) nucleic acid molecule, and they contain a topoisomerase enzyme recognition site or its cleaved products at the 3 ' end or 5 ' the end place of two ends that will be covalently bound.In another embodiment, this method is following carries out: the first kind of nucleic acid molecule that contains a topoisomerase enzyme recognition site or its cleaved products at the 5 ' end and 3 ' the end place of at least one end contacts with second kind of (or other) nucleic acid molecule, and the latter will contained one 3 ' hydroxyl and 5 ' hydroxyl with the end that the first kind of nucleic acid molecule end that contains recognition site is connected.As disclosed herein, this method can be carried out (for example, seeing Figure 12 A-12D) with the multiple nucleic acid molecule that contains multiple terminal combination.
Topoisomerase is categorized as: the I type comprises IA type and IB type topoisomerase, the chain and the II type topoisomerase (gyrase) of its cutting double chain acid molecule, two chains of its cutting nucleic acid molecule.A chain of IA type and IB type topoisomerase cutting nucleic acid molecule.IA type topoisomerase cutting nucleic acid molecule produces 5 ' phosphoric acid and 3 ' hydroxyl at the restriction enzyme site place, 5 ' end covalent attachment of IA type topoisomerase and cutting chain.By comparison, IB type topoisomerase cutting nucleic acid molecule produces 3 ' phosphoric acid and 5 ' hydroxyl at the restriction enzyme site place, 3 ' end covalent attachment of IB type topoisomerase and cutting chain.As disclosed herein, I type and II type topoisomerase and catalytic domain thereof and mutant form can be used for two double-stranded recombinant nucleic acid molecules that chain is covalently bound of the method according to this invention production.
IA type topoisomerase comprises: intestinal bacteria topoisomerase I, intestinal bacteria topoisomerase II I, eukaryote topoisomerase II, the contrary gyrase of archeal, yeast topoisomerase II I, fruit bat topoisomerase II I, human topoisomerase III, streptococcus pneumoniae topoisomerase II I etc., comprise that other IA type topoisomerase is (referring to Berger, Biochim.Biophys.Acta 1400:3-18,1998; DiGate and Marians, J.Biol.Chem.264:17924-17930,1989; Kim and Wang, J.Biol.Chem.267:17178-17185,1992; People such as Wilson, J.Biol.Chem.275:1533-1540,2000; People such as Hanai, Proc.Natl.Acad.Sci.USA 93:3653-3657,1996, U.S. Patent number 6,277,620 all is incorporated herein by reference).Intestinal bacteria topoisomerase II I is a kind of IA type topoisomerase, can discern, in conjunction with and cut sequence 5 '-GCAACTT-3 ', especially can use (people such as Zhang, J.Biol.Chem.270:23700-23705 in the method for the invention, 1995, be incorporated herein by reference).People such as Li, a kind of analogue that J.Biol.Chem.272:19582-19587 (1997) describes, the traE albumen of plasmid RP4 also can use in enforcement of the present invention.A kind of DNA-protein adduct is used with the covalently bound enzyme of 5 '-thymidine residue and is formed, and cutting takes place between two thymidine residues.
IB type topoisomerase comprises: the topoisomerase (referring to people such as Cheng, Cell 92:841-850 1998, is incorporated herein by reference) that is present in nuclear I type topoisomerase in all eukaryotic cells and vaccinia virus and other cell poxvirus coding.The example of eukaryote IB type topoisomerase comprises: in yeast, fruit bat and mammalian cell (comprising the human cell), express (referring to Caron and Wang, Adv.Pharmacol.29B:271-297,1994; People such as Gupta, Biochim.Biophys.Acta 1262:1-14,1995, all be incorporated herein by reference; Referring to Berger, together above, 1998).The example of virus IB type topoisomerase comprises: vertebrates poxvirus (cowpox, rabbit fibroma virus, ORF virus, fowlpox virus and MCV) and entomopoxvirus (amsacta moorei entomopoxvirus) generation (referring to Shuman, Biochim.Biophys.Acta 1400:321-337,1998; People such as Petersen, Virology 230:197-206,1997; Shuman and Prescott, Proc.Natl.Acad.Sci.USA 84:7478-7482,1987; Shuman, J.Biol.Chem.269:32678-32684,1994; U.S. Patent number 5,766,891; PCT/US95/16099; PCT/US98/12372 all is incorporated herein by reference; Referring to people such as Cheng, together above, 1998).
II type topoisomerase comprises, for example: bacteria gyrase, DNA of bacteria topoisomerase I V, eukaryotic dna topoisomerase II and the phage-coded DNA topoisomerase of T even number (Roca and Wang, Cell 71:833-840,1992; Wang, J.Biol.Chem.266:6659-6662,1991, all be incorporated herein by reference; Berger, together above, 1998).Be similar to IB type topoisomerase, II type topoisomerase has cutting and is connected activity.In addition, be similar to IB type topoisomerase, can prepare the substrate nucleic acid molecule, make that II type topoisomerase can be covalently bound with a chain formation at the cleavage site place.For example, the cutting of calf thymus II type topoisomerase endonuclease capable is a kind of to be contained apart from the substrate nucleic acid molecule of 5 ' depression topoisomerase enzyme recognition site of three Nucleotide of 5 ' end, cause the trinucleotide sequence of cleavage site 5 ' side to be dissociated, 5 ' end covalent attachment (people such as Andersen of topoisomerase and nucleic acid molecule, together above, 1991).In addition, with after the second kind of nucleotide sequence that contains 3 ' hydroxyl contacts, II type topoisomerase can link together these sequences, discharges from recombinant nucleic acid molecules then at the nucleic acid molecule of this II of carrying type topoisomerase.Like this, II type topoisomerase also can be used for carrying out method of the present invention.
The structural analysis of topoisomerase shows, the member of each particular topology isomerase family comprises IA type, IB type and II type topoisomerase, with other member of this family common constitutional features (Berger, with above, 1998) is arranged.In addition, the sequential analysis of different I Type B topoisomerase shows, their structure height is conservative, particularly catalytic domain (Shuman, with above, 1998; People such as Cheng, together above, 1998; People such as Petersen, together above, 1997).For example, the territory and other IB type topoisomerase that comprise the amino acid 81-134 of 314 amino acid whose cowpox topoisomerases have suitable homology, isolating territory and total length topoisomerase have essentially identical activity, though isolating territory transformation efficiency is lower, (see Shuman with the binding affinity of recognition site is lower, together above, 1998; People such as Cheng, together above, 1998).In addition, the sudden change cowpox topoisomerase of aminoterminal territory (amino-acid residue 70 and 72) sudden change show the character identical with the total length topoisomerase (people such as Cheng, same above, 1998).In fact, the mutation analysis of cowpox IB type topoisomerase shown and can suddenly change and do not influence the active a large amount of amino-acid residues of topoisomerase, and contains the active required several amino acid of determining (Shuman, with above, 1998).Because total high homology between cowpox topoisomerase catalytic domain and other IB type topoisomerase, will be appreciated that the catalytic domain of isolating IB type topoisomerase uses in the method for the invention with the IB topoisomerase endonuclease capable that contains the different aminoacids sudden change.
Different topoisomerases shows different sequence-specifics.For example, II type topoisomerase can be in conjunction with multiple sequence, but the cutting of the recognition site place of high special (referring to people such as Adersen, J.Biol.Chem.266:9203-9210 1991, is incorporated herein by reference).By comparison, IB type topoisomerase comprises the locus specificity topoisomerase, and their combinations are also cut specific nucleotide sequence (" topoisomerase enzyme recognition site ").After a kind of nucleic acid molecule is by topoisomerase (for example IB type topoisomerase) cutting, by form phosphoric acid tyrosyl key between 3 ' Nucleotide of the specific tyrosine residues of topoisomerase and topoisomerase enzyme recognition site, the energy of phosphodiester bond is kept.In 3 ' when end of topoisomerase cleavage site near nucleic acid molecule, downstream sequence (cleavage site 3 ') can dissociate, and produces the nucleic acid molecule (seeing Figure 29) that contains with the new covalently bound topoisomerase of 3 ' end that produces.
A kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain can followingly be carried out: can contact and at least a topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: the first kind of nucleic acid molecule that 1) has first end and second end, wherein first kind of nucleic acid molecule 5 ' end place of first end or second end or these two ends or near contain a locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site), randomly contain one or more recombination sites; 2) at least a second kind of nucleic acid molecule, it contains or can make it to contain first end and second end; With 3) at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) locus specificity topoisomerase (for example IA type or IB type topoisomerase enzyme recognition site).For example, topoisomerase can be an IA type topoisomerase, as intestinal bacteria topoisomerase I, intestinal bacteria topoisomerase II I, or eukaryote topoisomerase II I.After a kind of nucleic acid molecule cutting, topoisomerase is preferably held stable bond with 5 '.After with the topoisomerase cutting, the nucleic acid molecule after the cutting can comprise 3 ' outstanding sequence usually.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Can carry out the method for the covalently bound double-stranded recombinant nucleic acid molecules of chain of a kind of production of the present invention, make terminal arbitrary combination connect, wherein a chain is covalently bound in the end that connects, and the non-covalent connection of another chain still contains an otch.For example, first kind of nucleic acid molecule can comprise a kind of encoding sequence, and wherein the ATG initiator codon is located on or near first end, the poly a-signal second end or near coding; Second kind of nucleic acid molecule can comprise a kind of promoter element, it works when being positioned at the encoding sequence downstream, first end is positioned at the second complete terminal upstream, can carry out this method, wherein locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) is located on or near 5 ' end of first end of first kind of nucleic acid molecule, wherein topoisomerase (for example IA type or II type topoisomerase) can covalently bound first kind of nucleic acid molecule first end the 3 ' condition of holding of 5 ' end and second kind of nucleic acid molecule first end under carry out this contact, thereby produce a kind of double-stranded recombinant nucleic acid molecules, wherein can express a peptide species from this encoding sequence.In addition, also can carry out this method, wherein topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) is located on or near 5 ' end of second end of first kind of nucleic acid molecule, wherein under the condition of 5 ' end that topoisomerase (for example IA type or II type topoisomerase enzyme recognition site) can connect first kind of nucleic acid molecule second end and 3 ' end of second kind of nucleic acid molecule first end, carry out this contact, thus a kind of double-stranded recombinant nucleic acid molecules that generation can the antisence molecule.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Another example of using above-mentioned first kind of nucleic acid molecule and second kind of nucleic acid molecule is, can carry out this method, wherein topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) is located on or near first end of first kind of nucleic acid molecule and 5 ' end of second end, wherein at 5 ' end of covalently bound first kind of nucleic acid molecule first end of IA type topoisomerase endonuclease capable and 3 ' end of second kind of nucleic acid molecule first end, carry out this contact under 5 ' end of first kind of nucleic acid molecule second end and the condition that 3 ' of second kind of nucleic acid molecule second end held.Like this, the double-stranded recombinant nucleic acid molecules cyclisation that this method produces, on every chain with respect to containing an otch by the position of the covalently bound chain of topoisomerase (for example IA type or II type topoisomerase).In addition, the promotor of second kind of nucleic acid molecule can start the expression of first kind of nucleic acid molecule.In one embodiment, the double-stranded recombinant nucleic acid molecules of cyclisation comprises a kind of carrier.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Another example of using above-mentioned first kind of nucleic acid molecule and second kind of nucleic acid molecule is, can carry out this method, wherein topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) is located on or near first end of first kind of nucleic acid molecule and 5 ' end of second end, wherein topoisomerase (for example IA type or II type topoisomerase) can covalently bound first kind of nucleic acid molecule first end 3 ' end of 5 ' end and second kind of nucleic acid molecule second end, carry out this contact under 5 ' end of first kind of nucleic acid molecule second end and the 3 ' condition of holding of second kind of nucleic acid molecule first end.Like this, the double-stranded recombinant nucleic acid molecules cyclisation that this method produces, on every chain with respect to containing an otch by the position of the covalently bound chain of topoisomerase (for example IA type or II type topoisomerase).In addition, the promotor of second kind of nucleic acid molecule can start the expression of antisense sequences.In one embodiment, the double-stranded recombinant nucleic acid molecules of cyclisation comprises a kind of carrier.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
As disclosed herein, the method for the double-stranded recombinant nucleic acid molecules that chain of a kind of production is covalently bound comprises first kind of nucleic acid molecule and at least a second kind of nucleic acid molecule, can also comprise the step of the double-stranded recombinant nucleic acid molecules that chain of amplification is covalently bound.Amplified reaction can followingly carry out: double-stranded recombinant nucleic acid molecules and a kind of amplification primer are to contacting, wherein the right article one primer of this primer can an end place of first kind or second kind nucleic acid molecule or near in conjunction with covalently bound chain, and cause amplified reaction to another kind of nucleic acid molecule, what produce nucleotide sequence and this two strands recombinant nucleic acid molecules contains first kind of identical extension products of otch chain; The right second primer of this primer generally 3 ' end place or near can in the presence of article one primer, can produce a kind of amplified production as template in conjunction with first kind of extension products with covalently bound chain and extension products (or consequent extension products).For example, can carry out this method, make IA type topoisomerase enzyme recognition site be located on or near first end of first kind of nucleic acid molecule, this method comprises that also double-stranded recombinant nucleic acid molecules and a kind of amplification primer are to contacting, wherein forward primer can second end of first kind of nucleic acid molecule or near combination, reverse primer can in conjunction with at least a portion complementary nucleotide sequence of second kind of nucleic acid molecule second end; And this two strands recombinant nucleic acid molecules that increases.First kind of nucleic acid molecule can comprise a coding region, and second kind of nucleic acid molecule can comprise a kind of regulatory element.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
A kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain also can followingly be carried out: can contact and at least a topoisomerase endonuclease capable reaches under its active condition at all the components, the contact following ingredients: 1) have first kind of nucleic acid molecule of first end and second end, wherein first kind of nucleic acid molecule 5 ' end place of first end or second end or these two ends or near contain a locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site); 2) at least a second kind of nucleic acid molecule, it contains or can make it to contain first end and second end; 3) at least a the third nucleic acid molecule, it contains maybe can make it to contain first end and second end, and each end also comprises 5 ' end and 3 ' end; With 4) at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) locus specificity topoisomerase (for example IA type or IB type topoisomerase enzyme recognition site).For example, topoisomerase can be a kind of IA type topoisomerase, as intestinal bacteria topoisomerase I, intestinal bacteria topoisomerase II I or eukaryote topoisomerase II I.After a kind of nucleic acid molecule was cut, topoisomerase was preferably held stable bond with 5 '.After with the topoisomerase cutting, the nucleic acid molecule after the cutting preferably comprises 3 ' outstanding sequence.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Can carry out the method for the covalently bound double-stranded recombinant nucleic acid molecules of chain of a kind of production of the present invention, it comprises the first kind of nucleic acid molecule that contains locus specificity topoisomerase enzyme recognition site (for example IA type or IB type topoisomerase enzyme recognition site) or its cleaved products, at least a second kind of nucleic acid molecule and at least a the third nucleic acid molecule, make any end be connected, and a chain of the end that connects is covalently bound, and a chain contains otch.According to this embodiment, any end can both contain IA type, II type or IB type topoisomerase enzyme recognition site, perhaps can comprise its cleaved products, as long as first kind of double-stranded recombinant nucleic acid molecules 5 ' end place or near contain topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site), or its cleaved products, and have only a topoisomerase or topoisomerase enzyme recognition site in the end that will connect.For example, if first kind of nucleic acid molecule first end and the second end place or near comprise a locus specificity IA type topoisomerase enzyme recognition site, this method can also comprise: topoisomerase (for example IA type or II type topoisomerase) can covalently bound first kind of nucleic acid molecule first end 5 ' end with 3 ' end of first end of second kind of nucleotide sequence, under the condition of 3 ' end of 5 ' end of second end of first kind of nucleic acid molecule and first end of the third nucleotide sequence, first kind of nucleic acid molecule contacted with at least a the third nucleic acid molecule with second kind of nucleic acid molecule, the latter is contained or can be made it to contain first end and second end, and each end also comprises 5 ' end and 3 ' end.Will be appreciated that this method of the present invention is carried out in other combination of the enough ends of energy and topoisomerase enzyme recognition site or its cleaved products.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
A kind of method of the present invention also can followingly be carried out: under the condition of 5 ' end of first terminal or second end of 3 ' end of first terminal or second end of covalently bound the third nucleic acid molecule of IB type topoisomerase endonuclease capable and second kind of nucleic acid molecule, contact following ingredients: first kind of nucleic acid molecule and second kind of nucleic acid molecule and at least a the third nucleic acid molecule, the latter is contained first end and second end, each end also comprises 5 ' end and 3 ' end, wherein the third nucleic acid molecule 3 ' end place of first terminal or second terminal or first end and second end or near contain an IB type topoisomerase enzyme recognition site; With at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) IB type topoisomerase.In this method, if the third nucleic acid molecule 3 ' end place of first end or near comprise an IB type topoisomerase enzyme recognition site, can IB type topoisomerase can covalently bound the third nucleic acid molecule the 5 ' condition of holding of 3 ' end and first end of second kind of nucleic acid molecule of first end under carry out this contact.Will be appreciated that, also can carry out this method of the present invention with other combination of terminal and topoisomerase enzyme recognition site or its cleaved products.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
In another embodiment, a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain can followingly be carried out: can contact and at least a topoisomerase endonuclease capable reaches under its active condition at all the components, contact following ingredients: first kind of nucleic acid molecule that 1) first end and second end are arranged, wherein first kind of nucleic acid molecule 5 ' end place of an end or near contain a locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site), 3 ' end place of another end or near contain an IB type topoisomerase enzyme recognition site; 2) at least a second kind of nucleic acid molecule, it contains or can make it to contain first end and second end; 3) at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) locus specificity topoisomerase (for example IA type or II type topoisomerase); With 4) at least a (for example 1,2,3,4,5,6,7,8,9,10 kind etc.) IB type topoisomerase.For example, the topoisomerase that recognition site is located on or near 5 ' end can be a kind of IA type topoisomerase, as intestinal bacteria topoisomerase I, intestinal bacteria topoisomerase II I or eukaryote topoisomerase II I.After a kind of nucleic acid molecule cutting, IA type topoisomerase is preferably held stable bond with 5 ', and IB type topoisomerase is preferably held stable bond with 3 '.After with the topoisomerase cutting, the nucleic acid molecule after the cutting preferably comprises 3 ' outstanding sequence and 5 ' outstanding sequence.This method can also comprise the double-stranded recombinant nucleic acid molecules of contact and a kind of dna ligase, thereby produces a double-stranded recombinant nucleic acid molecules that chain is covalently bound.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
By contacting first kind of nucleic acid molecule, second kind of nucleic acid molecule and at least a the third nucleic acid molecule, produce a kind of method of the covalently bound double-stranded recombinant nucleic acid molecules of chain, can also comprise the step of the double-stranded recombinant nucleic acid molecules that amplification is particularly covalently bound.This amplification can followingly be carried out: double-stranded recombinant nucleic acid molecules and a kind of amplification primer are to contacting, wherein the right article one primer of this primer can end of first kind or second kind nucleic acid molecule or near the covalently bound chain of selective binding, and initiation produces and covalently bound first kind of extension products of chain complementary to the amplified reaction of another kind of nucleic acid molecule; The right second primer of this primer generally 3 ' end place or near can first kind of extension products of selective binding, in the presence of article one primer, can produce a kind of amplified production as template with covalently bound chain and extension products (or consequent extension products).Can carry out this method, make topoisomerase enzyme recognition site (for example IA type or IB type topoisomerase enzyme recognition site) be located on or near first end of first kind of nucleic acid molecule, can comprise that also the double-stranded recombinant nucleic acid molecules of contact and a kind of amplification primer are right, wherein forward primer can second end of first kind of nucleic acid molecule or near in conjunction with a kind of nucleotide sequence, reverse primer can in conjunction with at least a portion complementary nucleotide sequence of the third nucleic acid molecule; And this two strands recombinant nucleic acid molecules that increases.First kind of nucleic acid molecule can comprise a coding region, and the third nucleic acid molecule can comprise a kind of regulatory element.In addition, the end of connection also can contain complementary outstanding sequence.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Figure 11 A-11F has illustrated that to produce chain covalently bound and randomly comprise the typical embodiments of open method of the double-stranded recombinant nucleic acid molecules of one or more recombination sites.In Figure 11 A, one of nucleic acid molecule contains the topoisomerase of the 5 ' end that is attached to an end, when this molecule that contains 3 ' overhang contacts with the second kind of nucleic acid molecule that contains basic complementary 3 ' overhang under proper condition, the Nucleotide that contains 3 ' overhang can be hybridized, and the catalysis of topoisomerase endonuclease capable connects.Figure 11 B shows first kind of nucleic acid molecule, it contains with a kind of 5 ' end and 3 ' of two different ends of nucleotide sequence holds the topoisomerase molecule that is connected, first kind of nucleic acid molecule of further demonstration is connected with other two kinds of nucleotide sequences, produce a kind of nucleic acid molecule, wherein a chain does not contain any otch, and another chain contains two otch.Figure 11 C shows first kind of nucleic acid molecule containing the topoisomerase molecule that is connected with 5 ' end of an end and contains second kind of nucleic acid molecule holding the topoisomerase molecule that is connected with 5 ' of an end, further show first kind with being connected of second kind of nucleic acid molecule and another kind of nucleotide sequence, produce a kind of nucleic acid molecule, wherein a chain does not contain any otch, and another chain contains two otch.In Figure 11 D, one of nucleic acid molecule that will connect contains the locus specificity IA type topoisomerase of the 5 ' end that is attached to two ends, makes that complementary 3 ' overhang can be hybridized when the contact nucleotide sequence, and the topoisomerase enzyme catalysis connects.Figure 11 E shows another example that three kinds of nucleic acid molecule are linked together, wherein use a kind of nucleic acid molecule that carries topoisomerase that contains IA type topoisomerase at 5 ' end, carry the nucleic acid molecule of topoisomerase with another kind, its 3 ' end at the relative chain that will connect contains IB type topoisomerase, make when the contact nucleotide sequence, complementary 3 ' overhang can be hybridized, and the topoisomerase enzyme catalysis connects.Figure 11 F shows another example that three kinds of nucleic acid molecule are linked together, use a kind of nucleic acid molecule that carries topoisomerase in this case, it contains topoisomerase (for example IA type or II type topoisomerase) at 5 ' end, 3 ' end at relative chain contains IB type topoisomerase, make when contact nucleotide sequence under conditions suitable, complementary 3 ' overhang can be hybridized, and the topoisomerase enzyme catalysis connects.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Example shown in Figure 11 A-11F show with connect after contain the end of the opposite nucleic acid molecule of the nucleic acid molecule of flush end, and show that containing 3 ' gives prominence to the connection of sequence.Yet the substrate nucleic acid molecule can contain any end and overhang as desired, comprises flush end and/or complementary end, or its combination, makes end to be connected to each other, and for example, forms ring molecule, perhaps is connected with other nucleic acid molecule that contains suitable end.Therefore, one or more flush ends shown in Figure 11 A-11F can be replaced into a kind of nucleotide sequence that contains 5 ' overhang or 3 ' overhang, they all can be a Nucleotide, as the thymidine residue, or a plurality of Nucleotide (for example 2,3,4,5,6,7,8,9,10,11,12,13,14,15 etc.), they can be identical or different.In some embodiment of open method, first kind of nucleic acid molecule contains a flush end that will connect, second kind of nucleic acid molecule will contain an overhang by the end that locus specificity topoisomerase (for example IA type or IB type topoisomerase) connects, wherein overhang comprises and the sequence complementary sequence that contains flush end, thereby help the intrusion of chain, be the method for the suitable located terminal end of ligation as a kind of.
Shown in Figure 11 A-11C, utilize the double-stranded recombinant nucleic acid molecules of the method generation of this aspect of the present invention to comprise that a chain (not being two chains) is at the terminal covalently bound nucleic acid molecule that will connect (that is, the double-stranded recombinant nucleic acid molecules that utilizes these methods to produce contains an otch two terminal each positions that connects).These embodiment particularly advantageouies duplicate double-stranded recombinant nucleic acid molecules because can the time duplicate covalently bound chain by beginning with polysaccharase.For example, heat-staple polysaccharase, as can be used for carrying out the polysaccharase of amplified reaction such as PCR can be used for duplicating the covalency chain, and the chain that contains otch can not provide the suitable template of duplicating.
The present invention also provides the method for two ends of the terminal or same nucleic acid molecule of covalently bound two kinds of different IPs acid molecules, makes two chains of product connect, and therefore, does not contain otch.Figure 12 has shown the typical embodiments of this aspect of the present invention.For example, in Figure 12 A, a kind of nucleic acid molecule contains 3 ' end and 5 ' the topoisomerase molecule of holding that is attached to an end, make when this molecule that contains 5 ' overhang contacts the second kind of nucleic acid molecule that contains basic complementary 5 ' overhang under proper condition, the Nucleotide that contains 5 ' overhang can be hybridized, and the connection of two chains of this nucleic acid molecule of topoisomerase endonuclease capable catalysis.In Figure 12 B, each end of the nucleic acid molecule that will connect all contains the topoisomerase molecule that is attached to 3 ' end, make when contacting nucleotide sequence under proper condition, the Nucleotide that contains 5 ' overhang can be hybridized, and the topoisomerase enzyme catalysis connects (comparison diagram 12C, every kind of nucleic acid molecule that wherein will connect contain a topoisomerase that is attached to 5 ' end of the end that will connect).The nucleic acid molecule that Figure 12 D explanation contains topoisomerase by a kind of two ends at two ends links together three kinds of nucleic acid molecule.Be similar to Figure 11, the example shown in Figure 12 A-12D shows the end that can not be connected to the nucleic acid molecule of flush end.Yet, as described in for Figure 11, the substrate nucleic acid molecule that uses in the method as shown in figure 12 can contain any end as desired, comprise the end that carries topoisomerase, make these ends to be connected to each other, for example, form ring molecule, or be connected with other nucleic acid molecule that contains suitable end, flush end, 5 ' overhang, 3 ' overhang etc. as desired.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
Except the catalysis ligation, a kind of covalently bound topoisomerase also can the catalysis reversed reaction, for example, the connection again of 3 ' Nucleotide of recognition sequence, IB type topoisomerase is attached thereto by phosphoric acid tyrosyl key, before cutting, nucleotide sequence comprises 5 ' end of nucleic acid molecule, contains free 5 ' hydroxyl after cutting.So, developed the method for utilizing IB type topoisomerase to produce recombinant nucleic acid molecules.For example, contain that the cloning vector of bonded IB type topoisomerase develops, and can obtain commodity (Invitrogen Corp., La Jolla CA).This class cloning vector contains a covalently bound IB type topoisomerase (" carrying topoisomerase ") at each 3 ' end after linearizing.Will be cloned into this year intravital nucleotide sequence, as comprise the nucleotide sequence in cDNA library, or restricted fragment, or the genomic dna sequence of shearing, for example handle with a kind of Phosphoric acid esterase, produce 5 ' hydroxyl terminal, can 5 ' hold with carrier 3 ' the end place of containing covalently bound topoisomerase and be connected under the condition of nucleotide sequence what contain hydroxyl at topoisomerase then, add in the linearizing carrier that carries topoisomerase.A kind of nucleotide sequence that contains 5 ' hydroxyl terminal that produces as a kind of pcr amplification product, can (at room temperature about 5 minutes) be cloned in the carrier that carries topoisomerase in quick ligation.Topoisomerase ligation institute inherent connects fast and wide temperature range makes the carrier that carries topoisomerase be used for the high-throughput purposes ideally, and this generally carries out with automatic system.
II type topoisomerase generally is not used in produces recombinant nucleic acid molecules or cloning process, and IB type topoisomerase as mentioned above, uses in several different methods.As disclosed herein, IA type topoisomerase endonuclease capable uses in several different methods, and it is described to be similar to IB type topoisomerase.Yet in the past the method for describing of utilizing IB type topoisomerase to connect two or more nucleotide sequences had following shortcoming: the bonded topoisomerase can only realize that 3 ' of the chain that adheres to holds and being connected of the second chain that contains 5 ' hydroxyl.Because topoisomerase can not connect complementary strand, the nucleic acid molecule of generation contains otch.The existence of these otch can not hinder recombinant molecule to be used for transfection host cell, because otch dissolves in cell usually, but the direct application of recombinant molecule that had these otch significant limitation in the double chain acid molecule.For example, a chain that contains the nucleic acid molecule of otch can not pcr amplification, because primer extension reaction stops in incision.Therefore, must further handle usually with a kind of nucleic acid construct of topoisomerase preparation according to preceding method, for example, handle with dna ligase, to obtain the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains, therefore can be used for operation subsequently, as PCR.
The aforementioned method for preparing nucleic acid construct also needs a plurality of steps usually, and is particularly when connecting two or more nucleotide sequences, all the more so when sequence must connect with predetermined direction.For example, the nucleotide sequence that will connect is connection successively usually, construct in the middle of the generation, and their all must be cloned, increase in host cell, separate and characterize.The construct that contains correct sequence must separate with the appropriate form capacity then, makes that a kind of nucleotide sequence can connect down, and clone once more, increase, separation and characterization program, to identify correct construct.Obviously, because the quantity of the different IPs nucleotide sequence that will connect increases, the quantity of the basic repeating step that must carry out also increases, so cause costliness, loaded down with trivial details, tediously long process.
As disclosed herein, an advantage of producing a kind of method of the present invention of the covalently bound double-stranded recombinant nucleic acid molecules of two chains is, in order to obtain two functional double-stranded recombinant nucleic acid molecules that chain is covalently bound, do not need to carry out ligation (seeing Fig. 8 and Figure 12) separately.In addition, also can carry out a kind of method of this aspect of the present invention, make when multiple different IPs acid molecule is will be with predetermined direction covalently bound, before carrying out next step, not need the clone, characterize and separates centre construct (referring to embodiment 1B).Therefore, the method for this aspect of the present invention provides a kind of method, it can be than currently known methods faster and cost greatly produce two double-stranded recombinant nucleic acid molecules that chain is covalently bound with reducing.
Another advantage is, the covalently bound double-stranded recombinant nucleic acid molecules of two chains that produces be a kind of can be in next step direct applied form, for example, the separate procedure that comprises extension or primer, as the pcr amplification program, or other transcribes or translation program, because the construct that produces does not contain otch in the site that the double chain nucleotide sequence connects.As disclosed herein, in certain embodiments, of the present invention a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain also is favourable, because the double-stranded recombinant nucleic acid molecules that produces be a kind of can be in next step direct applied form, for example, the separate procedure that comprises extension or primer, as the pcr amplification program, or other is transcribed or translation program, because in certain embodiments, the double-stranded recombinant nucleic acid molecules that produces contains a chain, and this chain does not contain otch in the site that the double chain nucleotide sequence connects.
Term " nucleotide sequence " or " nucleic acid molecule " are used to refer to discontinuous nucleic acid molecule at this.When used as such, term " nucleotide sequence " composition that only is conveniently used for clearly to distinguish in the composition of the present invention or uses in the method for the invention.Therefore, for example, " nucleic acid molecule " is in the method for the invention corresponding to the reactant (substrate) that is used for producing reorganization " nucleic acid molecule " product.
Usually use IB type topoisomerase such as cowpox topoisomerase or IA type topoisomerase explanation some method of the present invention at this.Yet, should be appreciated that these methods also can carry out with the topoisomerase outside being exemplified, only need to regulate its composition.For example, as hereinafter in greater detail, disclose utilize a kind of PCR primer linear nucleic acid molecule one or two 3 ' end mix a kind of IB type topoisomerase enzyme recognition site method, this primer to small part comprises and topoisomerase enzyme recognition site complementary nucleotide sequence.By comparison, can utilize the PCR primer that contains recognition site, in a kind of nucleic acid molecule, mix the topoisomerase enzyme recognition site of IA type (when perhaps wishing, the II type).
Locus specificity IB type topoisomerase cutting nucleic acid molecule cause with the chain complementary chain that contains covalently bound topoisomerase in, produce 5 ' outstanding sequence in identical with it end.In addition, as disclosed here, the PCR primer can be designed to mix IB type topoisomerase enzyme recognition site in a kind of nucleic acid molecule, and can produce 5 ' outstanding sequence in the complementary strand that contains definite and predetermined sequence after topoisomerase cuts this nucleic acid molecule.Like this, these methods are suitable for producing the double-stranded recombinant nucleic acid molecules that contains the composition nucleic acid molecule that effectively connects with pre-determined direction.According to this disclosure, be to be understood that, the PCR primer can also be designed and can introduce an IA type topoisomerase enzyme recognition site in a kind of nucleic acid molecule (comprising diversified sequence library), when wishing, is producing 3 ' outstanding sequence with locus specificity topoisomerase cutting back.
Produce a kind of method of the covalently bound double-stranded recombinant nucleic acid molecules of two chains, as disclosed herein, by the end of every kind of nucleic acid molecule that will be covalently bound or near the generation topoisomerase, expanded previously known method.For example, for IB type topoisomerase, this method 3 ' end place of every kind of linear nucleic acid molecule that will connect or near topoisomerase enzyme recognition site of generation or its cleaved products (that is covalently bound IB type topoisomerase).Term " topoisomerase enzyme recognition site " is meant and can be discerned the also definite nucleotide sequence of bonded by a kind of locus specificity topoisomerase as used herein.For example, nucleotide sequence 5 '-(C/T) CCTT-3 ' is a kind of topoisomerase enzyme recognition site, can be by most of poxvirus topoisomerases, comprise vaccinia virus DNA topoisomerase I specific combination, can after 3 ' thymidine of recognition site, cut this chain then, generation comprises the nucleotide sequence of 5 '-(C/T) CCTT-PO4-TOPO, promptly by the tyrosine residues in the topoisomerase and the covalently bound topoisomerase enzyme complex of 3 ' phosphoric acid (referring to Shuman, J.Biol.Chem.266:11372-11379,1991; Sekiguchi and Shuman, Nucl.Acids.Res.22:5360-5365,1994; All be incorporated herein by reference; Referring to U.S. Patent number 5,766,891; PCT/US95/16099; PCT/US98/12372).By comparison, nucleotide sequence 5 '-GCAACTT-3 ' is the topoisomerase enzyme recognition site of IA type intestinal bacteria topoisomerase II I.
Carry the nucleic acid molecule of topoisomerase, comprise and containing and the 5 ' end of one or two end of nucleic acid molecule or the nucleic acid molecule of the covalently bound topoisomerase of 3 ' end or these two ends, can produce by one of several different methods.In some cases, under proper condition, I type topoisomerase endonuclease capable cutting single-chain nucleotide sequence.For example, comprise the structural domain in the aminoterminal 67kDa territory of intestinal bacteria topoisomerase I (it is a kind of IA type topoisomerase), can cut the strand nucleotide sequence that contains the topoisomerase enzyme recognition site.Under the condition of topoisomerase endonuclease capable cutting single-chain nucleic acid molecule, can parallelly carry out 5 ' end and the 3 ' cutting of holding the nucleic acid molecule that contains the topoisomerase enzyme recognition site at an end of nucleic acid molecule.In addition, when the identification of one or both topoisomerases and cutting need a kind of nucleic acid molecule, react continuously, wherein at first cut the far-end (end) of topoisomerase enzyme recognition site, cut the site, inside (near-end) that keeps in the two strands then.For example, a kind of nucleic acid molecule 5 ' end place of an end or near contain an intestinal bacteria topoisomerase II I recognition site, 3 ' end place of same end or near contain a cowpox IB type topoisomerase enzyme recognition site, wherein IB type topoisomerase enzyme recognition site is than more close this end of IA type recognition site, this nucleic acid molecule can be with cowpox topoisomerase incubation, produce a kind of nucleic acid molecule that carries IB type topoisomerase, then with intestinal bacteria topoisomerase incubation, produce a kind of contain with 5 ' end bonded IA type topoisomerase and with the nucleic acid molecule of 3 ' end bonded IB type topoisomerase.Therefore, the present invention includes the method for producing the nucleic acid molecule that comprises one or two the terminal topoisomerase that is attached at least one end, and this nucleic acid molecule that carries topoisomerase further is provided.
Term " cleaved products " as used herein, when being used for the topoisomerase enzyme recognition site, be meant a kind of can be by topoisomerase usually at the nucleotide sequence of its recognition site cutting, for IA type or II type topoisomerase, comprise and the covalently bound topoisomerase enzyme complex of 5 ' phosphate group of topoisomerase enzyme recognition site 5 ' terminal nucleotide, perhaps, comprise and the covalently bound topoisomerase enzyme complex of 3 ' phosphate group of topoisomerase enzyme recognition site 3 ' terminal nucleotide for IB type topoisomerase.This mixture comprises the nucleic acid molecule of covalently bound topoisomerase with it that contains of topoisomerase cutting, is referred to herein as " topoisomerase activated " or " carrying topoisomerase " nucleotide sequence.Topoisomerase activated nucleic acid molecule can use in the method for the invention, also can use and contain the nucleic acid molecule that does not cut topoisomerase enzyme recognition site and topoisomerase, wherein topoisomerase can cut this nucleic acid molecule at recognition site, and covalent attachment with it.
In an embodiment of a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of chain, the topoisomerase enzyme recognition site is located on or near 3 ' end of every kind of nucleotide sequence end that will connect, make in the presence of IB type topoisomerase, every kind of nucleotide sequence is cut the back and produces 3 ' end, and it contains covalently bound with it topoisomerase (see figure 8).Nucleotide sequence that will be covalently bound also can contain 5 ' hydroxyl with the terminal identical end that contains the topoisomerase enzyme recognition site, perhaps can produce 5 ' hydroxyl with a kind of Phosphoric acid esterase.Behind these nucleotide sequences of contact, locus specificity topoisomerase endonuclease capable will contain every chain of 3 ' phosphoric acid and be connected with separately 5 ' hydroxyl, produce the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains, it can be produced as the supercoiled nucleic acid molecule of linearity, ring-type or plus or minus.
Preferably, will be according to the present invention the 5 ' end of end of the nucleotide sequence that connects with IB type topoisomerase of the method for particular aspects contain complementary 5 ' outstanding sequence, this sequence can help the initial combination of nucleotide sequence, comprises the direction combination to be scheduled to when wishing.In addition, will be according to the present invention the 5 ' end of end of the nucleotide sequence that connects with IB type topoisomerase of the method for particular aspects also contain complementary 5 ' sequence, wherein one of sequence contains 5 ' outstanding sequence, and another kind of nucleotides sequence be listed in 5 ' end flush end contain a kind of complementary sequence, invade combination by chain at first to help nucleotide sequence, comprise direction combination to be scheduled to when wishing.At this chain that is used to refer to nucleic acid molecule, it extends the end of the complementary strand of this nucleic acid molecule with 5 ' direction for term " 5 ' overhang " or " 5 ' outstanding sequence ".Easily, can cut a kind of nucleic acid molecule by enough IB type topoisomerase site-specifics, produce 5 ' overhang (seeing embodiment 1).
Preferably, will be according to the present invention the 3 ' end of end of the nucleotide sequence that connects with IA type topoisomerase of the method for particular aspects contain complementary 3 ' outstanding sequence, this sequence can help the initial combination of nucleotide sequence, comprises the direction combination to be scheduled to when wishing.In addition, will be according to the present invention the 3 ' end of end of the nucleotide sequence that connects with topoisomerase (for example IA type or II type topoisomerase) of the method for particular aspects also contain complementary 3 ' sequence, wherein one of sequence contains 3 ' outstanding sequence, and another kind of nucleotides sequence be listed in 3 ' end flush end contain a kind of complementary sequence, invade combination by chain at first to help nucleotide sequence, comprise direction combination to be scheduled to when wishing.At this chain that is used to refer to nucleic acid molecule, it extends the end of the complementary strand of this nucleic acid molecule with 5 ' direction for term " 3 ' overhang " or " 3 ' outstanding sequence ".Easily, can produce 3 ' overhang in IA type or II type topoisomerase cutting back.
3 ' or 5 ' outstanding sequence can contain any sequence, though the sequence (Fig. 9 C is referring to embodiment 1B) of the predetermined end of the predetermined end of selecting usually to allow the method according to this invention to connect a kind of nucleic acid molecule and second kind of nucleotide sequence.Though 3 ' or 5 ' overhang can be a palindromic sequence, but they are not usually, can be bonded to each other because contain the nucleic acid molecule of palindrome overhang, thereby reduce the output that comprises the covalently bound double-stranded recombinant nucleic acid molecules of two chains of two or more nucleic acid molecule with pre-determined direction.For example, 5 ' of nucleic acid molecule outstanding sequence is a palindromic sequence shown in Fig. 9 A, and therefore, for example, first kind of CMV element passes through the combination of AGCT overhang as CMV element and the combine possibility of GFP element by the AGCT overhang with second kind of CMV element.A kind of construct comprises a kind of effectively covalently bound construct, and it contains a CMV element, a GFP element and a BGH element with 5 '-3 ' order, and the production efficiency of this construct will be lower than the efficient of producing this construct with element shown in Fig. 9 C.Element shown in Fig. 9 B an end of GFP element and shown in the end of BGH element contain palindrome overhang, the efficient of therefore producing the construct of wishing is lower than the element of Fig. 9 C, but than more effective shown in Fig. 9 A.
A kind of nucleotide sequence that uses in method of the present invention and the test kit can be designed to contain the thiophosphatephosphorothioate of a bridging, to prevent the connection again after topoisomerase cuts.For example, when topoisomerase was intestinal bacteria topoisomerase II I, the thiophosphatephosphorothioate of bridging can mix between two thymidines of GCAACTT cutting/recognition sequence.After the cutting, the sequence of cutting contains 3 '-SH rather than 3 '-OH, connects (referring to people such as Burgin, Nucl.Acids Res.23:2973-2979,1995) again thereby stop.
Can be used for the method for this aspect of the present invention or the nucleic acid molecule of test kit and can pass through a kind of amplification method such as pcr amplification, make it to contain the topoisomerase enzyme recognition site at 3 ' or 5 ' end of an end.In addition, also can be designed for or two primers of PCR, make that the nucleic acid molecule after the cutting contains 5 ' or 3 ' overhang at one or two end after the nucleic acid molecule of amplification is cut.In one embodiment, design PCR primer, make 5 ' on the outstanding sequence of 5 ' on kind of the nucleic acid molecule of winning and second kind of (or other) nucleic acid molecule give prominence to the sequence complementation, thereby help nucleotide sequence preferably with predetermined direction combination, so their energy the method according to this invention are covalently bound.According to the present invention, by the unique outstanding sequence of different IPs acid molecule design for connecting, multiple nucleic acid molecule can connect with the order and/or the direction of hope.
Should be appreciated that PCR uses in two ways for method of the present invention.On the one hand, the PCR design of primers be for can make the nucleic acid molecule of hope have special characteristic, for example, and a kind of the transcribing or the nucleic acid molecule in translation adjusting element or purpose encoding sequence such as epi-position mark or cellular compartment territory of encoding.In this respect, the PCR primer can be designed to, and after amplification, as desired, nucleic acid molecule contains the topoisomerase enzyme recognition site at one or two end.As disclosed herein, the PCR primer also can comprise another kind of sequence, makes that the nucleic acid molecule after the cutting contains 5 ' or 3 ' outstanding sequence in the topoisomerase cut end with behind the locus specificity topoisomerase cutting amplified production.Relate to can in conjunction with and cut in one embodiment of the invention of the 5 ' topoisomerase of holding (embodiment that for example relates to IA type topoisomerase), the PCR primer can be designed to contain the thiophosphoric acid key (on seeing) of a bridging, it can block the connection again after the topoisomerase cutting, and can participate in carrying the generation of the amplified production of topoisomerase.
The outstanding sequence that PCR produces can comprise a mononucleotide overhang, and it is a kind of artefact (artifact) that the PCR reaction produces.For example, use polysaccharase usually, as Taq, it does not have the proofreading function, and has inherent terminal enzyme (DNA) activity, is created in the PCR product that each end contains a non-template deutero-3 ' A overhang.Can utilize method of the present invention, these amplified productions are connected with the nucleic acid molecule that carries topoisomerase, the latter is contained one 3 ' T overhang or one 3 ' dU overhang at one or two end, for the T/A cloning reaction, can be that a kind of carrier is (referring to U.S. Patent number 5,487,993 and 5,856,144, all be incorporated herein by reference).
PCR also be used for increasing produce by method of the present invention, one or two double-stranded recombinant nucleic acid molecules that chain is covalently bound.For example, as shown in figure 13, a kind of method of the present invention can be produced the double-stranded recombinant nucleic acid molecules of a kind of expression type by three kinds of substrate nucleic acid molecule, and these three kinds of nucleic acid molecule comprise: contain the nucleotide sequence of promotor, the nucleotide sequence that contains the nucleotide sequence of encoding sequence and contain polyadenylation signal.Mix the generation that the outstanding sequence of complementary 3 ' (or 5 ') helps double-stranded recombinant nucleic acid molecules at the double chain nucleotide sequence end that will connect.For example, the double-stranded recombinant nucleic acid molecules of expression type can followingly produce: 5 ' end at first end contains IA type topoisomerase, holds the first kind of nucleic acid molecule that contains IB type topoisomerase to contact with the third double chain nucleotide sequence with second kind of nucleic acid molecule at 3 ' of second end.It is right to design a kind of PCR primer, comprise the special article one primer of a part (being positioned at the upstream of this promotor) for the nucleotide sequence that comprises promotor, with the special second primer of a part (being positioned at the downstream of this signal), can only increase and contain the functional double-stranded recombinant nucleic acid molecules of total length of promotor, encoding sequence and polyadenylation signal with correct (being scheduled to) direction for the nucleotide sequence that comprises polyadenylation signal.Particularly, the partial reaction product, the reaction product that for example only contains the reaction product of the promotor that is connected with encoding sequence and contain otch is not amplified.Therefore, also can use a kind of nucleic acid molecule of the special design of PCR, make it can be used for method of the present invention, and only selective amplification those contain the composition that is hopeful and the reaction product of feature.
Term " covalently bound " when being used for double-stranded recombinant nucleic acid molecules, is meant that this nucleic acid molecule is produced by two kinds of nucleic acid molecule that two chains link together by the connection of topoisomerase mediation at least as used herein.For example should be appreciated that, with the topoisomerase of one of nucleic acid molecule that will be covalently bound covalently bound topoisomerase and the another kind of nucleic acid molecule of covalent attachment may be identical or different.Therefore, the cowpox topoisomerase can with a kind of nucleic acid molecule covalent attachment, and another kind of poxvirus or eukaryote nuclear IB type topoisomerase can with another chain combination.Yet, when topoisomerase not simultaneously, they generally are the members of same family, for example, although IA type or IB type or II type are when topoisomerase for example also produces complementation 3 ' overhang with 5 ' phosphoric acid covalent attachment, topoisomerase may be from different families, for example IA type and II type.
Strand or double chain acid molecule that term " covalently bound " produces at these two kinds of nucleotide sequences that also are used for being linked together by a chain at least.For example, first kind of nucleic acid molecule of the covalently bound bonded of topoisomerase endonuclease capable 5 ' end with second kind of nucleic acid molecule 3 ' end condition under, 5 ' end place or near be combined with a topoisomerase the first kind of nucleic acid molecule that carries topoisomerase when contacting with second kind of double chain nucleotide sequence, the double-stranded recombinant nucleic acid molecules of generation can produce the covalently bound double-stranded recombinant nucleic acid molecules of an a kind of chain.
In one embodiment, the site of double-stranded recombinant nucleic acid molecules two kinds of nucleotide sequence connections in arbitrary chain that a kind of two chains that the method according to this invention produces are covalently bound does not contain otch, although may contain otch in the other parts of this molecule.In a kind of method of the covalently bound double-stranded recombinant nucleic acid molecules of chain of production, produce a kind of double-stranded recombinant nucleic acid molecules, it contains an otch in the terminal position that connects of complementary strand at least.In the double-stranded recombinant nucleic acid molecules transfered cell that will have otch, perhaps make double-stranded recombinant nucleic acid molecules carry out ligation, as utilize ligase enzyme to carry out, as known in the art, the double-stranded recombinant nucleic acid molecules of this breach can be converted into two a kind of double-stranded recombinant nucleic acid molecules that chain is covalently bound.
Term " recon " is used to refer to by method of the present invention at this and connects a kind of nucleic acid molecule that at least two kinds of nucleotide sequences produce.The nucleic acid molecule differ that double-stranded recombinant nucleic acid molecules that the present invention includes and nature (for example in reduction division) produce.For example, the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains that a kind of method of this aspect produces according to the present invention can be according to existing two topoisomerase enzyme recognition sites to identify, every complementary strand contains one, is located on or near the site that nucleic acid molecule connects.
A kind of method of the present invention can followingly be carried out: can contact and the topoisomerase endonuclease capable reaches under its active condition at these compositions, contact following ingredients: the first kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, first kind of nucleic acid molecule 3 ' end place or near contain a topoisomerase enzyme recognition site or its cleaved products, and 5 ' end at same end contains (perhaps for example by contacting with a kind of Phosphoric acid esterase, enabling to contain) hydroxyl; At least a second kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, at least the second kind of nucleic acid molecule 3 ' end place or near contain a topoisomerase enzyme recognition site or its cleaved products, and contain (perhaps can make it to contain) hydroxyl at 5 ' end of same end; A kind of topoisomerase.Topoisomerase with first kind with after second kind of (or other) nucleic acid molecule contacts and cuts, in case of necessity, every kind of nucleotides sequence is listed in cleavage site and comprises one and hold covalently bound topoisomerase 3 ', and contain hydroxyl at 5 ' end, make after the contact that first kind and at least the second kind of nucleotide sequence are covalently bound with two chains.Therefore, the invention provides the covalently bound double-stranded recombinant nucleic acid molecules of producing by this method of a kind of two chains.
Term " is located on or near " as used herein, when when the topoisomerase enzyme recognition site is held near a kind of 3 ' (IB type) or 5 ' (IA type or II type) of nucleotide sequence, using, be meant this site respectively with 3 ' or 5 ' end in about 1-100 Nucleotide, general in terminal about 1-20 Nucleotide, special in the about 2-12 of an end Nucleotide separately.The topoisomerase enzyme recognition site apart from the about 10-15 of an end Nucleotide with an interior advantage is, after with the topoisomerase cutting, the sequence part in cleavage site downstream can spontaneously be separated with remaining nucleotide sequence, and it contains covalently bound topoisomerase and (is commonly referred to as " cutting of committing suiside "; Referring to, for example, Shuman, together above, 1991; People such as Andersen, together above, 1991).When the topoisomerase enzyme recognition site apart from end during greater than about 12-15 Nucleotide, by revising reaction conditions, for example, under the temperature of the melting temperature(Tm) that is higher than the duplex part that comprises the topoisomerase enzyme recognition site, carry out incubation step, can induce the nucleotide sequence in cleavage site upstream or downstream to separate with the remainder of sequence.
Make up first kind or second kind (or other) nucleic acid molecule, for example make it to contain apart from another advantage of the IB type topoisomerase enzyme recognition site of one or two terminal about 2-15 Nucleotide and be, the locus specificity topoisomerase cuts one 5 ' overhang of generation behind this nucleic acid molecule.Utilize PCR method as disclosed herein, can design this 5 ' the outstanding sequence that contains 2-15 Nucleotide respectively, contain any sequence that is hopeful.Therefore, first kind of nucleic acid molecule after a method according to the present present invention will be cut and selection second kind (or other) when nucleic acid molecule is covalently bound, and when the sequence of selecting contains 5 ' outstanding sequence, can design 5 ' overhang on first kind of nucleic acid molecule, 5 ' overhang complementation with on second kind that selects (or other) double-stranded sequence makes two kinds of (or multiple) sequences because the complementarity of 5 ' overhang is covalently bound with predetermined direction.As mentioned above, for 3 ' the outstanding sequence that for example produces, can use similar method with IA type or II type topoisomerase cutting back.
As used herein, the nucleotide sequence that contains " first end " and " second end " is meant that this nucleotide sequence is linear.A kind of substrate nucleic acid molecule may be linearity or cyclic, comprise supercoiled, although produce a kind of linear nucleic acid molecule that carries topoisomerase usually with one or more topoisomerases cutting back.For example, a kind of circular nucleic acid molecule, its contain each other and on the complementary strand at a distance of about 100 Nucleotide with interior, preferably each other and on complementary strand at a distance of about 20 Nucleotide with two interior IB type topoisomerase enzyme recognition sites, this molecule can contact with a kind of locus specificity IB type topoisomerase, make every chain all be cut, and intervening sequence dissociates, thereby produces a kind of linear nucleic acid molecule that contains with the covalently bound topoisomerase of each end.
First end or second end that should be known in nucleic acid molecule are not intended to represent any specific direction of nucleotide sequence, and are not intended to represent these ends relative importance each other.When the nucleotide sequence that contains first end and second end was a kind of double chain nucleotide sequence, each end contained one 5 ' end and one 3 ' end.Therefore, for example mention at 3 ' end herein and contain a topoisomerase enzyme recognition site, hold the nucleotide sequence that contains a hydroxyl at 5 ' of same end, it may be first end or second end.
A kind of method of the present invention can only be carried out with first kind of nucleic acid molecule and second kind of nucleic acid molecule, perhaps can comprise in addition as desired the third, the 4th kind or more kinds of nucleic acid molecule.Every kind of nucleotide sequence usually at least one 3 ' end or 5 ' end place or near contain a topoisomerase enzyme recognition site or its cleaved products, and can contain a hydroxyl at 5 ' end of same end, perhaps can be with a kind of Phosphoric acid esterase generation hydroxyl.When a kind of nucleotides sequence is listed near the end that will be connected with second kind of nucleotide sequence or when not containing the topoisomerase enzyme recognition site, can utilize method as disclosed herein, for example, with the primer PCR that contains topoisomerase enzyme recognition site complement this sequence that increases, in this nucleotide sequence, introduce a topoisomerase enzyme recognition site.
Term " first kind of nucleotide sequence ", " second kind of nucleotide sequence ", " the third nucleotide sequence " etc. just are used for showing at this being meant any in the several nucleotides sequence.Therefore, without any specifically defined feature about specific nucleotide sequence, term " first kind ", " second kind ", " the third " etc. are not any particular order, importance or the out of Memory that will represent about nucleotide sequence when being used for a kind of nucleotide sequence or a group or multiple nucleotide sequence.Therefore, for example relate to pcr amplification first kind of nucleic acid molecule in described method, make amplified production when one or two end contains a topoisomerase enzyme recognition site, should be appreciated that similarly, second kind of (or other) nucleic acid molecule also can increase like this.
Term " at least the second kind of nucleic acid molecule " is used to refer to one or more nucleotide sequences except that first kind of nucleotide sequence at this.Therefore, this term may only be meant second kind of nucleotide sequence, perhaps refers to second kind of nucleotide sequence and the third nucleotide sequence (or more).Therefore, to be used herein to difference following true for term " second kind of (or other) nucleotide sequence " or " second kind of (and other) nucleotide sequence ": term " at least the second kind of nucleotide sequence " can refer to second kind, the third or more kinds of nucleotide sequence.Should be appreciated that unless otherwise noted the nucleotide sequence that implication comprised of term " at least the second kind of nucleotide sequence " may be identical or basic identical with first kind of nucleotide sequence.For example, first kind may be identical with second kind of nucleic acid molecule, and difference is to contain complementation 5 ' the outstanding sequence that the topoisomerase cutting produces, making win kind and second kind of enough method of the present invention of nucleic acid molecule energy covalently bound.Like this, can utilize the concatermer of first kind and second kind nucleic acid molecule of method generation of the present invention, randomly, can be scattered with for example the third nucleic acid molecule, as a kind of regulatory element, and can be with predetermined direction, for example, contain covalently bound sequence all with 5 '-3 ' direction.
As disclosed herein, method of the present invention provides a kind of method with covalently bound two or more double chain nucleotides of pre-determined direction.It is covalently bound with particular order that term " direction " or " pre-determined direction " are used to refer to two or more nucleotide sequences at this.Therefore, method of the present invention provides a kind of method, for example, is used for the modulator promoter element of covalently bound encoding sequence upstream, and the polyadenylation signal in downstream, covalently bound coding region produces a kind of effable functional double-stranded recombinant nucleic acid molecules; Perhaps covalently bound two kinds of encoding sequences make them to transcribe in frame and to translate, and produce a kind of fusion polypeptide.
Method of the present invention also can be undertaken by the contact following ingredients: the first kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, first kind of nucleic acid molecule contains the IB type topoisomerase that is incorporated into 3 ' end (carrying topoisomerase), contains (perhaps can make it to contain) hydroxyl at 5 ' end place of same end; With at least a second kind of nucleic acid molecule that carries IB type topoisomerase, (perhaps can make it to contain) hydroxyl is contained at its 5 ' end place at same end.After at least the second kind of nucleotide sequence that first kind of sequence of topoisomerase activated and end contain topoisomerase and 5 ' hydroxyl contacts, in every chain, form phosphodiester bond, thereby produce the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains.
The present invention also provides the method that connects two or more nucleotide sequences such as (for example 2,3,4,5,6,7 kind), wherein the double-stranded recombinant nucleic acid molecules of Lian Jieing is with a chain rather than two chains covalently bound (that is, an otch is contained in double-stranded recombinant nucleic acid molecules two terminal each positions that produces double-stranded recombinant nucleic acid molecules that connect in a chain).In addition, one or more nucleotide sequences also can comprise one or more recombination sites.With the synoptic diagram shown in Figure 11 A as an illustration, the present invention includes the method for at least two kinds of nucleotide sequences of connection, comprise the contact following ingredients: the first kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, first kind of nucleic acid molecule contains and the covalently bound locus specificity IA type topoisomerase of 5 ' end; With second kind of nucleic acid molecule, it does not contain the covalently bound topoisomerase of arbitrary end with at least one end.In addition, second kind of nucleic acid molecule generally contains hydroxyl at 3 ' end of the end that is connected with first kind of nucleic acid molecule.In many cases, in order to hybridize, two kinds of nucleotide sequences that will connect contain 3 ' or 5 ' overhang with sufficient sequence complementarity.In relevant embodiment, above-mentioned first kind and second kind of first end and second end that nucleic acid molecule can be same nucleic acid molecule.Therefore, the connection of these two ends causes the formation of cyclisation molecule.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
With the synoptic diagram shown in Figure 11 B as an illustration, the present invention includes the method for three kinds of connections or multiple nucleotide sequence.Though multiple variation of the present invention is possible, three kinds of nucleotide sequences can utilize a kind of linkers to connect, this linkers 5 ' and 3 ' end place of an end or near contain topoisomerase, randomly contain one or more recombination sites.Therefore, after three kinds of nucleotide sequences connect, form a kind of nucleotide sequence, it is included in the second chain that the tie point place does not contain article one chain of otch and contains otch at the tie point place.This method has the advantage that the molecule that uses a kind of topoisomerase enzyme modification links together three kinds of nucleotide sequences.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
The present invention also provides the method for two chains of covalently bound two or more nucleic acid molecule such as (for example 2,3,4,5,6,7 kind).With the synoptic diagram shown in Figure 12 A as an illustration, the present invention includes the method for at least two kinds of nucleotide sequences of connection, comprise the contact following ingredients: the first kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, first kind of nucleic acid molecule (for example contains two topoisomerases, IA type and IB type topoisomerase), hold one and 5 ' end covalent attachment for one and 3 '; With second kind of nucleic acid molecule, it does not contain the covalently bound topoisomerase of arbitrary end with at least one end.In addition, second kind of nucleic acid molecule contains hydroxyl at 5 ' and 3 ' end of the end that is connected with first kind of nucleic acid molecule usually.In many cases, in order to hybridize, two kinds of nucleotide sequences that will connect contain 3 ' or 5 ' overhang with sufficient sequence complementarity, randomly contain one or more recombination sites.In relevant embodiment, aforesaid first kind and second kind of first terminal and second end that nucleic acid molecule can be same nucleic acid molecule.Therefore, the connection of these two ends causes the formation of cyclisation molecule.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
With the synoptic diagram shown in Fig. 5 D as an illustration, the present invention includes the method for three kinds of connections or multiple nucleotide sequence.Though multiple variation of the present invention is possible, three kinds of nucleotide sequences can utilize a kind of linkers to connect, this linkers 5 ' and 3 ' end place of each end or near contain topoisomerase, randomly contain one or more recombination sites.Therefore, after three kinds of nucleotide sequences connect, be formed on a kind of nucleotide sequence that the tie point place does not contain otch.This method has the advantage that the molecule that uses a kind of topoisomerase enzyme modification links together three kinds of nucleotide sequences.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
The present invention also provides the ligation of carrying out topoisomerase mediation and the method for recombining reaction, and these reactions can be carried out in a test tube or a plurality of test tube.For example, carrying out the required all the components of the ligation of topoisomerase mediation and recombining reaction can combination in a test tube, and two kinds of reactions can substantially side by side take place.Figure 35-40 has shown the example of the topoisomerase/recombining reaction that can carry out in a test tube or a plurality of test tube.Therefore, in specific embodiments, the invention provides the single tube reaction, wherein two ends of (1) one or more nucleic acid molecule or a kind of nucleic acid molecule are connected to each other by the reaction of topoisomerase mediation, and (2) one or more recombination sites and another one or a plurality of recombination site are recombinated.The ligation and/or the recombining reaction of many topoisomerase mediations can take place in the method for the invention.In addition, these reactions also can occur in sequence with any.In specific embodiments, one or more nucleic acid molecule in the reaction mixture of the present invention can contain (1) one or more recombination sites and (2) one or more topoisomerases or one or more topoisomerase enzyme recognition site.
As described in following examples 9, in some cases, find that topoisomerase can suppress the certain heavy group reaction.In these situations, the nucleic acid molecule that carries out the ligation of topoisomerase mediation can separate with the topoisomerase that exists in the reaction mixture, can be used as the substrate of recombining reaction then.In these situations, the ligation of topoisomerase mediation is carried out in different test tubes usually with recombining reaction.The ligation product of topoisomerase mediation and the example of the isolating method of topoisomerase can be included but not limited to: phenol/chloroform extracting generally is nucleic acid precipitation (for example ethanol sedimentation) and chromatography (for example column chromatography) subsequently.
In addition, the topoisomerase that exists in the reaction mixture for example can (for example be heated to about 65 ℃ of about 60min, about 70 ℃ of about 60min, about 75 ℃ of about 60min by heat inactivation, about 70 ℃ of about 40min, about 75 ℃ of about 40min, about 80 ℃ of about 40min, about 80 ℃ of about 30min, about 85 ℃ of about 20min, about 90 ℃ of about 15min, about 95 ℃ of about 5min, perhaps about 99 ℃ of about 1min) or utilize proteolytic enzyme (for example Proteinase K) deactivation.In this case, it is normally possible to carry out the ligation and the recombining reaction of topoisomerase mediation in same test tube.
In the particular of single tube reaction, utilize the ligation of topoisomerase mediation that two or more nucleic acid fragments are connected to each other, they all comprise one or more topoisomerases or topoisomerase enzyme recognition site.Afterwards, test tube is heated to about 85 ℃ of about 20min, adds one or more recombinases.In addition, if one or more in two or more nucleic acid fragments do not contain recombination site,, then can add the nucleic acid fragment that comprises one or more recombination sites if perhaps wish and other nucleic acid fragment reorganization.The recombination site that exists in the test tube generally is the site that can recombinate each other.
In other particular of single tube reaction, two or more nucleic acid fragments experience the catalytic reorganization of one or more recombinases.After recombinating, in test tube, add topoisomerase, to promote the connection of the nucleic acid fragment that topoisomerase mediates.As mentioned above, randomly can in reaction mixture, add other nucleic acid fragment with topoisomerase.In addition, when interpolation is attached with the nucleic acid fragment of one or more topoisomerases in reaction mixture, needn't add other topoisomerase usually.Therefore, in specific embodiments, the nucleic acid fragment of topoisomerase enzyme modification can be in above-mentioned reaction mixture, added,, other topoisomerase can be added or not add according to special reaction condition.
The present invention also provides preparation to contain the method for the nucleic acid molecule of one or more (for example 1,2,3,4,5,6 be situated between etc.) multiple clone site.For example, one or more nucleic acid fragments that use in the method for the present invention can comprise one or more multiple clone site.An embodiment is, the adhering to of the joint by containing one or more multiple clone site, can prepare in the nucleic acid fragment of nucleic acid molecule or add multiple clone site in the prepared according to the methods of the invention nucleic acid molecule to being used for the method according to this invention.In the parties concerned, the present invention includes by method of the present invention nucleic acid molecule preparation, that contain one or more multiple clone site, and one or more such multiple clone site are being modified by the purposes in the nucleic acid molecule of method preparation of the present invention.The present invention also provides the nucleic acid molecule that produces by aforesaid method, and these molecules and the purposes that comprises the composition of these molecules.
Virus vector
The method of nucleic acid molecule that the present invention also provides preparation to contain the viral nucleic acid district, and the nucleic acid molecule by these methods preparations and comprise the composition of these nucleic acid molecule.
Adenovirus is the virus vector that can use in gene therapy for example.Adenovirus is the attractive especially carrier that is used for carrying to airway epithelial gene, comprises the application of these carriers in the scope of the present invention.The adenovirus naturally infect airway epithelial causes slight disease in infection place.Other target based on the delivery system of adenovirus is liver, central nervous system, endotheliocyte and muscle.Adenovirus has the advantage that can infect nondividing cell.Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) provide one piece of summary based on the gene therapy of adenovirus.People such as Bout, HumanGene Therapy 5:3-10 (1994) has confirmed the purposes of adenovirus carrier to rhesus monkey airway epithelial metastatic gene.People such as the visible Rosenfeld of other example of the application of adenovirus in gene therapy, Science 252:431-434 (1991); People such as Rosenfeld, Cell 68:143-155 (1992); People such as Mastrangeli, J.Clin.Invest.91:225-234 (1993); PCT publication number WO94/12649 and WO96/17053; U.S. Patent number 5,998,205; People such as Wang, Gene Therapy 2:775-783 (1995), its disclosure is all this complete quoting as a reference.
Adeno associated virus (AAV) and simplexvirus and also once be intended for use in gene therapy (people such as Walsh, 1993, Proc.Soc.Exp.Biol.Med.204:289-300 by carriers of these virus preparations; U.S. Patent number 5,436,146; People such as Wagstaff, Gene Ther.5:1566-70 (1998)).Herpesvirus vector especially can be used for wishing to carry out the purposes of genetic expression in neurocyte.
Therefore the present invention comprises the method for the nucleic acid molecule for preparing one or more functional performances with virus vector (for example adenovirus carrier, Alphavirus carrier, herpesvirus vector, adeno-associated virus vector etc.).In specific embodiments, method of the present invention comprises the connection of nucleic acid fragment, and wherein one or more nucleic acid fragments contain and can make the product nucleic acid molecule have the ability (ability of for example, duplicating as virus vector in particular host cell, be packaged into the ability of virion, etc.) the zone.
In specific embodiments, other nucleic acid fragment of nucleic acid fragment and one or more that the present invention includes by at least a (for example 1,2,3,4 kind etc.) being comprised adenoviral sequence is connected, and prepares the method for adenovirus carrier.Adenovirus carrier and being used for prepares the object lesson of nucleic acid fragment of adenovirus carrier at U.S. Patent number 5,932, and open in 210,6,136,594 and 6,303,362, its complete disclosure is incorporated herein by reference.Adenovirus carrier by method preparation of the present invention can be rf or replication defect type.
An example of adenovirus carrier can prepare by a kind of other nucleic acid fragment of nucleic acid fragment and one or more that comprises adenoviral nucleic acid is connected.For example, when hope was replication-defective adenoviral vector, adenoviral nucleic acid can contain all or part of disappearance in following one or more zones: E1a district, E1b district and/or E3 district.The adenovirus carriers that contain disappearance in these districts are described in 594 for example at U.S. Patent number 6,136.The present invention also comprises the adenovirus carrier by method preparation of the present invention, and these carriers and the application that comprises the composition of these carriers.The example of the purposes of the adenovirus carrier by method of the present invention preparation comprises in Mammals (for example people) cell carries nucleic acid fragment.Therefore, the invention provides the method that preparation is applicable to the carrier of gene therapy scheme.These carriers generally are replication defect types.
In specific embodiments, adenovirus carrier of the present invention comprises whole basically adenoviral gene group, and difference is all or part of disappearance in following one or more zones: E1a district, E1b district and/or E3 district.In other particular, in one of E1a district, E1b district and/or E3 district or its are a plurality of, can there be non-adenoviral nucleic acid.
In specific embodiments, the adenovirus carrier for preparing by method of the present invention contains at least one replication orgin and/or a selected marker, and this can make carrier increase in prokaryotic cell prokaryocyte such as intestinal bacteria.
Adeno-associated virus vector and herpesvirus vector can be used and the similar method preparation of the present invention of aforesaid method.Therefore, the present invention also provides the method for these carriers of preparation, and with the carrier of these methods productions, the purposes of these carriers and comprise the composition of these carriers.
The present invention also provides the method for preparing Alphavirus carrier (for example Sindbis disease poisonous carrier, Semliki Forest virus carrier, ross river virus carrier, Venezuelan equine encephalitis virus carrier, western equine encephalitis virus carrier, eastern equine encephalitis virus carrier etc.), and the Alphavirus carrier that passes through these methods preparations, use the method for these Alphavirus carriers and comprise the composition of these Alphavirus carriers.
In specific embodiments, the present invention includes, prepare the method for Alphavirus carrier by at least a other nucleic acid fragment of nucleic acid fragment and one or more that comprises the Alphavirus sequence is connected.Alphavirus carrier and being used for prepares the object lesson of nucleic acid of Alphavirus carrier at U.S. Patent number 5,739,026 and 6,224,879, among the Syndebis expression system handbook catalog number (Cat.No.) K750-01 (version E) of Gibco BRL service manual 10179-018 " SFV gene expression system " and Invitrogen description is arranged, its complete disclosure is incorporated herein by reference.
In specific embodiments, the Alphavirus carrier sequence that is used for preparing the Alphavirus carrier in the method for the invention can comprise one or more following ingredients: the nucleic acid (for example nsp1, nsp2, nsp3, nsp4 etc.) of one or more packaging signals (may be or may not be the Alphavirus source), one or more subgene group promotors and/or one or more Nonstructural Proteins of encoding.
Alphavirus carrier of the present invention can be used as in DNA or the RNA molecule transfered cell.When in cell, importing these carriers of dna form, can use expression control sequenc (for example induction type, expression type or composing type control sequence) to produce the RNA molecule, this molecule can be translated as one or more Nonstructural Proteins.In specific embodiments, these Nonstructural Proteins will form a kind of RNA polymerase of dependenc RNA, the RNA molecule of all or part of of its transcript of producing corresponding to Alphavirus carrier DNA form of can increasing.Therefore, but these Nonstructural Protein catalysis produce the RNA molecule of other copy by the RNA template, cause the RNA amplification.In addition, wish that a kind of nucleic acid fragment of high level expression can effectively be connected with a kind of subgene group promotor, thereby produce high-level RNA corresponding to this nucleic acid fragment.
In a typical embodiments, Alphavirus carrier by method preparation of the present invention comprises DNA, wherein a kind of inducible promoter instructs the transcribing of RNA molecule of coding sindbis alphavirus nsp1, nsp2, nsp3 and nsp4, the Syndebis subgene group promotor that effectively is connected with a kind of nucleic acid fragment with non-sindbis alphavirus source.The present invention also provides the Alphavirus carrier by method of the present invention preparation, uses the method for these Alphavirus carriers and comprises the composition of these Alphavirus carriers.
The present invention also provides the method that connects nucleic acid fragment, and wherein one or more nucleic acid fragments contain one or more viral packaging signals (for example deriving from one or more packaging signals of above-mentioned virus) such as (for example 1,2,3,4 kind).These packaging signals can be used to refer to the packing that the nucleic acid molecule of method preparation of the present invention is crossed in conducting.A kind of method of packing nucleic acid molecule for preparing is to import or express nucleic acid molecule of the present invention in expression is suitable for producing the proteinic package cell line of virus-like particle.The present invention also comprises the nucleic acid molecule of the present invention of packing, the method for the nucleic acid molecule of the present invention of preparation packing and comprise the composition of the nucleic acid molecule of the present invention of packing.
The present invention also provides composition and contains the test kit of these compositions, comprises the test kit that contains the composition that can be used for carrying out method of the present invention.On the one hand, a kind of composition of the present invention comprises the poly-peculiar separated component of a step in the method for the present invention.For example, a kind of composition of the present invention can comprise two or more identical or different nucleic acid molecule that carries topoisomerase.Term " different " as used herein, when being used for the nucleic acid molecule of composition of the present invention, be meant when best comparison, nucleic acid molecule have be lower than 95% sequence identity, generally be lower than 90% sequence identity, be usually less than 70% sequence identity.Therefore, for composition of the present invention, be the different nucleic acid molecule of multiform variant each other just for example, or just contain the nucleic acid molecule of 5 ' or 3 ' different outstanding sequences, do not think " different ".By comparison, the example of different nucleic acid molecule has: first kind of sequence of the peptide species of encoding and comprise a kind of second kind of sequence of regulatory element, or second kind of sequence of first kind of sequence of first peptide species of encoding and a kind of non-homogeneous polypeptide of coding.
When composition of the present invention comprises two or more isolating different IPs acid molecule or two or more when carrying the different IPs acid molecule of topoisomerase, these nucleic acid molecule all differ from one another, and promptly they all are different from each other.Yet, should be appreciated that each nucleic acid molecule, for example be called as the sequence of first kind of nucleic acid molecule, comprise the such nucleotide sequence of mutually the same or essentially identical a group usually.Therefore, should be understood that term " different " is used for comparison as first kind of nucleic acid molecule (or its colony) and second kind of (or other) nucleic acid molecule.Comprise two or more compositions that carry the different IPs acid molecule of topoisomerase and can also comprise a kind of topoisomerase.The example of these nucleic acid molecule of the composition that comprises composition of the present invention is disclosed at this, comprise, for example: encoding sequence, transcription regulatory element, translation adjusting element, coding can detect or the element of element, coded polypeptide territory such as the cellular compartment territory or the signal peptide of selected marker such as epi-position mark or antibiotics resistance gene, or the like.
Term " isolating " is meant as used herein, and the form of described molecule is different from the form that nature exists.For example, isolating nucleotide sequence can be any nucleotide sequence of a cellular genome part usually, perhaps physical sepn from the cell that contains this nucleotide sequence usually.Should be appreciated that different compositions of the present invention comprises the mixture of isolated nucleic acid molecule.Therefore it should be understood that term " isolating " just is used for from the state of nature isolated molecule, rather than refer to that this molecule is a kind of composition.
Composition of the present invention can comprise two kinds of different nucleic acid molecule, all one or two end or near contain the topoisomerase enzyme recognition site, with the locus specificity topoisomerase, this enzyme can and cut this nucleic acid molecule in the combination of topoisomerase enzyme recognition site place.Randomly, having at least a in the different IPs acid molecule may be the nucleic acid molecule that carries topoisomerase.Preferably, with covalently bound topoisomerase of the nucleic acid molecule that carries topoisomerase and said composition in topoisomerase belong to same family.
Can use different composition combinations in the method for the invention.For example, this method can be undertaken by contacting following composition: first kind of nucleic acid molecule of topoisomerase activated, and it randomly comprises one or more recombination sites; The second kind of nucleic acid molecule that contains first end and second end, wherein at first end or second end or this two ends, second kind of nucleotides sequence be listed in 3 ' end place or near contain a topoisomerase enzyme recognition site, contain a hydroxyl at 5 ' end place of same end; With a kind of topoisomerase.When 5 ' end of one or two end that will connect contained 5 ' phosphate group, a kind of Phosphoric acid esterase also can contact with the composition of reaction mixture.After the contact, second kind of nucleotide sequence of topoisomerase endonuclease capable cutting, produce second kind of nucleic acid molecule of a kind of topoisomerase activated, in case of necessity, Phosphoric acid esterase can produce one 5 ' hydroxyl at same end, and second kind of nucleic acid molecule can be covalently bound with first kind of nucleic acid molecule of topoisomerase activated then.Therefore, should be appreciated that composition of the present invention can comprise any different composition combination that can be used for carrying out method of the present invention.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
The method of the present invention of producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains is usually based on to judge: two covalently bound double-stranded recombinant nucleic acid molecules of chain can be by first kind of nucleic acid molecule of contact and second kind of nucleic acid molecule generation, wherein first kind all contains the topoisomerase enzyme recognition site with second kind of sequence at the end that will be connected, 5 '-(C/T) CCTT-3 ' (Shuman for example, together above, 1991; U.S. Patent number 5,766,891).After the cutting, the locus specificity topoisomerase is covalently bonded in 3 ' end.Nucleotides sequence after the cutting is listed in when also containing one 5 ' hydroxyl in conjunction with the identical end of topoisomerase, the end combination of two kinds of nucleotide sequences, the topoisomerase endonuclease capable on each 3 ' end will be held the covalently bound (see figure 1) of 5 ' hydroxyl that lists with the bonded nucleotides sequence.
As used herein, " under the condition that all the components can contact " first kind of nucleotide sequence of contact and at least a second kind of nucleotide sequence are meant, it is fully close that this reaction conditions is suitable for the nucleotide sequence end of topoisomerase cutting, make the topoisomerase endonuclease capable reach its enzymic activity, and 3 ' or 5 ' end of first kind of nucleotide sequence is covalently bound with 5 ' or 3 ' end of second kind of nucleotide sequence respectively.The example of these conditions disclosed herein, comprise temperature of reaction, centrifugal intensity, pH etc., for example specific 5 ' of the end of topoisomerase cutting back generation give prominence to needed other felicity condition of sequence, can rule of thumb determine, perhaps determine with the general formula of the condition of predicting the nucleotide sequence specific hybridization, as well known in the art (referring to, people such as Sambrook for example, " molecular cloning: laboratory manual " (Cold Spring Harbor Laboratory Press1989); People such as Ausubel, " modern molecular biology method ", John Wiley and Sons, Baltimore, MD (1987 and nineteen ninety-five supplementary issue) all is incorporated herein by reference).
In one embodiment, method of the present invention provides a kind of method, is used for encoding sequence by one or more regulatory elements of effective connection and deduction, makes the open reading frame of cDNA or isolating genomic dna sequence to express.Therefore, the first kind of enough a kind of primer of nucleic acid molecule energy that comprises a kind of open reading frame is to pcr amplification, produce first kind of nucleic acid molecule of amplification, it contains the topoisomerase enzyme recognition site at one or two end, randomly, contain one or more recombination sites as desired, make that one or two end contains definite 5 ' or 3 ' overhang or flush end after cutting with the locus specificity topoisomerase.When two of first kind of nucleic acid molecule of such structure amplification were terminal, 5 ' or 3 ' outstanding sequence usually but be not to differ from one another.Under the condition that helps recombinating, first kind of nucleic acid molecule of amplification can contact second kind of nucleic acid molecule, the latter contains the regulatory element that is hopeful, as promotor, in certain embodiments, (a) one or more topoisomerase enzyme recognition sites, with a kind of topoisomerase and/or (b) one or more recombination sites, 5 ' end of second kind of nucleotide sequence and encoding sequence is effectively covalently bound to utilize method of the present invention.
In this method, second kind of (or other) nucleic acid molecule also can comprise two or more regulatory elements, for example promotor, internal ribosome entry site and ATG initial methionine codon etc., or other aim sequence, for example encode a kind of sequence of epi-position mark, they are covalently bound each other, and can be effectively covalently bound with 5 ' end of the first kind of nucleic acid molecule that comprises encoding sequence.This method can also comprise the third nucleic acid molecule of contact, and the latter comprises for example polyadenylation signal, and is can the method according to this invention effectively covalently bound with 3 ' end of encoding sequence, thereby produces a kind of expression type two strands recombinant nucleic acid molecules.Therefore, method of the present invention provides a kind of method of producing functional double-stranded recombinant nucleic acid molecules, and this molecule can transcribe, translate as functional unit or transcribe and translate.As disclosed herein, will contain complementation 5 ' or 3 ' the outstanding sequence that the topoisomerase cutting produces by the nucleic acid molecule end that the locus specificity topoisomerase links together, help producing the double-stranded recombinant nucleic acid molecules of the nucleotide sequence that in construct, contains desired directions.
In another embodiment, carry out method of the present invention, making win kind of nucleic acid molecule or second kind (or other) nucleic acid molecule or its combination is one of a group nucleotide sequence.Term " colony (plurality) " is meant that nucleotide sequence is relevant but inequality when being used for first kind or at least the second kind of nucleotide sequence as used herein.For the present invention, a group nucleotide sequence " is correlated with ", contains a topoisomerase enzyme recognition site or its cleaved products and/or at least one recombination site at least because each nucleotides sequence in this colony is listed in one or more ends.In addition, the nucleotide sequence in the kind of groups is " difference ", and they for example can comprise cDNA library, nucleotide sequence combinatorial library, diversified nucleotide sequence colony etc.Preparation cDNA library, combinatorial library, the method in library etc. that contains diversified nucleotide sequence colony well-known in this area (referring to, for example: U.S. Patent number 5,837,500; U.S. Patent number 5,622,699; U.S. Patent number 5,206,347; Scott and Smith, Science 249:386-390,1992; People such as Markland, Gene 109:13-19,1991; People such as O ' Connell, Proc.Natl.Acad.Sci.USA 93:5883-5887,1996; Tuerk and Gold, Science249:505-510,1990; People such as Gold, Ann.Rev.Biochem.64:763-797,1995; All be incorporated herein by reference).
The present invention also provides a kind of method of producing double-stranded recombinant nucleic acid molecules, comprise: with the part of a kind of PCR primer the first kind of nucleic acid molecule that increase, wherein right at least one primer of this primer coding topoisomerase enzyme recognition site or its cleaved products, randomly one or more recombination sites, thereby produce the first kind of nucleic acid molecule that contains first end and second end, wherein first end or second end or this two ends contain a topoisomerase enzyme recognition site at 3 ' end and/or 5 ' end place; Contact first kind of nucleic acid molecule then; At least the second kind of nucleic acid molecule that contains first end and second end, wherein first end or second end or this two ends contain topoisomerase enzyme recognition site or its cleaved products at 3 ' end and/or 5 ' end place; With the topoisomerase (see figure 1).When under an end of end of the first kind of nucleic acid molecule that is containing the topoisomerase enzyme recognition site and at least the second kind of nucleic acid molecule that contains the topoisomerase enzyme recognition site can the bonded condition, contacting, produce two double-stranded recombinant nucleic acid molecules that chain is covalently bound.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.The present invention also comprises the nucleic acid molecule by method of the present invention preparation, comprises the composition of these nucleic acid molecule and uses the method for these nucleic acid molecule.
As disclosed herein, a kind of PCR method utilizes primer to mix one or more topoisomerase enzyme recognition sites and randomly one or more recombination site at one or two end of amplifier nucleic acid molecule, and this method provides produces a kind of facilitated method that can be used for method of the present invention.In some embodiments, at least one right design of primers of primer is held complementary nucleotide sequence (being the special district of target) for comprising with 5 '-3 ' direction with topoisomerase enzyme recognition site complementary nucleotide sequence with the target nucleic acid molecule 3 ' that will increase.In addition, this primer also can locate to contain random length (generally about 1-100 Nucleotide at 5 ' of topoisomerase enzyme recognition site complement, common about 2-20 Nucleotide, the nucleotide sequence of a kind of hope especially about 4-12 Nucleotide), after amplified production is by the cutting of locus specificity topoisomerase, form the 5 ' overhang of wishing.The right second primer of PCR primer may with the sequence complementation of the hope of the nucleotide sequence that will increase, and the complement that can comprise the topoisomerase enzyme recognition site, after being cut, will produce the sequence of 5 ' overhang by the locus specificity topoisomerase, or any other sequence of wishing.
This primer other any aim sequence that can comprise or encode comprises, for example, the site-specific integration recognition site, as att site, lox site etc., perhaps as mentioned above, can only be used in the nucleic acid molecule that comprises this aim sequence, importing the topoisomerase enzyme recognition site.The method according to this invention double-stranded recombinant nucleic acid molecules that produce, that contain site-specific integration recognition site such as att site or lox site, can be by in the locus of the special hope that is incorporated into the integration site (respectively as att site or lox site) that contains needs, as in a kind of carrier, a kind of locus etc., and the required suitable enzyme of contact site-specific incident, respectively as λ Int and IHF protein or Cre recombinase.For example, the method according to this invention is mixed attB or attP sequence in the covalently bound double-stranded recombinant nucleic acid molecules of two chains, allow to utilize GATEWAY TMCloning system (Invitrogen Corp., La Jolla CA) is operated this nucleic acid molecule easily.
In one embodiment, by PCR reaction or other amplified reaction a kind of construct that the method according to this invention produces that further increases.It is possible that the double-stranded recombinant nucleic acid molecules that the method according to this invention is produced directly carries out PCR, because this construct at least one chain is covalently bound.Therefore, can produce a large amount of constructs with PCR.The more important thing is that as mentioned above, PCR provides a kind of in-vitro screening method, be used for only obtaining the product of the hope that the method according to this invention produces, and do not obtain the partial reaction product.For example, can produce the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains with method of the present invention, it effectively comprises with 5 '-3 ' direction with connecting: contain promotor first kind of nucleic acid molecule, contain second kind of nucleic acid molecule of coding region and contain the third nucleic acid molecule of polyadenylation signal.
As disclosed herein, on the end of the nucleic acid molecule that will connect, comprise complementary 5 ' outstanding sequence and can produce construct with pre-determined direction.By selecting a kind of PCR primer right, can produce the functional amplified production that comprises promotor, coding region and polyadenylation signal, this primer is to comprising nucleic acid molecule complementary with first kind, as to be positioned at promoter sequence upstream article one primer and second primer nucleic acid molecule complementary with the third, that be positioned at the polyadenylation signal downstream.On the contrary, the partial reaction product that lacks first kind of nucleic acid molecule or the third double chain nucleotide does not increase, because article one or second primer are not hybridized with portion of product respectively.In addition, because first kind of 5 ' outstanding sequence with the third nucleic acid molecule lacks complementarity, can not produce the construct that lacks second kind of nucleic acid molecule.Therefore, method of the present invention provides the method for the covalently bound functional double-stranded recombinant nucleic acid molecules of a kind of two chains that obtain to wish.
Use PCR by this way a kind of method further is provided, it is in order to identify the purpose construct, a large amount of nucleic acid molecule that screening the method according to this invention is produced.Because it is conventional using the method for PCR in automatic high throughput analysis, and well-known, should be known in that method of the present invention correct easily is to use in high throughput system.Utilize this system, can a large amount of constructs of parllel screening, and can identify and treating part or incomplete reaction product, thereby avoid waste time and funds, also need in addition to characterize these constructs or check the functional of these constructs with further testing.
Method of the present invention has extensive use in biology field.As hereinafter describing in detail, for example, can utilize method marker DNA of the present invention or rna probe, carry out directed cloning (seeing embodiment 1B), produce justice or antisense rna molecule (seeing embodiment 2A) are arranged, preparation is used to carry out bait (bait) or prey (prey) construct (seeing embodiment 2C) that double cross measures, prepare linear Expression element (seeing embodiment 2A and 2B), construct (seeing embodiment 2B) that preparation can be used for coupling in-vitro transcription/translation mensuration.For example, a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains provides the method for a kind of production of linear Expression element (LEE), this element is made up of a kind of linear nucleic acid molecule, this molecule comprises two or more nucleotide sequences, as promotor or other regulatory element (seeing embodiment 1) of being connected with a kind of open reading frame.It is reported effectively transfectional cell of LEE, thus need be in carrier clonal expression element (Sykes and Jonhston, Nat.Biotechnol.17:355-359,1999).The non-covalent connection of composition possibility of LEE perhaps may be covalently bound by ligation.The preparation of the LEE of non-covalent connection need utilize each nucleotide sequence element of PCR primer amplification that contains the deoxyuridine residue, handles PCR product, the overhang that generation can be hybridized with uridylic-DNA glycosylase then.Yet the transfection efficiency that uses the LEE of this non-covalent connection is variable, sometimes, and far below the efficient of covalently bound LEE (Sykes and Jonhson, with above, 1999).In addition, these LEE are unsuitable for the template as pcr amplification, because primer extension reaction can not stride across the otch on the template, therefore stop, and produce incomplete reaction product.
A kind of method of the present invention provides a kind of method of directly, simply producing covalently bound LEE, thereby has avoided former for the described inconvenience of preparation LEE and other step, and has reduced the variability of the transfection efficiency that exists as the LEE with non-covalent connection.For example, first kind of nucleic acid molecule of coding purpose open reading frame be pcr amplification as disclosed herein, to obtain topoisomerase enzyme recognition site or its cleaved products at one or two end.In addition, the PCR primer can also be designed behind first kind of nucleic acid molecule with locus specificity topoisomerase cutting amplification, and cleaved products contains predetermined and 5 ' outstanding sequence that wish.Second kind of nucleotide sequence (with the third or more, as desired) except containing topoisomerase enzyme recognition site or its cleaved products, a kind of regulatory element can also comprise or encode, for example promotor, enhanser, silencer, acceptor splicing site, translation initiation site, ribosome recognition site or internal ribosome entry site, poly-adenosine signal, initial methionine codon or terminator codon, perhaps can the encode sequence of other any hope is as epi-position mark or cellular compartment territory.Preferably, will contain and 5 ' overhang complementary, 5 ' outstanding sequence at the end of first kind of nucleic acid molecule that will be connected with first kind of nucleic acid molecule covalently bound second kind (or other) nucleic acid molecule.Behind this nucleotide sequence of contact in the presence of the topoisomerase, for example, promotor can be effectively covalently bound with 5 ' end of open reading frame, polyadenylation signal can be effectively covalently bound with 3 ' end of open reading frame, thereby produce a kind of covalently bound functional LEE (referring to embodiment 1).
The example that can be used for regulatory element of the present invention is open at this, comprises transcription regulatory element, translation adjusting element, helps in the cell (or outside) nucleotide sequence or polypeptide transhipment or localized element, the element that can detect phenotype etc. is provided.Transcription regulatory element comprises, for example: promotor, as promotor from cytomegalovirus, moloney leukemia virus and simplexvirus, and the promotor of coming the gene of own coding metallothionein(MT), skeletal muscle filamentous actin, Phosphoenolpyruvate carboxylase, phosphoglyceride, Tetrahydrofolate dehydrogenase and thymidine kinase, and from the promotor of viral long terminal repeat (LTR), and operator gene as Rous sarcoma virus LTR; Enhanser can be a constitutive activity, as the immunoglobulin (Ig) enhanser, or induction type, as the SV40 enhanser; Or the like.For example, metallothionein promoter is a kind of constitutive activity promotor, also can induce high level expression after being exposed to metal ion such as copper, nickel or cadmium ion.By comparison, tsiklomitsin (tet) inducible promoter is an example of inductive promotor after being exposed to tsiklomitsin or tetracycline analogue, but does not have activity.Transcription regulatory element also may be tissue-specific regulatory element, and the special regulatory element of myocyte for example makes the expression of coded product be only limited to the myocyte in the body one by one, the perhaps myocyte in the culturing cell population mixture (for example organ cultures).The special regulatory element of myocyte is well-known in ability, comprise for example muscle creatine kinase promotor (people such as Sternberg, Mol.Cell.Biol.8:2896-2909,1988, be incorporated herein by reference) and myosin light chain enhancers/promoters (people such as Donoghue, Proc.Natl.Acad.Sci.USA 88:5847-5851,1991, be incorporated herein by reference).Other tissue-specific promotor, and the regulatory element of only expressing in the specific etap of cell or biology, also well-known in the art.
In other embodiments, contained regulatory element may be one or more operator genes in the nucleotide sequence that use in the embodiment of this invention or its generation.Multiple operator gene known in this field.Be applicable to a trp operator that example is the intestinal bacteria tryptophan operon of operator gene of the present invention.When the tryptophane repressor combined with two tryptophane molecules, in conjunction with the intestinal bacteria operator gene, when the appropriate location that is positioned at respect to promotor, blocking-up was transcribed.Another example that is applicable to operator gene of the present invention is the operator gene of intestinal bacteria tetracycline operator.The composition of also finding colibacillary tetracyclin resistance system works in eukaryotic cell, has been used for regulatory gene to express.For example, when not containing tsiklomitsin, can in vegetable cell, express in conjunction with the tsiklomitsin repressor that tsiklomitsin operator gene and suppressor gene are transcribed, its concentration is enough to suppress the promotor transcriptional start (people such as Gatz, Plants 2:397-404 (1992)) from containing tsiklomitsin operator gene sequence.For example, U.S. Patent number 5,789,156 have described the expression system that tsiklomitsin is regulated, and its complete disclosure is incorporated herein by reference.Other example that can be used for operator gene of the present invention comprise Lac operator gene and intestinal bacteria molybdenum salt transhipment operator gene/promoter systems operator gene (referring to, people such as Cronin for example, people such as GenesDev.15:1461-1467 (2001) and Grunden, J.Biol.Chem., 274:24308-24315 (1999)).
Therefore, in specific embodiments, the invention provides the method for preparing nucleic acid molecule, this molecule contains can be used for regulating one or more operator genes of expressing in protokaryon or the eukaryotic cell.Those skilled in the art are to be understood that, when placing, deposits in vivo or following time of condition of in-vitro transcription mechanism the nucleic acid molecule that contains a kind of operator gene, usually by making this nucleic acid molecule contact a kind of repressor or one or more help suitable repressor and operator gene bonded metabolite, the adjusting of expressing.Therefore, the present invention also provides the method for the nucleic acid molecule of the repressor that preparing encodes can regulate the operator gene function, and by the nucleic acid molecule that method of the present invention prepares, comprises the purposes of composition and these molecules and the composition of these nucleic acid molecule.
Useful adjusting or other element can obtain with several different methods in the method according to this invention production construct.Particularly, multiple element is contained in the commercially available carrier, can therefrom separate, and can enough PCR method as disclosed herein modify, to contain the topoisomerase enzyme recognition site at one or two end.In addition, the sequence of useful herein element or its sequence of encoding are generally well-known, and open in publication.Under many situations, these elements, for example multiple transcribing and translation adjusting element, and cellular compartment territory are relatively short sequences, therefore, are suitable for element or the chemosynthesis of the nucleotide sequence of this element of encoding.Therefore, in one embodiment, a kind of element that can chemosynthesis comprises composition of the present invention, it can be used for producing double-stranded recombinant nucleic acid molecules by method of the present invention, perhaps be contained in the test kit of the present invention, can synthesize when wishing, make it to contain the topoisomerase enzyme recognition site, after the cutting of locus specificity topoisomerase, further contain a kind of outstanding sequence at one or two end of this element.
A kind of carrier that carries topoisomerase can enough following methods produce (Genome Res.9:383-392,1999): with a kind of carrier of restriction enzyme linearizing that can produce " cohesive end ".Utilize ligase enzyme such as T4 dna ligase, be connected with two chains with two ends of linearizing DNA connecting oligonucleotide.This connection oligonucleotide contains and locatees a kind of 5 '-CCCTT-3 ' cowpox topoisomerase I type recognition sequence, and it can be cut by topoisomerase, and catches covalency topoisomerase-DNA mixture at each 3 ' end of this carrier.Connection carrier is with the cowpox topoisomerase and the annealed oligonucleotide incubation of purifying, in each terminal form " topoisomerase site " of this carrier then.The annealed oligonucleotide is used for producing fracture or otch in " end " chain, and is relative with last T of the oligonucleotide that contains 5 '-CCCTT-3 '.The oligonucleotide junction fragment (" leavings group ") that is positioned at topoisomerase cleavage site " downstream " discharges in topoisomerase cutting back, is removed in topoisomerase-carrier purge process.When " leavings group " do not contain 5 ' hydroxyl, topoisomerase was contained in the covalent complex with the DNA end, produces a kind of carrier that carries topoisomerase.
When the covalently bound nucleic acid molecule of the method according to this invention, nucleotide sequence is effective usually to be connected, and makes the recombinant nucleic acid molecules that produces have the structure of hope, and exercises the function of hope or the expression product of a kind of hope of encoding.Term " effective connection " is meant as used herein, and two or more nucleotide sequences position respect to one another makes them can obtain be attributable to the function of one or both sequences or its combination as a kind of unit.Term " effectively covalently bound " is used to refer to the nucleotide sequence of effective connection at this, and it is to produce according to the method for the present invention that is used to produce the covalently bound double-stranded recombinant nucleic acid molecules of or two chains.For example, the nucleotide sequence that contains a kind of open reading frame can effectively be connected with a kind of promotor, make this promotor to apply regulating effect to open reading frame, its regulative mode is similar to the mode that relevant with the cellular genome usually open reading frame of influence is expressed.Similarly, two or more nucleotide sequences that comprise open reading frame can effectively connect in frame, make that transcribing and translate the back produces a kind of chimeric fusion polypeptide.
Although a chain or two covalently bound double-stranded recombinant nucleic acid molecules of chain that the method according to this invention is produced are linear, the construct that produces also may be the double-stranded recombinant nucleic acid molecules of cyclisation.In addition, also can produce the double-stranded recombinant nucleic acid molecules of a kind of ring-type, make it have the feature of carrier, and for example contain and in prokaryotic host cell, eukaryotic host cell or this two kinds of cells, duplicate required regulatory element, and can contain the nucleotide sequence that a kind of coding provides the polypeptide of antibiotics resistance, or the like.An advantage of this method is, the double-stranded recombinant nucleic acid molecules of the generation of the method according to this invention cyclisation can transform or the transfection appropriate host cell, and this construct obtains amplification therein.Therefore, except in vitro method such as PCR---it can be used for the double-stranded recombinant nucleic acid molecules of a large amount of linearities that production the method according to this invention produces, and also can utilize a kind of in vitro method of using host cell to obtain a large amount of cyclisation product that the method according to this invention is produced.These elements comprise cellular replication starting point, antibiotics resistance gene etc., and they contain with good grounds topoisomerase enzyme recognition site of the present invention, may be contained useful components in the test kit of the present invention as disclosed herein.
Be to be understood that, article one, chain or two covalently bound linear double-stranded recombinant nucleic acid molecules of chain also can be cloned in a kind of carrier, can be a kind of plasmid vector or virus vector, as phage, baculovirus, retrovirus, slow virus, adenovirus, vaccinia virus, Semliki Forest virus and adeno-associated virus vector, they are all well-known, can be available from supplier (Promega, Madison WI; Stratagene, La Jolla CA; GIBCO/BRL, GaithersburgMD).When wishing, can the method according to this invention, for example use the PCR method, linearizing is also modified carrier, make it contain topoisomerase enzyme recognition site or its cleaved products, perhaps can make up and (see that usually Meth.Enzymol.Vol.185, Goeddel write (Academic Press by those skilled in the art at one or two 3 ' end, Inc., 1990); Jolly, Canc.GeneTher.1:51-64,1994; Flotte, J.Bioenerg.Biomemb.25:37-42,1993; People such as Kirshenbaum, J.Clin.Invest.92:381-387,1993; All be incorporated herein by reference).
When producing the covalently bound double-stranded recombinant nucleic acid molecules of or two chains with method of the present invention, when promptly particularly importing in patient's cell in cell, virus expression carrier is useful especially.Virus vector has can be with higher relatively efficient host cells infected and the advantage that can infect the specific cells type or can modify the specific cells among the postoperative infection host.
Developed the virus vector that is used for the specific host system, comprised, for example: the baculovirus vector of infected insect cell; Retroviral vector, other lentiviral vectors, as based on the carrier of human immunodeficiency virus (HIV), adenovirus carrier, adeno associated virus (AAV) carrier, herpesvirus vector, vaccinia virus vector etc., their mammalian cell-infectings are (referring to Miller and Rosman, BioTechniques 7:980-990,1992; People such as Anderson, Nature 392:25-30 Suppl., 1998; Verma and Somia, Nature 389:239-242,1997; Wilson, New Engl.J.Med.334:1185-1187 (1996) all is incorporated herein by reference).For example, can be with a kind of viral vector infection T cell based on HIV, for example, and can be with a kind of viral vector infection airway epithelial cell based on adenovirus, can be with a kind of viral vector infection neuronal cell based on simplexvirus.Other carrier as the AAV carrier, may have bigger host cell scope, therefore, can be used for infecting the various kinds of cell type, although also can be with special acceptor or ligand modified virus or non-virus carrier, to change target-specific by receptor-mediated incident.
Can with the effectively covalently bound first kind of nucleic acid molecule that contains an open reading frame of a kind of method of the present invention with contain second kind of an open reading frame (and other) nucleic acid molecule, produce a kind of nucleic acid molecule of the chimeric polyeptides of encoding.Chimeric polyeptides comprises a kind of fusion polypeptide, and wherein two kinds of (or multiple) encoded peptides (or polypeptide) are translated into a kind of product, that is, peptide is covalently bound by peptide bond.For example, first kind of nucleic acid molecule a kind of cellular compartment territory of can encoding, as plasma membrane locator field, nuclear localization signal, mitochondrial membrane signal for locating, endoplasmic reticulum signal for locating etc., or a kind of protein transduction domain, as human immunodeficiency virus TAT protein transduction domain, the peptide that it helps being attached thereto to intracellular transfer (referring to people such as Schwarze, Science285:1569-1572,1999; People such as Derossi, J.Biol.Chem.271:18188,1996; People such as Hancock, EMBO J.10:4033-4039,1991; People such as Buss, Mol.Cell.Biol.8:3960-3963,1988; U.S. Patent number 5,776,689 all is incorporated herein by reference).This territory can be used for target and comprise the fusion polypeptide in this territory and the polypeptide of second kind of nucleic acid molecule encoding, and the specific compartment in its method according to this invention and the cell is covalently bound, or from emiocytosis or enter cell.Therefore, the invention provides a kind of method of producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains of coding chimeric polyeptides.
A kind of fusion rotein that the nucleic acid molecule of being produced by the method according to this invention is expressed also can comprise a kind of peptide with feature of detectable label or label, makes it possible to detect, separate the fusion polypeptide of expression etc.For example, as disclosed herein, the nucleic acid molecule that contains topoisomerase enzyme recognition site or its cleaved products a kind of enzyme of can encoding is as alkaline phosphatase, beta-galactosidase enzymes, E.C. 2.3.1.28, luciferase or other enzyme; It is a kind of peptide-labeled perhaps to encode, as polyhistidyl sequence (for example six Histidines), V5 epi-position, c-myc epi-position; Hemagglutinin A epi-position, FLAG epi-position etc.Comprise the expression of the fusion polypeptide of detectable label can be enough suitable reagent detect, for example, after in the fusion polypeptide that comprises luciferase, adding luciferin, detecting optical radiation, perhaps detect combining of nickel ion and the fusion polypeptide that comprises polyhistidine tag.Similarly, can comprise a kind of separation of fusion polypeptide of mark, for example, make the fusion polypeptide that comprises the myc epi-position by contain bonded with it anti--post of c-myc epitope antibodies, the fusion polypeptide of elution of bound then, perhaps make the fusion polypeptide that comprises polyhistidine tag by nickel ion or cobalt ion affinity column, the fusion polypeptide of elution of bound.Detect or to separate the method for these fusion polypeptide well-known in this area, based on the selected marker of selecting or label (referring to, for example, people such as Hopp, BioTechnology 6:1204,1988; U.S. Patent number 5,011,912; All be incorporated herein by reference).
Method of the present invention also can be used for detecting a kind of nucleotide sequence that contains chemistry or organic or inorganic small portion of ground mark, makes this nucleotide sequence can be used as probe.For example, but the nucleic acid molecule that contains topoisomerase enzyme recognition site or its cleaved products at 3 ' end can contain bonded test section with it, the vitamin H that if can detect with avidin or Streptavidin, fluorescent chemicals (for example Cy3, Cy5, Fam, fluorescein or rhodamine), radionuclide (for example Sulphur-35, technetium-99, phosphorus-32 or tritium), paramagnetic rotary label (for example carbon-13), chemiluminescence compound etc., make that the nucleic acid molecule of generation is labeled after the method according to this invention is produced covalently bound double-stranded recombinant nucleic acid molecules.Can detect ground mark contain the method for nucleotide sequence of this part well-known in this area (referring to, for example, Hermanson, " biological coupling technology " (AcademicPress 1996) are incorporated herein by reference).In addition, also can catch the double chain acid molecule of producing by the present invention with a kind of detectable label.At last, can use detectable label, the biological example element, the topoisomerase end that contains of first kind of nucleic acid molecule of blocking-up is connected with the mark of second kind of nucleic acid molecule is terminal, thereby the method for the unmarked end of second kind of nucleic acid molecule of a kind of direct connection is provided.Should be appreciated that as disclosed herein or these known elements of this area, comprise Codocyte compartmentation territory, detectable label or label or comprise and transcribe or the nucleotide sequence of translation adjusting element, may be the useful component of test kit as disclosed herein.
Method of the present invention provides a kind of method of producing double-stranded recombinant nucleic acid molecules easily, and this molecule encoding for example can be used for carrying out the chimeric polyeptides that double cross is measured.In this method, first kind of nucleic acid molecule encoding one peptide species, or its domain of dependence have been suspected or checking and the special interactional ability of one or more other polypeptide.First kind of nucleic acid molecule makes it to contain a topoisomerase enzyme recognition site at one or two end as modify publicly herein, when wishing, contains 5 ' outstanding sequence.Will the method according to this invention and first kind of second kind of nucleic acid molecule that nucleic acid molecule is covalently bound, can encode a kind of transcription activating domain or DNA in conjunction with territory (embodiment 2C), and contain a topoisomerase enzyme recognition site or its cleaved products, with terminal complementary 5 ' the outstanding sequence of first kind of nucleic acid molecule that will be connected.Behind a kind of topoisomerase of contact, if this nucleotide sequence does not contain topoisomerase, then produce first kind of heterozygote, its can be used for carrying out double cross measure (referring to, for example Fields and Song, Nature 340:245-246,1989; U.S. Patent number 5,283,173; People such as Fearon, Proc.Natl.Acad.Sci.USA89:7958-7962,1992; People such as Chien, Proc.Natl.Acad.Sci.USA88:9578-9582,1991; Young, Biol.Reprod.58:302-311 (1998) all is incorporated herein by reference), or the modification of double cross mensuration, measure (Leanna and Hannink, Nucl.Acids Res.24:3341-3347 as reverse double cross, 1996, be incorporated herein by reference), the trans-activation system (U.S. Patent number 5,885,779 that suppress, be incorporated herein by reference), protein replenishment system (U.S. Patent number 5,776,689, be incorporated herein by reference) etc.Produce second kind of hybrid albumen with similar method, it can comprise multiple polypeptides, will detect the ability of it and first kind of proteic polypeptide of hybrid or its domain interaction.
Similarly, producing this method of chimeric protein can carry out according to the method that the present invention produces the covalently bound double-stranded recombinant nucleic acid molecules of chain, wherein use first kind and second kind of nucleic acid molecule comprising locus specificity topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) or its cleaved products at least one 5 ' end of the end that will connect, wherein this nucleic acid molecule can also comprise complementary 3 ' overhang after with the topoisomerase cutting.
Similarly, producing this method of chimeric protein can carry out according to the method that the present invention produces the covalently bound double-stranded recombinant nucleic acid molecules of two chains, wherein use first kind and second kind of nucleic acid molecule comprising locus specificity topoisomerase enzyme recognition site or its cleaved products at least at 5 ' end of the end that will connect, wherein this nucleic acid molecule can also comprise complementary 3 ' overhang after with the topoisomerase cutting; One of or first kind or second kind nucleic acid molecule, its 5 ' end and 3 ' end at least one end comprises topoisomerase enzyme recognition site or its cleaved products, other nucleic acid molecule contains one 3 ' hydroxyl and 5 ' hydroxyl at the end that will connect, wherein after the topoisomerase cutting, the nucleic acid molecule that contains topoisomerase contains 5 ' or 3 ' overhang at the end of other nucleic acid molecule that will connect, and this overhang is complementary to and helps respectively hybridization with 5 ' or 3 ' overhang or flush end.
In an alternative embodiment, the present invention also provides a kind of method to clone or expression vector interior orientation insertion dna fragmentation, and it has the clone's of topoisomerase mediation easy to be capable property and efficient.The present invention also is better than current cloning system, because it has reduced the required loaded down with trivial details screening process of identifying with the direction clone of hope of insertion fragment.The simple form of this aspect of the present invention is made up of the linear expression vector of all containing covalently bound topoisomerase molecule at two 3 ' ends.At least one end of linearized vector contains 5 ' strand overhang, and opposing ends may be a flush end, has a 3 ' T who can be used for the T/A clone and extends, and perhaps itself can contain the outstanding sequence of second 5 ' strand.These single stranded sequence overhangs are also referred to as " SSS " at this, can be made up of any suitable sequence.
The cloning vector that this aspect structure carries topoisomerase according to the present invention can followingly carry out: for example, endonuclease digestion carrier (can be pDONR carrier (seeing Figure 32) or pDEST carrier (seeing Figure 33)), complementary subsequently annealing synthetic oligonucleotide, and cut heteroduplex with cowpox topoisomerase I site-specific ground.Produce special cohesive end with any suitable endonuclease digestion carrier.The oligonucleotide of customization can be annealed with these cohesive ends, and has the sequence (seeing Figure 32 and 33) that can form the customization end of this carrier after topoisomerase I is modified.According to application target, the sequence of SSS and length are with different.
In a purposes of the TOPO SSS carrier that the present invention provides aspect this, will insert and carry an intravital dna fragmentation is a kind of PCR product.After the amplification of customization primer PCR, product can directed be inserted in one or two end that inserts the site and contain in the cloning vector that carries topoisomerase I of SSS.The customization primer can be designed as, and at least one right primer of primer contains another kind of sequence at its 5 ' end.The sequence of adding can be designed as with carrier in the complementation of strand overhang sequence.Complementarity mediation PCR product between 5 ' strand overhang in the carrier and the PCR product 5 ' end is to intravital directed insertion of carrying of topoisomerase mediation.Particularly, owing to have only an end of carrier and an end of PCR product to have complementary SSS district, the insertion of this product is directed.Topoisomerase I catalysis PCR product is connected with carrier.
This aspect of the present invention also provides a kind of cloning vector of modification, and it contains outstanding single stranded DNA fragment (SSS), carries topoisomerase, or " TOPO SSS carrier ".The carrier of modifying allows directed insertion open reading frame pcr amplification or that be suitable for expressing subsequently (ORF), and has the clone's of topoisomerase mediation efficient.
As mentioned above, topoisomerase is by the class of enzymes of DNA chain break and the topology state that is connected modifying DNA again (people such as Shuman, U.S. Patent number 5,766,891 is incorporated herein by reference).The vaccinia virus a kind of 314 amino acid whose I type topoisomerases of encoding, this enzyme can site-specific ground strand cutting double-stranded DNA, and the connection again that guides of 5 ' hydroxyl.Site-specific I type topoisomerase includes but not limited to viral topoisomerase, as the poxvirus topoisomerase.The example of poxvirus topoisomerase comprises rabbit fibroma virus and ORF virus.Known other locus specificity topoisomerase of those skilled in the art also can be used for implementing the present invention.
Shuman claims, the cowpox topoisomerase is in conjunction with double-stranded DNA and cut the phosphodiester backbone of a chain, shows high-caliber sequence-specific.Cutting occurs in easily to split and has five pyrimidine elements, 5 '-(C/T) CCTT-3 ' or a correlated series place in the chain.In one embodiment, easily split bond length double-stranded DNA 3 ' end 2-12bp.In another embodiment, the formation of the mixture that can be cut by the cowpox topoisomerase needs 6 double chain nucleotides of cleavage site upstream and 2 Nucleotide in downstream.The example of the sequence that the cowpox topoisomerase can cut includes but not limited to :+6/-6 duplex G CCCTTATTCCC ,+8/-4 duplex TCG CCCTTATTC ,+10/-2 duplex TGTCG CCCTTAT ,+11/-1 duplex GTGTCG CCCTTA.
The example of other locus specificity I type topoisomerase is well-known in this area.These enzymes are by multiple biological coding, include but not limited to yeast saccharomyces cerevisiae, grain brewer yeast and tetrahymena (Tetrahymena), however the topoisomerase I of these kinds is lower than cowpox topoisomerase (Lynn, R.M. to the specificity of consensus sequence, Bjornsti, M., Caron, P.R. and Wang, J.C., (1989) " peptide sequencing and site-directed mutagenesis are identified tyrosine-the 727th, the avtive spot tyrosine of yeast saccharomyces cerevisiae DNA topoisomerase I ", Proc.Natl.Acad.Sci.USA, 86:3559-3563) (Eng, W., Pandit, S.D. and Sternglanz, R., (1989) " mapping of the avtive spot tyrosine of eukaryotic DNA topoisomerase I " J.Biol.Chem., 264:13373-13376) with (Busk, H., Thomsen, B., Bonven, B.J., Nielsen, O.F. and Westergaard, O. (1987) " the preferential of super coiled DNA that contains topoisomerase I ten hexasomic recognition sites relaxes ", Nature, 327:638-640).
Used as this aspect of the present invention herein, the term donor is meant near a kind of double-stranded DNA that contains 5 '-CCCTT cleavage site 3 ' end, and the term acceptor is meant a kind of double-stranded DNA that contains 5 '-OH end.In case activated by the topoisomerase covalency, donor promptly is transferred to these and SSS complementary acceptor.
This aspect according to the present invention is inserted for the orientation that helps dna fragmentation, further transforms the carrier of topoisomerase enzyme modification, makes it to contain the outstanding sequence of at least a 5 ' strand.A preferred embodiment, the fragment that will clone is a kind of PCR product, and it forms the open reading frame of being expressed by the recombinant vectors that produces (ORF).Be designed for the primer of amplification ORF, make at least one right primer of primer contain another sequence at its 5 ' end.This sequences Design is 5 ' the strand overhang sequence complementation contained with the carrier of topoisomerase enzyme modification of the present invention.
It is preferred but be not only embodiment that aspect this some has been described in detail in detail in following embodiment 5-8 according to the present invention.
Utilize the nucleic acid molecule of method assembling of the present invention directly to use, be used for multiple purpose after perhaps can increasing.According to Figure 34, utilize the nucleic acid fragment of method assembling of the present invention to produce with several different methods.For example, these fragments can obtain with the known any method in this area.Do not contain in the terminal and/or regional situation of one or more (for example 1,2,3,4 etc.) that are suitable for utilizing method assembling of the present invention at nucleic acid fragment, can add this end and/or zone.For example, can pass through pcr amplification nucleic acid, perhaps add one or more joints (joint that for example contains one or more topoisomerase enzyme recognition sites) such as (for example 1,2,3,4 kind), add suitable terminal and/or regional.Can utilize the described method assembling of the present invention of this paper other parts to contain the nucleic acid fragment in suitable end and/or zone then.
As shown in figure 34, the nucleic acid fragment that after the assembling, can increase (for example in external or body) connects uses in several different methods or program then, wherein manyly describes in this paper other parts.In addition, the nucleic acid fragment of assembling can directly use, as is used for in-vitro transcription/translation, recombinant clone, or is used for transforming or transfectional cell.Compositions for universal use and method that therefore the present invention is provided for operating nucleic acid.
The invention provides composition and the method for utilizing topoisomerase to be connected nucleic acid molecule with reorganization.In particular of the present invention, nucleic acid molecule experience one or many (for example 1,2,3,4,5,6,7,8,9,10 is inferior) recombining reaction utilizes to comprise that the covalently bound method of one or more enzymatic chains of topoisomerase such as (for example 1,2,3,4 kind) is connected with one or more other nucleic acid molecule such as (for example 1,2,3,4,5,6,7,8,9,10 kind) then.In other embodiments, by comprising that one or more covalently bound methods of enzymatic chain of topoisomerase such as (for example 1,2,3,4 kind) are connected nucleic acid molecule with other nucleic acid molecule, carry out one or many (for example 1,2,3,4,5,6,7,8,9,10 is inferior) recombining reaction then.It will be appreciated by those skilled in the art that the present invention does not rely on the nucleic acid molecule connection of topoisomerase mediation or any order of recombining reaction.Therefore, the present invention relates generally to and be used to carry out recombining reaction and utilize topoisomerase to be connected the composition and the method for nucleic acid fragment.
The linkers that the present invention also provides the method according to this invention and composition to use.Provided by the invention and can contain topoisomerase site and recombination site with the joint that the present invention uses.An example of method of the present invention illustrates in Figure 35.Figure 35 has shown a kind of method, comprises being connected of the nucleic acid fragment of recombination site (" joint ") and another kind of nucleic acid fragment (being called and inserting fragment) not of containing of topoisomerase transformation.These two kinds of nucleic acid fragments can connect by the method for any topoisomerase mediation described herein.
Joint of the present invention can comprise (1) one or more recombination sites and/or (2) one or more topoisomerase enzyme recognition sites or one or more topoisomerase.In specific embodiments, at least one at least one in one or more recombination sites of joint and one or more topoisomerase enzyme recognition site or the one or more topoisomerase is within 0,1,2,3,4,5,6,7,8,9,10,15 or 20 Nucleotide.In specific embodiments, the contained recombination site of joint of the present invention is attL, attB, attP or attL recombination site.In other particular, the topoisomerase enzyme recognition site is the recognition site of IB type topoisomerase, IA type topoisomerase or II type topoisomerase, and perhaps topoisomerase is IB type topoisomerase, IA type topoisomerase or II type topoisomerase.In addition, in joint of the present invention, the relative position of topoisomerase enzyme recognition site or topoisomerase and recombination site can be so that after the reorganization, specific recombination site combines with the product molecule.For example, the topoisomerase enzyme recognition site can be arranged in arbitrary end in joint attL site, makes after this joint and nucleic acid molecule adhere to and recombinate generation attB or attP site on the nucleic acid molecule that joint will adhere to.Therefore, joint can contain topoisomerase enzyme recognition site and/or topoisomerase, its with respect to position of recombination site make be connected with nucleic acid molecule and recombinate after, the multiple variation of recombination site is arranged on the product nucleic acid molecule.The example of these recombination sites comprises attL, attB, attP and attR recombination site.
The present invention also provides and utilizes the joint that contains identical or different specific recombination site to connect the method for multiple nucleic acid fragment, and contains joint with identical or different specific recombination site and the test kit that contains these joints.For example, three kinds of different PCR products are called as Segment A, B and C, can be connected with joint, make attL1 and attL3 site be positioned at the end of Segment A, and attR3 and attR4 site are positioned at the end of fragment B, and attL4 and attL2 site are positioned at the end of fragment C.Therefore, with locate endways or near contain the linearized vector reorganization of attR1 and attR2 recombination site after, all three kinds of PCR products are connected to each other, and insert in the carrier, produce a kind of cyclisation nucleic acid molecule.Above-mentioned multiple variation is possible, and is included in the scope of the present invention.
The present invention also comprises several groups of two or more joints such as (for example 2,3,4,5,6,7,8,9 kind), they contain (1), and one or more have identical or different specific recombination site, and/or (2) one or more topoisomerases or topoisomerase enzyme recognition site, and utilize these a few set of joints productions to contain the method for the nucleic acid molecule of one or more recombination sites, the composition that comprises indivedual members of these joint groups or these groups, nucleic acid molecule of transforming with one or more joints of these groups and the method for using these nucleic acid molecule.
After the assembling of topoisomerase mediation, the nucleic acid molecule of assembling can with contain one or more (for example 1,2,3,4 etc.) suitably another kind of nucleic acid fragment reorganization of recombination site.Recombination site shown in Figure 35 is attL1 and attR1 site, but also can use any suitable recombination site (for example lox site, attR site, attL site, attB site, attP site etc.).Other suitable recombination site is described in this paper other parts.
The present invention includes topoisomerase enzyme recognition site and the recombination site method of recombinant production nucleic acid molecule each other of utilizing.The present invention also comprises the nucleic acid molecule that also uses in the method for the invention by method preparation of the present invention, and the method for using the nucleic acid molecule of producing by method described herein.
The present invention also comprises the method for utilizing a plurality of (for example 2,3,4,5,6,7,8,9,10 etc.) recombination site and topoisomerase enzyme recognition site to produce nucleic acid molecule, and with these methods nucleic acid molecule that prepare and that in these methods, use.In addition, these recombination sites also may have multiple (for example 2,3,4,5,6,7,8,9,10 kind etc.) specificity.In addition, the topoisomerase enzyme recognition site can be designed, these terminal ends that is connected with the different IPs acid fragment can be made to produce.For example, can design these ends, be used for producing different " cohesive end " in topoisomerase cutting back.
Another example of aforesaid method shows in Figure 36.Figure 36 shows a kind of method, wherein utilizes the covalently bound method of the terminal chain of the nucleic acid fragment that comprises the topoisomerase mediation to connect two kinds of nucleic acid fragments.The nucleic acid molecule that produces is recombinated then, and the nucleic acid molecule that causes (1) topoisomerase to assemble is connected with the nucleic acid fragment that contains replication orgin and (2) negative selected marker (for example ccdB gene) is replaced by a kind of promotor.The nucleic acid molecule of reorganization is connected with a kind of nucleic acid fragment then, and the latter uses the topoisomerase transformation at two ends, and contains a kind of positive selected marker.Final step produces the nucleic acid molecule of cyclisation.
The terminal generation of the cyclisation nucleic acid that Figure 36 shows can import in the host cell, and this cell can be protokaryon (for example bacterium) or eucaryon (for example yeast, plant, animal (comprising Mammals, as the people)) cell, as described in this paper other parts.In addition, also can utilize and just selecting and bearing the cell of selecting screening to contain this end products.Therefore, for example, do not select to have obtained a kind of cell of nucleic acid molecule, negative selected marker is not activated the son replacement in this molecule.The present invention comprises also and is similar to the method and composition shown in Figure 35 and 36 that wherein a plurality of steps are different with composition.The step that may be different and the example of composition are described in this paper other parts.The present invention also comprises the method for use by the nucleic acid molecule of aforesaid method production.
It will be appreciated by those skilled in the art that the nucleic acid fragment as using in Figure 35 and the method shown in 36 can contain multiple different element.For example, can replace promotor shown in Figure 36 with a kind of positive selective marker.In addition, insertion fragment shown in Figure 35 also can contain and has multiple functional nucleic acid.Particularly, contain when transcribing the zone when inserting fragment, transcript may be the mRNA or the RNA of functionating when untranslated.The example of the RNA of functionating comprises transfer RNA (tRNA) (for example suppressing tRNA), sense-rna, ribosome-RNA(rRNA) and ribozyme when untranslated.In addition, utilize method of the present invention to connect and/or more than one nucleic acid fragment of reorganization can contain all or part of of one or more open reading frame such as (for example 1,2,3,4,5,6,7 kind).In these situations, nucleic acid fragment can be connected to each other, and makes to transcribe and translate one or more fusion roteins of generation.Other nucleic acid elements that can use is in the method for the invention described in this paper other parts.
Utilize method of the present invention to produce a kind of nucleic acid molecule, the end product of method as shown in figure 35, afterwards, this nucleic acid molecule randomly can be connected with one or more other nucleic acid molecule such as (for example 1,2,3,4 kind), perhaps can be by the end cyclisation that is connected to each other.In addition, when utilizing method of the present invention that three kinds or multiple nucleic acid molecule are connected to each other, the end of different middle elements or end product can be connected to each other, thus these molecules of cyclisation.
The present invention also is provided for homologous recombination and produces composition and the method for transgenic animal.Can accurately modify by the predetermined site in genome by the gene targeting that the homologous recombination between foreign DNA construct and the homologous chromosomes sequence is carried out.For example, in mouse embryonic stem (ES) cell, set up gene targeting, and in a large amount of musculus cdnas, realized modification (referring to, people such as Brandon for example, Curr.Biol.5:625-634,758-765,873-881 (1995)).Gene targeting also can in somatocyte, carry out (referring to, people such as Itzhaki for example, Nat.Genet.15:258-265 (1997)).Can operate the cell of modifying with gene targeting by homologous recombination with the known method in this area then, to set up transgenic animal.
An example that can be used for the composition of the present invention of homologous recombination purposes is an end product nucleic acid molecule shown in Figure 37.Figure 37 has further shown an example for preparing these method for compositions.Particularly, Figure 37 has shown being connected of nucleic acid fragment of nucleic acid fragment that topoisomerase transforms and a kind of non-topoisomerase transformation.In this case, the planner of nucleic acid end product attempts to be incorporated into intrachromosomal nucleic acid fragment---and be called the insertion fragment at this, its flank is for containing the zone of (1) positive selected marker and (2) negative selected markers between two recombination sites.Can utilize reorganization two negative selected markers to be replaced with the chromosomal region homologous nucleic acid (in Figure 37, being labeled as " HR1 " and " HR2 ") that is incorporated into end product then.
The cell chromosome that the homologous region that uses in enforcement of the present invention will be incorporated into nucleic acid molecule and difference.In many cases, select to help the homologous region in the particular organisms cell, integrated.This biology can be unicellular organism (for example yeast, protozoon etc.) or multicellular organism (for example plant, animal etc.).
The cell that the present invention therefore is provided for carrying out the nucleic acid molecule of homologous recombination and composition and produces by the homologous recombination that relates to these molecules and composition.Method of the present invention can be used to connect multiple nucleic acid fragment.For example, Figure 38 shown with topoisomerase and connected 4 kinds of nucleic acid fragments, produces near a kind of synoptic diagram that contains the linear nucleic acid molecule of recombination site (being labeled as " L1 " and " L2 ") endways.The first step utilizes topoisomerase that two kinds of nucleic acid fragments of the nucleic acid fragment that contains attL1 recombination site and attL2 recombination site and other of topoisomerase transformation are connected.In this Special Circumstances, every chain and a kind of topoisomerase molecule of end connected to one another are covalently bound.Therefore, after the connection of the nucleic acid chains of covalently bound mediation, the tie point place does not contain otch.In second step, allowing under the condition of recombinating between attL and the attR recombination site, at LR CLONASE TMExistence under, the nucleic acid fragment contact of topoisomerase assembling contains the another kind of nucleic acid fragment of replication orgin (being labeled as " ori "), positive selected marker (being labeled as " PM "), attR1 recombination site and attR2 recombination site.In the method, for example, the carrier that TOPO transforms and one or more nucleic acid fragments (for example one or more PCR products) descended the about 5-30 of incubation (preferably about 10) minute in room temperature (for example about 20-25 ℃); Then at about 20 minutes these reaction solutions of thermal treatment of about 80 ℃ of following incubations, use this reaction mixture according to working instructions (Invitrogen Corporation) in standard LR reaction then, difference is that the incubation time lengthening of LR reaction was by about 3 hours.Reorganization causes the formation of circular nucleic acid molecule, and it contains the different initial nucleic acid fragments that separate with attB1 and attB2 recombination site with starting point and selected marker.It will be appreciated by those skilled in the art that the att recombination site shown in can be enough any suitable recombination site replacement figure.Therefore the present invention also provides the composition that comprises these nucleic acid, is used to produce the composition of these nucleic acid and these nucleic acid and the composition purposes in the method for attachment of reorganization of the present invention that this paper other parts are described and topoisomerase mediation.
The present invention also provides the nucleic acid molecule that is suitable for carrying out cloning reaction, wherein utilizes the first kind of nucleic acid molecule that has one or more homologous regions with second kind of nucleic acid molecule to insert nucleic acid from second kind of nucleic acid molecule in first kind of nucleic acid molecule.The present invention also is provided for carrying out the composition and the method for these cloning reactions.
An example of aforesaid method is the RecE/T clone, and it is described in the open text WO01/04288 of PCT, and its complete disclosure is incorporated herein by reference.Generally speaking, in the RecE/T clone, a kind of linear first kind of nucleic acid molecule (for example a kind of carrier) imported in a kind of cell, it contains (the plasmid for example of contained nucleic acid molecule in (1) and the cell, bacterial artificial chromosome, natural dyeing bodies etc.) two kinds of adjacent domains of separating that (are called " second kind of nucleic acid molecule " at this) have the stub area of homology (for example length are for about 20-about 30, about 20-about 40, about 20-about 50, about 30-about 40, about 40-about 50, about 40-about 60, about 40-about 80, about 90 Nucleotide of about 50-etc.), (2) selected marker and (3) replication orgin.Linear first kind of nucleic acid molecule only duplicates after cyclisation usually.In addition, first kind of nucleic acid molecule generally and second kind of nucleic acid molecule reorganization and obtain to insert between the homologous region from the nucleic acid of second kind of nucleic acid molecule the time just cyclisation.In these embodiments, the homologous region in first kind of nucleic acid molecule is general reverse with second kind of nucleic acid molecule.The cell that reorganization takes place is the cell of expressing a kind of recombinase such as RecE/T or RedAlpha/Beta.Therefore, the present invention partly provides the method for carrying out the RecE/T clone, and the nucleic acid molecule by these method preparations comprises the composition of these nucleic acid molecule and uses these nucleic acid molecule and method for compositions.
Can utilize the modification of RecE/T method to produce a large amount of different end products.For example, when homologous region was arranged by different way, first kind of nucleic acid molecule can be designed to (1) and insert in second kind of nucleic acid molecule, or (2) deletion is from the nucleic acid of second kind of nucleic acid molecule.Generally speaking, when hope is inserted second kind of nucleic acid molecule in second kind of nucleic acid molecule, the homologous region of first kind of nucleic acid molecule will with the homologous region of second kind of nucleic acid molecule in the same way.In addition, when hope deletion during from the nucleic acid of second kind of nucleic acid molecule, the homologous region of first kind of nucleic acid molecule is reverse with the homologous region of second kind of nucleic acid molecule usually.Equally, when hope was inserted first kind of nucleic acid molecule in second kind of nucleic acid molecule, first kind of nucleic acid molecule generally do not contain replication orgin.The invention provides the method for carrying out said process.The present invention also is provided for the nucleic acid molecule and the composition of aforesaid method.
The present invention also can utilize topoisomerase and one step of recombination site to be connected two kinds of nucleic acid fragments, produces a kind of circular nucleic acid molecule.Figure 39 has shown an example of this embodiment, and wherein one of nucleic acid fragment contains an attL1 recombination site (being labeled as " L1 "), a promotor (being labeled as " P ") and the topoisomerase molecule covalently bound with an end.Other nucleic acid fragment contains an attR1 recombination site (being labeled as " R1 "), an open reading frame (being labeled as " ORF "), a replication orgin (being labeled as " ORI "), a positive selected marker (being labeled as " PM ") and the topoisomerase molecule covalently bound with an end.Therefore, when allowing under the condition that the nucleic acid chains that reorganization between attL and the attR recombination site and topoisomerase mediate is connected, at LRCLONASE TMExist down, when these two kinds of nucleic acid fragments contact with each other, form a kind of ring molecule with described structure.In some such methods, for example, the carrier that TOPO transforms and one or more nucleic acid fragments (for example one or more PCR products) descended the about 5-30 of incubation (preferably about 10) minute in room temperature (for example about 20-25 ℃); Then at about 20 minutes these reaction solutions of thermal treatment of about 80 ℃ of following incubations, use this reaction mixture according to working instructions (InvitrogenCorporation) in standard LR reaction then, difference is that the incubation time lengthening of LR reaction was by about 3 hours.It will be appreciated by those skilled in the art that can be with the att recombination site shown in any suitable recombination site replacement figure.
The present invention also can utilize the method for topoisomerase mediation to connect two kinds of nucleic acid fragments, produces a kind of circular nucleic acid molecule.Figure 40 has illustrated the synoptic diagram of an embodiment of this aspect of the present invention.As shown in figure 40, this ring molecule contains an open reading frame (being labeled as " ORF ") between attL1 and attL2 recombination site (being labeled as " L1 " and " L2 ").The product of topoisomerase assembling is recombinated with the another kind of ring molecule that contains attR1 and attR2 recombination site then, is created in the third circular nucleic acid molecule that contains this open reading frame between attB1 and the attB2 recombination site.In addition, this open reading frame also can effectively be connected with a kind of promotor.Therefore, the end-nucleus acid molecule that utilizes this method to produce is a kind of expression construct.It will be appreciated by those skilled in the art that can be with the att recombination site shown in any suitable recombination site replacement figure.
As disclosed herein, first kind of nucleic acid molecule may be one of a group nucleotide sequence, for example cDNA library, nucleotide sequence combinatorial library or diversified nucleotide sequence colony.Therefore, a useful especially embodiment of method of the present invention is to produce the recombination of polynucleotide of coding chimeric polyeptides, this chimeric polyeptides is used to carry out the high-throughput double cross and measures, the protein-protein interaction that evaluation takes place between polypeptide colony is (referring to U.S. Patent number 6,057,101 and U.S. Patent number 6,083,693, all be incorporated herein by reference).In this method, detected two nucleotide sequence colonies of coded polypeptide, each colony has from a small amount of relevant but different nucleotide sequence to the complicacy that can reach up to ten thousand this sequences.By carrying out method of the present invention, for example, utilize the PCR primer to each nucleotide sequence in the amplification colony, wherein at least one right primer of this PCR primer comprises (a) at least one topoisomerase enzyme recognition site or its complement, or (b) at least one recombination site, can produce the covalently bound recombination of polynucleotide of coding chimeric bait polypeptide of a group and the chimeric prey polypeptide of a group, its production method is: the nucleotide sequence colony of amplification, all comprise (a) at least one topoisomerase enzyme recognition site, contact at least a topoisomerase and a kind of nucleotide sequence, the latter contain at least one topoisomerase enzyme recognition site and encode a transcription activating domain or DNA in conjunction with the territory, perhaps (b) at least one recombination site, contact at least a topoisomerase and a kind of nucleotide sequence, the latter contain at least one recombination site and encode a transcription activating domain or DNA in conjunction with the territory.
In implementing method of the present invention, first kind of nucleic acid molecule a kind of Yeast Nucleic Acid (RNA) molecule of also encoding, for example, it can be as nucleic acid probe, antisense base sequences, ribozyme or triple helix nucleotide sequence, perhaps can in external translation reaction, use second kind of nucleic acid molecule a kind of regulatory element (seeing embodiment 2A) that can be used for expressing from the RNA of first kind of nucleotide sequence of also encoding.For example, when a large amount of RNA was produced in hope, the second kind of nucleic acid molecule composition that is used to carry out method of the present invention can comprise a kind of rna polymerase promoter, as T7, T3 or SP6 rna polymerase promoter.When the RNA molecule is expressed in cell, for example, when in mammalian cell, expressing a kind of antisense molecule, second kind of (or other) nucleic acid molecule can comprise a kind of in mammalian cell promoters active, particularly a kind of tissue-specific promoter, it only has activity in target cell.In addition, when the RNA molecule will be translated, for example, in link coupled in-vitro transcription/translation reaction, first kind of nucleotide sequence or second kind (or other) nucleotide sequence can contain suitable translation adjusting element (seeing embodiment 2B).
Method of the present invention also can be used for producing and can make construct reticent in the genosome.A kind of method of silencer comprises the generation double-stranded RNA, be called RNA interfere (RNAi) (referring to, people such as Mette for example, EMBO J., 19:5194-5201 (2000)).Think the RNAi mechanism that works, people such as Fjose, summary among the Biotechnol.Annu.Rev.7:31-57 (2001) is seemingly induced the ability of specific RNA molecular degradation based on double-stranded RNA.It is reported that this mechanism comprises that double-stranded RNA is converted into short rna, the latter is with the rnase cognate rna target (for example mRNA target) that leads.Method of the present invention can be produced molecule such as RNAi in many ways.Therefore, the expression product of nucleic acid molecule of the present invention can be used for silencer and expresses.
An example that is used for producing the nucleic acid molecule of RNAi is a kind of like this molecule, and wherein nucleic acid fragment is connected with one or more promotors, makes RNA corresponding to two chains be produced as two kinds of different transcripts or as the part of same transcript.For example, can enough methods of the present invention prepare a kind of nucleic acid molecule, wherein the open reading frame of two copies is connected with two promotors of transcribing with the different directions guiding by interleaving nucleic acid fragment.Therefore, one of this promotor guiding sense strand mRNA transcribes, and another kind of promotor guides transcribing of antisense mRNA.Another example that can be used for producing the nucleic acid molecule of RNAi is, wherein each terminal flank of open reading frame promotor of transcribing in the opposite direction for the guiding open reading frame.The 3rd example be, can produce double-stranded RNA by the nucleic acid molecule that coding at one end contain the RNA in " turning back " district (for example, length is the zone of 6,7,8,9,10 Nucleotide etc.).Therefore, such rna transcription thing will be at one end or near formation hair clip folding.This RNA of incubation divides the period of the day from 11 p.m. to 1 a.m in the presence of a kind of RNA polymerase of dependenc RNA under proper condition, and it is synthetic to cause second chain with the double stranded region that hair clip forms, and forms double stranded rna molecule.
Be used for producing the nucleic acid fragment of RNAi, as above-mentioned nucleic acid molecule, need be corresponding to full-length gene or open reading frame.For example, when nucleic acid fragment divides the period of the day from 11 p.m. to 1 a.m corresponding to all or part of the RNA that all or part of or the coding of ORF do not correspond to ORF, this fragment may be only corresponding to part of ORF (for example about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 40, about 50, about 60 Nucleotide at 5 ' of ORF or 3 ' end place etc.).
Therefore, in specific embodiments, the invention provides the method that preparation comprises at least three segmental nucleic acid molecule.In certain embodiments, in these fragments at least two total at least one sequence same zone (for example, length is at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about the zone of 100 Nucleotide etc.).In other embodiments, the flank of a nucleic acid fragment is transcribed the zone of (for example produce justice and antisense transcript are arranged) in the opposite direction for making intramolecule.The present invention also provides nucleic acid molecule and these molecules in inhibiting genetic expression for preparing by method of the present invention or promotes the purposes of specific RNA molecular degradation.
The method of nucleic acid molecule that the present invention also provides preparation to be used for antisence RNA (for example antisense mRNA).Can use and the above-mentioned similar method of production method that can be used for the nucleic acid molecule of RNAi; Yet, in the molecule of the method preparation of the present invention by can be used to produce sense-rna, generally have only antisense strand to transcribe.
In relevant embodiment, the promotor that guiding has adopted RNA or sense-rna to transcribe can be composing type (for example CMV promotor, SV40 promotor etc.), induction type (for example metallothionein promoter etc.) or inhibition type.Therefore, for example, can transcribing of adopted RNA and sense-rna be arranged enough two kinds of different inducible promoter guiding.In this case, can utilize the promotor activation-inducing that adopted RNA, sense-rna are arranged or the generation of adopted RNA and sense-rna is arranged.In addition, for example utilize progressive induce and/or promotor is disinthibited, can get in touch the amount of adopted RNA of having of generation and/or sense-rna.
Comprise the gene silencing methods that uses compound such as RNAi and sense-rna, for example, be particularly useful for the identified gene function.More specifically, gene silencing methods can be used for reducing or stop the expression of one or more genes in cell or biology.Can use the phenotype performance relevant will act on then owing to " silence " gene with the selectivity inhibition of gene function.An example is that people such as Chuang, Proc.Natl.Acad.Sci. (USA) 97:4985-4990 (2000) confirm that generation can change the gene activity among the Arabidopsis thaliana in the body of RNAi.Therefore, the invention provides the adjusting cell and organize the amplifying nucleic acid developed by molecule method of (comprising the expression of RNAi and sense-rna).The present invention also provides the method for preparing nucleic acid molecule, and this molecular energy is used for producing the RNA corresponding to a kind of one or two chain of dna molecular.
Therefore the present invention provides the method for regulating nucleic acid molecule body interior (for example in cell and tissue) and/or vivoexpression (including the expression of adopted RNA and/or sense-rna).The present invention also provides the method for preparing nucleic acid molecule, can be used for producing the RNA corresponding to one or two chain of a kind of nucleic acid molecule (for example a kind of dna molecular).The present invention also is provided for carrying out the composition of aforesaid method and the nucleic acid molecule of producing by aforesaid method (for example RNA and dna molecular).
The present invention also relates to be used for the Compounds and methods for of the gene silencing relevant with ribozyme.Particularly, the invention provides sense-rna/ribozyme syzygy, it comprises: 1) corresponding to a kind of sense-rna and 2 of target gene) can cut one or more ribozymes (for example hammerhead ribozyme, hair clip shape ribozyme, delta ribozyme, thermophilas L-21 ribozyme etc.) of RNA.The present invention also provides the carrier of expressing these syzygys, produces the method for these carriers and with the method for these carrier inhibition of gene expression.
For example, can utilize the special RNA molecule in the expression incising cell of the antisense molecule that merges with ribozyme, because the sense-rna of transcript part can be designed to and specific mRNA molecular hybridization.In addition, the ribozyme of transcript partly can also be designed and can cut the RNA molecule of hybridization with it.For example, this ribozyme may be the ribozyme (for example thermophilas L-21 ribozyme) that can cut double-stranded RNA.
A kind of method of the present invention especially can be used for producing the double-stranded recombinant nucleic acid molecules of a kind of expression type, and this molecular energy inserts in the target DNA sequence in site-specific mode.The target DNA sequence can be any dna sequence dna, particularly genomic dna sequence, the preferably part or all of known gene of nucleotide sequence.This method can be carried out with first kind of nucleic acid molecule, this molecule contains first end and second end, the peptide species of encoding, for example a kind of selected marker, wherein first kind of nucleic acid molecule comprises at least one topoisomerase enzyme recognition site and/or at least one recombination site or its cleaved products at 3 ' end place of each end, randomly contains a hydroxyl at 5 ' end place of each end, wherein preferably, 5 ' end comprises 5 ' outstanding sequence, and they differ from one another; And the covalently bound first kind of nucleic acid molecule of the method according to this invention and first kind and second kind of pcr amplification product.First kind and second kind of amplified production is inserted the site upstream and downstream by construct sequence generation, every kind of amplified production contains at least one topoisomerase enzyme recognition site and at least one recombination site randomly, preferably, one 5 ' outstanding sequence, it is contacting the back generation with the locus specificity topoisomerase.Preferably, first kind or second kind of amplified production contain 5 ' different outstanding sequences, make each to be connected with the predetermined end of first kind of nucleic acid molecule.This method can be carried out with a kind of double-stranded amplified production similarly, it comprises at least one topoisomerase enzyme recognition site and randomly at least one recombination site or its cleaved products at 5 ' end of one or two end, wherein, after with the topoisomerase cutting, the molecular energy that carries topoisomerase comprises 3 ' overhang at one or two end that contains topoisomerase.In addition, this method also can be carried out with a kind of double-stranded amplified production, it 5 ' end of one or two end and 3 ' end place or near comprise topoisomerase enzyme recognition site and randomly recombination site or its cleaved products, wherein, after with the topoisomerase cutting, the nucleic acid molecule that carries topoisomerase preferably contains 5 ' or 3 ' overhang at one or two end that contains topoisomerase.In case nucleic acid molecule connects by aforesaid method, the molecule of generation promptly can be used for recombining reaction, as described in this paper other parts.
First kind and second kind of amplified production can be with two groups of PCR primers to producing.Can select two groups of PCR primers right, make at suitably polysaccharase such as Taq polysaccharase and comprise in the presence of the template of sequence to be amplified, this primer amplification is positioned at selected marker and inserts the also part of adjacent target DNA sequence of upstream, site and adjacent and downstream.In addition, it is right also can to design several groups of PCR primers, makes amplified production containing the topoisomerase enzyme recognition site with the covalently bound end of selected marker, and after by the cutting of locus specificity topoisomerase, contains 5 ' outstanding sequence.First kind of PCR primer is to comprising: 1) article one primer, it comprises and 5 ' the outstanding sequence complementary nucleotide sequence of amplified production with covalently bound selected marker end with 5 '-3 ' direction, with topoisomerase enzyme recognition site complementary nucleotide sequence and with 3 ' the sequence complementary nucleotide sequence that inserts upstream, site target DNA sequence; With 2) the second primer, it comprises the nucleotide sequence that with article one primer complementary 3 ' sequence upstream, promptly inserts the target gene group DNA in downstream, site.Second kind of primer is to comprising: 1) article one primer, it comprises with selected marker end 5 ' that will be covalently bound from 5 '-3 ' gives prominence to sequence complementary nucleotide sequence, with topoisomerase enzyme recognition site complementary nucleotide sequence, with the nucleotide sequence of 5 ' sequence of target DNA sequence, wherein 5 ' the sequence of target gene group DNA is positioned at 3 ' sequence downstream with the right article one primer complementary target DNA sequence of first kind of PCR primer; With 2) second kind of right second primer of primer, it comprises 3 ' sequence complementary nucleotide sequence with the target DNA sequence, and this target DNA sequence is positioned at the downstream of the 5 ' sequence of the contained target gene group of article one primer DNA.The technician should be known in target gene group DNA complementary primer sequence according to the target DNA sequence selection.These primers are to also comprising one or more recombination sites.
Comprise the nucleic acid molecule, first kind and second kind of amplified production and a kind of topoisomerase (if this molecule does not contain topoisomerase) of selected marker in contact after, the method according to this invention is produced the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains.When wishing, can utilize the sequence-specific PCR primer of upstream and downstream of target gene group DNA, the double-stranded recombinant nucleic acid molecules of generation that further increases, thus guarantee the functional construct that only increases.The double-stranded recombinant nucleic acid molecules that produces can be used for carrying out genomic homologous recombination, for example, knocks out the gene function in the cell, or makes the cell of the recombinant nucleic acid molecules that contains generation have new phenotype.This method can also be used for producing the stable transgenic nonhuman's biology that keeps the double-stranded recombinant nucleic acid molecules that produces in genome.
A kind of method of the present invention also can be used for one or two end of covalently bound a kind of linker or joint sequence and purpose nucleic acid molecule, comprises the end of a group nucleic acid molecule.For example, when hope places two of first kind of nucleic acid molecule terminal joint, this method can be undertaken by the contact following ingredients: a kind of topoisomerase, with first kind of nucleic acid molecule, it contains topoisomerase enzyme recognition site or its cleaved products at one of 3 ' or 5 ' end or these two ends, can comprise hydroxyl and one or more recombination site at two 5 ' ends; With second kind of nucleic acid molecule and at least a the third double chain nucleotide sequence, they all can comprise topoisomerase enzyme recognition site or its cleaved products at 3 ' or 5 ' suitable end, and when wishing, also can comprise 5 ' hydroxyl and one or more recombination site at same end.Suitable end be at least one chain joint will with first kind of end that nucleotide sequence is covalently bound.In one embodiment, one or both joint sequences contain a kind of outstanding sequence, the sequence complementation of 5 ' end of first kind of nucleic acid molecule end of should outstanding sequence and will covalently bound joint, thereby help nucleotide sequence at first with correct (be scheduled to) direction combination (referring to, for example Fig. 2 and embodiment 1B).In carrying out this method, comprise second kind and the joint sequence of the third nucleotide sequence can be identical or different at least.
Figure 14 shows an a kind of example for preparing the method for nucleic acid molecule, this molecule contains 5 ' end bonded topoisomerase (for example IA type topoisomerase) with an end of sequence, and wherein same end also comprises one 3 ' overhang (seeing (4) among Figure 14).In steps A, will be with the topoisomerase modified nucleotide sequences with producing the digestion with restriction enzyme that " gluing " holds.In step B, the nucleotide sequence of restriction enzyme digestion and the linear strand nucleotide sequence that contains the 5 ' end that is attached to topoisomerase and a kind of ligase enzyme (for example dna ligase, as the T4 dna ligase) contact.This linearity strand nucleotides sequence is listed in 3 ' end and also contains a zone, and " gluing " end that it and restriction enzyme produce has sufficient sequence complementarity, and these two kinds of molecules can be hybridized.Therefore, in step B, two kinds of nucleotide sequences are connected to each other.In step C, the product in second step contacts with a kind of ligase enzyme with the third nucleotide sequence, and the part of the linear single stranded nucleic acid molecule that produces among the third nucleotide sequence and the step B has the sequence complementarity.(4) product of the step C of Xian Shiing is to contain and the 5 ' topoisomerase that adheres to of end of an end and a kind of nucleic acid molecule of 3 ' overhang on the same end.The multiple variation that should be appreciated that described method belongs to scope of the present invention.For example, can carry out similar method, comprise with the 3 ' topoisomerase that adheres to of end of an end or at the end that topoisomerase adheres to preparation and contain the 5 ' overhang or the nucleic acid molecule of flush end.In another embodiment, the nucleotide sequence that is labeled as No. 3 in Figure 14 can enough following methods produce: can use a kind of nucleic acid molecule of digestion with restriction enzyme, produce a kind of nucleic acid molecule that contains strand 5 ' overhang, it comprises an IA type topoisomerase enzyme recognition site.The nucleic acid molecule that contains the strand overhang can contact with IA type topoisomerase then, produces a kind of nucleic acid molecule that carries IA type topoisomerase.
Figure 15 shows two embodiments of the present invention, and wherein strand or double-stranded DNA and single stranded RNA are covalently bound.When single stranded DNA was connected with single stranded RNA, 3 ' end of ribonucleoside acid sequence was covalently bound with 5 ' end of deoxyribonucleotide sequence.When double-stranded DNA was connected with single stranded RNA, 3 ' end of ribonucleoside acid sequence had sufficient sequence complementarity with 3 ' overhang of deoxyribonucleotide sequence, and these two kinds of molecules can be hybridized.As mentioned above, 3 ' of ribonucleoside acid sequence end is also covalently bound with 5 ' end of deoxyribonucleotide sequence.Should be known in above-mentioned multiple variation within the scope of the invention.For example, the RNA molecule may be double-stranded.In another embodiment, all nucleotide sequences can be the deoxyribonucleotide sequences, and/or can comprise one or more recombination sites.
The invention provides the double-stranded recombinant nucleic acid molecules that contains or can make it to contain first end and second end, each end comprises one 5 ' end and one 3 ' end, wherein this carrier 5 ' end place of first end, second end or first end and second end or near comprise a locus specificity IA type topoisomerase enzyme recognition site.This two strands recombinant nucleic acid molecules can also 3 ' end place of an end or near comprise an IB type topoisomerase enzyme recognition site, and do not comprise IA type topoisomerase enzyme recognition site.This two strands recombinant nucleic acid molecules can be a kind of carrier.
The present invention also provides a kind of double-stranded recombinant nucleic acid molecules that carries topoisomerase, it contains first terminal and second end, each end has one 5 ' end and one 3 ' end, and wherein locus specificity IA type topoisomerase is held combination at 5 ' of first end, second end or first or second end.For example, the double-stranded recombinant nucleic acid molecules that carries topoisomerase can be included in 5 ' end bonded IA type topoisomerase of first and second ends.The nucleic acid double chain recombinant nucleic acid molecules that carries topoisomerase can be included in 3 ' end bonded IB type topoisomerase of an end, this end debond IA type topoisomerase.The double-stranded recombinant nucleic acid molecules that carries topoisomerase can be a kind of carrier.
Test kit
The present invention also provides test kit, wherein contains the composition that can be used for implementing easily method of the present invention.In one embodiment, test kit of the present invention comprises first kind of nucleic acid molecule, its peptide species of encoding, and particularly a kind of selected marker, and comprise a topoisomerase enzyme recognition site at each end.Preferably, first kind of nucleotide sequence comprises a kind of topoisomerase activated nucleotide sequence.More preferably, the first kind of nucleotides sequence that carries topoisomerase is listed in each end and comprises one 5 ' outstanding sequence, and most preferably, 5 ' outstanding sequence has nothing in common with each other.Preferably, each 5 ' end comprises one 5 ' hydroxyl.
In addition, test kit also can comprise at least a nucleotide sequence (or its complementary sequence) that comprises a kind of regulatory element, and this element can be upstream or downstream regulatory element, or other element, comprises a topoisomerase enzyme recognition site at one or two end.Preferably, test kit comprises multiple nucleic acid molecule, and every kind of molecule comprises different regulatory elements or other element, for example, but the sequence in encode a kind of mark or other detection molecules or cellular compartment territory.Different elements can be the dissimilar of a kind of particular adjustments element, and for example constitutive promoter, inducible promoter and tissue-specific promoter may be different types of components perhaps, comprises, as transcribes and translation adjusting element, epi-position mark etc.These nucleic acid molecule can be the topoisomerase activated, can include the 5 ' overhang and the 3 ' overhang that help with covalently bound this element in preset bearing, particularly, make a polypeptide such as the selected marker can be external or express in one or more cellular types.
Test kit also can comprise primer, comprise first kind and second kind of primer, the primer that makes it possible to select to comprise first kind and second kind primer is right, and is used to or two double-stranded recombinant nucleic acid molecules that chain is covalently bound increasing and wish, and its produces with the composition of test kit.For example primer can comprise first kind of primer, it and the element complementation of 5 ' end of the double-stranded recombinant nucleic acid molecules that generally is positioned at generation, a part that for example comprises the nucleic acid molecule of promoter element, with second kind of primer, it and the element complementation of 3 ' end of the double-stranded recombinant nucleic acid molecules that generally is positioned at generation for example comprise the Transcription Termination site or the part of the nucleic acid molecule of a kind of epi-position mark of encoding.According to the element that is selected from the test kit that is used to produce the covalently bound double-stranded recombinant nucleic acid molecules of two chains, can select suitable first kind and second kind of primer, total length formation function body is used for increasing.
In another embodiment, test kit of the present invention comprises multiple different elements, every kind of element can comprise one or more recombination sites and/or be the topoisomerase activated at one or two end, and every kind of element can comprise one 5 ' outstanding sequence or one 3 ' outstanding sequence or its combination.5 ' or 3 ' outstanding sequence may be that particular element is distinctive, or multiple related elements is common, and for example, multiple different promoter element has.More preferably, 5 ' outstanding sequence of these elements is designed to one or more elements can be effectively covalently bound, to provide the function of usefulness, for example, the element that comprises the element of Kozak sequence and comprise translation initiation site can have complementary 5 ' overhang, makes these elements can the method according to this invention effectively covalently bound.
Multiple element in the test kit can comprise any element, comprises and transcribing or translation adjusting element; The required element of nucleotide sequence reproduce in bacterium, insect, yeast, the mammalian host cell; The element that comprises the recognition sequence of locus specificity nucleic acid binding protein (as restriction endonuclease or recombinase); But the element of coding expression product (as epi-position mark or drug resistance gene); Or the like.Therefore, test kit of the present invention provides the convenient source of different elements, for example, can select these elements according to the specific cells that the construct that produces by method of the present invention will import or express.Test kit also can comprise the PCR primer, comprises first kind or second kind of primer, and they are combination as mentioned above, and with a kind of or two the double-stranded recombinant nucleic acid molecules that chain is covalently bound of increasing, it is to use the element of test kit to produce.Preferably, test kit also comprises the locus specificity topoisomerase of some amount, being used at least one chain covalently bound first kind of nucleic acid molecule that contains the topoisomerase enzyme recognition site and second kind (or other) nucleic acid molecule, randomly can be topoisomerase activated nucleic acid molecule or the nucleotide sequence that contains the topoisomerase enzyme recognition site.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, and its a kind of selected marker of encoding comprises a topoisomerase enzyme recognition site and/or a recombination site at each end; First kind and second kind of PCR primer are right, can the method according to this invention be created in one or two chains first kind and second kind of amplified production with the covalently bound first kind of nucleic acid molecule of pre-determined direction.So the construct that produces can pass through in the locus specificity homologous recombination transfered cell, and mixes in the cellular genome, can stablize preservation at this, and can express a kind of heterologous polypeptide in cell, perhaps can knock out a kind of target gene function.For example, the target gene that will knock out can be that at least a portion sequence is known or be easy to measure and wish to destroy any gene of its function, for example, gene or other any gene of oncogene, gene, encoding serine/Threonine or the Tyrosylprotein kinase relevant with apoptosis.
In the test kit of the present invention, the first kind of PCR primer that can be used for producing the covalently bound double-stranded recombinant nucleic acid molecules of two chains is to comprising first kind of primer, its from 5 ' to 3 ' direction comprises: with 5 ' outstanding sequence of nucleic acid molecule that will be covalently bound (for example, an end of the nucleic acid molecule of coding selected marker) complementary nucleotide sequence, with topoisomerase enzyme recognition site and/or recombination site complementary nucleotide sequence, with 3 ' sequence complementary nucleotide sequence of target DNA sequence.First kind of PCR primer be to also comprising second kind of primer, and it comprises the nucleotide sequence that is positioned at the target DNA sequence of first kind of primer complementary, 3 ' sequence upstream.
The second kind of PCR primer that is used to produce the covalently bound double-stranded recombinant nucleic acid molecules of two chains in the test kit is to comprising first kind of primer, its from 5 ' to 3 ' direction comprises: with 5 ' outstanding sequence complementary nucleotide sequence of nucleic acid molecule that will be covalently bound, with topoisomerase enzyme recognition site and/or recombination site complementary nucleotide sequence, with the nucleotide sequence of 5 ' sequence of target DNA sequence, wherein 5 ' sequence of target DNA sequence is positioned at 3 ' sequence downstream with the right first kind of primer complementary target DNA sequence of first kind of primer.Second kind of PCR primer be to also comprising second kind of primer, and 3 ' sequence of the nucleotide sequence that this primer comprises and the target gene in 5 ' the sequence downstream that is positioned at first kind of contained target DNA sequence of primer is in complementation.
In another embodiment, the test kit of the present invention that is used to produce the covalently bound double-stranded recombinant nucleic acid molecules of two chains comprises: first kind of nucleic acid molecule, its a kind of transcription activating domain of encoding comprises a topoisomerase enzyme recognition site or its cleaved products at 3 ' end; With second kind of nucleic acid molecule, it encodes a kind of DNA in conjunction with the territory, comprises a topoisomerase enzyme recognition site and/or a recombination site at 3 ' end, or its cleaved products.Through the cutting of locus specificity topoisomerase, first kind or second kind of nucleic acid molecule can contain one 5 ' overhang, and perhaps these two kinds of sequences all can contain 5 ' overhang, and they are same to each other or different to each other.When nucleic acid molecule contained 5 ' overhang, this overhang is complementary to usually will the method according to this invention and first kind or second kind of nucleic acid molecule that nucleic acid molecule is covalently bound.This test kit also can comprise a kind of or a pair of linker, joint etc., and they can comprise topoisomerase enzyme recognition site or its cleaved products at one or two 3 ' end, randomly can comprise a hydroxyl at same end.Select these linkers, joint etc., make they comprise with above-mentioned and described two kinds of nucleic acid molecule of test kit part in one or another kind of complementary 5 ' overhang.
Similar, test kit of the present invention can comprise a kind of or a pair of linker, joint etc., and it comprises a topoisomerase enzyme recognition site and/or a recombination site or its cleaved products at one or two 5 ' end, randomly, contains a hydroxyl at same end.Select this class linker, joint etc., make it to contain with above-mentioned and the described two kinds of nucleic acid molecule of test kit part in one or another kind of complementary 3 ' overhang.In addition, this test kit also can comprise a kind of or a pair of linker, joint etc., and it is comprising a topoisomerase enzyme recognition site or its cleaved products at one or two 5 ' end and/or 3 ' end, and, randomly, contain a hydroxyl at same end.
Usually select linker, joint etc., make its comprise with above-mentioned and the described two kinds of nucleic acid molecule of test kit part in one or another kind of complementary 5 ' and/or 3 ' overhang.This class linker, joint etc. can be connected in with test kit contained first kind or second kind of nucleic acid molecule in one of or the end of another covalently bound nucleic acid molecule, thereby help to be coded in the structure of double cross chimeric polynucleotide of useful bait and prey polypeptide in measuring.
A kind of PCR primer in the test kit of the present invention is right, it can be used to produce a double-stranded recombinant nucleic acid molecules that chain is covalently bound, can comprise first kind of primer, it comprises with 5 '-3 ' direction: the nucleotide sequence of 5 ' outstanding sequence of the nucleic acid molecule that will connect (for example, the end of the nucleic acid molecule of coding selected marker), a topoisomerase enzyme recognition site (for example IA type or II type topoisomerase enzyme recognition site) and preferably recombination site and with 5 ' sequence complementary nucleotide sequence of target DNA sequence.This PCR primer is to also comprising second kind of primer, and this primer comprises the nucleotide sequence that is positioned at the target DNA sequence in first kind of primer complementary, 5 ' sequence downstream.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, its a kind of transcription activating domain of encoding, and comprise a locus specificity topoisomerase enzyme recognition site (being IA type II type topoisomerase enzyme recognition site) and recombination site preferably, or its cleaved products at 5 ' end; With second kind of nucleic acid molecule, it encodes a kind of DNA in conjunction with the territory, comprises a locus specificity topoisomerase enzyme recognition site (being IA type or II topoisomerase enzyme recognition site) or its cleaved products at 5 ' end.Through locus specificity topoisomerase cutting, first kind or second kind of nucleic acid molecule can contain one 3 ' overhang, and perhaps these two kinds of sequences all contain 3 ' overhang, and they are same to each other or different to each other.When nucleic acid molecule contains one 3 ' overhang, this overhang usually with the method according to this invention and first kind or second kind of a kind of nucleic acid molecule complementation that nucleic acid molecule is connected.This test kit also can comprise a kind of or a pair of linker, joint etc., they comprise a locus specificity topoisomerase enzyme recognition site (being IA type or II topoisomerase enzyme recognition site) and recombination site preferably at one or two 5 ' end, or its cleaved products, and can comprise one of two kinds of nucleic acid molecule with this test kit or another complementary 5 ' overhang.
The method according to this invention is produced, and one or two double-stranded recombinant nucleic acid molecules that chain is covalently bound can be used for various objectives, for example comprise: express a peptide species in cell, diagnose or treat a kind of disease etc.Therefore, the invention provides a kind of medicine,, can be used for the treatment of disease by in one or more cells, expressing a peptide species or expressing a kind of antisense molecule etc.By the exposing cell that exsomatizes, this double-stranded recombinant nucleic acid molecules can offer cell, then the patient is used this cell, and this method also allows to screen before using and/or increase to contain the cell of this double-stranded recombinant nucleic acid molecules, perhaps can directly supply with the patient.For the object of living is used, one or two covalently bound double-stranded recombinant nucleic acid molecules of chain are usually formulated as a kind of composition that the patient is used of being suitable for.Therefore, the invention provides and contain that the method according to this invention produces, the composition of the double-stranded recombinant nucleic acid molecules that or two chains are covalently bound.As disclosed herein, this nucleic acid molecule can be used as this patient's of treatment medicine.
The composition that is used to use with one or more pharmaceutically acceptable carrier preparations well-known in the art, comprises, for example: the aqueous solution usually, as water or physiological saline, or other solvent or carrier, as ethylene glycol, glycerine, oil, as sweet oil, or the injection organic ester.Pharmaceutically acceptable carrier can comprise the acceptable compound of physiology, for example is used for stablizing or improving the absorption of conjugate.The acceptable compound of this physiology comprises, carbohydrate for example, and as glucose, sucrose or dextran, antioxidant, as xitix or gsh, sequestrant, low molecular weight protein, or other stablizer or vehicle.It will be appreciated by those skilled in the art that pharmaceutically acceptable carrier, comprise the selection of the acceptable compound of physiology, for example, depending on the route of administration of composition, for example may be per os or parenteral, as intravenous administration, injection, intubate, or other method well known in the art.Composition of the present invention also can contain second kind of reagent, as diagnostic reagent, nutritive substance, toxin or therapeutical agent, for example, cancer chemotherapeutic agent.
Article one, chain or two covalently bound double-stranded recombinant nucleic acid molecules of chain can mix in the encapsulating material, as (seeing in oil-in-water emulsion, microemulsion, micelle, mixed micelles, liposome, microsphere or other polymeric matrix, for example, Gregoriadis, " liposome technology " the 1st volume, (FL 1984 for CRCPress, Boca Raton); People such as Fraley, Trends Biochem.Sci.6:77 (1981) all is incorporated herein by reference).For example, the liposome of forming by phosphorus or other lipid be nontoxic, physiology is acceptable and metabolizable carrier, it can prepare and use relatively simply." Stealth " liposome (referring to, for example U.S. Patent number 5,882, and 679; 5,395,619; 5,225,212, all be incorporated herein by reference) be an example of this encapsulating material, especially can be used for preparing medicinal compositions, can use other " camouflage " liposome similarly, these liposomes have prolonged the time that nucleic acid molecule keeps in circulation.For example, cationic-liposome also can be with special receptor or ligand modified (91:2580-2585 (1993) be incorporated herein by reference for people such as Morishita, J.Clin.Invest.).Nucleic acid molecule also can by with adenovirus-compound transfered cell of polylysine mixture in (referring to, for example, people such as Michael, J.Biol.Chem.268:6866-6869 (1993) is incorporated herein by reference).These compositions especially are used in external or the body, comprise that ex vivo ground imports a kind of nucleic acid molecule in cell, and the cell that wherein contains this nucleic acid molecule feeds back to the patient (referring to U.S. Patent number 5,399,346, being incorporated herein by reference).A kind of nucleic acid molecule that the method according to this invention is produced also can utilize in the biolistic method transfered cell (referring to, for example, Sykes and Johnson, with above, 1999).
Host cell
The present invention also relates to comprise one or more nucleic acid molecule of the present invention or carriers, the nucleic acid molecule particularly described in detail herein and the host cell of carrier.Can be according to the present invention the representative host cell that uses of this aspect include but not limited to: bacterial cell, yeast cell, vegetable cell and zooblast.Preferred bacterial host cell comprises: the cell of the kind of Escherichia (Bacillus coli cells particularly, most particularly intestinal bacteria DH10B, Stb12, DH5 α, DB3, DB3.1 (intestinal bacteria LIBRARY EFFICIENCY more preferably DB3.1 TMCompetent cell; Invitrogen Corporation, Carlsbad, CA), DB4 and DB5 strain (are seen the U. S. application submitted on March 2nd, 2000 number 09/518,118, its disclosure is incorporated herein by reference), the cell of the kind of bacillus (particularly subtilis (B.subtilis) and bacillus megaterium (B.megaterium) cell), the cell of the kind of streptomyces, the cell of the kind of Erwinia (Erwinia), the cell of the kind of Klebsiella, the cell of the kind of serratia. (particularly serratia marcescens (S.marcessans) cell), the cell of the kind of cell of the kind of Rhodopseudomonas (particularly Pseudomonas aeruginosa cell) and salmonella (particularly Salmonella typhimurtum (S.typhimurium) and Salmonella typhi (S.typhi) cell).The preferred animal host cell comprises: insect cell (most particularly black-tailed fruit flies (Drosophila melanogaster) cell, fall army worm (Spodoptera frugiperda) Sf9 cell and cabbage looper (Trichoplusa) High-Five cell), elegans cell (being mainly the C.elegans cell), birds cell, Amphibians cell (particularly Xenopus laevis cell), Reptilia cell and mammalian cell (most particularly NIH3T3, CHO, COS, VERO, BHK and human cell).Preferred yeast host cell comprises brewing yeast cell and pichia pastoris phaff (Pichia pastoris) cell.The host cell of these and other can obtain by commercial sources, for example available from Invitrogen Corporation (Carlsbad, Califormia), US mode culture collection center (Manassas, Virginia) and farming research culture collection center (NRRL; Peoria, Illinois).
In order to produce the host cell that comprises one or more nucleic acid molecule of the present invention and/or carrier, nucleic acid molecule of the present invention and/or carrier are imported the method for host cell described herein, those skilled in the art know.For example, utilize well-known infection, transduction, electroporation, transfection and transformation technology, nucleic acid molecule of the present invention and/or carrier can be imported in the host cell.Nucleic acid molecule of the present invention and/or carrier can import separately or import with other nucleic acid molecule and/or carrier and/or protein, polypeptide or RNAs.In addition, nucleic acid molecule of the present invention and/or carrier also can be used as a kind of precipitation, as calcium phosphate precipitation, or import in the host cell with the mixture of lipid.Also can utilize electroporation that nucleic acid molecule of the present invention and/or carrier are imported in the host cell.Equally, this quasi-molecule also can import in chemoreception attitude cell such as the intestinal bacteria.If this carrier is a kind of virus, it can or import in a kind of packing cell in external packing, and used pack virus transducer cell.Therefore, being applicable to that the intracellular multiple technologies of this aspect according to the present invention with nucleic acid molecule of the present invention and/or carrier importing are well-known, is routine techniques to those skilled in the art.This class technology is summarized in following document in detail, for example: Sambrook, J. wait the people, " molecular cloning: laboratory manual " second edition, Cold SpringHarbor, NY:Cold Spring Harbor Laboratory Press, 16.30-16.55 (1989), Watson, J.D. wait the people, " recombinant DNA " second edition, New York:W.H.Freeman and Co.pp.213-234 (1992), Winnacker, E.-L., and " from gene to clone ", New York:VCH Publisher (1987), they are laboratory manuals that these technology are described in detail in detail, quote its relevant disclosure as a reference at this.
Polysaccharase
Be used for polysaccharase of the present invention and include but not limited to polysaccharase (DNA and RNA polymerase) and reversed transcriptive enzyme.Archaeal dna polymerase includes but not limited to: thermus thermophilus (Thermusthermophilus) is (Taq) archaeal dna polymerase, Naples (Tne) (Tma) archaeal dna polymerase, Thermococcus litoralis (Tli or VENT of archaeal dna polymerase, Thermotoga maritima (Thermotoga maritima) of thermobacillus (Thermotoga neopolitana) of dwelling of archaeal dna polymerase, thermus aquaticus (Thermus aquaticus) (Tth) TM) archaeal dna polymerase, fierce fireball bacterium (Pyrococcus furiosus) (Pfu) archaeal dna polymerase, DEEPVENT TMArchaeal dna polymerase, Wo Shi fireball bacterium (Pyrococcus woosii) is archaeal dna polymerase (Pwo), the KOD2 of the kind of Pyrococcus (KOD) archaeal dna polymerase, bacstearothermophilus (Bacillus sterothermophilus) is archaeal dna polymerase (Bst), Bacillus caldophilus (Bca) archaeal dna polymerase, sulfolobus acidocaldarius (Sulfolobus acidocaldarius) is archaeal dna polymerase (Sac), thermoplasma acidophilum (Thermoplasma acidophilum) is archaeal dna polymerase (Tac), Huang (Tfl/Tub) archaeal dna polymerase of hot bacterium (Thermus flavus) of dwelling, the red hot bacterium that dwells (Thermus ruber) is archaeal dna polymerase (Tru), Bu Shi hot bacterium (the Thermusbrockianus) (DYNAZYME of dwelling TM) archaeal dna polymerase, hot autotrophic methane bacteria (Methanobacterium thermoautotrophicum) (Mth) archaeal dna polymerase, mycobacterium archaeal dna polymerase (Mtb, Mlep), intestinal bacteria pol I archaeal dna polymerase, T5 archaeal dna polymerase, T7 archaeal dna polymerase, with common pol I type archaeal dna polymerase, and mutant, variant and derivative.RNA polymerase such as T3, T5, T7 and SP6 and mutant thereof, variant and derivative also can be used according to the invention.
The nucleic acid polymerase of Shi Yonging can be had a liking for gentle thermophilic, preferably thermophilic in the present invention.Preferably have a liking for the archaeal dna polymerase (and Klenow fragment separately) that warm archaeal dna polymerase comprises Pol I family, they are all separable from biological, as intestinal bacteria, Haemophilus influenzae (H.influenzae), the abnormal cocci of anti-radiation the (D.radiodurans), helicobacter pylori (H.pylori), the orange green bacterium (C.aurantiacus) of subduing, Rickettsia prowazeki (R.prowazekii), treponema pallidum (T.pallidum), the kind of collection born of the same parents large cortical cells bacterium (Synechocystis), subtilis (B.subtilis), Lactococcus lactis (L, lactis), streptococcus pneumoniae (S.pneumoniae), mycobacterium tuberculosis (M.tuberculosis), Mycobacterium leprae (M.leprae), M. smegmatics (M.smegmatis), phage L5, phi-C31, T7, T3, T5, SP01, SP02, plastosome from yeast saccharomyces cerevisiae MIP-1, with eukaryote C.elegans and black-tailed fruit flies (Astatke, M. wait the people, 1998, J.Mol.Biol.278,147-165), from any source isolating pol III type archaeal dna polymerase, and mutant, derivative or variant, or the like.The preferred heat-stable DNA polymerase that can use in method and composition of the present invention comprises: Taq, Tne, Tma, Pfu, KOD, Tfl, Tth, Stoffel fragment, VENT TMAnd DEEPVENT TMArchaeal dna polymerase, and mutant, variant and derivative (U.S. Patent number 5,436,149; United States Patent (USP) 4,889,818; United States Patent (USP) 4,965,188; United States Patent (USP) 5,709,352; United States Patent (USP) 5,614,365; United States Patent (USP) 5,374,553; United States Patent (USP) 5,270,179; United States Patent (USP) 5,047,342; U.S. Patent number 5,512,462; WO92/06188; WO92/06200; WO96/10640; WO97/09451; Barnes, W.M., Gene112:29-35 (1992); Lawyer, people such as F.C., PCR Meth.Appl.2:275-287 (1993); Flaman, people such as J.-M., Nucl.Acids Res.22 (15): 3259-3260 (1994)).
Be used for reversed transcriptive enzyme of the present invention and comprise any enzyme with reverse transcriptase activity.This fermentoid includes but not limited to: retrovirus reversed transcriptive enzyme, retrotransposon reversed transcriptive enzyme, hepatitis B reversed transcriptive enzyme, cauliflower mosaic virus reversed transcriptive enzyme, bacterium reversed transcriptive enzyme, Tth archaeal dna polymerase, Taq archaeal dna polymerase (Saiki, R.K. wait the people, Science 239:487-491 (1988); U.S. Patent number 4,889,818 and 4,965,188), Tne archaeal dna polymerase (WO96/10640 and WO97/09451), Tma archaeal dna polymerase (U.S. Patent number 5,374,553) and mutant, variant or derivative (referring to, for example WO97/09451 and WO98/47912).Be used for preferred enzyme of the present invention and comprise the active enzyme that reduces, reduces or disappear substantially of those RNase H." the active basic reduction of RNase H " enzyme is meant, with respect to wild-type or RNase H +Enzyme, as Moloney murine leukemia virus (M-MLV), the too much syndrome virus of bird pith mother cells (AMV) or Rous sarcoma virus (RSV) reversed transcriptive enzyme, it is about 20% that the RNaseH activity of this enzyme is lower than, and more preferably is lower than approximately 15%, 10% or 5%, most preferably is lower than about 2%.The RNase H activity of any enzyme can be used multiple test determination, as U.S. Patent number 5,244,797, Kotewicz, M.L. wait the people, Nucl.Acids Res.16:265 (1988) and Gerard, people such as G.F., FOCUS 14 (5): 91 (1992) is described, and its disclosure is this complete quoting as a reference.Being used for particularly preferred polypeptide of the present invention includes but not limited to: M-MLVH -Reversed transcriptive enzyme, RSV H-reversed transcriptive enzyme, AMV H-reversed transcriptive enzyme, RAV (Rous sarcoma virus) H -Reversed transcriptive enzyme, MAV (myeloblastemia correlated virus) H -Reversed transcriptive enzyme and HIV H -Reversed transcriptive enzyme (referring to U.S. Patent number 5,244,797 and WO98/47912).Yet, it will be appreciated by those skilled in the art that and can be composition of the present invention, method and test kit similarly use from any enzyme (promptly having reverse transcriptase activity) that ribonucleic acid molecule produces dna molecular.
Being used for the enzyme with polymerase activity of the present invention can obtain from commercial channels, for example, available from Invitrogen Corporation (Carlsbad, California), Perkin-Elmer (Branchburg, New Jersey), New England Biolabs (Beverly, Massachusetts) or Boehringer Mannheim Biochemicals (Indianapolis, Indiana).Being used for the enzyme with reverse transcriptase activity of the present invention can obtain from commercial channels, for example available from Invitrogen Corporation (Carlsbad, California), Pharmacia (Piscataway, New Jersey), Sigma (Saint Louis, Missouri) or Boehringer Mannheim Biochemicals (Indianapolis, Indiana).In addition, also can be according to the known separation of those skilled in the art, the proteinic standard method of purifying natural, from natural viral or bacterial origin, separate polysaccharase with polymerase activity or reversed transcriptive enzyme (referring to, Houts for example, G.E. wait the people, J.Virol.29:517 (1979)).In addition, these polysaccharase/reversed transcriptive enzymes also can by recombinant DNA technology well known to those skilled in the art preparation (referring to, Kotewicz for example, people such as M.L., Nucl.Acids Res.16:265 (1988); U.S. Patent number 5,244,797; WO98/47912; Soltis, D.A. and Skalka, A.M., Proc.Natl.Acad.Sci.USA 85:3372-3376 (1988)).Example with enzyme of polymerase activity and reverse transcriptase activity can comprise the described any enzyme of the application's book.
Nucleic acid is synthetic, amplification and sequence measurement
The present invention can with comprise any method combined utilization of nucleic acid molecule (as DNA (comprising cDNA) and RNA molecule) synthetic.These methods include but not limited to: nucleic acid synthetic method, nucleic acid amplification method and method for nucleic acid sequencing.These methods can be used for preparing the molecule (for example starting molecule) that uses among the present invention or further operate molecule or the carrier that the present invention produces.
The nucleic acid synthetic method of this aspect can comprise one or more steps according to the present invention.For example, the invention provides a kind of method of synthetic nucleic acid molecule, comprise: (a) mix a kind of nucleic acid-templated (nucleic acid molecule for example of the present invention or carrier) and have the enzyme of polysaccharase or reverse transcriptase activity, form mixture with one or more primers and one or more; (b) be enough to make under all or part of complementary condition of first kind of nucleic acid molecule and template this mixture of incubation.This aspect according to the present invention, nucleic acid-templated can be a kind of dna molecular, as cDNA molecule or library, or a kind of RNA molecule, as the mRNA molecule.Be enough to cause the synthetic condition,, can optimize by those skilled in the art as pH, temperature, ionic strength and incubation time.When wishing, can be during building-up process or afterwards, on these synthetic molecules, add recombination site (referring to, for example, the Application No. of submitting on October 23rd, 1,998 09/177,387, it is based on the U.S. Provisional Patent Application of submitting on October 24th, 1997 number 60/065,930).
According to the present invention, target or template nucleic acid molecule or library can be by the nucleic acid molecule preparations that obtains from natural origin (as various kinds of cell, tissue, organ or biology).Can be protokaryon (bacterial cell as the cell in nucleic acid molecule source, comprise Escherichia, bacillus, serratia (Serratia), salmonella (Salmonella), Staphylococcus (Staphylococcus), streptococcus (Streptococcus), fusobacterium (Clostridium), chlamydiaceae (Chlamydia), neisseria (Neisseria), treponema (Treponema), Mycoplasma (Mycoplasma), Borrelia (Borrelia), legionella (Legionella), Rhodopseudomonas (Pseudomonas), Mycobacterium (Mycobacterium), Helicobacter (Helicobacter), Erwinia (Erwinia), Agrobacterium (Agrobacterium), the cell of the kind of rhizobium (Rhizobium) and streptomyces (Streptomyces)), or eucaryon (comprises fungi (particularly yeast), plant, protozoon and other parasite, and animal, comprise insect (the particularly cell of the kind of Drosophila), nematode (particularly Caenorhabditis elegans cell), and Mammals (particularly human cell)) cell.
Certainly, known other nucleic acid synthetic technology that is easy to use of those skilled in the art.
In others of the present invention, the present invention can with the method combined utilization of amplification or sequencing nucleic acid molecules.The nucleic acid amplification method of this aspect according to the present invention, in the method as a step (a for example one step RT-PCR) or two step (for example two one step RT-PCRs) reversed transcriptive enzyme amplified reactions known in the art, can comprise and use one or more to have the polypeptide of reverse transcriptase activity.For the longer nucleic acid molecule that increases (being that length is greater than about 3-5Kb), can use the combination of archaeal dna polymerase, as described in WO98/06736 and WO95/16028.
Can comprise one or more steps according to amplification method of the present invention.For example, the invention provides a kind of method of amplifier nucleic acid molecule, comprising: (a) mix one or more enzymes and one or more are nucleic acid-templated with polymerase activity; (b) under the condition that is enough to make enzymatic amplification one or more and all or part of complementary nucleic acid molecule of template with polymerase activity, this mixture of incubation.The present invention also provides the nucleic acid molecule of these method amplifications.When wishing, can be during the amplification step process or on the molecule of these amplifications, add recombination site afterwards (referring to, the Application No. of submitting on October 23rd, 1,998 09/177,387 for example, it is based on the U.S. Provisional Patent Application of submitting on October 24th, 1997 number 60/065,930).
Known amplification of those skilled in the art and analyzing nucleic acid molecules or segmental general method (referring to, for example, U.S. Patent number 4,683,195; 4,683,202; 4,800,159; " PCR method: method and application guide " that Innis, people such as M.A. write, San Diego, California:Academic Press, Inc. (1990); " round pcr: innovation " that Griffin, H.G. and Griffin, A.M. write, Boca Raton, Florida:CRC Press (1994)).For example, can comprise PCR (U.S. Patent number 4,683,195 and 4,683,202), strand displacement amplification (SDA by amplification method used according to the invention; U.S. Patent number 5,455,166; EP0684315) with based on the amplification (NASBA of nucleotide sequence; U.S. Patent number 5,409,818; EP0329822).
These amplification methods generally comprise: (a) in the presence of one or more primer sequences, one or more enzymes with polymerase activity are mixed with nucleic acid samples; (b) preferably by PCR or suitable automatic amplification technique amplification of nucleic acid sample, produce the nucleic acid fragment of one group of amplification.
After utilizing method amplification of the present invention or synthesizing, can separate amplification or synthetic nucleic acid fragment and further use or characterize.This step is following finishing usually: separate amplification or synthetic nucleic acid fragment according to size or by any physics or biochemical method, comprise gel electrophoresis, capillary electrophoresis, chromatography (comprising big or small chromatography, affinity chromatography and immunochromatography), density gradient centrifugation and immunosorption.Especially preferably by the gel electrophoresis separating acid fragment because it be a kind of fast, sensitive, highly repeatably separate the method for multiple nucleic acid fragment, and the fragment in can directly more several simultaneously nucleic acid samples.In a further preferred embodiment, people can expand this method, are used for separating and characterize these fragments or increase or any nucleic acid fragment of synthetic by method of the present invention.Therefore, the present invention also relates to the isolated nucleic acid molecule that produces by amplification of the present invention or synthetic method.
In this embodiment, utilize standard technique,, take out one or more amplifications or synthetic nucleic acid fragment (opinion) from the gel that is used for identifying as electroelution or physics cutting.Isolating nucleic acid fragment can insert then be suitable for transfection transform multiple protokaryon (bacterium) or the standard vector of eucaryon (yeast, plant or animal comprise the mankind or other Mammals) cell in, comprise expression vector.In addition, nucleic acid molecule by method preparation of the present invention can further characterize, for example by order-checking (promptly measuring the nucleotide sequence of nucleic acid fragment), other standard technique by method described below and this area (referring to, routine U.S. Patent number 4,962,022 and 5,498,523, about the dna sequencing method).
Can comprise one or more steps according to method for nucleic acid sequencing of the present invention.For example, the present invention can unite with a kind of nucleic acid molecule sequence measurement, comprise: a kind of enzyme that (a) will have polymerase activity mixes with a kind of nucleic acid molecule to be checked order, one or more primers, one or more Nucleotide and one or more terminators (as dideoxy nucleotide), forms a kind of mixture; (b) under the condition of all or part of complementary a group molecule that is enough to synthetic and the molecule of waiting to check order, this mixture of incubation; (c) separate this colony, measure all or part of nucleotide sequence of the molecule of waiting to check order.
Operable nucleic acid sequencing technology comprises as U.S. Patent number 4,962,022 and 5,498,523 disclosed dideoxy sequencing methods.
Test kit
On the other hand, the invention provides can with the test kit of combined utilization of the present invention.Test kit of the present invention can comprise multiple composition, but generally comprises few two kinds of compositions.The test kit of this aspect can comprise one or more containers according to the present invention, wherein can contain one or more and be selected from following composition: one or more nucleic acid molecule of the present invention or carrier, one or more primers, molecule of the present invention and/or mixture, carrier of the present invention, one or more polysaccharases, one or more ThermoScript II, one or more recombinant proteins (or be used to implement other enzyme of the method for the present invention), one or more topoisomerases, one or more buffer reagents, one or more stain removers, one or more restriction endonucleases, one or more Nucleotide, one or more terminators (for example ddNTPs), one or more transfection agents, Pyrophosphate phosphohydrolase etc.Test kit of the present invention also can comprise the specification sheets that is used to implement method of the present invention.
For example, test kit of the present invention can comprise: (1) first kind of nucleic acid molecule, it comprises the specification sheets that one or more (as 1,2,3,4,5,6,7,8,9,10 etc.) recombination site and/or topoisomerase enzyme recognition site and (2) utilize covalently bound first kind of nucleic acid molecule of method described herein and another kind of nucleic acid molecule.In specific embodiments, this specification sheets is described in the method that connects two or more nucleic acid molecule in or two chains.In a related embodiment, first kind of nucleic acid molecule transformed with topoisomerase before being contained in test kit.
Other test kit of the present invention can comprise, and for example: the nucleic acid molecule substrate that one or more carry topoisomerase can comprise the control nucleotide sequence of one or more accuracies that for example can be used for the detection kit composition or fidelity; One or more topoisomerases; One or more comprise the composition of one or more topoisomerases; One or more recombinases (or recombinant protein); One or more comprise the composition of one or more recombinases (or recombinant protein); One or more primers, its can comprise at least one topoisomerase enzyme recognition site and/or at least one recombination site, with at least a topoisomerase enzyme recognition site and/or a kind of nucleotide sequence of at least a binding site complementary, or at least a topoisomerase enzyme recognition site and with at least a nucleotide sequence of at least a topoisomerase enzyme recognition site complementary; One or more cells, it can contain or can be used for containing the nucleic acid molecule of this test kit or the nucleic acid molecule that produces with this test kit; One or more reagent, polymkeric substance, damping fluid etc. are used to utilize this test kit to implement a kind of method; Utilize this test kit to implement a kind of specification sheets of method; Or the like.
On the other hand, test kit of the present invention can comprise a kind of nucleic acid molecule, it has first terminal and second end, and encode a kind of will polypeptide expressed, for example a kind of selected marker, wherein this nucleic acid molecule comprises a kind of topoisomerase enzyme recognition site or its cleaved products at 3 ' end place of one or two end.Randomly, this nucleic acid molecule is at 5 ' end place of one or two other end, promptly not containing the topoisomerase enzyme recognition site or carrying the end of topoisomerase, contains a hydroxyl.In addition, one or two 5 ' end can comprise the outstanding sequence that differs from one another.Test kit of the present invention also can comprise a kind of nucleic acid molecule of tool, it has first terminal and second end, and encode a kind of will polypeptide expressed, for example a kind of selected marker, wherein this nucleic acid molecule comprises a kind of topoisomerase enzyme recognition site or its cleaved products at 5 ' end of one or two end.Randomly, this nucleic acid molecule contains a hydroxyl at 3 ' end place of one or two end, and preferably, one or two 3 ' end comprises the outstanding sequence that differs from one another.Test kit of the present invention in addition also can comprise a kind of nucleic acid molecule, it has first terminal and second end, and encode a kind of will polypeptide expressed, for example a kind of selected marker, wherein this nucleic acid molecule comprises a kind of topoisomerase enzyme recognition site or its cleaved products at the 5 ' end and the 3 ' end of one or two end.Therefore, should be known in that test kit of the present invention can comprise the nucleic acid molecule that contains one or more topoisomerase enzyme recognition sites or carry any various combination of the nucleic acid molecule of topoisomerase.
Test kit of the present invention also can comprise a kind of nucleic acid molecule, this molecule comprises a kind of regulatory element or other nucleotide sequence at 3 ' end of at least the first end, for example, a kind of encoding sequence, with a kind of topoisomerase enzyme recognition site and/or binding site, or its cleaved products, randomly, contain a hydroxyl at 5 ' end of the end that comprises this recognition site; Perhaps 5 ' end at least the first end comprises a kind of topoisomerase enzyme recognition site or its cleaved products, randomly, contains a hydroxyl at 3 ' end of the end that contains this recognition site; Perhaps 5 ' end and the 3 ' end at least the first end comprises a kind of topoisomerase enzyme recognition site.In certain embodiments, this test kit can comprise multiple upstream regulation element, multiple downstream regulatory element, the multiple element that can be used for detecting or identifying the molecule that comprises this element, and combination.For example, this test kit can comprise the several genes promoter element, and their composing type or induction type ground in minority or number of different types cell has activity, allows rrna bonded element, as internal ribosome entry site, the element of encoded K ozak sequence or initial methionine etc.In addition, this test kit can comprise multiple downstream regulatory element, as the polyadenylation signal sequence, stop the sequence transcribe or translate etc.Similarly, this test kit can comprise the element of encoded detectable label such as epi-position mark etc.Aspect these, test kit comprises multiple such element of the present invention, and every kind contains at least one topoisomerase enzyme recognition site and/or at least one binding site.Aspect other these, these elements can comprise a kind of outstanding sequence, make they can the method according to this invention each other effectively covalency link to each other or be covalently bound with the nucleic acid molecule of coding one peptide species such as selected marker.
Randomly, this test kit comprises the element Auele Specific Primer, and they can increase and contain a kind of construct of one of contained multiple element of test kit.When comprising these primers in the test kit, the nucleic acid molecule that comprises regulatory element or other element contains a kind of nucleotide sequence that can be discerned by primer specific, its cause primer by and comprise and regulate sequence and extend.Particularly, test kit can comprise forward and the reverse primer that element is special, and they can be right in conjunction with producing a kind of primer, and this primer is to for example a kind of specific 5 ' regulatory element of test kit and construct of specific 3 ' regulatory element of comprising of amplification.This primer is to the covalently bound functional double chain acid molecule of a kind of hope of alternative amplification the method according to this invention generation, and the partial reaction product still can not increase.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, it contains first terminal and second end, one or two 3 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products and/or a recombination site, and a kind of transcription activating domain of encoding; With second kind of nucleic acid molecule, it contains first terminal and second end, one or two 3 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products, and a kind of DNA that encodes is in conjunction with the territory; Or comprise first kind of nucleic acid molecule, it contains first terminal and second end, one or two 5 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products and/or a recombination site, and a kind of transcription activating domain of encoding; With second kind of nucleic acid molecule, it contains first terminal and second end, one or two 5 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products and/or a recombination site, and a kind of DNA that encodes is in conjunction with the territory.Test kit of the present invention can also comprise: first kind of nucleic acid molecule, it contains first terminal and second end, and a kind of DNA that encodes is in conjunction with the territory, with second kind of nucleic acid molecule, it contains first terminal and second end, and a kind of DNA that encodes is in conjunction with the territory, wherein at least the first kind of nucleic acid molecule or second kind of nucleic acid molecule 5 ' end place of at least one end or near and 3 ' end place or near contain a topoisomerase enzyme recognition site or its cleaved products, wherein another kind of double chain nucleotide contains one 3 ' hydroxyl and one 5 ' hydroxyl will having with the terminal covalently bound end of the nucleic acid molecule that comprises this recognition site.For example, this test kit can be used for producing covalently bound double-stranded recombinant nucleic acid molecules, and this molecule encoding can be used for carrying out the chimeric polyeptides that double cross is measured.It is right that this test kit can further comprise a kind of primer, it can increase and first kind or second kind of a kind of nucleotide sequence that nucleic acid molecule effectively is connected, wherein, the right at least a primer of this primer comprises topoisomerase enzyme recognition site, topoisomerase enzyme recognition site complement, or the two has concurrently.Preferably, with the amplified production of this primer, after with the cutting of locus specificity topoisomerase, contain a kind of 3 ' or 5 ' outstanding sequence, this sequence and first kind covalently bound or second kind of nucleic acid molecule complementation to producing.This test kit helps producing first kind or the second kind of nucleotide sequence that comprises this test kit, and coding can be used for carrying out the polynucleotide of the chimeric polyeptides that double cross measures.
The present invention also relates to be used to implement method of the present invention, especially for other test kit of producing product nucleic acid molecule of the present invention.The present invention also relates to the method according to this invention and carry out the test kit of homologous recombination (particularly gene targeting).This class test kit of the present invention also can comprise other composition, with the molecule that contains recombination site and/or the compound of further operation method generation of the present invention.Test kit of the present invention can comprise one or more nucleic acid molecule of the present invention (particularly comprise one or more recombination sites and randomly comprise one or more response functions starting molecule partly), one or more molecules of the present invention and/or compound, one or more upholders of the present invention and/or one or more carriers of the present invention.This class test kit randomly can comprise one or more other compositions, and it is selected from: one or more host cells, one or more Nucleotide, one or more polysaccharases and/or ThermoScript II, one or more suitable reducing, one or more primers, one or more terminators, one or more are used to produce molecule colony and one or more combinatorial library of combinatorial library.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, and its peptide species of encoding, particularly a kind of selected marker, and comprise a topoisomerase enzyme recognition site at each end.In such certain preferred embodiments, first kind of nucleic acid molecule is a kind of ring molecule (for example plasmid, carrier etc.), comprise at least one recombination site, at least two recombination sites more preferably are positioned at one or more on the molecule, the more preferably flank of two or more topoisomerase enzyme recognition sites.Preferably, first kind of nucleotide sequence comprises a kind of topoisomerase activated nucleotide sequence.More preferably, the first kind of nucleotides sequence that carries topoisomerase is listed in each end and all comprises one 5 ' outstanding sequence, and most preferably, these 5 ' outstanding sequences are different.Preferably, each 5 ' end comprises one 5 ' hydroxyl.
The test kit of this respect also comprises at least a nucleotide sequence according to the present invention, this sequence comprises a kind of regulatory element, can be upstream or downstream regulatory element, or other element, comprise one or more topoisomerase enzyme recognition sites at one or two end, and randomly, comprise one or more recombination sites.Preferably, test kit comprises multiple nucleic acid molecule, and each nucleic acid molecule all comprises different regulatory elements or other element, for example, but the sequence in encode a kind of mark or other detection molecules or cellular compartment territory.Different elements can be dissimilar particular adjustments element, and for example, composing type or inducible promoter or tissue-specific promoter can be different types of components perhaps, comprises, for example: transcribe and translation adjusting element, epi-position mark etc.This class nucleic acid molecule can be the topoisomerase activated, can comprise 5 ' outstanding sequence, this sequence helps with effective covalently bound these elements of pre-determined direction, makes that particularly a peptide species selected marker can be external or express in one or more cellular types.
This class test kit also can comprise primer, comprises first kind and second kind of primer, and a kind of primer that makes it possible to select to comprise first kind and second kind primer is right, the covalently bound double-stranded recombinant nucleic acid molecules of the hope that the composition that utilizes this test kit of being used for increasing produces.For example, this primer can comprise: first kind of primer, it be usually located at generation double-stranded recombinant nucleic acid molecules 5 ' end the element complementation, for example, comprise the part of the nucleic acid molecule of promoter element; With second kind of primer, it be usually located at generation double-stranded recombinant nucleic acid molecules 3 ' end the element complementation, for example, comprise the Transcription Termination site or the part of the nucleic acid molecule of a kind of epi-position mark of encoding.According to the element that is selected from the test kit that is used to produce covalently bound double-stranded recombinant nucleic acid molecules, can select suitable first kind and second kind of primer, total length formation function body is used for increasing.
In another embodiment, test kit of the present invention comprises multiple different elements, and every kind all is the topoisomerase activated at one or two end, all can comprise one 5 ' outstanding sequence.This 5 ' outstanding sequence may be that particular element is peculiar, perhaps may be multiple related elements, and for example multiple different promoter element is common.Preferably, design 5 ' outstanding sequence of these elements, make that one or more elements can be effectively covalently bound, produce a kind of useful function, for example, the element that comprises the element of Kozak sequence and comprise translation initiation site can contain complementary 5 ' overhang, makes these elements can the method according to this invention effectively covalently bound.
Multiple element in the test kit can comprise any element, comprises and transcribing or translation adjusting element; The required element of nucleotide sequence reproduce in bacterium, insect, yeast or the mammalian host cell; The element that comprises locus specificity nucleic acid binding protein (as restriction endonuclease or recombinase) recognition sequence; But the element of coding expression product (as epi-position mark or drug resistance gene); Or the like.Therefore, test kit of the present invention provides the convenient source of different elements, for example, can select these elements according to the specific cells that the construct that produces by method of the present invention will import or express.This test kit also can comprise the PCR primer, comprises first kind or second kind of primer, and they are combination as mentioned above, and with the covalently bound double-stranded recombinant nucleic acid molecules that amplification utilizes the element of this test kit to produce, it is to use the element of test kit to produce.Randomly, this test kit also comprises one or more topoisomerases (for example one or more locus specificity topoisomerases) and/or one or more recombinases (or recombinant protein) of some amount, can be used for the covalently bound first kind of nucleic acid molecule that contains the topoisomerase enzyme recognition site and second kind (or other) nucleic acid molecule, the latter can be a topoisomerase activated nucleic acid molecule, perhaps can be the nucleotide sequence that contains the topoisomerase enzyme recognition site.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, and its a kind of selected marker of encoding comprises a topoisomerase enzyme recognition site at each end; First kind and second kind of PCR primer are right, and it can produce first kind and second kind of amplified production, and this product is can the method according to this invention covalently bound with pre-determined direction and first kind of nucleic acid molecule.This construct that produces can pass through in the locus specificity homologous recombination transfered cell, and can mix in the cellular genome, can stablize preservation at this, and can express a kind of heterologous polypeptide in cell, perhaps can knock out a kind of target gene function.For example, the target gene of desiring to knock out can be that at least a portion sequence is known or be easy to measure and wish to destroy any gene of its function, for example, gene or other any gene of oncogene, gene, encoding serine/Threonine or the Tyrosylprotein kinase relevant with apoptosis.
First kind of PCR primer in the test kit of the present invention is to comprising first kind of primer, it comprises with 5 '-3 ' direction: (for example give prominence to sequence with 5 ' of the nucleic acid molecule that will be connected, the end of the nucleic acid molecule of coding selected marker) complementary nucleotide sequence, with topoisomerase enzyme recognition site and/or recombination site complementary nucleotide sequence and with 3 ' sequence complementary nucleotide sequence of target DNA sequence.This first kind of PCR primer be to also comprising second kind of primer, and this primer comprises the nucleotide sequence that is positioned at the target DNA sequence in first kind of primer complementary, 3 ' sequence downstream.
Second kind of PCR primer in the test kit of the present invention is to comprising first kind of primer, it comprises with 5 '-3 ' direction: with 5 ' outstanding sequence complementary nucleotide sequence of the nucleic acid molecule that will be connected, with topoisomerase enzyme recognition site complementary nucleotide sequence, randomly with recombination site complementary nucleotide sequence, with with 5 ' sequence complementary nucleotide sequence of target DNA sequence, wherein 5 ' of target gene sequence is positioned at the downstream with 3 ' sequence of the right first kind of primer complementary target DNA sequence of first kind of primer.This second kind of PCR primer is to also comprising second kind of primer, and it comprises a kind of nucleotide sequence, with target gene 3 ' the sequence complementation that is positioned at 5 ' sequence downstream of first kind of contained target DNA sequence of primer.
In another embodiment, test kit of the present invention comprises: first kind of nucleic acid molecule, its a kind of transcription activating domain of encoding, and 3 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products; With second kind of nucleic acid molecule, it encodes a kind of DNA in conjunction with the territory, 3 ' end place or near comprise a topoisomerase enzyme recognition site and randomly a recombination site or its cleaved products.Through locus specificity topoisomerase cutting, first kind or second kind of nucleic acid molecule can contain one 5 ' overhang, and perhaps these two kinds of sequences all contain 5 ' overhang, and they are same to each other or different to each other.When nucleic acid molecule contains one 5 ' overhang, this overhang common and the method according to this invention and first kind or second kind of a kind of nucleic acid molecule complementation that nucleic acid molecule is covalently bound.
This test kit also can comprise a kind of or a pair of linker, joint etc., they comprise a locus specificity topoisomerase enzyme recognition site and recombination site randomly at one or two 5 ' end, or its cleaved products, and randomly contain a hydroxyl at same end.Select these linkers, joint etc., make its contain with above with one of described two kinds of nucleic acid molecule of test kit part or another complementary 5 ' overhang.Similarly, this test kit also can contain a kind of or a pair of linker, joint etc., and they comprise a topoisomerase enzyme recognition site and randomly a recombination site or its cleaved products at one or two 5 ' end, randomly contain a hydroxyl at same end.Select these linkers, joint etc., make its contain with above with one of described two kinds of nucleic acid molecule of test kit part or another complementary 3 ' overhang.In addition, this test kit also can contain a kind of or a pair of linker, joint etc., they one or two 5 ' end and/or 3 ' end place or near comprise a topoisomerase enzyme recognition site or its cleaved products, randomly contain a hydroxyl at same end.Select these linkers, joint etc., make its contain with above with one of described two kinds of nucleic acid molecule of test kit part or another complementary 5 ' and/or 3 ' overhang.These linkers, joint etc. can be connected in with the end of the covalently bound nucleic acid molecule of provide a kind of of test kit or other first kind or second kind of nucleic acid molecule, can be used for the bait that double cross measures and the chimeric polynucleotide of prey polypeptide thereby help making up coding.This test kit also can contain a kind of PCR primer or primer right, they can be used for preparing the nucleotide sequence colony that comprises topoisomerase enzyme recognition site or its cleaved products of amplification.Other test kit of this aspect can randomly comprise one or more other compositions according to the present invention, as one or more topoisomerases, one or more recombinant proteins, one or more carriers, one or more have polypeptide and one or more host cells of polymerase activity.
Various equivalent modifications is to be understood that, the information known according to those of skill in the art, according to description of the invention, understand other the suitable modification and the change of method described herein and purposes easily, can under the situation of the scope that does not deviate from the present invention or its any embodiment, carry out.The present invention to be described in detail in detail now, can be expressly understood more, just in order illustrating, to be not intended to limit the present invention at this by the following example.
Embodiment
Embodiment 1
Covalently bound double-stranded recombinant nucleic acid molecules utilizes the structure of topoisomerase
This experiment confirm, topoisomerase can be used for producing covalently bound two strands (ds) recombinant nucleic acid molecules.
A. method
Unless otherwise indicated, this experiment is carried out with following method.In 50 μ l reaction systems, carry out PCR, wherein comprise 10ng plasmid (template), every kind of primer of 100ng, 2.5 Taq of unit archaeal dna polymerases (Sigma), 5 μ l 10 * PCR damping fluids and 4 μ l dNTPs (each 200mM).Reaction system is carried out initial sex change at 94 ℃ of following incubation 4min; 94 ℃ of (45sec) sex change subsequently, 55 ℃ of (45sec) primer annealings, 72 ℃ (every kb target sequence 1min) extend totally 30 PCR circulations.After the circulation, reaction system places under 4 ℃ then at 72 ℃ of following incubations (10min).
The topoisomerase ligation is carried out in 5 μ l systems, comprises element (PCR produce or synthetic), 0.5 μ l 500mM Tris (pH7.5) and the 0.5 μ g topoisomerase of every kind of amplification of 50-100ng.Reaction system is incubation 5min at room temperature, and the product that connects with 1-2 μ lTOPO-produces linear fragment then.
Being created in the 50 μ l reaction systems of linear fragment undertaken by PCR, wherein comprises product (template), every kind of primer of 100ng, 2.5 Taq of unit archaeal dna polymerases (Sigma), 5 μ l 10 * PCR damping fluids and 4 μ l dNTPs (each 200mM) that 1-2 μ l TOPO-connects.PCR carries out as mentioned above.
The linear fragment that produces with SNAP Miniprep test kit (Invitrogen) as purifying as described in the manufacturer.Basically, 100 μ l PCR products mix with 300 μ l binding buffer liquid, 750 μ l Virahols, and mixture places SNAP Miniprep post/collection tube, with the centrifugal 30sec of 7000rpm.Wash post with 700 μ l lavation buffer solutions, with the centrifugal 30sec of 7000rpm; Use 900 μ l 1 * whole washings washing then, with the centrifugal 30sec of 7000rpm.This post with the centrifugal again 30sec of 7000rpm, is removed all residual liquid then.Add water (30-50 μ l), this post is with the centrifugal 30sec of 7000rpm, the DNA of wash-out purifying.DNA concentration is passed through spectrophotometry.
B. the generation of the linear nucleic acid molecule of topoisomerase connection
Design PCR primer checks that element is to green fluorescent protein (GFP; See Fig. 9 A-C) orientation on the encoding sequence adds.Utilize the primer shown in Fig. 9 D, from pCMV/myc/nuc plasmid template amplification CMV promotor (about 700bp) and BGH polyadenylation signal sequence (about 380bp), from pcDNA3.1/GFP plasmid template (Invitrogen) amplification GFP element (about 700bp).The amplified production that produces connects with topoisomerase as mentioned above, with the part of ligation thing as template, use primers F 6945 (SEQ ID NO:11) and F6948 (SEQ ID NO:15) and carry out PCR, complete construct (CMV+GFP+BGH is used for increasing; About 1700bp).In addition, 5 μ l connect mixed solution and handle 30min with Proteinase K down at 37 ℃, remove all bonded topoisomerases, and electrophoresis on 3-8%NuPAGE Tris-acetate gel is checked to connect product then.
When producing recombinant nucleic acid molecules, only observe the connection product (Fig. 9 A or 9B) of a small amount of correct size (1.7kb), and produce a large amount of products (Fig. 9 C) of wishing with the element that contains non-palindrome overhang with the element that contains the outstanding sequence of the palindrome.These results confirm, contain with the production efficiency of the covalently bound double-stranded recombinant nucleic acid molecules of two chains of the effective nucleotide sequence that connects of pre-determined direction relevant with the character of outstanding sequence.Particularly, the outstanding sequence that select to lack palindrome district causes the efficient generation of the covalently bound double-stranded recombinant nucleic acid molecules of two chains, and exist palindromic sequence to cause forming connection product outside the expection product in the overhang, thereby reduced the efficient of producing the product of wishing.
Embodiment 2
The function of the covalently bound double-stranded recombinant nucleic acid molecules that topoisomerase produces characterizes
This embodiment confirms that method of the present invention provides the method for the covalently bound functional double-stranded recombinant nucleic acid molecules of two chains of a kind of production.
A. the construct that connects from Topo-is expressed justice and antisense mRNA is arranged
Two kinds of synthins that utilization contains T7 or T3 promoter sequence have been checked a kind of ability that contains the double-stranded recombinant nucleic acid molecules of functional upstream and downstream element at the goal gene flank of producing.These elements pass through the annealing synthetic oligonucleotide to preparation.The T7 joint is by mixing the T7top (F9304 of equimolar amount; SEQ ID NO:20) and T7bottom (F9305; SEQ IDNO:21) oligonucleotide produces (Fig. 9 D).The T3 joint is by mixing the T3top (F9661 of equimolar amount; SEQ ID NO:23) and T3bottom (F9662; SEQ ID NO:24) oligonucleotide produces (Fig. 9 D).Mixed solution heats 5min in boiling water, be cooled to room temperature then.These two kinds of elements all are designed at one end contain a topoisomerase enzyme recognition site.
GFP gene GFP primers F 8418 (SEQ ID NO:17) and F8420 (SEQID NO:18, Fig. 9 D; Referring to Fig. 9 C) amplification.Unpurified GFP PCR product (2 μ l) mixes with 50ng T7 joint and 50ng T3 joint, adds topoisomerase, and the topo-ligation at room temperature continues 5min.As template, carry out 50 μ lPCR reaction with 2 μ l ligation liquid with the primer of T7 and T3 sequence.
After the amplification, with the template of 4 μ l equal portions PCR reaction solutions as in-vitro transcription.This reaction is carried out according to working instructions with Promega RiboProbe in-vitro transcription system test kit.Use T7 or T3 RNA polymerase and continue reaction 60min (final volume 20 μ l) down at 37 ℃.The equal portions of in-vitro transcription reaction are with RNase or DNase digestion, and the sample of indigested and digestion is electrophoresis in the 2%TBE gel then.The remarkable band (justice or antisense orientation are arranged) of a visible prediction size in indigested sample.Sample product band minimizing not to be noted with the DNase processing.Sample is handled the after product band with RNase and is disappeared, and shows that product is RNA.These results confirm, can produce two chains with the covalently bound double-stranded recombinant nucleic acid molecules of pre-determined direction with topoisomerase according to method of the present invention, and can be by this nucleic acid molecule expressed rna transcript.
B. the construct that connects from Topo-is expressed translation product
The polynucleotide that has detected the topoisomerase connection is supported the ability of coupling in-vitro transcription/translation.The method according to this invention contains the element of T7 promotor (adding the Kozak sequence) and the lacZ PCR product of 1kb, 2kb or 3kb by connection, produces a kind of double-stranded recombinant nucleic acid molecules.With template (primer, the SEQ ID NO:25-28 of 2 μ l products as pcr amplification reaction; Fig. 9 D)., utilize TNTT7 Quick for PCR DNA test kit to carry out coupling and transcribe/translate as template with unpurified amplified reaction equal portions (3 μ l) according to manufacturers instruction (Promega).
Each reacts 2 μ l equal portions by Tris-glycine gels (Novex) electrophoretic separation, shows by radioautograph then, shows the protein to expect the size migration.These results confirm that method of the present invention can be used for producing the covalently bound double-stranded recombinant nucleic acid molecules of a kind of two chains, and it can be used as template, expresses a peptide species by coupling in-vitro transcription/translation reaction.
C. be used to carry out the generation of the construct that Topo-that double cross measures connects
It is a kind of effective ways that detect protein-protein interaction in vivo that double cross is measured.This is measured based on the following fact: multiple eukaryotic transcription activator is made up of two kinds of physics and the isolating territory of function, comprise can combine with specific dna sequence bonded DNA the territory with can with the interactional transcription activating domain of basal transcription machine.Trans-activation domain combines the assembling of the bound energy promotion function RNA polymerase II mixture in territory with DNA, for example can detect reporter gene transcriptional activation (Field and Song, Nature 340:245-246,1998) thereby make.When first kind of protein X combines the territory with DNA such as GAL4 merges in conjunction with the territory, and may merge with the identical or different second kind of protein Y of X and trans-activation domain such as VP16 territory the time, the transcribing of reporter gene of containing the GAL4 promotor by detection can identification of protein X and the interaction of Y.
Detected the ability that method production of the present invention is used to express the linear construct of the fusion rotein that carries out Mammals double cross mensuration.Be created in GAL4 (F10779 and the F12667 primer that suitable end contains the topoisomerase site with PCR; Be respectively SEQ ID NO:1 and 3), VP16 (F10779 and F12668 primer; Be respectively SEQ ID NO:1 and 5), p53 (F12669 and F12505 primer; Be respectively SEQ ID NO:8 and 4), T antigen (F12670 and F12505 primer; Be respectively SEQ ID NO:9 and 4) and SV40pA (F12016 and F561 primer; Be respectively SEQ ID NO:6 and 7) element.Produce covalently bound double-stranded construct GAL4+p53+SV40pA and VP16+T antigen+SV40pA with topoisomerase, the connection product of generation is as the template of pcr amplification.
The GAL4+p53+SV40pA of purifying and VP16+T antigen+SV40pA PCR construct and lacZ reporter gene (pGene/lacZ plasmid; Invitrogen) cotransfection Chinese hamster ovary celI (6 orifice plates, 1 * 10 5Cells/well).In parallel laboratory test, detect the application of the plasmid vector that contains expression construct, and the application that contains the PCR reaction mixture of unpurified construct.Control reaction is with GAL4+pA and do not contain and insert segmental VP16+pA (negative control) or p53+VP16 (positive control) carries out.The activity of kit measurement reporter gene is measured in cell cracking 48 hours after transfection with beta-galactosidase enzymes.
Detect high-caliber reporter gene activity with positive control (Figure 10, sample 3) and in sample (Figure 10, sample 4) with reporter gene and linear GAL4+p53+SV40pA and VP16+T antigen+SV40pA construct cotransfection.Detect low-level activity when using the construct (Figure 10, sample 1) of plasmid form and (but be higher than negative control; Sample 5,6,8,9).In sample (sample 7), also observe low-level activity with bait unpurified, that PCR produces and prey construct cotransfection.These results confirm that method of the present invention can be used for preparing and be used to carry out the construct that double cross is measured.
Embodiment 3
Orientation is carried the generation and the application of the Gateway carrier of Topo
Foreword
The directed Gateway carrier that carries Topo of development, it is topoisomerase and GATEWAY TMThe combination of recombinant clone technology.These instruments help easily entering the Gateway system by reducing before being reassembled as the donor carrier necessity of adding attB site (25 base pairs) to arbitrary end of the ORF of pcr amplification.On the contrary, hold the tag identification sequence (CACC) of adding 4 bases to 5 ' of OFR, directed then TOPO-clone PCR products produces a kind of entering or the expression vector (see Fig. 8 and 9) compatible with Gateway.
In this embodiment, produce three kinds of Topo-Gateway carriers and a kind of destination carrier altogether.Produce two kinds of topo and enter carrier: (1) pENTR/D-TOPO (Figure 22), it can make the ORF directed cloning merge between the attL site of protokaryon and all eucaryon DEST carriers to transferring to all N ends; (2) pENTR/SD/D-TOPO (Figure 23), it can make the directed topo of ORF be cloned into the downstream of protokaryon ribosome bind site (Shine-Dalgarno).Cloned genes can be transferred in the protokaryon DEST carrier that does not contain the N endmost tag by this way, and expresses in bacterium, produces the protein that contains natural N end.
Also once made up a kind of directed Topo Gateway mammalian expression vector pcDNA/GWD-TOPO (Figure 19).This carrier can be with a kind of ORF directed cloning in the pcDNA3.1 derivative.Be cloned into this year of intravital ORF expression under the control of CMV promotor in mammalian cell.Clone's the flank of ORF in this carrier is the attB site, and they can be moved around the Gateway system by BP and LR clone enzyme reaction.This carrier also encode C end V5 label, TK polyadenylation signal and be used for Xin Meisu (G418) resistance marker at mammal cell line screening stable clone.At last, by shifting ccdB and chlorampenicol resistant box by pcDNA/GWD-TOPO Make up the Gateway destination carrier.
These Topo Gateway enter with expression vector and have improved the easy degree that enters the Gateway system, because they make the researchist can directly clone a kind of gene of pcr amplification, and do not need to add the attB site and carry out BP clone enzyme reaction on primer.
Materials and methods
PcDNA/GWD-TOPO Structure.PcDNA/GWD-TOPO Following structure: at first replace the multiple clone site among the pcDNA3.1aatb (a kind of earlier version that contains the BGH polyadenylation signal).Its implementation is with BsrG I (it is cut at each the att site endoenzyme that is positioned at the MCS flank) digestion parental generation carrier, inserts the double chain oligonucleotide (Figure 18) of the new MCS of coding.In case correct insertion is confirmed, promptly replace V5/His label and BGH polyadenylation signal with the V5 label, be 3 terminator codons (TAG, TGA, TAA) and afterwards from thymidine kinase (TK) polyadenylation signal of hsv.Implementation method is to digest this carrier with AscI and AvrII, cmy vector fragment, the fragment (seeing Figure 19) of two kinds of new sequences of coding of insertion in ternary connects.
The structure of pcDNA-DEST40.PcDNA-DEST40 is by pcDNA/GWD-TOPO Produce by carrying out BP clone enzyme reaction with pDONR221.PDONR221 and pcDNAGW-DT (sc) and BP clone enzyme (InvitrogenCorporation; Carlsbad, CA) combination in suitable damping fluid.According to this reaction system of standard scheme incubation, on the kantlex flat board, screen transformant.Screen product containing on the substratum of penbritin/paraxin, a kind of attP site that is positioned at ccdB, ccdA flank and pcDNA destination carrier (seeing Figure 20) of chloramphenicol resistance gene of containing.
PENTR/D-TOPO (sc) structure.By with pcDNA/GWD-TOPO (sc) carry out BP and be binned in a transformation of interpolation sequence between the attP site, modify pDONOR221, produce pENTR/D-TOPO (sc) (Figure 21).PDONR221 and pcDNA/GWD-TOPO (sc) and the combination in suitable damping fluid of BP clone enzyme.Except carrying out pENTr/D-TOPO with the DH10BsbcC cell (sc) outside conversion and the propagation, according to this reaction system of standard scheme incubation.This clone contains a sudden change, allows to keep having the plasmid of close closely hairpin structure (for example attL site).This plasmid is not supported the growth of Top 10 cells in selecting substratum.
PENTR/D-TOPO And pENTR/SD/D-TOPO Generation.By digesting successively with NotI, AscI and XhoI, then 15 ℃ down with directed topo linker Topo-D71 ,-D72 ,-D75 and-D76 is (for pENTR/SD/D-TOPO ) or Topo-D73 ,-D74 ,-D75 and-D76 is (for pENTR/D-TOPO ) connect and spend the night, make carrier pENTR/D-TOPO (sc) orientation is carried topo.By isopropanol precipitating at room temperature, the carrier of transforming is separated with free oligonucleotide.The oligo Topo D-70, T4 kinases and the recombinant vaccinia topoisomerase I that add normarzing annealing make carrier purifying, that transform carry topo.After 15 minutes, this carrier is by agarose gel electrophoresis (NB JC-12,2001-035, page 3) or 25Q MacroPrep post (BioRad) (NB2000-0342, the 45th page) chromatography purification at 37 ℃ of following incubations.With 1ng cmy vector and 5ng orientation (CACC) 750bp insertion fragment to be measured incubation 5 minutes at room temperature, measure directed topo cloning efficiency.Transform Top 10 chemoreception attitude cells with 2 μ l cloning reaction things then, carry out microbiotic and select containing on the LB flat board of kantlex growth.
Topo-Gateway clone and genetic expression.In order to detect the ability that these carriers support that Topo clone, Gateway clone and protein produce, utilize the primer that mixes 4 base CACC marks at the direct upstream of ATG initiator codon 5 ' end, the gene (preserving number D32129) of pcr amplification coding people I class HLA.The PCR product cloning is gone into pENTr/D-TOPO And pENTr/SD/D-TOPO In.10 clones of each HLA reaction system carry out the directed PCR reaction of bacterium colony (d-PCR).In this experiment, these clones increase with T7 primer (be incorporated into attL1 site 5 ') and 129 reverse primers (HLA3 ' terminal specific).
Except the HLA gene, E.C. 2.3.1.28 (CAT) gene that increases similarly, and be cloned into two kinds and enter in the carrier.After preparation and digestion were analyzed in a small amount, clone of each Reaction Separation utilized the order-checking of M13 forward primer and M13 reverse primer.All enter the clone and all confirm by order-checking, and by L/R clone's enzyme reaction and pcDNA/GW DEST 40 (pENTR-D-TOPO Clone) or pET DEST 42 (pENTR/SD/D-TOPO The clone) reorganization.(site is positioned at the 5 ' end of the ORF of directional transformation, ca to positive colony by NcoI CCATGG) and NotI (data not shown) digestion confirmation.Then with the pcDNA-DEST 40 (HLA and CAT) and the pcDNa/GW/D-TOPO that produce (HLA and CAT) construct rotaring redyeing COS cell.Cell Lipofectamine 2000,8 μ gDNA and the transfection of Optimem damping fluid.Reaction solution application cell 5 hours is changed substratum then.After being incubated overnight under 37 ℃, harvested cell, cracking, and carry out 4-20%Tris-glycine gels electrophoresis according to standard program.Behind the electrophoresis, protein transduction moves on on the nitrocellulose filter, and sealing with the hybridization of V5-HRP antibody probe, is carried out ECL and detected.
Positive colony of each pET DEST 42 reactions transforms BL21 (DE3) cell, and in LB/Amp grow overnight.Culture grows to O.D. (600nm)=0.5 with same medium dilution in 1: 25, and add IPTG this moment is that 1mM induces Recombinant Protein Expression to final concentration.Nutrient solution descends growth after 3 hours at 37 ℃, centrifugal collecting cell.The cell precipitation equal portions boil in NuPage sex change sample buffer, carry out the 4-12%NuPage polyacrylamide gel electrophoresis, use SafeStain TM(Invitrogen) dyeing.HLA and the direct topo of CAT gene are cloned among pET100 CAT and the HLA (dTopo, no attB site), as the positive control of testing gene expression in pET DEST 42 carriers.With these construct transfections BL21 (DE3) large intestine rod cell, grow to logarithmic phase, induce with IPTG as mentioned above.
Result and discussion
HLA and CAT are cloned in the directed cloning efficient among pENTR-dTopo and the pENTR/SD-dTopo.Directed PCR reacts and is used for guaranteeing to be cloned into pENTR/D-TOPO And pENTR/SD/D-TOPO Interior HLA ORF has correct direction.Each Topo clone transforms 10 bacterium colonies of picking, directly carries out the PCR reaction as described in " materials and methods ".Among 10 pENTR/SD-HLA clone who is detected 8 are in the right direction, and among 10 pENTR-HLA clones 9 are correct.These carriers that detect with gel-purified carry out, and their about 10-15% do not have insertion background (data not shown).
In addition, also the CAT clone is carried out restriction analysis.Separating clone is with NcoI and AscI dna digestion.One of two NcoI sites are present in the 5 ' end of each ORF among the CAT clone in the right direction, as the part of Kozak directional transformation sequence and preceding two codons (caCCATGG) of CAT gene.AscI is present in the 3 ' end of ORF in the carrier.Clone in the right direction will contain two NcoI sites (is positioned at 5 ' one at end and is positioned at inside), and will produce the fragment of 500bp and 150bp after using the AscI double digestion.CAT ORF is at its 3 ' end encoding sequence CGCC, and it and optimum mark sequence have the mispairing of a base pair.This close homology makes CAT PCR product only with 50% efficient directed cloning (among 8 clones 4, data not shown).
Enter clone's order-checking.Check order from two ends for every kind of being reassembled as that DEST carrier and expressing subsequently selects enters the clone, confirm that linker correctly is connected with ORF.Use M13 forward and reverse primer, reactant is delivered to ResGen and is checked order with ABI 3700 kapillary sequenators.From these reactions, obtain the readable sequences of minimum 600 bases.Obviously because reaction continues by the attL site, signal has losing to a certain degree, but utilizes this method still to keep tangible signal (data not shown) behind this point.
HLA and the CAT expression in the COS cell.As the testing gene rotaring redyeing COS cell in these constructs, detect pcDNA/GW/D-TOPO with HLA and CAT Expression with pcDNA-DEST 40.The Westernblot of the lysate of results by using V5 antibody carries out probe hybridization to the recombinant protein of V5 mark.Figure 27 data presented shows that HLA and CAT gene are all expressed in these carriers, no matter gene is directly cloned (Figure 27, the 3rd, 6 roads) by the Topo clone is still cloned enzyme from pENTR/D-TOPO with LR Clone in (Figure 27, the 2nd, 5 roads) after middle the transfer.
The bacterial expression of HLA and CAT.Be cloned into pENTR/SD/D-TOPO Interior CAT and HLA gene are transferred among the pDEST-42 (pET, C holds V5/His) by LR clone enzyme.Figure 28 result displayed prompting, no matter its flank contains the attB site to the CAT gene does not still have, and all expresses (Figure 28, relatively the 6th road and the 7th road) in bacterium.Find that the CAT gene is from pENTR/SD/D-TOPO Transfer to behind the pET DEST good representation in intestinal bacteria, this has confirmed that this system is utilizing the clone of Topo-Gateway system and expressing the purposes of ORF.
What is interesting is that in two were independently tested, the HLA (flank is the attB site) of being cloned among the pDEST 42 can not express (Figure 28, the 3rd, 4 roads) in BL21 (DE3) cell.As above finding, from the same clone's of entering HLA gene after in a kind of Mammals DEST carrier of recombinating in the COS cell good representation.In addition, the pET system can not support that flank is the fact prompting of the HLA genetic expression in attB site, utilize the Gateway system at least the expression in bacterium may have the change of gene specific.Factor that may be relevant with this result is, by HLA unusual electrophoresis (41kDa of 30kDa rather than prediction) in gel of control vector (pET 100 d-Topo) expression.This human protein under any circumstance perhaps all can not be in bacterium good representation, add the problem that the attB site may increase the weight of to express.Need more experiment to be familiar with this discovery.
In a word, we have described two kinds of structure and detections that new Topo Gateway enters carrier, a kind of new Topo Gateway expression vector and by a kind of new DEST carrier of its generation.These new tools that combine the versatility of Topo clone's easy to be capable property and efficient and Gateway system allow to clone and express a large amount of genes with minimum expense and work at different aspect.
Embodiment 4
The alternative approach of topoisomerase enzyme clone
In a preferable alternative embodiment of the present invention, following structure TOPO SSS carrier: at first obtain commercially available cloning vector.A kind of such carrier is that (Invitrogen Corp, Carlsbad CA), are a kind of ring-type superhelix carriers that contains the unique element of design to A type pUni/V5-His.These elements comprise: improve polyadenylation sequence, T7 transcription termination region, the R6Kg dna replication dna starting point of the stability of mRNA in eucaryon host and be used for kalamycin resistance gene and the promotor that antibiotics resistance is selected.In addition, A type pUni/V5-His also contains a multiple clone site, and it is the synthetic DNA sequence of a series of restriction enzyme enzyme recognition sites of coding.Specific position cloned DNA for to carrier makes up these sites.Also contain the loxP site of inserting endonuclease enzyme recognition site 5 ' in the multiple clone site of carrier, thereby be fused to (Echo in multiple other expression vector with helping the Cre recombinase-mediated TMCloning system, Invitrogen Corporation, Carlsbad, CA).In order easily to detect the fusion rotein of expression, contain a kind of optional C end V5 epi-position mark with anti--V5 antibody.For can fast purifying and detect expressed protein, also contain a kind of optional C end polyhistidyl (6 * His) marks.The bacterial ribosome binding site that is arranged in downstream, loxP site makes the transcription initiation intestinal bacteria become possibility.Although this unit construction is special for A type pUni/V5-His cloning vector, multiple similar clone and expression vector can obtain from commercial channels, perhaps can assemble with this area known sequence and method.A type pUni/V5-His is the double-stranded plasmid of a kind of 2.2kb.
Make up following the carrying out of cloning vector of carrying topoisomerase I by A type pUni/V5-His: this carrier of endonuclease digestion, carry out the complementation annealing of synthetic oligonucleotide then, and cut heteroduplex with cowpox topoisomerase I site-specific ground.SacI and EcoRI are two kinds in the multiple restriction endonuclease sites that exists in the multiple clone site of A type pUni/V5-His.With corresponding restriction enzyme SacI and EcoRI digestion A type pUni/V5-His, on carrier, produce cohesive end (5 '-AGCT-3 ' and 5 '-AATT ' 3 ').These enzymes can be available from how tame supplier, comprise New England Biolabs (Beverly, MA, catalog number (Cat.No.) RO156S, SacI and RO101S, EcoRI).Utilize the isopropanol precipitating A type pUni/V5-His of separating digesting from the fragment of digestion easily.These and other method (Sambroo k of known digestion of those skilled in the art and DNA isolation, J., Fritsch, E.F. and T.Maniatis. (1989) " molecular cloning: laboratory manual " second edition, Cold Spring Harbor Laboratory Press.5.28-5.32).
The carrier of purifying, digestion is then with two specific specificity oligonucleotide linkers and T4 dna ligase incubation.This linker is the oligonucleotide duplex that contains the end compatible with the EcoRI end with the SacI of carrier.It will be appreciated by those skilled in the art that other connection oligonucleotide that can contain suitable sequence for other preparing carriers that contains different restriction sites.With T4 dna ligase incubation after, contain the carrier of the linker of connection with the Virahol purifying.TOPO D1 at one end contains strand EcoRI overhang with the duplex that is connected that TOPO D2 annealing produces, and contains the strand overhang of 12 Nucleotide at the other end.
First kind connects oligonucleotide (TOPO D1) and EcoRI cohesive end 3 '-TTAA-5 ' complementation.In addition, TOPO D1 contains other 24-bp, comprises that the topoisomerase that is positioned at 3 ' end upstream 16-bp has five pyrimidine elements, 5 '-CCCTT.Remaining sequence and size that TOPO D1 connects oligo are variable, can modify to satisfy researchist's specific needs.According to this one side of the preferred embodiment of the invention, the full length sequence of used linker is 5 ' AATTGAT CCCTTCACCGACATAGTACAG-3 '.
Second kind of connection oligonucleotide (TOPO D2) must be complementary fully with TOPO D1.5 ' directly complementation of TOPO D2 and EcoRI cohesive end, the end chain of extension linearized vector.In addition, TOPO D2 also contains sequence 3 '-GTGG, and it is the essential SSS of directed cloning.In this embodiment, select and Kozak sequence complementary SSS, known it can by improve rrna on the mRNA in conjunction with helping the expression of ORF in eukaryotic cell, yet, in order to satisfy individual user's specific needs, sequence and length are alterable heights.The complete sequence of TOPO D2 is 3-CTAGGGAA GTGG-5.Similar to the above, oligonucleotide TOPO D4 at one end contains strand SacI overhang with the duplex that is connected that TOPO D5 annealing produces, and contains the strand overhang of one 12 Nucleotide at the other end.
The third connects oligonucleotide (TOPO D5) and SacI cohesive end 3 '-TCGA-5 ' complementation.Be similar to TOPO D1, TOPO D5 contains other base that can produce a strand overhang.According to user's needs, length may be different with sequence.In the present embodiment, the sequence of TOPO D5 is 5 '-AAGGGCG AGCT-3 '
The 4th kind to connect oligonucleotide (TOPO D4) complementary fully with TOPO D5, and 5 ' directly complementary with the SacI cohesive end, extends the top chain of linearized vector.TOPO D4 also contains topoisomerase consensus sequence 5 '-CCCTT.TOPO D4 connects residue sequence and the variable size of oligo, and can modify to satisfy specific needs.In the present embodiment, the sequence of TOPOD4 is 3 '-GACATGATACAG TTCCCGC-3 ', it contains the strand overhang of another 12bp.
These connect the enough multiple technologies chemosynthesis of oligonucleotide energy, comprise phosphamide (phosphoramadite) method (Caruthers, M.H., Barone, A.D., Beaucage, S.L., Dodds, D.R., Fisher, E.F., McBride, L.J., Matteucci, M., Stabinsky, Z. and Tang, J.Y., the chemosynthesis of (1987) deoxy-oligonucleotide, MethodsEnzymol.154:287-313).Known this method and other method that is used for chemosynthesis oligos of those skilled in the art.
The carrier of purifying, digestion is finished by incubation DNA in the presence of the T4 dna ligase with the complementation annealing that is connected oligonucleotide.Typical ligation is undertaken by the incubation of cloning vector with suitable dna fragmentation in the presence of ligase enzyme and appropriate reaction damping fluid.The damping fluid that is used for ligation should contain ATP provides energy for reaction, and goes back original reagent, as dithiothreitol (DTT) and pH stablizer, as Tris-HCl.The concentration ratio of cloning vector and dna fragmentation depends on differential responses, its calculate general formula have in the literature a large amount of descriptions (referring to, for example " method and application guide " (1991), Promega Corporation, Madison, WI, 45 pages).But the catalysis in the incubation process of T4 ligase enzyme forms phosphodiester bond between 5 ' adjacent phosphoric acid and 3 ' C-terminal.The cohesive end connection was generally carried out under 12-15 ℃ 30 minutes, and 4-16 hour (Ausubel, F.M. need be at room temperature carried out in the flush end connection, Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1992) " second edition: molecular biology straightforward method ", John Wiley﹠amp; Sons, Inc., New York, NY, pp3.14-3.37), yet, the parameter area difference of each experiment.In the present embodiment, the A type pUni/V5-His of purifying, digestion and linker oligos the T4 ligase enzyme and suitably in the presence of the damping fluid 12.5 ℃ of following incubations 16 hours.The linearizing that produces and the carrier of transformation comprise by base complementrity and catalytic phosphodiester bond of T4 ligase enzyme and the purifying cloning vector that is connected the oligonucleotide connection.
The carrier of effectively modifying transformation with topoisomerase need add annealed oligo, to produce double-stranded DNA on the strand overhang of TOPO D1 and TOPO D4.The cowpox topoisomerase I combines with double-stranded DNA is non-covalent at first.This enzyme spreads along duplex then, has five pyrimidine sequences, 5 '-CCCTT up to being positioned at and being covalently attached to, and forms the mixture (referring to people such as Shuman, U.S. Patent number 5,766,891) that topoisomerase is transformed.When not containing dna ligase, take place to transform the modification of carrier, preventing forming phosphodiester bond between the carrier of transforming and the annealing oligo because the phosphodiester bond not in the chain of easy fracture will stop cut after the dissociating of leavings group.
Annealed oligonucleotide (TOPO D3) must with the single stranded DNA overhang complementation of TOPO D1 and TOPO D4.In the present embodiment, this overhang has following sequence: 5 '-GACATAGTACAG-3 '.Therefore, TOPO D3 contains following sequence: 3-CTGTATCATGTCAAC-5, and the strand overhang of it and linker oligo and another 3bp overhang 3 '-AAC-5 ' are complementary fully.
In the presence of topoisomerase, transform carrier and will produce double-stranded DNA, the non-covalent with it combination of topoisomerase endonuclease capable with annealing oligo incubation.The bonded topoisomerase is by a kind of flooding mechanism search double-stranded DNA of reinforcement, up to being positioned 5 '-CCCTT identification motif.The cutting of easily splitting the chain phosphodiester backbone of 3 ' this motif 3 ' of phosphorus atom catalysis by the preferred oligonucleotide of nucleophillic attack cutting sequence 5-CCCTT, make DNA and enzyme by 3 '-phosphoric acid tyrosyl key covalently bound (referring to, Shuman, S., Kane, E.M., Morham, S.G. (1989) Proc.Natl.Acad.Sci.USA 86,9793-9796).The cutting of easily splitting chain produces and comprises the double-stranded leavings group that the 3 ' end that is positioned at 5 '-CCCTT motif downstream connects oligo and annealing oligo TOPO D3.Although the attack of the phosphoric acid tyrosyl key by 5 ' hydroxyl mediation, leavings group can be connected with the carrier end of topoisomerase enzyme modification again, when leavings group no longer when covalently bound, is unfavorable for this reaction with carrier.Make the further accumulation of the deflection topoisomerase of catching of balance to cutting/add in the ligation again T4 polynucleotide kinase and ATP, because the 5 ' hydroxyl that this kinases can the phosphorylation leavings group, prevent and connect (Ausubel again, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1992) " second edition: molecular biology straightforward method ", John Wiley﹠amp; Sons, Inc., NewYork, NY, pp3.14-3.30).The linearized vector that produces comprises one and contains the SSS end from the flush end of TOPOD4/D3 leavings group and one from TOPO D1/D3 leavings group.Two ends of linearizing cloning vector all contain topoisomerase, can fast, effectively, directionally insert to the topoisomerase mediation a kind of acceptor molecule.
Although the foregoing description has described in detail in order to form the directed cloning carrier modification A type pUni/V5-His of topoisomerase enzyme modification, those skilled in the art are to be understood that how any plasmid, clay, virus or other DNA are used these methods.Also should be understood that, this embodiment has confirmed a kind of carrier, it contains 5 ' strand overhang, comprise sequence 5 '-GGTG-3 ', yet the design that connects duplex and annealing oligonucleotide should make those skilled in the art can design the overhang of any sequence or length in one or two end of specific support.
Particularly, can modify any plasmid, clay, virus or other DNA, make it to contain the SSS of any suitable sequence and length.Basic step is: at first with this carrier of disposal methods of known linear DNA.Common method includes but not limited to digestion with restriction enzyme and topoisomerase II processing.After the linearizing, add a kind of SSS of customization.In the above-described embodiments, the cohesive end interpolation complementary oligonucleotide to restrictive diges-tion produces the SSS that wishes, yet, also can connect the oligonucleotide that interpolation forms SSS by the T4 flush end.Strand cutting by the topoisomerase I mediation exposes the SSS sequence.The PCR product that can contain subsequently, one or more complementary SSS with the directed insertion of this SSS.
Equally, also can carry out the topoisomerase enzyme modification to any double-stranded plasmid, clay, virus or other dna fragmentation.The method of attachment of topoisomerase I and double-stranded DNA is well known in the art (referring to people such as Shuman, U.S. Patent number 5,766,891).Mix (referring to people such as Shuman, U.S. Patent number 5,766,891) of topoisomerase I consensus sequence depended in the strategic location of topoisomerase on double chain DNA fragment.Topoisomerase I can be in conjunction with double-stranded DNA, and chain is easily split in cutting, thereby exposes the outstanding sequence of predetermined strand, and connects the PCR product of introducing with the direction of correct SSS mediation.
Embodiment 5
The generation of the carrier that the customization topoisomerase I is transformed
Another example of the purposes of the another kind of plasmid in this aspect of the present invention is to modify pCR2.1 (Invitrogen Corporation; Carlsbad CA), produces the carrier that customizes single stranded sequence that contains of topoisomerase I transformation.
Plasmid pCR2.1 is the T/A cloning vector of 3.9kb.The unique element of a plurality of designs is arranged in the sequence of this carrier.These elements comprise a f1 starting point, ColE1 starting point, kalamycin resistance gene, ampicillin resistance gene, a LacZ-alpha fragment and are positioned at a polyclone sequence of LacZ-alpha fragment that this sequence allows indigo plant-Bai to select recombinant plasmid.The polyclone sequence of pCR2.1 contains a plurality of restriction sites, includes but not limited to: HindIII, SpeI and EcoRI; M13 forward and reverse primer and T7 rna polymerase promoter.
The structure that contains the topoisomerase I carrier with customization single stranded sequence comprises: endonuclease digestion, and follow and anneal, and cut heteroduplex with cowpox topoisomerase I site-specific ground by the complementation of synthetic oligonucleotide.On carrier, produce HindIII and EcoRI cohesive end with restriction enzyme HindIII, SpeI and EcoRI digestion pCR2.1.In order to reduce its size, cut the isolated fragment of the pCR2.1 that is positioned at HindIII restriction enzyme site downstream with the further enzyme of SpeI.By reducing clip size, the carrier of digestion is easy to by isopropanol precipitating purifying from less digestion fragment.These enzymes can obtain from how tame suppliers, comprise New England Biolabs (Beverly, MA, catalog number (Cat.No.): RO104S, HindIII; RO133S, SpeI; RO101S, EcoRI).Method (the Sambrook of known digestion of those skilled in the art and DNA isolation, J., Fritsch, E.F. and T.Maniatis. (1989) " molecular cloning: laboratory manual " second edition, Cold Spring Harbor Laboratory Press.5.28-5.32).
The carrier of purifying, digestion connects oligonucleotide and T4 dna ligase incubation with 4 kinds then.These connect oligonucleotide and are designed to and HindIII cohesive end, EcoRI cohesive end or complimentary to one another.Behind T4 dna ligase incubation, with the carrier of Virahol purifying transformation.
First kind connects oligonucleotide (TOPO H) and HindIII cohesive end 3 '-TCGA-5 ' complementation.In addition, TOPO H also contains other 24bp, comprises that the topoisomerase that is positioned at 3 ' end upstream 19bp has five pyrimidine elements, 5 '-CCCTT.Remaining sequence and size that TOPO H connects oligo are variable, and can modify for the specific needs that satisfies the researchist.In the present embodiment, the full length sequence of the linker of use is 5 ' AGCTCG CCCTTATTCCGATAGTG-3 '.
Second kind of connection oligonucleotide (TOPO 16) must be complementary fully with TOPO H.5 ' directly complementation of TOPO 16 and HindIII cohesive end, the end chain of extension linearized vector.In addition, TOPO 16 also contains sequence 3 '-TAAG, and it is the single stranded sequence of selecting for directed cloning.The complete sequence of TOPO 16 is 3 '-GCGGGAA TAAG-5 '.
The third connects oligonucleotide (TOPO 1) and EcoRI cohesive end 3 '-TTAA-5 ' complementation.Be similar to TOPO H, TOPO 1 contains other base, contains the topoisomerase I consensus sequence CCCTT that is positioned at 3 ' end upstream 12bp.According to user's needs, the length of TOPO 1 may be different with sequence.In the present embodiment, the sequence of TOPO 1 is 5 '-AATTCGCCCTTATTCCGATAGTG-3 '.
The 4th kind to connect oligonucleotide (TOPO 2) complementary fully with TOPO 1, and 5 ' directly complementary with the EcoRI cohesive end, extends the top chain of linearized vector.In the present embodiment, the sequence of TOPO 2 is 3 '-GCGGGAA-5 '.
The carrier of purifying, digestion is finished by incubation DNA in the presence of the T4 dna ligase with the complementation annealing that is connected oligonucleotide.But the catalysis in the incubation process of T4 ligase enzyme forms phosphodiester bond between 5 ' adjacent phosphoric acid and 3 ' C-terminal.In the present embodiment, the pCR2.1 of purifying, digestion be connected oligos the T4 ligase enzyme and suitably in the presence of the damping fluid 12.5 ℃ of following incubations 16 hours.The linearizing that produces and the carrier of transformation comprise by base complementrity and catalytic phosphodiester bond of T4 ligase enzyme and the purifying cloning vector that is connected the oligonucleotide connection.Interconnection technique have in the literature a large amount of descriptions (referring to Ausubel, people such as F.M., (1992) " second edition: molecular biology straightforward method ", John Wiley ﹠amp; Sons, Inc., New York, NY, pp3.14-3.37).
Make the carrier of transformation contain topoisomerase enzyme require interpolation annealed oligonucleotide, on the strand overhang of TOPO H and TOPO 1, to produce double-stranded DNA.The carrier of transforming when not containing dna ligase is modified, preventing forming phosphodiester bond between the carrier of transforming and the annealed oligo, because the phosphodiester bond not in the chain of easy fracture can stop cutting dissociating of leavings group afterwards.
Annealed oligonucleotide (TOPO 17) must with the single stranded DNA overhang complementation of TOPO H.In the present embodiment, overhang contains following sequence: 5 '-CGATAGTG-3 '.Therefore, TOPO 17 contains following sequence: 3 '-GCTATCAC-5 ', and it is complementary fully with the strand overhang that is connected oligo.
Annealed oligonucleotide (TOPO 3) must with the single stranded DNA overhang complementation of TOPO 1.In the present embodiment, overhang contains following sequence: 3 '-GTGATAGCCTTA-5 '.Therefore, TOPO 3 contains following sequence: 5 '-CAACACTATCGGAAT-3 ', and it is complementary fully with the strand overhang that is connected oligo and another 3bp overhang 5 '-CAA-3 '.
In the presence of topoisomerase, the carrier of transformation and annealed oligo incubation will produce double-stranded DNA, the non-covalent with it combination of topoisomerase endonuclease capable.The bonded topoisomerase is by a kind of flooding mechanism search double-stranded DNA of reinforcement, up to being positioned 5 '-CCCTT identification motif.The cutting of easily splitting the chain phosphodiester backbone of this motif 3 ' will make DNA and enzyme by 3 '-phosphoric acid tyrosyl key covalently bound (referring to, Shuman, people such as S., (1989) Proc.Natl.Acad.Sci.USA 86,9793-9796).The cutting of easily splitting chain is created in 5 '-CCCTT motif downstream and contains the double-stranded leavings group that 3 ' end connects oligo and complementary annealing oligonucleotide.By the attack of 5 ' hydroxyl to phosphoric acid tyrosyl key, leavings group can be connected with the carrier of topoisomerase transformation again, and this is also by the topoisomerase enzyme catalysis.In balanced reaction, add the T4 polynucleotide kinase and can stop generation reversed reaction (Ausubel, people such as F.M. (1992) " second edition: molecular biology straightforward method ", John Wiley ﹠amp by the phosphorylation of kinase mediated leavings group 5 ' hydroxyl; Sons, Inc., NewYork, NY, pp3.14-3.30).The linearized vector that produces comprises a flush end and the single stranded sequence end from TOPO H/17 leavings group from TOPO 1/3 leavings group.Two ends of linearizing cloning vector all contain topoisomerase, can fast, effectively, directionally insert to the topoisomerase mediation a kind of acceptor molecule.
Embodiment 6
Utilize the directed cloning of topoisomerase
This aspect of the present invention also provides a kind of method of DNA directed cloning.In these methods, utilize directed insertion of the TOPO SSS carrier that makes up by A type pUni/V5-His to clone (Invitrogen Corporation, Carlsbad, ORF CA) from GeneStorm Expression Ready.Select the pUni carrier of modification in order to clone these ORF, because the strand and the known Kozak sequence that can improve the ORF expression of adding in the carrier have homology.Yet notice, as previously mentioned, can modify any plasmid, clay, virus or other DNA, make it to contain essential single stranded sequence.Equally, also can modify any dna fragmentation, make it to contain homologous sequence with any carrier S SS.The important point is that the SSS sequence can influence directed cloning efficient.For example, the SSS of low GC content has lower annealing stability, and treats that the segmental two ends of cloned DNA height complementary SSS also loses these DNA of guiding and inserts segmental ability.Therefore, should carefully design the sequence of SSS, to avoid these and similar problem.
This aspect of the present invention especially can be used for inserting the PCR product to the carrier interior orientation that makes up according to the present invention.In the segmental pcr amplification of the insertion of hope, design PCR primer makes it to be complementary to and will carry the segmental definite sequence of intravital insertion to TOPO SSS by directed cloning.5 ' terminal modified at it with dna encoding chain upstream bonded primer with another kind of carrier S SS complementary sequence.The PCR product that produces contains a kind of complementary sequence, and this sequence allows the orientation in TOPO SSS cloning vector of SSS mediation to insert, and product is subsequently expressed.
A kind of such embodiment comprises: by with 5 ' the Oligonucleolide primers pcr amplification donor double chain DNA molecule that contains SSS, import a SSS site in donor double-stranded DNA substrate.The pcr amplification in DNA district is finished the known region complementation outside the zone of this primer and hope with the Oligonucleolide primers of design.In a preferred embodiment, contain another nucleotide sequence of SSS complementary with TOPO SSS cloning vector with the coding strand homologous primer of dna double sequence.
Use the present invention with high throughput format, we have selected from GeneStorm expression system (Invitrogen Corporation, Carlsbad, CA) 82 kinds of known ORF, be used for to TOPO SSS carrier interior orientation clone, yet the user also can choose at random any dna sequence dna.For every kind of ORF, design of primers is and coding strand and noncoding strand homology.For as described in embodiment 4 with oriented approach clone PCR products in the A type pUni/V5-His TOPO SSS carrier of modifying, modify a right primer of specific primer, make it to contain and the contained SSS complementary of carrier nucleotide sequence.In the present embodiment, the coding primer contains the sequence 5 '-CACC-3 ' of interpolation, " SSS " 3 '-GTGG-5 ' complementation of it and TOPO SSS cloning vector.Can produce double chain DNA fragment with the above-mentioned ORF that increases of primer PCR separately, they contain SSS at 5 ' end.We use the pfu polysaccharase in pcr amplification, but well-known, can carry out the PCR reaction with non-thermophilic polysaccharase such as pfu or thermophilic polysaccharase such as taq, mend flat step subsequently and remove nontemplated nucleotide.These enzymes are retained in PCR product end.
In the present embodiment, every kind of primer of 0.1 μ g and the 0.05 μ g DNA that contains ORF combines in cumulative volume is the PCR reaction mixture of 50 μ l.Except primer and carrier, reaction mixture also contains water, PCR buffering salt, 10mM dNTPs and 1.25 pfu of unit polysaccharases.Thermal cycling temperature is as follows: initial 94 ℃ of sex change; 94 ℃ of sex change, 55 ℃ of primer annealings, 72 ℃ of extensions subsequently repeated 25 times in equal 1 minute; Last 72 ℃ were extended 15 minutes.These parameters are different with dna fragmentation to be amplified, and can enough those skilled in the art known method is to fragment optimization (Ausubel, the F.M. of different lengths and composition, Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1992) " second edition: molecular biology straightforward method ", John Wiley﹠amp; Sons, Inc., New York, NY, pp15.3-15.4).Those skilled in the art also know with 3 ' overhang be converted into flush end technology (" method and application guide (1991) ", Promega Corporation, Madison, WI, pp.43-44).
Contain the donor double-stranded DNA of pcr amplification of SSS complementary sequence and the A type pUni/V5-His TOPO SSS carrier incubation of modification, cause the directed cloning of donor dna.For example, the primer amplification that utilizes SSS to transform is gathered (InvitrogenCorporation, Carlsbad, 82 kinds of ORF CA) from the GeneStorm clone.To the 82 kinds of GeneStorm ORF that increase, be created in the PCR product that 5 ' end contains the SSS complementary sequence with the Mdification primer of hope.This ORF PCR product combines in sterilized water or salts solution with 10ng TOPO SSS cloning vector.Mix this reaction solution gently, incubation is 5 minutes under room temperature (22-23 ℃).After 5 minutes, we place reactant on ice, carry out OneShot then (Invitrogen TOPO clones scheme for chemical conversion or electroporation (CA, catalog number (Cat.No.) are respectively C4040-10 and C4040-50 for Invitrogen Corporation, Carlsbad).Invitrogen?Corporation，Carlsbad，CA)。Topoisomerase is by the adjacent chain (Figure 17) of catalysis ligation connection carrier again and product.So efficiently, correctly insert in the TOPO SSS cloning vector with the dna fragmentation that SSS makes up at its 5 ' end.
As to shown in the order-checking of a plurality of bacterium colonies of transformed host cell, the orientation that contains the dna fragmentation of 5 ' SSS is inserted with the frequency greater than 90% and is taken place.In the present embodiment, contain the TOPO SSS cloning vector of GeneStorm ORF with transformed competence colibacillus e. coli host cell incubation.In 74 conversion reactions, the directed cloning of ORF in TOPO SSS cloning vector takes place at least in 7 of 8 bacterium colonies of picking, in all 8 bacterium colonies of picking, 59 of these cloning reactions is directed.Total directed cloning must be divided into 609 and 656, therefore, has directed insert (seeing Table 1) in the clone of the picking more than 93%.
Table 1. utilizes the directed cloning of the ORF of TOPO SSS cloning vector
Positive bacterium colony, the dPCR reaction The clone's number that detects
8/8 59
7/8 15
6/8 2
5/8 1
4/8 3
3/8 2
Embodiment 7
The directed cloning of reporter gene
In a similar embodiment, utilize the pCR2.1 TOPO SSS carrier of above-mentioned modification, the lacZ fragment frame interior orientation clone who exists in the gene ORF of the coding reporter molecule green fluorescent protein (GFP) that PCR produces and the carrier.The primer of GFP gene of being used for increasing contains essential SSS the complementary sequence 5 '-ATTC-3 ' and the known array 5 '-ATG-3 ' of translation initiation methionine(Met).Utilize above-mentioned essential clone's step, the GFP of pcr amplification is inserted in this carrier, cell transformed is grown on the solid agar plate.The correct PCR product (seeing Table 2) that inserts of bacterium colony representative of growth.
Insert with directed in the frame of table 2.GFP in modifying pCR2.1 TOPO SSS cloning vector
5 ' sequence of PCR product The segmental percentage ratio of correct insertion The white colony sum
5 '-ATTCATG-3 ' (homologous) 86％ 457
5 '-CAAGATG-3 ' (not homologous) 35％ 118
5 '-ATTCGGATG-3 ' (frameshit) 0％ 268
Independent carrier 0％ 31
These data show than existing clone technology and improve a lot, and clone of the present invention and high-throughput techniques highly compatible.If directed cloning efficient is higher than 90%, the user only need select two bacterium colonies for each dna fragmentation of clone.Therefore, on 96 orifice plates, can insert for orientation and select 48 different clones, this is higher by 400% than existing clone technology.Use the present invention and will make multiple high-throughput genetic expression operating processization, and can make its sub-fraction operation with most current cost.
Embodiment 8
Flush end PCR product carries intravital directed topoisomerase enzyme clone to entering
General introduction
In other embodiments, composition of the present invention, test kit and method will 5 minutes efficiently clone's strategy (" TOPO Clone "; Invitrogen Corporation, Carlsbad CA) with to carrier interior orientation clone flush end PCR product combines, with enter recombinant clone of the present invention system (for example can be from Invitrogen Corporation, Carlsbad, the GATEWAY that CA obtains TMSystem).Utilize this clone strategy of the present invention, flush end PCR product is with the efficient directed cloning more than 90%, and do not need program or restriction enzyme behind ligase enzyme, the PCR.
For with GATEWAY TMDestination carrier reorganization back optimum expression PCR product can use any suitable expression vector.Example includes but not limited to the directed TOPO of the pENTR that can obtain from commercial channels Carrier (CA), they have many advantages, comprising for Invitrogen Corporation, Carlsbad:
Carrier Advantage
pENTR/D-topO ● with GATEWAY TMEfficiently express goal gene after the destination carrier reorganization
pENTR/SD/D-topO ● contain T7 gene 10 translational enhancers and ribosome bind site, with protokaryon GATEWAY TMDestination carrier reorganization back optimum expression natural protein ● also be suitable for suitable GATEWAY TMAfter the destination carrier reorganization, in other host cell systems (for example Mammals, insect, yeast), efficiently express goal gene
These pENTR/D-TOPO And pENTR/SD/D-TOPO Carrier is used for promoting quick, the directed TOPO of flush end PCR product The clone is to enter GATEWAY TMSystem.The feature of these carriers comprises:
● be used to enter clone and GATEWAY TMThe attL1 and the attL2 site of the reorganization of destination carrier locus specificity;
● be used for flush end PCR product fast, efficiently and directionally clone's directed TOPO Cloning site;
● be used for stoping the rrnB transcription termination sequence of purpose PCR product primary expression in intestinal bacteria;
● be used for the kalamycin resistance gene that screens intestinal bacteria;
● be used for the pUC starting point that plasmid duplicates and keeps at the high copy of intestinal bacteria; With
● be used for the PCR product at prokaryotic system (independent pENTR/SD/D-TOPO ) in T7 gene 10 translational enhancers and the ribosome bind site of efficient translation.
Utilize the directed TOPO of these pENTR Carrier is in conjunction with GATEWAY of the present invention TMThe recombinant clone system, the contained goal gene of flush end PCR product can be expressed by following several easy steps:
1. with flush end PCR product cloning (described herein " TOPO The clone " use topoisomerase in the step) go into above-mentioned pENTR TOPO In one of carrier, produce a kind of clone that enters;
2. by enter clone and the GATEWAY that selects at this TMCarry out recombining reaction between the destination carrier (as described in this paper other parts) and produce a kind of expression construct; With
3. expression construct is imported proper host cell (for example bacterium, Mammals, yeast, insect or other proper host cell, its selection is depended on for producing the specific objective carrier that above-mentioned expression construct is selected) in, and utilize the expression condition that is suitable for the particular host cell system to express the recombinant protein of (being contained on the expression construct now) goal gene coding on the PCR product.
Directed TOPO The clone
Can be from the topoisomerase I of vaccinia virus at specific site (CCCTT) in conjunction with double-stranded DNA, and cut a phosphodiester backbone (Shuman, 1991) in the chain.The energy that the phosphodiester backbone of fracture produces keeps by formation covalent linkage between the tyrosine residues (Tyr-274) of 3 ' phosphoric acid of cutting chain and topoisomerase I.5 ' hydroxyl radicals attack DNA of the chain of available initial cutting subsequently and the phosphoric acid-tyrosyl key between the enzyme, reversal reaction discharges topoisomerase (Shuman, 1994).TOPO The clone utilizes this reaction high-efficient cloning PCR product.
Add one 3 ' strand end (overhang) by going up, with containing TOPO to the DNA that introduces The oligonucleotide orientation of carrying out double-stranded DNA connect (Cheng and Shuman, 2000).This strand overhang with contain TOPO Dna fragmentation 5 ' end identical.By the present invention, by to containing TOPO DNA go up to add the outstanding sequence of 4 Nucleotide, and make it to become " complete vector " form, improve this method.
In this system, by in forward primer, adding 4 bases (CACC) directed cloning PCR product.Overhang in the cloning vector (GTGG) is invaded 5 ' end of PCR product, anneals with the base of adding, and stablizes the PCR product with correct direction.Inserting fragment can clone with correct direction to be equal to or higher than 90% efficient.
Method
Design PCR primer.It is extremely important for expressing to be used for the PCR primer design of amplifying target genes.According to the pENTR TOPO that uses Carrier must be remembered Several Factors in the PCR primer design, comprising:
● be beneficial to the required sequence of directed cloning;
● the sequence that the suitable translation initiation of PCR product is required; With
● entering clone and GATEWAY TMAfter the destination carrier reorganization, whether the PCR product holds the indicia framing endomixis with N end or C.
The principle of design forward PCR primer.When design forward PCR primer, must consider these points.
For can directed cloning, forward PCR primer must contain sequence C ACC at 5 ' end of primer.At each pENTR TOPO In the carrier, 4 Nucleotide CACC and outstanding sequence GTGG base pairing.
(entering clone and GATEWAY if in mammalian cell, express the PCR product TMDestination carrier reorganization back), aim sequence must comprise the Kozak translation initiation sequence, and the latter is contained translation suitably initial required ATG initiator codon (Kozak, 1987; Kozak, 1991; Kozak, 1990).An example of Kozak consensus sequence is (G/A) NN ATGG.Other sequence also is possible, but the G at the G at place, site-3 or A and site+4 places is most important (showing with black matrix) for function.The ATG initiator codon shows with underscore.Attention: if aim sequence does not contain initiator codon in the Kozak sequence, can design forward PCR primer, make its 5 ' end contain Kozak sequence (seeing below) at primer.
(entering clone and GATEWAY if in prokaryotic cell prokaryocyte, express the PCR product that does not contain the N end and merge mark TMDestination carrier reorganization back), the PCR product should TOPO Be cloned into pENTR/SD/D-TOPO Enter in the carrier.As mentioned above, in order to make the PCR product in intestinal bacteria, efficiently translate pENTR/SD/D-TOPO Contain T7 gene 10 translational enhancers and a ribosome bind site (RBS).In order to ensure the suitable optimal spacing of translation, forward PCR primer should be designed to, and the ATG initiator codon of PCR product is located immediately at (seeing below) after the required CACC of directed cloning.
The example of forward primer design.It below is the sequence of the corresponding forward PCR primer of the dna sequence dna of theoretical proteinic N end and proposition.Line out below the ATG initiator codon.
Dna sequence dna: 5 '-ATG GA TCT GAT AAA
G
The forward CPR primer that proposes:
If forward PCR primer designs as mentioned above, then (a) ATG initiator codon is positioned at Kozak sequence (seeing the sequence that frame goes out), allow the PCR product in mammalian cell, suitably to begin translation (noticing that first three base pair of the PCR product after 5 ' the CACC overhang constitutes a function codon); (b) ATG initiator codon and RBS suitably separate (only at pENTR/SD/D-TOPO In), allow the suitably translation in prokaryotic cell prokaryocyte of PCR product.
The principle of design reverse primer.When design inverse PCR primer, what time followingly consider.About pENTR/D-TOPO And pENTR/SD/D-TOPO TOPO The diagram of cloning site is seen Figure 26 and 27 respectively.
In order to ensure PCR product efficiently and directionally clone, the inverse PCR primer must be not and the outstanding sequence complementation of 5 ' end.The mispairing of a base pair can be reduced to 50% from 90% with directed cloning efficient, and improves the possibility (" embodiment A " in seeing below) that ORF clones in the opposite direction.We also do not have the mispairing of discovery owing to two base pairs, the evidence that the PCR product is cloned in the opposite direction.
If PCR product and C end indicia framing endomixis (are entering clone and GATEWAY TMDestination carrier reorganization back), should design the inverse PCR primer, to remove the natural terminator codon (" Embodiment B " in seeing below) in the goal gene.
If the PCR product (is not entering clone and GATEWAY with C end indicia framing endomixis TMDestination carrier reorganization back), should comprise the native sequences that contains terminator codon in the reverse primer, should guarantee that perhaps terminator codon is arranged in the upstream of inverse PCR primer binding site (" Embodiment B " that see below).
The embodiment A of reverse primer design.It below is the sequence of theoretical proteinic C end.This protein should hold the indicia framing endomixis (entering clone and GATEWAY with C TMDestination carrier reorganization back).Line out below the terminator codon.
Dna sequence dna: AAG TCG GAG CAC TCG ACG ACG GTG TAG-3 '
Method is a design inverse PCR primer, and just from the codon of terminator codon upstream, but latter two codon contains GTGG (below line out), and to give prominence to sequence identical with 4bp for it.As a result, reverse primer will be given prominence to the sequence complementation with 4bp, thereby improve the possibility that the PCR product is cloned in the opposite direction.This situation should be avoided.
Dna sequence dna: AAG TCG GAG CAC TCG ACG AC G GTG TAG-3 '
The inverse PCR primer sequence that proposes: TG AGC TGC TG C CACAAA-5 '
Another scheme is the design reverse primer, makes it just in the hybridization of terminator codon downstream, but still comprises the C-terminal of ORF.Notice that terminator codon does not need to replace with the codon of a kind of harmless amino acid such as glycine, L-Ala or Methionin.
The Embodiment B of reverse primer design.It below is the sequence of theoretical proteinic C-terminal.Line out below the terminator codon.
...GCG?GTT?AAG?TCG?GAG?CAC?TCG?ACG?ACT?GCA TAG-3’
In order to make ORF and C end mark (reorganization back destination carrier contained) frame endomixis, from last codon (TGC) and continuous upstream homologous Nucleotide, remove terminator codon.Reverse primer is:
5’-TGC?AGT?CGT?CGA?GTG?CTC?CGA?CTT-3’
The C end that this will increase and not contain terminator codon, and make ORF and interior connection of C end indicia framing.If do not wish ORF and interior connection of C end indicia framing, reverse primer should be designed to comprise terminator codon simply:
5’- CTA?TGC?AGT?CGT?CGA?GTG?CTC?CGA?CTT-3’
Important: as must to remember pENTR TOPO Carrier is accepted flush end PCR product.5 ' phosphoric acid should do not added, because this connects into pENTR TOPO with prevention in the PCR primer In the carrier.In addition, advise gel-purified oligonucleotide before use, particularly when they are longer (＞30 Nucleotide).
Produce flush end PCR product
In case selected PCR is tactful and according to the mentioned above principle synthetic primer, promptly can produce flush end PCR product.Any heat-staple proofreading polysaccharase may be used to this purpose, comprises the ThermalAce that is used for PCR TM, PLATINUM , Pfx, Pfu or Vent In order to produce flush end PCR product, should be according to the explanation and the recommendation of polysaccharase production firm.In order to produce single discontinuous PCR product, it is important optimizing the PCR condition.Also recommend basis method gel-purified PCR fragment hereinafter described.
Produce the PCR product
In order to produce amplified production, utilize following principle to set up 25 μ l or 50 μ lPCR reaction mixtures by PCR:
Working instructions according to used archaeal dna polymerase.
Use is applicable to the loop parameter of primer and template.
Extend fully in order to ensure all PCR products, use and extended eventually in 7-30 minute.
After the circulation, test tube should place on ice, or is stored under-20 ℃ and was up to for 2 weeks.
The confirmation of PCR product
For quality and the quantity that confirms the PCR product, from each PCR reaction system, take out 5 μ l-10 μ l, by the following analysis of agarose gel electrophoresis:
The per-cent of the single zone of discontinuity of correct size.If there is not single zone of discontinuity, recommend to optimize the PCR reaction of using selected polysaccharase with reference to manufacturer.The product (seeing below) of in addition, also can gel-purified wishing.
Estimate the concentration of PCR product.For TOPO The clone recommends PCR product and TOPO The mol ratio of carrier is 5: 1, to obtain the highest cloning efficiency.For example, at TOPO Can use 20ng 500bp PCR product or 10ng 1000bp PCR product in the cloning reaction.Carrying out TOPO The concentration that may need to regulate the PCR product before the clone.
Attention: if use ThermalAce TMPolysaccharase is produced flush end PCR product, should be noted that ThermalAce TMCan higher output be arranged than other proofreading polysaccharase.When producing the PCR product of 0.5-1.0kb, we are usually at TOPO Cloning reaction is before with 1 * ThermalAce TMDamping fluid dilution in 1: 5 PCR reaction system.For PCR product, may not need dilution greater than 1.0kb.
Set up TOPO Cloning reaction
Foreword
In case produce the PCR product of wishing, promptly prepare with its TOPO Be cloned into pENTRTOPO In the carrier, and transform the TOP10 intestinal bacteria with recombinant vectors.In order to ensure obtaining best possible result, have need that set up and that prepare to use all be important.Our suggestion is read exercise question for " to set up TOPO before beginning Cloning reaction " (10-11 page or leaf) and " conversion OneShot The TOP10 competent cell " part of (12-14 page or leaf).If being you, this carries out TOPO for the first time The clone is with the parallel control reaction of carrying out the 22-24 page or leaf of your sample.
If carry out TOPO with the HTP form Clone's (seeing below), you can use BulkTOP10 cell (500 reaction kit) or MultiShot TMTOP10 cell (480 reaction kit) transforms the TOP10 intestinal bacteria.Use which kind of test kit according to you, referring to the TOPO of 15-16 page or leaf or 17-18 page or leaf Clone and method for transformation.
Attention: nearest experiment confirm, at TOPO Comprise salt (200mMNaCl, 10mM MgCl in the cloning reaction 2) transformant quantity is increased.According to these results, we recommend to TOPO Add salt in the cloning reaction system.In test kit, comprise the storage salts solution for this reason.Please note to TOPO The amount of the salt that adds in the cloning reaction system is difference with conversion chemoreception attitude cell (providing) or electroreception attitude cell (classified information is seen the X page or leaf) are provided.Two kinds of different TOPO are provided for this reason Cloning reaction obtains best possible result to help you.The PLEASE READ CAREFULLY following message.
Transform chemoreception attitude intestinal bacteria
For TOPO Clone and conversion chemoreception attitude intestinal bacteria are to TOPO Adding final concentration in the cloning reaction system is 200mM NaCl, 10mM MgCl 2Sodium-chlor and magnesium chloride, this can increase colony number.With salts solution (1.2M NaCl, 0.06M MgCl 2) adjusting TOPO The cloning reaction system is to the NaCl and the MgCl that recommend 2Concentration.
Transform electroreception attitude intestinal bacteria
For TOPO Clone and conversion electroreception attitude intestinal bacteria are at TOPO Also can to comprise salt in the cloning reaction system, but to form electric arc when the electroporation in order preventing, the content of salt must be reduced to 50mM NaCl and 2.5mM MgCl2.Water prepares 300mM NaCl, 15mM MgCl with 4 times of salts solution dilutions 2Solution is conveniently to add TOPO to In the cloning reaction system.
Set up TOPO The cloning reaction system
Following table has been described how to set up and finally has been used to transform chemoreception attitude OneShot TOP10 intestinal bacteria (providing) or the colibacillary TOPO of electroreception attitude Cloning reaction system (6 μ l).About optimizing TOPO as required Visible the 21st page of the out of Memory of cloning reaction system.If use ThermalAce TMPolysaccharase is produced the PCR product, please notes and may dilute PCR reaction system (seeing the 9th page) before continuation.
Attention: TOPO The blueness of carrier soln is normal, is used for showing this solution.
Table 3. is set up TOPO The cloning reaction mixture
Reagent * Chemoreception attitude intestinal bacteria Electroreception attitude intestinal bacteria
New PCR product 0.5-4μl 0.5-4μl
Salts solution 1μl --
Diluting salt solution (1: 4) -- 1μl
Sterilized water Adding to final volume is 5 μ l Adding to final volume is 5 μ l
topO Carrier 1μl 1μl
* all reagent are stored in-20 ℃ after finishing.Salts solution and water can be in room temperature or 4 ℃ of storages down.
Carry out TOPO Cloning reaction
The hybrid reaction system was descended incubation 5 minutes in room temperature (22-23 ℃) gently.
Attention: for most of purposes, can produce the bacterium colony that is enough to be used in analyzing in 5 minutes.As required, the time of TOP011 cloning reaction can be 30 seconds-30 minutes.For the conventional subclone of PCR product, 30 seconds may be enough.For bigger PCR product (＞1kb), perhaps if TOPO Clone a large amount of PCR products, the raising reaction times can produce more bacterium colony.
Reaction system is placed on ice, continue to transform One Shot7 TOP10 competent cell, vide infra.Attention: you must store TOPO7 cloning reaction system down at-20 ℃ and spend the night.
Transform One Shot The TOP10 competent cell
Foreword
Finish TOPO Behind the cloning reaction, use pENTR TOPO Construct transformed competence colibacillus intestinal bacteria.Comprise One Shot in 20 reaction kits TOP10 chemoreception attitude intestinal bacteria (Box 2) cell, it helps transforming, however you also can transform electroreception attitude cell (classified information is seen the X page or leaf).This section provides conversion chemoreception attitude or the colibacillary method of electroreception attitude.
The material that the user provides
Except general microbiology articles for use (promptly dull and stereotyped, spreader), also need following reagent and equipment.
(a) 42 ℃ of water-baths (or have the electroporation device of container, optional)
(b) contain the LB flat board (at every turn transforming two) of 50 μ g/ml kantlex
(c) 37 ℃ of joltings and non-jolting incubator
Inserting segmental existence need not indigo plant-Bai screening.Most of transformants contain recombinant plasmid, contain the purpose PCR product with the correct direction clone in the plasmid.Comprise sequencing primer in the test kit, the insertion fragment in the multiple clone site that is used for checking order is to confirm direction and to read frame.
The preparation that transforms
For each conversion, need one bottle of competent cell and two selections dull and stereotyped.
Balance water-bath to 42 ℃ (being used for chemical conversion) perhaps, if use electroreception attitude intestinal bacteria, is provided with the electroporation device.
For electroporation, with 4 times of sub-fraction salts solution dilutions, preparation diluting salt solution (for example in 150 sterilized waters, adding 5 μ l salts solutions).
Heat SOC medium bottle from Box 2 to room temperature.
Dull and stereotyped 30 minutes of the LB that under 37 ℃, heats and contain 50 μ g/ml kantlex.
Transform at every turn and melt one bottle of One Shot on ice from Box 2 The TOP10 cell.
Important: as to please note directed TOPO The clone produces usually and clones to TOPO TA than traditional double Few 5-10 bacterium colony doubly.As directed TOPO During the insertion fragment to be measured of clone 750bp, utilize the scheme of 22-23 page or leaf, we generally obtain 1800-3000 bacterium colony.Although obtain less total number of bacterial colony, the bacterium colony more than 90% will contain and contain PCR with correct direction and insert segmental plasmid.
One Shot TOP10 chemical conversion scheme
1. to a bottle One Shot Add 2 μ l in the TOP10 chemoreception attitude intestinal bacteria from carrying out TOPO The TOPO in the 2nd step (the 11st page) of cloning reaction Cloning reaction liquid, and mix gently.Not by on move down liquid and mix.
2. at incubation 5-30 minute on ice.
Attention: as if there is slight influence the incubation long period to transformation efficiency on ice.The incubation time span is determined by the user.
3. under 42 ℃, do not add jolting ground heat-shocked cell 30 seconds.
4. immediately test tube is transferred on ice.
5. add 250 μ l room temperature SOC substratum.
6. cover tight test tube, horizontal jolting test tube (200rpm) is 30 minutes under 37 ℃.
7. transform on the selection flat board that 50-200 μ l coats pre-temperature at every turn, under 37 ℃, be incubated overnight.We recommend with two different volume coated plates, contain good at interval bacterium colony to guarantee at least one flat board.
8. the TOPO7 cloning reaction can produce a hundreds of bacterium colony efficiently.Picking～5 bacterium colony is analyzed (seeing the analysis transformant, the 19th page).
Transform by electroporation
For fear of producing electric arc, only use electroreception attitude cell to carry out electroporation.Do not use One Shot TOP10 chemoreception attitude cell carries out electroporation.
1. in containing the colibacillary 0.1cm cuvette of 50 μ l electroreception attitudes, add 2 μ l from carrying out TOPO The TOPO in the 2nd step (the 11st page) of cloning reaction Cloning reaction liquid, and mix gently.Not by on move down liquid and mix.Avoid forming bubble.
2. utilize yourself's scheme and electroporation apparatus electroporation sample.
Attention: if the electric arc problem is arranged, as follows.
3. add 250 μ l room temperature SOC substratum immediately.
4. solution is transferred in the 15ml snap-cap pipe (being Falcon),, kalamycin resistance gene is expressed 37 ℃ of following joltings at least 1 hour.
5. transform the selection flat board of the pre-temperature of 20-100 μ l coating at every turn, under 37 ℃, be incubated overnight.In order to ensure the even coating of small volume, add 20 μ l SOC.We recommend with two different volumes coated plates, contain good at interval bacterium colony to guarantee at least one flat board.
6. the TOPO7 cloning reaction can produce a hundreds of bacterium colony efficiently.Picking～5 bacterium colony is analyzed (seeing the analysis transformant, the 19th page).
At TOPO Add diluting salt solution in the cloning reaction system and make TOPO NaCl in the cloning reaction system and MgCl 2Final concentration reach 50mM and 2.5mM respectively.In order to prevent sample generation electric arc in electroporation, cell volume should be 50-80 μ l (0.1cm cuvette) or 100-200 μ l (0.2cm cuvette).
If electric arc takes place in conversion process, attempts one of following suggestion:
With the loss of voltage 10% that is commonly used to the electroporation apparatus charging
Reduce pulse length by load resistance being reduced to 100ohms
Ethanol sedimentation TOPO before electroporation Cloning reaction liquid, laying equal stress on suspends in water.
High throughput applications
In order to produce the GATEWAY that is used for high-throughput (HTP) purposes TMEnter the clone, design the directed TOPO of 480 and 500 reaction pENTR and pENTR/SD especially Clone's test kit.In these test kits, contain large quantities of pENTR TOPO Carrier provides chemoreception attitude TOP10 intestinal bacteria with two kinds of forms selecting:
With the large quantities of cells that provide of 5ml equal portions, so that cell is transferred to (catalog number (Cat.No.) K2400-500 and K2420-500) 96 orifice plates that contain TOPO7 cloning reaction liquid simply from aseptic groove.
Cell is pre-five equilibrium (in 12 hole stripwell) in 96 orifice plates, to add TOPO7 cloning reaction liquid (Invitrogen Corporation, Carlsbad, CA in cell; Catalog number (Cat.No.) K2400-480 and K2420-480).
Utilize the HTP TOPO of large quantities of cells Clone and conversion
Describe
In this scheme, polystyrene plate at the bottom of 96 hole U-shapeds is set up TOPO in (Costar, catalog number (Cat.No.) 3366,330 μ l/ holes) Cloning reaction system, TOP10 competent cell place groove so that disperse.
Before the beginning
(VWR, catalog number (Cat.No.) 13259-260) turns cold up to this unit at cooled on ice 96 mesoporous metal heating units.
Make bottle SOC reach room temperature.
With heating unit or contain the unitary thermal cycler of 96 mesoporous metals and preheat 42 ℃.
Attention: also can use water-bath, but careful not contamination of cells.
● melt 1 test tube (5ml) TOP10 chemoreception attitude intestinal bacteria (30-60 minute) on ice.
● the LB agar plate that will contain 50 μ g/ml kantlex is warmed to 37 ℃.If plan comprises the pUC19 contrast to detect the transformation rate, need contain the LB agar plate of 50-100 μ g/ml penbritin.
Contrast: for simplicity, provide 50 μ l equal portions competent cells to test TOPO Clone and conversion reaction.In addition, also can comprise the pUC19 plasmid as internal contrast (program that sees below).
Program
1. following 6 μ l TOPO that set up in every hole The cloning reaction system.If comprise pUC19 in contrast, make the 2-3 hole for empty.
PCR product 1 μ l
Salts solution 1 μ l
Sterilized water 3 μ l
pENTR?TOPO ? 1μl
Final volume 6 μ l
2. room temperature incubation 5-10 minute.
3. 96 orifice plates are placed cooling unit last 5 minute.
4., in 2-3 emptying aperture, add 1 μ l (10pg) plasmid if comprise pUC19.
5. the TOP10 intestinal bacteria of melting are poured in the aseptic groove, disperse 45 μ l/ holes immediately.Moving down liquid gently mixes for 1-2 time.
6. use Parafilm Cover flat board, incubation is 20 minutes on the refrigerative unit.
7. flat board is transferred on the heating unit of pre-temperature or on the thermal cycler, cell was 42 ℃ of following heat-shockeds 30 seconds.
8. flat board is shifted back cooling unit, push, contact fully with cooling unit to guarantee flat board.Incubation 1 minute.
9. remove Parafilm , add 150 μ l/ hole SOC.
10. cover dull and stereotyped, dull and stereotyped again 37 ℃ of following incubations 1 hour.
Attention: jolting gently (125rpm) is chosen wantonly.
11. every hole 50 μ l coat on the LB agar plate that contains 50 μ g/ml kantlex.For the pUC19 plasmid, 10 μ l conversion mixed solution is added 20 μ l SOC coat on the LB flat board that contains 100 μ g/ml penbritins.Under 37 ℃, be incubated overnight.
12. select 5-10 bacterium colony next day, handles as hope ground.
Too many bacterium colony
If obtain too many bacterium colony, reduce the amount of the inoculum of coating, and/or dilute conversion fluid with other SOC.
Utilize MultiShot TMThe HTP TOPO clone and the conversion of cell
Describe
In this scheme, in 96 orifice plates, set up TOPO Cloning reaction, and 2 μ l are transferred to every hole contain the colibacillary 96 hole MultiShot of 15 μ l chemoreception attitude TOP10 TMOn the flat board.
Before the beginning
● at two 96 mesoporous metal heating units of cooled on ice (VWR, catalog number (Cat.No.) 13259-260), turn cold up to the unit.
● make a bottle SOC to room temperature.
● the LB agar plate that will contain 50 μ g/ml kantlex is warmed to 37 ℃.If plan comprises pUC19 and contrasts the transformation rate that detects, need contain the LB agar plate of 50-100 μ g/ml penbritin.
● with heating unit or contain the unitary thermal cycler of 96 mesoporous metals and preheat 42 ℃.
● note: also can use water-bath, but careful not contamination of cells.
● if use thermal cycler, machine programming remains on 42 ℃.
Contrast: detect flat board and comprise row's (12 hole) TOP10 cell, to test TOPO Cloning reaction and conversion.In addition, also can comprise the pUC19 plasmid as internal contrast (program that sees below).
Program
1. in 96 hole flat boards, in every hole, set up following 6 μ l TOPO The cloning reaction system.
PCR product 1 μ l
Salts solution 1 μ l
Sterilized water 3 μ l
pENTR?TOPO 1μl
Final volume 6 μ l
2. room temperature incubation 5-10 minute.
3. 96 orifice plates are placed cooling unit last 5 minute.
4. from refrigerator, take out 96 hole MultiShot TMDull and stereotyped chemical competence TOP10 intestinal bacteria place second cooling unit.Cell should melt in 30 seconds.
5. carefully remove aluminium foil sealing.
6. use hyperchannel pipettor every hole in the 96 hole flat boards that contain cell to add every kind of TOPO of 2 μ l Cloning reaction liquid (～3.3ng).For obtaining the result of homogeneous, volume is maintained at about 2 μ l.For the pUC19 contrast, add 1 μ l (10pg) DNA.
7. cover cell with the plastic cover that provides, incubation cell and DNA are 20 minutes in cooling unit.
8. the cell flat board is transferred on the heating unit of pre-temperature or on the thermal cycler, 42 ℃ of following heat-shockeds 30 seconds.
9. the cell flat board is shifted back cooling unit, flat board is pressed in the unit, make dull and stereotyped cooling 1 minute.
10. remove plastic cover, in every hole, add 90 μ l SOC.
11. flat board was added a cover, 37 ℃ of following incubations 1 hour.Attention: jolting gently (125rpm) is chosen wantonly.
12. every hole 100 μ l coat on the LB agar plate that contains 50 μ g/ml kantlex.For the pUC19 contrast, 10 μ l conversion mixed solution is added 20 μ l SOC coat on the LB flat board that contains 100 μ g/ml penbritins.Under 37 ℃, be incubated overnight.
Attention: if obtain too many bacterium colony, can reduce the cell concentration of plating, or before in cell, adding reaction solution, dilute TOPO with sterilized water or TE damping fluid Cloning reaction liquid.
Analyze transformant
Analyze positive colony
1. 5 bacterium colonies of picking, overnight incubation in LB that contains 50-100 μ g/ml kantlex or SOB substratum.
2. with the method isolated plasmid dna of selecting.Hyperpure if desired plasmid DNA is carried out automatically or manual order-checking, and we recommend to use S.N.A.P.J MidiPrep test kit (catalog number (Cat.No.) K1910-01).
3. analyze plasmid by restriction analysis, insert segmental the existence and correct direction with confirmation.Use the combination of restriction enzyme or enzyme, enzyme is cut once in carrier, and enzyme is cut once in inserting fragment.
Order-checking
You can clone with correct direction with the gene that confirms you your construct order-checking.Comprise M13 forward primer (20) and M13 reverse primer in the test kit, insert fragment to help order-checking.M13 forward primer (20) and M13 reverse primer also can obtain (classified information is seen the X page or leaf) from Invitrogen respectively.
It is important: if you download pENTR/D-TOPO from the website of Invitrogen Corporation Or pENTR/SD/D-TOPO Sequence (seeing the description of Figure 26 and Figure 27 herein), notice that outstanding sequence (GTGG) shows to hybridize with CACC.The dna sequence analysis program can make us not have to show overhang in the absence of complementary sequence.
By the pcr analysis transformant
You can utilize the pcr analysis positive transformant.For the PCR primer, use the combination of M13 forward (20) primer or M13 reverse primer and the primer that can in inserting fragment, hybridize.You must determine amplification condition.If you use this technology for the first time, we recommend the parallel restriction analysis that carries out.Because wrong the initiation or the template pollution may obtain artefact.
Following scheme is provided for convenience's sake.Other scheme also is suitable.
1. prepare the PCR mixture of forming by PCR damping fluid, dNTP, primer and Taq polysaccharase.Use 20 μ l reaction volumes.Multiply by the colony number (for example 5) of analysis.
2. 5 bacterium colonies of picking are resuspended to respectively in the 20 μ l PCR mixed solutions and (remember to prepare replica plate, further analyze to keep bacterium colony).
3. reaction system is at 10 minutes lysing cell of 94 ℃ of following incubations, and the deactivation nuclease.
4. 20-30 circulation of amplification.
5. extend in 72 ℃ of following incubations 10 minutes for the last time.Be stored in-4 ℃.
6. show by agarose gel electrophoresis.
Important: as, to carry out as the described control reaction of 22-24 page or leaf if the transformant of acquisition is arranged or correctly insert segmental problem.These reactions will help you to solve problem in the experiment.
Prolonged preservation
After identifying correct clone, certain purifying bacterium colony also prepares the glycerine stock solution and carries out prolonged preservation.We are recommended in-20 ℃ of stock solutions of preserving plasmid DNA down.
1. the primary colony of single bacterium colony is rule on the LB flat board that contains 50 μ g/ml kantlex.
2. separate single bacterium colony, inoculation 1-2ml contains the LB of 50 μ g/ml kantlex.
3. grow to cultivate and reach stationary phase.
4. mix 0.85ml nutrient solution and the aseptic glycerine of 0.15ml, transfer in the refrigerating bottle.
5. be stored in-80 ℃.
Reorganization enters construct and destination carrier
After acquisition entered the clone, pENTR TOPO can recombinate Any GATEWAY of construct and selection TMDestination carrier produces a kind of cloning by expression.This " LR " recombining reaction is by LR CLONASE TMMediation, the latter is a kind of recombinant protein mixture.LR CLONASE TMEnzyme mixture can (Carlsbad CA) obtains from Invitrogen Corporation.In some such methods, for example, the carrier that TOPO transforms and one or more nucleic acid fragments (for example one or more PCR products) descended the about 5-30 of incubation (preferably about 10) minute in room temperature (for example about 20-30 ℃); By in about 20 minutes these reaction systems of thermal treatment of about 80 ℃ of following incubations, in standard LR reaction, use this reaction mixture according to manufacturer's explanation (Invitrogen Corporation) then, difference is that the incubation time lengthening of LR reaction was by about 3 hours.
Optimize TOPO Cloning reaction
Quicken clone's process.TOPO Clone's high-level efficiency makes people will clone process flowization.If conventional clone PCR products also wishes to quicken this process, consider following points:
● an incubation TOPO Cloning reaction system 30 seconds rather than 5 minutes.
Perhaps, you can not obtain the bacterium colony of maximum quantity, but have higher TOPO Cloning efficiency, most of transformants will contain your insertion fragment.
● in chemoreception attitude cell, adding 3 μ l TOPO Behind the cloning reaction liquid, only incubation on ice 5 minutes.
Incubation time lengthening to 30 minute can not significantly improve transformation efficiency.
Obtain more transformant.If you are TOPO Clone bigger PCR product, virulent gene, or clone one group of PCR product, the clone that you may need more transformant to obtain to wish.In order to improve colony number:
● incubation adds the TOPO of salt Cloning reaction liquid 20-30 minute rather than 5 minutes.
Prolong the TOPO that adds salt The incubation time of cloning reaction can make more molecule connect, thereby has improved transformation efficiency.Add salt and can prevent that as if topoisomerase I from connecting the PCR product and after separating recombine and cutting DNA from the DNA.
● the amount of the PCR product that in the TOPO7 cloning reaction, uses during titration maximum bacterium colony output.
The PCR product of clone's dilution
In order to clone the PCR product of dilution, you can:
● improve the amount of PCR product
● incubation TOPO Cloning reaction liquid 20-30 minute
● concentrate the PCR product.
Carry out control reaction
Foreword
We recommend to carry out following contrast TOPO Cloning reaction at first uses 20 reaction kits to help your evaluation result.Carrying out control reaction comprises with test kit contained reagent and the direct TOPO of use The product of cloning reaction is produced a kind of contrast PCR product.
Before the beginning
For each conversion, prepare two LB flat boards that contain 50 μ g/ml kantlex.
Produce contrast PCR product
Use heat-staple, proofreading polysaccharase and suitable damping fluid amplification contrast PCR product.Manufacturer according to employed polysaccharase is recommended.
1. in order to produce 750bp contrast PCR product, set up following 50 μ l PCR:
Contrast pcr template (100ng) 1 μ l
10 * PCR damping fluid (enzyme is suitable), 5 μ l
DNTP mixed solution 0.5 μ l
Contrast PCR primer (being 0.1 μ l/ μ l) 1 μ l
Sterilized water 41.5 μ l
Heat-staple polysaccharase (1-2.5 unit/μ l) 1 μ l
Final volume 50 μ l
2. cover 70 μ l (1) mineral oil.
3. with following loop parameter amplification:
Stage Time Temperature Circulation
Initial sex change 2 minutes 94℃ 1×
Sex change 1 minute 94℃ 25×
Annealing 1 minute 55℃
Extend 1 minute 72℃
Last extension 7 minutes 72℃ 1×
4. from reaction system, take out 10 μ l, by the agarose gel electrophoresis analysis.As seen discontinuous 750bp band should be.Continue contrast TOPO7 cloning reaction, nextpage.
Contrast TOPO Cloning reaction
Page or leaf is produced before using contrast PCR product and pENTR TOPO Carrier, the TOPO that sets up two 6 μ l as described below Cloning reaction.
1. set up contrast TOPO Cloning reaction:
Reagent " independent carrier " " carrier+PCR inserts fragment "
Sterilized water 4μl 3μl
Salts solution or diluting salt solution 1μl 1μl
Contrast PCR product -- 1μl
pENTR?topO Carrier 1μl 1μl
2. room temperature incubation 5 minutes and placing on ice.
3. react 3 μ l at every turn and transform the One Shot of different bottles TOP10 cell (the 13rd page).
4. transform the LB flat board that the coating of 100-200 μ l mixed solution contains 50 μ g/ml kantlex at every turn.Necessarily, contain good at interval bacterium colony to guarantee at least one flat board with two kinds of different volumes coatings.
5. under 37 ℃, be incubated overnight.
Interpretation of result
Carrier+PCR insertion reaction should produce up to a hundred bacterium colonies.In order to analyze conversion, isolated plasmid dna, and with following listed suitable digestion with restriction enzyme.Following table has been listed with correct direction or the being seen digestion pattern of insertion fragment (Jeanette: please fill out following table) to clone in the other direction.
Carrier Restriction enzyme The digestion pattern (bp) of expection
pENTR/D-topO Correct direction: in the other direction: empty carrier:
pENTR/SD/D-topO Correct direction: in the other direction: empty carrier:
750 bp that bacterium colony more than 90% should contain correct direction insert fragment.
In the reaction that only contains carrier, should produce less relatively bacterium colony.
Transform contrast
In order to check One Shot The transformation efficiency of TOP10 competent cell comprises the pUC19 plasmid.Utilize the 13rd page scheme, transform a bottle One Shot with 10pg pUC19 The TOP10 cell.10 μ l transform mixed solution and add the LB flat board that 20 μ l SOC coating contains 100 μ g/ml penbritins.Transformation efficiency should be-1 * 10 9Cfu/ μ g DNA.
Influence the factor of cloning efficiency
Please note that following variation will make cloning efficiency reduce.Wherein easily corrigendum of great majority, if but cloning big insertion fragment, perhaps you can't obtain to expect 90% directed cloning efficient.
Change Solution
The directed cloning rate is low Forward primer should contain CACC at 5 ' end
The overhang complementation of reverse primer and 5 ' end.For fear of with the overhang base pairing, the redesign primer.
Pcr amplification reaction thing pH＞9 Check the pH of pcr amplification reaction, and use 1M Tris-HCl that pH8 regulates.
Not exclusively extend in the PCR process In the PCR process, must comprise last 7-30 minute last extension step.Long PCR product needs the long extension time.
The big insertion of clone fragment (＞1kb) Improve to insert segmental amount, or as gel-purified as described in the 25-26 page or leaf.
Excessive (or excess dilution) PCR product Reduce the amount of (or concentrating) PCR product.
PCR clones artefact (" false positive ") topO The small segment that the clone exists in reacting for some PCR (＜100bp) very effective.Gel-purified PCR product (25-26 page or leaf) or optimization PCR.
Gel-purified PCR product
Foreword
In blocks, multi-ribbon, primer dimer artefact or big PCR product (＞3kb) may need gel-purified.If wish purified pcr product, remove all nuclease source of pollution very carefully.The method that multiple DNA isolation fragment is arranged or remove oligonucleotide.The most frequently used method please refer to " modern molecular biology method " unit 2.6 (people such as Ausubel, 1994).3 kinds of simple methods have below been listed.
Attention: the purifying of PCR product (for example PCR product excess dilution) can reduce cloning efficiency.You may wish to optimize PCR, to produce single band (referring to producing flush end PCR product, the 9th page).
Use S.N.A.P. TMThe gel-purified test kit
S.N.A.P. from the Invitrogen acquisition TMGel-purified test kit (catalog number (Cat.No.) K1999-25) make you can be from sepharose fast purifying PCR product.
1. electrophoresis amplified reaction thing on the 1-5%TAE sepharose.(note: do not prepare sepharose with TBE.Borate can disturb the sodium iodide step, as follows.)
2. downcut the gel film that contains the PCR product, 65 ℃ of thawings in the 6M of 2 times of volumes IodineSodium Solution.
3. add the binding buffer liquid of 1.5 times of volumes.
4. the solution (once being no more than 1ml) of step 3 is gone up sample to S.N.A.P. TMOn the post.In Eppendorf tube centrifugal 1 minute with 3000 * g, abandoning supernatant.
5. if step 3 has rest solution, repeating step 4.
6. add the whole lavation buffer solution of 900 μ l.
7. in Eppendorf tube centrifugal 1 minute at full speed, discard tile and flow through liquid.
8. repeating step 7.
9. with the PCR product of 40 μ l TE or sterilized water wash-out purifying.TOPO Cloning reaction liquid uses 4 μ l, as continuation as described in the 11st page.
Quick S.N.A.P. TMMethod
A kind of easier method is to downcut the gel film that contains the PCR product simply, is placed on S.N.A.P. TMPost bed top, centrifugal 10 seconds kinds at full speed.At TOPO Use 1-2 μ l to flow through liquid in the cloning reaction (the 11st page).For obtaining optimum, the as far as possible little gel film of certain preparation.
The low melting-point agarose method
If preference is used low melting-point agarose, adopt follow procedure.Note that gel-purified will cause dilution of PCR product and cloning efficiency to reduce.
1. in the TAE damping fluid, go up at low melting-point agarose gel (0.8-1.2%) electrophoresis may PCR reaction solution how to the greatest extent.
2. show the purpose band and downcut this band.
3. gel film is placed Eppendorf tube, melt up to gel film at 65 ℃ of following incubation centrifuge tubes.
4. centrifuge tube is placed 37 ℃, make agarose keep melted state.
5. as described in the 11st page, to TOPO Add the agarose that contains the PCR product of 4 μ l fusing in the cloning reaction system.
6.TOPO Cloning reaction liquid was at 37 ℃ of following incubation 5-10 minutes.Make agarose keep melted state.
7. utilize the 13rd page method, directly transform OneShot with 2-4 μ l The TOP10 cell.
Attention: the purifying of PCR product can reduce cloning efficiency.In order to produce single band, you can optimize PCR.
Embodiment 9
Utilize GATEWAY TMCarrier carries out the optimization of the reaction conditions of TOPO ligation
To use the TOPO cloning process in order uniting, to have studied the top condition of association reaction with the GATEWAY carrier.When carrying out these researchs, several problems have been solved.
The abundance of BP reaction template and TOPO reacted constituent are to the inhibition of BP reaction
In order to address these problems, as described in this paper other parts, utilize TOPO tool production attB1+CAT+attB2 template.Carry out the PCR second time then, the template that production testing research is enough, and carry out BP with these products and react.Each step of this method is used following reaction conditions:
The topO ligation: The BP reaction:
37 ℃ of 15min of x ng PCR product (seeing below) 1 μ l topoisomerase 0.5 μ l 500mM Tris 1 μ l 40mM NaCl transform (chemistry) 2 μ l do not have salt buffer 1 μ l topO and connect product 0.5 μ l pDONR222 (300ng/ μ l) 2 μ l BP clone enzyme (Invitrogen) room temperature 25min → Proteinase K processing
After the BP reaction, mixture chemical conversion chemoreception attitude Bacillus coli cells (TOPO10 for example; Invitrogen Corporation), the cell plating is measured recombination fraction.
The result
1 2 3 4 5 6
Bacterium colony 149 270 514 0 0 0
The template of using 0.8ng 1.6ng 4ng 1.6ng 4ng 0ng
Does topO connect? Not Not Not Be Be Not
These results confirm that the TOPO instrument produces to be enough to carry out the template of BP reaction subsequently.In addition, these results confirm that also TOPO connects the BP reaction that suppresses subsequently.
The existence of attB1 and attB2 linker is to the influence of BP reaction
In this section in the research, checked to have the influence of excessive attB1 and attB2 linker in the reaction mixture to subsequently BP reaction.In order to address this problem, (attB1+CAT+attB2 adds the attB1 and the attB2 linker of different content in 20ng), carries out BP reaction (under the room temperature 60 minutes) under standard conditions to template.After the BP reaction, with mixture chemical conversion chemoreception attitude Bacillus coli cells (TOP10 for example; InvitrogenCorporation), the cell plating is measured recombination fraction.
The result
1 2 3 4 5 6
Linker content (ng) 20 10 5 2.5 1 0
The colony number that forms 270 475 760 590 340 460
These results confirm that the existence of excessive attB1 and attB2 linker has no significant effect transformation efficiency, show to have attB1 and not remarkably influenced of attB2 linker BP reaction in the reaction mixture.
The removal of inhibitor in the TOPO ligation system
For the best approach of determining before using the BP reaction product, from TOPO ligation system, to remove inhibitor, assessed multiple treatment process.Carry out the TOPO ligation with following reaction mixture, at room temperature incubation is 5 minutes:
AttB1+attB2 (each 20 μ g/ μ l) 2μl
CAT(100ng/μl) 1.7μl
AttB1+CAT+attB2 product (10ng/ μ l) 1μl
500mM?Tris 0.5μl
Topoisomerase I (1 μ g/ μ l) 1μl
After the TOPO ligation, before carrying out the BP reaction, 7 different samples of reaction mixture under one of following condition:
(1) in a reaction, adds 1 μ l, 0.6% SDS+3mM EDTA, 37 ℃ of 15min;
(2) in 4 reactions, add 4 μ l, 0.6% SDS+3mM EDTA, 37 ℃ of 15min, SNAP is purified in the 20 μ l water then;
(3) in 4 reactions, add 4 μ l, 0.6% SDS+3mM EDTA+1 μ l Proteinase Ks (2 μ g/ μ l), 37 ℃ of 15min, SNAP is purified in the 20 μ l water then;
(4) in a reaction, add 0.8 μ l 2.5mM NaCl, 37 ℃ of 17min;
(5) in 4 reactions, add 3.2 μ l 2.5M NaCl, 37 ℃ of 15min, SNAP is purified in the 20 μ l water then;
(6) in 4 reactions, add 3.2 μ l 2.5M NaCl and 1 μ l, 2 μ g/ μ l Proteinase Ks, 37 ℃ of 15min, SNAP is purified to (positive control in the 20 μ l water then; Use the 0.8ng template);
(7) (negative control; Do not use template).
At room temperature carry out BP reaction 60 minutes with no salt buffer.For unpurified mixture, per 10 μ l BP reaction systems are used 1 μ l TOPO ligation mixture.For the mixture of purifying, per 10 μ l BP reaction systems are used 5.5 μ l TOPO ligation mixtures.After the BP reaction, mixture chemical conversion chemoreception attitude Bacillus coli cells (TOPO10 for example; Invitrogen Corporation), the cell plating is measured recombination fraction.
The result
1 2 3 4 5 6 7 8
Handle SDS SDS SDS NaCl NaCl NaCl (+) (-)
Proteinase K - - + - - +
Purifying - + + - + +
Colony number 6 515 400 0 550 657 179 0
These results confirm: (1) for carrying out the BP reaction effectively, purifying is optional; (2) in order to make BP reaction subsequently reach top efficiency, after the TOPO ligation, do not need to use the Proteinase K reaction mixture; (3) SDS handles with the NaCl reaction mixture and produces identical transformation efficiency (therefore reaction has identical influence to BP).
The optimization of BP temperature of reaction
In order to determine after TOPO connects, to carry out the optimal reaction temperature of BP reaction, as template, under differing temps, carry out the BP reaction with attB1+CAT+attB2 PCR product.After the BP reaction, mixture chemical conversion chemoreception attitude Bacillus coli cells (TOP10 for example; Invitrogen Corporation), the cell plating is measured recombination fraction.
The result
The BP temperature of reaction 42℃ 37℃ Room temperature 14℃
Colony number (+template) 3 337 588 195
Colony number (no template) 0 4 0 0
These results confirm that room temperature (about 20-25 ℃) is the optimal reaction temperature that carries out the BP reaction.
AttB1: the optimization of inserting the mol ratio of fragment: attB2
In order to determine the optimum mole ratio of attB1, insertion fragment and attB2 template in the BP reaction, these templates are with different mixed in molar ratio, and BP is reflected under the above-mentioned top condition and carries out.After BP reaction, mixture chemical conversion chemoreception attitude Bacillus coli cells (TOP10 for example; Invitrogen Corporation), and plating, recombination fraction measured.
The result
AttB1: insert fragment: the attB2 ratio 2∶1∶2 ?1.5∶1∶1.5 1∶1∶1 1∶2∶1 0 (contrast)
Colony number 81 93 165 154 9
These results confirm, attB1: the ratio that inserts fragment: attB2 is 1: 1: 1st, and it is best to carry out the BP reaction.
Determining of the influence of salt pair BP reaction
In order to determine the BP reaction soln exists salt whether to influence recombination fraction, in no salt buffer or containing and carry out BP in the standard BP reaction buffer of salt and react.
Result's (colony number of formation)
Buffering salt - +
+ template 108 109
-template (negative control) 1 0
These results confirm, in the BP reaction process, contain in the reaction buffer or not saliferous to not influence of recombination efficiency.
Determining of the best number of times of TOPO ligation
In following a series of experiment, checked whether a TOPO ligation is enough to provide best recombination fraction this problem for the reaction of the BP behind the purifying.Carry out a TOPO ligation with following reaction mixture:
AttB1 and attB2 (each 20ng/ μ l) 0.5 μ l
CAT(100ng/μl) 1.7μl
500mM?Tris 0.5μl
Topoisomerase (1 μ g/ μ l) 1 μ l
DH 2O is enough to make final volume to reach 5 μ l
Reaction mixture adds 1 μ l, 0.6% SDS+3mM EDTA then 37 ℃ of following incubations 15 minutes; Mixture uses SNAP post (seeing above) to be purified in the 20 μ l water 37 ℃ of following incubations 15 minutes then.Product with following TOPO ligation carries out the BP reaction then:
Standard BP reaction buffer 2 μ l
pDONR222(300ng/μl) 0.5μl
TOPO connects product (from top) 5.5 μ l
BP clone enzyme 2 μ l
Reaction mixture is incubation 60 minutes at room temperature, adds 1 μ l, 2 μ g/ μ l Proteinase Ks then; Mixture was 37 ℃ of following incubations 15 minutes, and is following 15 minutes at 75 ℃ then.Use 4 μ l reaction mixture chemical conversion chemoreception attitude Bacillus coli cells (TOP10 for example then; Invitrogen Corporation), the cell plating is measured recombination fraction.
Result's (colony number of formation)
+ template -template (negative control)
188 0
These results confirm that a TOPO ligation can provide the template that is enough to carry out effective BP reaction.
The optimization of purification process
Also experimentize, determine that SNAP purification column (Invitrogen Corporation) or CONCERT purification system (Invitrogen Corporation) carry out the BP reaction and provide whether different on the best purifying template after connecting for TOPO.TOPO ligation and BP reaction are carried out as mentioned above, and difference is some samples SNAP column purification, and other sample is used CONCERT plasmid purification system purifying after carrying out the TOPO ligation.The sample of purifying carries out the standard BP reaction then, transforms with reaction mixture by chemical conversion or electroporation.After the conversion, the cell plating is to determine recombination fraction.
Result's (colony number of formation)
Method for transformation SNAP ?CONCERT No template (negative control)
Chemistry 188 254 0
Electroporation 8220 11460 672
These results confirm that SNAP and CONCERT purification system all provide the template of purifying well for the reaction of the BP after the TOPO ligation.
Top condition
According to comprehensive above-mentioned experimental result, determine that the top condition of combination TOPO connection-Gateway reaction is as follows:
(1) TOPO ligation
(a) attB1/ insertion fragment mol ratio is 1: 1,5 μ l reaction volumes
(b) 37 ℃ of following incubations 15 minutes
(c) add 1 μ l, 0.6% SDS+3mM EDTA; 37 ℃ of following incubations 15 minutes
(d) be purified in the 20 μ l water with SNAP post or CONCERT system
(2) BP reaction
(a) preparation feedback mixture:
(i) TOPO of purifying connects product 5.5 μ l
(ii) standard BP reaction buffer 2 μ l
(iii)pDONR222(30ng/μl) 0.5μl
(iv) BP clones enzyme 2 μ l
(b) room temperature incubation reaction mixture is 60 minutes;
(c) add 1 μ l, 2 μ g/ μ l Proteinase Ks;
(d) 37 ℃ of following incubations 15 minutes;
(e) 75 ℃ of following incubations 15 minutes;
(3) transform
(a) the 2-4 μ l reaction mixture that uses BP to react carries out chemical conversion or electroporation.
In order to confirm the efficient of these optimal conditions, the CAT and the lacZ insertion fragment that reach the different sizes of BP reaction subsequently with experience TOPO connection experimentize subsequent transformation and plating.
The result
Chemical conversion
Insert fragment CAT ?lacZ(1kb) ?lacZ(1.5kb) ?lacZ(2kb) ?lacZ(3.2kb) Do not have
Colony number 188 ?180 ?182 ?177 ?71 3
The clone of correct size 10/10 ?18/18 ?16/16 ?17/18 ?18/18
Electricity transforms
Insert fragment CAT ?lacZ(1kb) ?lacZ(1.5kb) ?lacZ(2kb) ?lacZ(3.2kb) Do not have
Colony number 8222 ?7335 ?7320 ?7500 ?6150 510
These results integrate confirmation, and for the combination TOPO connection-Gateway reaction that different size insertion fragments are carried out, above-mentioned condition is best.
Embodiment 10
Do not need the structure of the Mammals expression cassette of PCR method for the second time
The preparation of purpose element and gene
The pcr amplification of purpose element and gene uses following primer sets (seeing the following form 4) and template:
(a) primer sets: sequence #1 and #2; Template: pcDNA 4/TetO.PCR product: 5 ' element.
(b) primer sets: sequence #3 and #4; Template: pcDNA 3.2/V5.PCR product: 3 ' element.
(c) primer sets: sequence #5 and #6; Template: pcDNA 3.1/CAT.PCR product: CAT inserts fragment.
Table 4. is used for the primer of construction expression box
Sequence #1 ?GTTGACATTGATTATTGACTAG
Sequence #
2 ?GTTCCGAAGGGTTAACGCTAGAGTCCGGAGGC
Sequence #
3 ?GACTCAAAGGGAAGGTAAGCCTATCCCTAAGG
Sequence #
4 ?GCGCAGATCTGCTATGGCAG
Sequence #
5 ?CGGAACAAGGGACCATGGAGAAAAAAATCACTGGATA
Sequence #
6 ?TGAGTCAAGGGCGCCCCGCCCTGCTGCCACTCATCG
Sequence #
7 ?GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCCTTC-?GGAAC
Sequence #
8 ?GTTCCGAAGGGAAGCCTGCTTTTTTGTACAAACTTGT-?CCCC
Sequence #
9 ?GACTCAAAGGGACCCAGCTTTCTTGTACAAAGTGGT-?CCCC
Sequence #
10 ?GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTTTG-?AGTC
Sequence #
11 ?CACGACGTTGTAAAACGACG
Sequence #
12 ?ATGTAATACGACTCACTATAGG
(Invitrogen Corporation, Carlsbad CA) carry out PCR with Platinum Taq high-fidelity DNA polymerase.The PCR condition is as follows:
Composition Volume Final concentration
dH 2O 35.5μl
10mM dNTP mixture (each 2.5mM) 4μl Each 0.2mM
10 * high-fidelity PCR damping fluid 5μl 1×
50mM?MgSO 4 2μl 2mM
Primer 1 (100ng/ μ l) 1μl
Primer 2 (100ng/ μ l) 1μl
Template (10ng/ μ l) 1μl
Platinum Taq high-fidelity (5U/ μ l) 0.5μl
94 ℃ of 4min (1 circulation)
94 ℃ of 30sec → 55 ℃ 30sec → 68 ℃ of 1min (30 circulations)
68 ℃ of 10min (1 circulation)
4 ℃ (finishing)
The fragment of utilizing following condition purifying PCR to produce:
Reagent: SNAP MiniPrep test kit (Invitrogen Corporation).
Step
(1) mixes 50 μ l PCR products and 150 μ l binding buffer liquid.Thorough mixing.
(2) add 350 μ l Virahols.Thorough mixing.
(3) on the sample sample to SNAP MiniPrep post.
(4) with 14000rpm centrifugal 1 minute.Discard post and flow through liquid.
(5) add 500 μ l lavation buffer solutions, with the centrifugal 1min of 14000rpm.Discard post and flow through liquid.
(6) add 700 μ l 1 * whole lavation buffer solution, with the centrifugal 1min of 14000rpm.Discard post and flow through liquid.
(7) with 14000 centrifugal 1 minute dry posts.
(8) post is transferred in the new centrifuge tube.Xiang Zhuzhong adds 50 μ l dH 2O.Room temperature incubation 2-5min.With the centrifugal 1min of 14000rpm.Liquid is flow through in collection.
(9) measure DNA concentration according to the ultraviolet absorptivity under the 260nm.
The TOPO ligation
PCR produces expression cassette in order to use for the second time, uses following condition of contact:
5 ' element (700bp) 75ng
3 ' element (350bp) 35ng
500mM?Tris(pH7.5) 0.5μl
Topoisomerase (1 μ g/ μ l) 0.5 μ l
CAT inserts fragment (700bp) 150ng
DH 2O is enough to make final volume to reach 5 μ l
5-15min is at room temperature carried out in this reaction., carry out second with primer sets sequence #1 and sequence #4 and take turns PCR as template with the reactant of half volume.Except the extension time is the 2min, the PCR condition is same as described above.Behind the PCR, purify DNA as mentioned above.The DNA of purifying is used for transfection.
For the expression cassette of PCR production for the second time, use following condition of contact:
5 ' element (700bp) 510ng
3 ' element (350bp) 230ng
500mM?Tris(pH7.5) 1.5μl
Topoisomerase (1 μ g/ μ l) 3 μ l
CAT inserts fragment (700bp) 450ng
DH 2O is enough to make final volume to reach 5 μ l
This is reflected at and carries out 15min under 37 ℃.Adding Proteinase K to final concentration is 50 μ g/ml, and mixture is at 37 ℃ of following incubation 10min.The DNA that handles prepares to be used for transfection.
Gene expression research
With 3 kinds of clones (suspension TRex-CHO, adhere to TRex-CHO and adhere to TRex-293 clone) as the model cell system of detecting these expression cassettes.Use the standard cell lines cultural method.Use 24 porocyte culture plates.With Lipofectamine 2000 as transfection reagent.After the transfection 24 hours, with the final concentration interpolation tsiklomitsin of 1 μ g/ml.Tsiklomitsin is not added in control experiment.Cell incubation 24 hours again before cracking.With Western trace transferring protein, detect with anti--V5 or anti--CAT antibody.
Result and discussion
The purpose of this research is do not need to confirm for the second time that PCR can produce expression cassette.In this research, we have compared the expression data of the expression cassette that carries out the generation of secondary PCR step and the data of the expression cassette acquisition of not carrying out the generation of secondary PCR step.For the expression cassette of secondary PCR generation, with about 1.2 μ g/ hole DNA transfections, 24 orifice plates.For not carrying out the expression cassette that secondary PCR produces, use the product (about 1.2 μ g/ holes) of a ligation.The detection data show, utilize method of the present invention, and not needing for the second time, the PCR step can produce functional expression box (Figure 30).
Embodiment 11
Utilize the Topo tool method to produce the compatible expression cassette of Gateway
The preparation of linker
Equivalent sequence #7 and sequence #8 (seeing the above table 4) mix in 40mM NaCl, and mixture slowly cools to room temperature at 95 ℃ of following sex change 5min, form the attB1 linker.Equivalent sequence #9 and sequence #10 (seeing the above table 4) mix in 40mM NaCl, and mixture slowly cools to room temperature at 95 ℃ of following sex change 5min, form the attB2 linker.
TOPO connects
As described in embodiment 10, produce CAT insertion fragment.Condition of contact is optimized (referring to embodiment 9 and 10) as mentioned above:
AttB1 linker (40bp) 10ng
AttB2 linker (40bp) 10ng
500mM?Tris(pH7.5) 0.5μl
Topoisomerase (1 μ g/ μ l) 1 μ l
CAT inserts fragment (700bp) 170ng
DH 2O is enough to make final volume to reach 5 μ l
This is reflected at and carries out 15min under 37 ℃.Add SDS and EDTA and be respectively 0.1% and 0.5mM to final concentration.Mixture is at 37 ℃ of following incubation 15min.
Purifying
In the mixture of handling, add water (15 μ l).With SNAP MiniPrep test kit (Invitrogen) purify DNA.
Step
(1) product of combination treatment and 60 μ l binding buffer liquid.Thorough mixing.
(2) add 140 μ l Virahols.Thorough mixing.
(3) on the sample sample to SNAP MiniPrep post.
(4) with the centrifugal 1min of 14000rpm.Discard post and flow through liquid.
(5) add 500 μ l lavation buffer solutions, with the centrifugal 1min of 14000rpm.Discard post and flow through liquid.
(6) add 700 μ l 1 * whole lavation buffer solution, with the centrifugal 1min of 14000rpm.Discard post and flow through liquid.
(7) with the dry post of 14000 centrifugal 1min.
(8) post is transferred in the new centrifuge tube.On post, add 20 μ l dH 2O.Room temperature incubation 2-5min.With the centrifugal 1min of 14000rpm.Liquid is flow through in collection.
The BP reaction
BP reaction buffer 2 μ l
The product 5.5 μ l of purifying
pDONR222(300ng/μl) 0.5μl
BP clone enzyme 2 μ l
Reaction mixture is incubation 60min at room temperature, adds 1 μ l Proteinase K (2 μ g/ μ l) then.For inactivator, mixture is at 37 ℃ of following incubation 15min, subsequently at 75 ℃ of following 15min.
Transform
The mixture of handling transforms TOP10 competent cell (chemistry) or electroporation ElectroMax competent cell.Cell inoculation is incubated overnight under 37 ℃ on LP-kantlex flat board.The counting colony number.In order to confirm to contain the insertion fragment in these bacterium colonies, we have designed primer sets (sequence #11 and #12) and have carried out bacterium colony PCR.Insert fragment if exist, the PCR product will produce the band of a treaty 700bp; Yet if do not contain the insertion fragment, the size of PCR product band is about 2.2kb.
Result and discussion
In this research, we wish to confirm that the PCR product that contains TOPO instrument cohesive end that produces can directly be connected with the attB2 linker with attB1.The product that connects can directly use in the BP recombining reaction, to produce GATEWAY TMEnter clone's (table 5).
The bacterium colony that table 5.BP reaction produces
Transform type attB1-Cat-attB2 Independent carrier
Chemistry 188 0
Electroporation 8220 672
In order further to confirm that these bacterium colonies contain the insertion fragment, our picking 18 positive bacterium colonies and 2 negative bacterium drop into performing PCR.PCR result shows, all contains the product (Figure 31) of correct size in 18 bacterium colonies checking.
In order to be expressly understood, the present invention describes in detail by explanation and embodiment, it will be appreciated by those skilled in the art that, under the situation that does not influence scope of the present invention or its any particular, in condition, preparation and other parameter of extensive and suitable scope, revise or change, can carry out equally, and these modifications or change also are contained in the scope of additional claims.
Following total, common unsettled U.S. Patent application is this complete quoting as a reference: the U.S. Provisional Application of submitting on December 8th, 2000 number 60/254,510; The U. S. application of submitting on December 11st, 2000 number 09/732,914; The U.S. Provisional Application of submitting to May 21 calendar year 2001 number 60/291,972; The U.S. Provisional Application of submitting to September 14 calendar year 2001 number 60/318,902; The U.S. Provisional Application of submitting to September 28 calendar year 2001 number 60/326,092.
One of ordinary skill in the art's of the present invention level is all represented in the open text of all that mention in this specification sheets, patent and patent application, is incorporated herein by reference.

Claims (45)

1. isolated nucleic acid molecule, it comprises: (a) one or more recombination sites; (b) one or more topoisomerase enzyme recognition sites and/or one or more topoisomerase.
2. the nucleic acid molecule of claim 1, wherein this nucleic acid molecule is a kind of ring molecule.
3. the nucleic acid molecule of claim 1, wherein this nucleic acid molecule comprises two or more recombination sites.
4. the nucleic acid molecule of claim 3, wherein one of these two or more recombination sites are arranged in each terminal flank of this molecule topoisomerase enzyme recognition site at least.
5. the nucleic acid molecule of claim 1, wherein this recombination site is selected from:
(a) attB site,
(b) attP site,
(c) attL site,
(d) attR site,
(e) lox site,
(f) psi site,
(g) dif site,
(h) cer site,
(i) frt site,
Mutant, variant and derivative with the (a) and (b), (c), (d), (e), (f), (g), (h) or the recombination site (i) that keep the reorganization ability.
6. the nucleic acid molecule of claim 1, wherein this topoisomerase enzyme recognition site is by a kind of I type topoisomerase identification and combination.
7. the nucleic acid molecule of claim 6, wherein this I type topoisomerase is a kind of IB type topoisomerase.
8. the nucleic acid molecule of claim 7, wherein this IB type topoisomerase is selected from eukaryote nuclear I type topoisomerase and poxvirus topoisomerase.
9. the nucleic acid molecule of claim 8, wherein this poxvirus topoisomerase produces or therefrom separates by being selected from following virus: vaccinia virus, rabbit fibroma virus, ORF virus, fowlpox virus, MCV and amsacta moorei entomopoxvirus.
10. carrier that comprises the nucleic acid molecule of claim 1.
11. the carrier of claim 10, wherein this carrier is a kind of expression vector.
12. a carrier, it is selected from: pcDNAGW-DT (sc), pENTR-DT (sc), pcDNA-DEST41, pENTR/D-TOPO, pENTR/SD/D-TOPO, pcDNA3.2/V5/GWD-TOPO and pcDNA6.2/V5/GWD-TOPO.
13. host cell that comprises the isolated nucleic acid molecule of claim 1.
14. host cell that comprises the carrier of claim 10.
15. host cell that comprises the carrier of claim 12.
16. the method for a body outer clone nucleic acid molecule comprises:
(a) obtain first kind of nucleic acid molecule to be cloned;
(b) first kind of nucleic acid molecule will treating body outer clone mixes with second nucleic acid molecule, this second kind of nucleic acid molecule comprises flank at least one first topoisomerase enzyme recognition site at least one first recombination site, flank is at least one second topoisomerase enzyme recognition site of at least one second recombination site, wherein first and second recombination sites are not recombinated each other, and at least a topoisomerase; With
(c) first kind of nucleic acid molecule to be cloned inserted under the condition between first and second topoisomerase enzyme recognition site of this second kind of nucleic acid molecule, this mixture of incubation, thus be created in the first kind of product molecule that comprises first kind of nucleic acid molecule to be cloned between first and second recombination site.
17. the method for claim 16, wherein this second kind of nucleic acid molecule is a kind of carrier.
18. the method for claim 16, first kind of nucleic acid molecule of this that wherein will clone is a kind of linear nucleic acid molecule.
19. the method for claim 18, wherein this linear nucleic acid molecule is a kind of flush end nucleic acid molecule.
20. the method for claim 16, first kind of nucleic acid molecule of this that wherein will clone is a kind of PCR product.
21. the method for claim 16, first kind of nucleic acid molecule of this that wherein will clone comprises at least one open reading frame.
22. the method for claim 16, it further comprises: help first and the 3rd and second and quadruple group site between under the condition of recombinating, this first kind of product molecule contacted with at least a the third nucleic acid molecule, and the latter comprises at least a third and fourth recombination site of not recombinating each other.
23. the method for claim 22, wherein the third nucleic acid molecule is a kind of carrier.
24. the method for claim 16, it further comprises this first kind of product molecule of insertion in a kind of host cell.
25. the method for claim 17, it further comprises this first kind of product molecule of insertion in a kind of host cell.
26. the method for claim 22, it further comprises this second kind of product molecule of insertion in a kind of host cell.
27. the method for claim 23, it further comprises this second kind of product molecule of insertion in a kind of host cell.
28. the method for claim 17, wherein this carrier is a kind of expression vector.
29. the method for claim 23, wherein this carrier is a kind of expression vector.
30. the method for claim 16, wherein this second kind of nucleic acid molecule comprises another nucleotide sequence at least, and it is selected from: selected marker, cloning site, restriction site, promotor, operator gene, operon, replication orgin and gene or portion gene.
31. the method for claim 22, wherein this third nucleic acid molecule comprises another nucleotide sequence at least, and it is selected from: selected marker, cloning site, restriction site, promotor, operator gene, operon, replication orgin and gene or portion gene.
32. the method for claim 16, wherein this first kind and second kind of recombination site are selected from:
(a) attB site,
(b) attP site,
(c) attL site,
(d) attR site,
(e) lox site,
(f) psi site,
(g) dif site,
(h) cer site,
(i) frt site,
Mutant, variant and derivative with the (a) and (b), (c), (d), (e), (f), (g), (h) or the recombination site (i) that keep the reorganization ability.
33. the method for claim 22, wherein this third and the 4th kind of recombination site be selected from:
(a) attB site,
(b) attP site,
(c) attL site,
(d) attR site,
(e) lox site,
(f) psi site,
(g) dif site,
(h) cer site,
(i) frt site,
Mutant, variant and derivative with the (a) and (b), (c), (d), (e), (f), (g), (h) or the recombination site (i) that keep the reorganization ability.
34. the method for claim 32, wherein this lox site is selected from loxP site and loxP511 site.
35. the method for claim 33, wherein this lox site is selected from loxP site and loxP511 site.
36. the method for claim 16, wherein this topoisomerase is a kind of I type topoisomerase.
37. the method for claim 36, wherein this I type topoisomerase is a kind of IB type topoisomerase.
38. the nucleic acid molecule of claim 37, wherein this IB type topoisomerase is selected from eukaryote nuclear I type topoisomerase and poxvirus topoisomerase.
39. the nucleic acid molecule of claim 38, wherein following virus produces this poxvirus topoisomerase or therefrom separation: vaccinia virus, rabbit fibroma virus, ORF virus, fowlpox virus, MCV and amsacta moorei entomopoxvirus by being selected from.
40. the method for claim 22, wherein this product nucleic acid molecule combines in the presence of at least a recombinant protein with the third nucleic acid molecule.
41. the method for claim 40, wherein this recombinant protein is selected from:
(a)Cre；
(b)Int；
(c)IHF；
(d)Xis；
(e)Fis；
(f)Hin；
(g)Gin；
(h)Cin；
(i) Tn3 resolvase;
(j)TndX；
(k) XerC; With
(l)XerD。
42. the method for claim 40, wherein this recombinant protein is Cre.
43. the method for claim 40, wherein this recombinant protein is selected from Int, Xis, IHF and Fis.
44. test kit that comprises the isolated nucleic acid molecule of claim 1.
45. the test kit of claim 44, it further comprises one or more compositions, it is selected from: one or more topoisomerases, one or more recombinant proteins, one or more carriers, one or more have polypeptide and one or more host cells of polymerase activity.
CNA2007101667135A 2000-12-08 2001-12-07 Compositions and methods for rapidly generating recombinant nucleic acid molecules Pending CN101173276A (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US25451000P 2000-12-08 2000-12-08
US60/254,510 2000-12-08
US09/732,914 2000-12-11
US60/318,902 2001-09-14
US60/326,092 2001-09-28
US60/333,124 2001-11-27

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CNB01822539XA Division CN100357427C (en) 2000-12-08 2001-12-07 Method and compositions for synthesis of nuclear acid molecules using multiple recognition sites

Publications (1)

Publication Number Publication Date
CN101173276A true CN101173276A (en) 2008-05-07

Family

ID=39422028

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA2007101667135A Pending CN101173276A (en) 2000-12-08 2001-12-07 Compositions and methods for rapidly generating recombinant nucleic acid molecules

Country Status (1)

Country Link
CN (1) CN101173276A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103237889A (en) * 2010-08-16 2013-08-07 萨克生物研究学院 Adenoviral assembly method
CN109415766A (en) * 2016-02-29 2019-03-01 艾瑞迪亚公司 Method, composition and device for information storage
CN112851771A (en) * 2021-02-09 2021-05-28 中国科学院武汉病毒研究所 Method for linking nucleic acids to proteins or peptides
CN114686581A (en) * 2020-12-29 2022-07-01 深圳泰乐德医疗有限公司 Detection method and kit for 19bp insertion mutation of DHFR gene intron and use method of kit

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103237889A (en) * 2010-08-16 2013-08-07 萨克生物研究学院 Adenoviral assembly method
CN103237889B (en) * 2010-08-16 2017-04-05 萨克生物研究学院 Adenoviruss assemble method
CN107090440A (en) * 2010-08-16 2017-08-25 萨克生物研究学院 Adenovirus assemble method
CN107090440B (en) * 2010-08-16 2021-10-22 萨克生物研究学院 Adenovirus assembly method
CN109415766A (en) * 2016-02-29 2019-03-01 艾瑞迪亚公司 Method, composition and device for information storage
CN114686581A (en) * 2020-12-29 2022-07-01 深圳泰乐德医疗有限公司 Detection method and kit for 19bp insertion mutation of DHFR gene intron and use method of kit
CN112851771A (en) * 2021-02-09 2021-05-28 中国科学院武汉病毒研究所 Method for linking nucleic acids to proteins or peptides

Similar Documents

Publication Publication Date Title
CN100357427C (en) Method and compositions for synthesis of nuclear acid molecules using multiple recognition sites
US7244560B2 (en) Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
US8945884B2 (en) Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites
US20070196838A1 (en) Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
AU2001288356B2 (en) Methods and reagents for molecular cloning
AU2002227153A1 (en) Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
AU2001288356A1 (en) Methods and reagents for molecular cloning
JP4731078B2 (en) Methods for manipulating and sequencing nucleic acid molecules using translocation and recombination
EP1539998A2 (en) Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
CN101173276A (en) Compositions and methods for rapidly generating recombinant nucleic acid molecules
WO2009000281A1 (en) Methods for directional cloning of amplified nucleic acids and uses thereof
AU2007202811A1 (en) Methods and reagents for molecular cloning
AU2012200337A1 (en) Methods and reagents for molecular cloning

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20080507