JP2015192666A - Method and kit for detecting food allergen by real-time pcr - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a qualitative real-time PCR detection method which can simply and efficiently yield a positive/negative determination of food allergens in food and drinks.SOLUTION: The presence or absence of a food allergen in a food sample is determined by performing real-time PCR using a primer set for detecting food allergens for DNA extracted from the food sample and DNA of the food allergens with pre-defined copy-number which is a positive control to compare Ct values of the obtained amplified signals.

Description

  The present invention relates to a test method using a real-time PCR method capable of performing positive / negative determination for food allergens in food and drink.

  Food allergens (for example, wheat, buckwheat, peanuts, etc.) can cause allergic reactions when ingested, and can cause severe anaphylactic shock in some patients even by ingestion of trace amounts. In addition, the number of food allergy patients has been increasing in recent years, which is one of the major social problems worldwide. Against this background, food allergy labeling systems are being implemented in various countries including Japan. This labeling system is intended to provide the patient with the information necessary to select foods that do not contain a specific food allergen.

  In implementing the food allergy labeling system, an inspection method for verifying the validity of the labeling is required. In Japan, among the food allergens, 7 specified raw materials that are required to be labeled (shrimp, crab, wheat, buckwheat, egg, milk, peanut) and 20 items that are recommended to be specified (abalone, squid, No matter how much, orange, cashew nut, kiwi fruit, beef, walnut, sesame, salmon, mackerel, soybean, chicken, banana, pork, matsutake, peach, yam, apple, gelatin (non-patent document 1) ), Of which, for specific raw materials such as wheat, buckwheat, and peanuts, an inspection method has been notified (Non-patent Document 2). According to these notices, labeling is required for foods and drinks that contain a certain amount of specific raw materials in the amount of protein, that is, the protein content derived from food allergen per gram of food collected is quantitatively screened by ELISA. If the test results in 10 μg or more, it is judged positive for the food allergen and display is required. Moreover, about the food-drinks judged to be positive by the quantitative screening test | inspection by ELISA, the qualitative confirmation test | inspection by highly specific PCR and a Western blot is performed as needed.

  Here, in the qualitative PCR test used for the confirmation test of the specific raw material, the presence / absence of the amplification product using the DNA derived from the specific raw material as a template is confirmed by electrophoresis to determine whether the specific raw material is positive / negative. . Therefore, in the qualitative PCR test, the complexity of performing electrophoresis and the risk of contamination of the test environment due to the amplification product become problems. To solve these problems, there is a real-time PCR method for monitoring and detecting the intensity of fluorescent signal derived from the amplification product in the PCR reaction solution. The test methods using this method include wheat, buckwheat, and peanuts that are food allergens. Test methods (patent documents 1 and 2), genetically modified crop test methods (non-patent document 3), pathogenic bacteria test methods (non-patent document 4), fungus test methods (non-patent document 5), etc. ing.

  However, the judgment criteria for the confirmation test using the conventional real-time PCR method cannot take into account differences between models of various real-time PCR devices or differences between individuals of the same device (difference due to differences in serial numbers). However, when PCR is performed under the same conditions using a real-time PCR device of a different model, the Ct value may vary due to differences in the temperature, reaction time, fluorescence signal detection sensitivity, and analysis method of the PCR reaction solution. Different results / decisions may occur. This variation can produce completely different results / judgments, especially in tests that require detection of trace levels. Therefore, in Non-Patent Document 3, it is recommended to specify the model of the real-time PCR device to be used, or to use a model that can obtain a result equivalent to the specified model. Regarding the problem that occurs between these models, the positive / negative criterion is “whether the Ct value of the fluorescent signal derived from the test sample is less than or above the Ct value of the fluorescent signal derived from a certain amount of DNA as a positive control. "Can be solved (Non-Patent Documents 4 and 5). However, the amount of DNA used as a positive control here is several copy levels as the target DNA sequence, that is, an amount near the detection lower limit of PCR, in order to suppress variations in Ct values including amplification / non-amplification. In this case, it is necessary to measure Ct values at several points on the high concentration side with little variation, and to estimate Ct values serving as judgment criteria using a calibration curve created based on the values, which makes the operation complicated. . In particular, Non-Patent Document 5 estimates 5 copies, which is the detection limit, using a circular plasmid that is less likely to be amplified than linear DNA. As described above, any of the qualitative real-time PCR methods shown in Non-Patent Documents 4 and 5 is a method for determining positive / negative at a level close to the theoretical detection lower limit of PCR. In the high PCR method, there is a problem in that it is difficult to clearly distinguish between a fluorescent signal caused by environmental contamination and a fluorescent signal caused by a positive test sample, and cannot be judged correctly.

  Therefore, in this field, the real-time PCR method can accurately determine positive / negative for food allergens in foods and drinks without specifying the model of the real-time PCR device and without creating a calibration curve. There has been a demand for an inspection method using the above.

JP 2013-188164 A Japanese Patent No. 4399417

Labeling guidelines for foods containing allergens (Consumer Affairs Agency website) About the inspection method of the food containing allergic substances (Sat Table No. 286 dated September 10, 2010) About inspection method of food applied with recombinant DNA technology that has not been examined for safety (November 16, 2012 Food Safety 1116 No. 4) Johne's disease test manual (March 29, 2013 edition) FungiQuant: A broad-coverage fungal quantitative real-time PCR assay, BMC Microbiology 10.1186 / 1471-2180-12-255

  The present invention uses a real-time PCR method that can accurately determine positive / negative for food allergens in foods and drinks without specifying the model of the real-time PCR device and without creating a calibration curve. The purpose is to provide inspection methods.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that a food allergen with a protein concentration corresponding to 10 μg / g equivalent of food allergen is difficult (that is, food and drink for which a PCR test with higher sensitivity is required). A food allergen DNA copy number serving as a positive control that gives a Ct value that can be determined to be positive by comparing the Ct value using a real-time PCR method for food allergen DNA. The Ct value obtained for the test food or drink was obtained by applying the DNA to the template DNA extracted from the test food or drink and real-time PCR under the same conditions for amplifying the food allergen DNA. If the value is less than the value, preferably less than Food is found that can be judged to be positive for food allergens, it has led to the completion of the present invention.

  That is, according to the present invention, the Ct value obtained for the DNA amplification product of the food allergen by the real-time PCR method using the template DNA extracted from the food or drink to be tested is used as a positive control for a food having a preset copy number. Just by comparing with the Ct value obtained by performing real-time PCR in the same manner using allergen DNA, it is not necessary to specify the model of the real-time PCR apparatus, and it is not necessary to create a calibration curve. A positive / negative determination can be made for food allergens.

That is, the present invention includes the following inventions.
[1] A method for determining the presence or absence of a food allergen contained in a food or drink or a raw material for food or drink,
(A) A step of obtaining a Ct value of an amplified signal by performing real-time PCR using a DNA extracted from a food or drink or a raw material for food or drink as a template and using a primer set for detecting food allergens;
(B) using the food allergen-derived DNA as a template, performing real-time PCR under the same conditions as in step (a) to obtain a Ct value of the amplified signal,
(B-1) The DNA is in a circular form including the target sequence of the primer set, and is extracted from the amount (copy number) of the DNA and the food or drink or raw material used in the step (a) Used in real-time PCR in an amount ratio of more than 24 copies: 50 ng, or (b-2) a linear chain containing the target sequence of the primer set Amount that is in the form and the amount (ng) of DNA extracted from the food or drink used in step (a) or the raw material for food or drink (ng) exceeds 6 copies: 50 ng Steps used for real-time PCR in ratios;
(C) A step of comparing the Ct value obtained in step (a) with the Ct value obtained in step (b), wherein the Ct value obtained in step (a) is obtained in step (b). The process which shows that a food allergen is contained in this food-drinks or food-drinks raw materials, when it is below the Ct value made.
[2] The method according to [1], wherein a food allergen is contained in food or drink or a raw material for food or drink as a protein concentration in an amount of 10 μg / g or more as positive.
[3] Circular DNA or 6 copies derived from a food allergen in the amount of more than 24 copies in step (b), using as a template DNA extracted from a 50 ng amount of food or drink or raw material for food in step (a) The method according to [1] or [2], wherein linear DNAs derived from food allergens in excess of the number are used as templates for real-time PCR, respectively.
[4] In step (b), when the food allergen-derived DNA is circular DNA, the amount is 50 copies or more, or when the food allergen-derived DNA is linear DNA 12.5 [3] The method according to [3], which is used for real-time PCR in an amount of copy number or more.
[5] In the step (c), when the Ct value obtained in the step (a) is less than the Ct value obtained in the step (b), a food allergen is contained in the food or drink or the raw material for food or drink. The method according to any one of [1] to [4], which indicates that
[6] The method according to any one of [1] to [5], wherein the food allergen is one or more food allergens selected from the group consisting of wheat, buckwheat and peanuts.
[7] The food allergen is wheat, and the primer set to be used is the following oligonucleotide (i) or a variant thereof and at least one oligonucleotide or variant thereof selected from (ii) to (iv): Including the method according to [6].
(I) oligonucleotide containing the base sequence shown in SEQ ID NO: 1 (ii) oligonucleotide containing the base sequence shown in SEQ ID NO: 2 (iii) oligonucleotide containing the base sequence shown in SEQ ID NO: 3 (iv) shown in SEQ ID NO: 4 [6] An oligonucleotide containing a base sequence [8] A food allergen is nearby, and a primer set used includes the following oligonucleotide (v) or a variant thereof and (vi) an oligonucleotide or a variant thereof: [6 ]the method of.
(V) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 6 (vi) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 7 [9] The food allergen is peanut, and the primer set used is the following oligo (vii) A nucleotide or a variant thereof, and an oligonucleotide (viii) or a variant thereof, or an oligonucleotide (ix) or a variant thereof (x) and an oligonucleotide or a variant thereof (x): 6].
(Vii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 9, and (viii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 10, or (ix) an oligonucleotide containing the base sequence shown in SEQ ID NO: 22, and (x ) The method according to any one of [1] to [9], wherein the oligonucleotide [10] comprising the nucleotide sequence shown in SEQ ID NO: 23 [10] is used to detect an amplification product by real-time PCR using a fluorescently labeled probe.

[11] A kit for use in a method for determining the presence or absence of a food allergen contained in a food or drink or a raw material for food or drink by a real-time PCR method,
A primer set for detecting a food allergen, and a DNA derived from a food allergen, wherein the DNA is in a circular form containing the target sequence of the primer set and is present in an amount exceeding 24 copies, or the DNA Is a linear form containing the target sequence of the primer set, and is present in an amount exceeding 6 copies.
A kit as described above.
[12] The kit according to [11], further comprising a fluorescently labeled probe for detecting an amplification product by real-time PCR.
[13] The food allergen is wheat, and the primer set includes the following oligonucleotide (i) or a variant thereof and at least one oligonucleotide selected from (ii)-(iv) or a variant thereof: [11] or [12] kit.
(I) oligonucleotide containing the base sequence shown in SEQ ID NO: 1 (ii) oligonucleotide containing the base sequence shown in SEQ ID NO: 2 (iii) oligonucleotide containing the base sequence shown in SEQ ID NO: 3 (iv) shown in SEQ ID NO: 4 Oligonucleotide comprising a base sequence [14] The kit according to [13], further comprising a fluorescently labeled probe comprising the oligonucleotide comprising the base sequence shown in SEQ ID NO: 5 or a variant thereof.
[15] The kit according to [13] or [14], wherein the food allergen-derived DNA comprises DNA consisting of the nucleotide sequence of SEQ ID NO: 19 or a variant thereof.
[16] The kit of [11] or [12], wherein the food allergen is nearby, and the primer set comprises the following oligonucleotide (v) or a variant thereof, and (vi) an oligonucleotide or a variant thereof:
(V) an oligonucleotide containing the base sequence shown in SEQ ID NO: 6 (vi) an oligonucleotide containing the base sequence shown in SEQ ID NO: 7 [17] and further fluorescently labeled containing an oligonucleotide containing the base sequence shown in SEQ ID NO: 8 The kit according to [16], comprising a probe or a variant thereof.
[18] The kit according to [16] or [17], wherein the food allergen-derived DNA comprises DNA consisting of the nucleotide sequence of SEQ ID NO: 20 or a variant thereof.
[19] The food allergen is peanut, and the primer set to be used includes the following oligonucleotide (vii) or a variant thereof, and (viii) an oligonucleotide or a variant thereof, or the following (ix) The kit according to [11] or [12], comprising the oligonucleotide or variant thereof and the oligonucleotide (x) or variant thereof.
(Vii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 9, and (viii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 10, or (ix) an oligonucleotide containing the base sequence shown in SEQ ID NO: 22, and (x ) Oligonucleotide comprising the base sequence shown in SEQ ID NO: 23 [20] and further comprising a fluorescently labeled probe containing the oligonucleotide consisting of the base sequence shown in SEQ ID NO: 11 or a variant thereof, or the base sequence shown in SEQ ID NO: 24 [19] The kit according to [19], comprising a fluorescently labeled probe containing an oligonucleotide or a variant thereof.
[21] The kit of [19] or [20], wherein the food allergen-derived DNA comprises DNA consisting of the nucleotide sequence of SEQ ID NO: 21 or a variant thereof, or DNA consisting of the nucleotide sequence of SEQ ID NO: 25 or a variant thereof. .
[22] The food allergen-derived DNA is contained in a circular form in an amount of 50 copies or more, or the food allergen-derived DNA in a linear form is 12.5 copies or more The kit according to any one of [11] to [21], which is contained in the amount of

  According to the present invention, there is provided a real-time PCR method capable of accurately determining positive / negative for food allergens in foods and drinks without specifying the model of the real-time PCR apparatus and without preparing a calibration curve. The inspection method used can be provided.

FIG. 1 shows the analysis results of the degree of DNA degradation using canned food boiled in clams. FIG. 2 shows the analysis results of the amount of DNA extracted and the degree of DNA degradation of commercially available processed foods. The X axis indicates the amount of extracted DNA, and the Y axis indicates the length of the DNA fragment. FIG. 3 shows the analysis results of the amount of DNA extracted and the degree of DNA degradation of the clam boiled model processed food and the commercially available clam boiled processed food.

This invention relates to the method of determining the presence or absence of the food allergen contained in food-drinks or food-drinks raw materials, and the said method includes the following process (a)-(c):
(A) A step of obtaining a Ct value of an amplified signal by performing real-time PCR using a DNA extracted from a food or drink or a raw material for food or drink as a template and using a primer set for detecting food allergens;
(B) a step of performing real-time PCR under the same conditions as in step (a) using DNA derived from the food allergen as a template to obtain a Ct value of an amplified signal, the DNA comprising the target sequence of the primer set; And the process used for real-time PCR by the specific quantity (copy number) which can be determined based on the usage-amount (ng) of DNA extracted from the food / beverage products or food-drinks raw materials in process (a);
(C) A step of comparing the Ct value obtained in step (a) with the Ct value obtained in step (b), wherein the Ct value obtained in step (a) is obtained in step (b). The process which shows that a food allergen is contained in this food-drinks or food-drinks raw materials, when it is below or less than Ct value made.

  In the present invention, "food allergen" means shrimp, crab, wheat, buckwheat, egg, milk, peanut, abalone, squid, squid, orange, cashew nut, kiwi fruit, beef, walnut, sesame, salmon, mackerel, soybean, Examples include chicken, banana, pork, matsutake, peach, yam, apple, gelatin, etc., but preferably shrimp, crab, wheat, buckwheat, peanut, and soybean, particularly preferably prone to severe anaphylactic shock. Wheat, buckwheat, or peanut.

  According to the present invention, a food allergen that is contained in a food or drink or a raw material for food or drink in an amount of 10 μg / g or more as a protein concentration can be easily and quickly determined as positive using a real-time PCR method. . The results obtained in the present invention can be used for confirming the correctness of allergy indications and for determining whether or not to display allergy indications.

  “Food / beverage or food / beverage raw material” means a food / beverage that contains or may contain a food allergen, raw materials thereof, and food / beverage raw materials that are in the process of processing.

  Extraction of DNA from a food or drink or a raw material for food or drink may use any method known to those skilled in the art as a nucleic acid extraction method, such as phenol / chloroform method, cell lysis with a surfactant or cell lysis with a protease enzyme, It can be performed using a physical destruction method using glass beads, a treatment method in which freeze-thaw is repeated, and a combination thereof. Further, various DNA extraction kits such as commercially available DNeasy Plant mini Kit, Genomic-tip 20 / G, DNeasy Mericon Food Kit (all of which are QIAGEN) may be used.

  The concentration and purity of the extracted DNA can be evaluated by measuring absorbance at wavelengths of 230, 260, and 280 nm using a spectrophotometer. That is, the concentration of the extracted DNA can be calculated using the following formula (1).

  In addition, the degree of DNA purification is preferably such that the 260/230 nm absorbance ratio is 2.0 or more and the 260/280 nm absorbance ratio is 1.8 to 2.0 so that the PCR reaction can be performed satisfactorily.

  Further, the extracted DNA may be subjected to a PCR reaction using a primer set for an endogenous gene shared by plants or animals to confirm that an amplification product is obtained.

  The extracted DNA should be adjusted to about 20 ng / μL based on the DNA preparation method described in “Regarding the method for testing foods containing allergic substances” provided by the Consumer Affairs Agency (Non-Patent Document 2 above). Can do. The extracted DNA can be used as template DNA in an amount of 5 to 500 ng. Preferably, the extracted DNA is used as a template DNA in an amount of 50 ng (this amount is described in “Regarding the method for testing foods containing allergens” provided by the Consumer Affairs Agency (Non-patent Document 2)). Specified amount).

In the present invention, DNA amplified by the PCR reaction can be detected and quantified using a fluorescent compound or a fluorescent substance-labeled probe based on a conventional method. As the “fluorescent compound”, SYBR (registered trademark) Green I or the like can be used, and these are added to the PCR reaction system as an intercalator to bind to the amplified DNA. By irradiating this with excitation light, fluorescence is emitted, and by measuring the fluorescence intensity, the amount of PCR amplification product generated can be measured. On the other hand, a “probe labeled with a fluorescent substance” (hereinafter sometimes simply referred to as “probe”) is a nucleic acid probe capable of specifically hybridizing to a target sequence in amplified DNA. is there. As an example, when added to a PCR reaction system, it specifically hybridizes to the target sequence in the DNA amplified in the annealing step, and in the subsequent extension reaction step, due to the 5 ′ → 3 ′ exonuclease activity of Taq DNA polymerase. There is a probe that emits fluorescence when the probe hybridized to the template is decomposed and the fluorescent substance is released from the probe. By measuring the fluorescence intensity, the amount of PCR amplification product produced can be measured, and such a probe is also called a TaqMan probe.
In the present invention, the amplified DNA is preferably detected and quantified using a probe.

  “Primer set for food allergen detection” can specifically or selectively bind (hybridize) to a target sequence on food allergen-derived DNA and amplify a DNA fragment having the target sequence by real-time PCR reaction. If there is no particular limitation.

  The “food allergen-derived DNA” may be DNA (genomic DNA or the like) or a part thereof that is an indicator of the presence of food allergens, and may be derived from a region encoding a specific protein. It may be derived from a spacer region (ITS sequence or the like). The base sequence of such DNA is known, for example, disclosed in a known database such as GenBank, and primers and probes can be designed based on such gene information. For example, the ITS sequence of wheat is registered as AF 438186 in GenBank, the ITS sequence of buckwheat is registered as AB000331 in GenBank, and the ITS sequence of peanut is registered as FJ21319 in GenBank. Can utilize such sequence information.

Primers can be designed based on the base sequence of food allergen-derived DNA, and can be designed to have one or more of the following characteristics.
The size of the amplified product by PCR is 80 to 300 bp, more typically 80 to 150 bp.
・ The size of each primer should be about 17-25 bases.
-The GC content of each primer shall be 40-60%, and shall not be partially GC rich or AT rich.
Each primer has a similar Tm value.
・ Design to sequences that are specific / relatively specific to the target gene. The specificity of the sequence can be confirmed using NCBI BLAST search or the like.
・ There is no complementary sequence of 3 bases or more inside or between primers.
• Avoid primers with a T at the 3 'end.
• Avoid primers with G at the 3 'end.

In addition, the probe used when detecting and quantifying the amplified DNA can be designed based on the base sequence of DNA derived from food allergens, and should be designed to have one or more of the following characteristics: Can do.
・ The probe size should be about 10-30 bases.
-The GC content of the probe is 20 to 80%, and there is no continuation of 4 bases or more in the sequence.
-It has a Tm value higher than the primer (for example, about 8 to 10 ° C higher).
Design to a sequence that is specific / relatively specific to the target sequence. The specificity of the sequence can be confirmed using NCBI BLAST search or the like.
-The 5 ′ end is labeled with a fluorescent substance (for example, 6-FAM ^™ , TET ^™ , VIC ^™ , HEX ^™ , NED ^™ , PET, etc.).
-The 3 ′ end is labeled with a quencher (quencher) (for example, TAMRA, ROX, etc.).

  Primers and probes may be designed using known primer / probe design software. Examples of such software include OLIGO Primer Analysis Software (Molecular Biology Insights), Beacon Designer (PREMIER Biosoft), Primer Express software (Life Technologies).

  Oligonucleotides to be used as primers or probes can be synthesized by a method known in the art as a method for synthesizing oligonucleotides, for example, a phosphotriethyl method, a phosphodiester method, etc., using a commonly used automatic DNA synthesizer. it can.

  In the present invention, a known primer set and probe capable of amplifying / detecting food allergen-derived DNA can be used as the primer set and probe (for example, Japanese Patent Application Laid-Open No. 2013-188164, Japanese Patent No. 4399417). Gazette, Japanese Patent No. 4658816).

  In the present invention, as specifically shown in the Examples below, the following primer sets and probes can be used for detection of each food allergen.

When the food allergen is wheat, the primer set can use the following oligonucleotide (i) and at least one oligonucleotide selected from (ii)-(iv):
(I) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 1, or consisting of the base sequence (ii) containing a base sequence shown in SEQ ID NO: 2, or an oligonucleotide consisting of the base sequence (iii) shown in SEQ ID NO: 3 An oligonucleotide comprising the base sequence or comprising the base sequence (iv) comprising the base sequence shown in SEQ ID NO: 4, or an oligonucleotide comprising the base sequence,
As the probe, a probe containing the base sequence shown in SEQ ID NO: 5 or an oligonucleotide comprising the base sequence can be used.

When the food allergen is buckwheat, the primer set comprises the following oligonucleotides (v) and (vi):
(V) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 6 or consisting of the base sequence (vi) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 7 or consisting of the base sequence,
A probe containing the base sequence shown in SEQ ID NO: 8 or an oligonucleotide comprising the base sequence can be used.

When the food allergen is peanut, the primer set comprises the following (vii) oligonucleotide and (viii) oligonucleotide:
(Vii) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 9 or consisting of the base sequence (viii) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 10 or consisting of the base sequence,
A probe containing the base sequence shown in SEQ ID NO: 11 or an oligonucleotide comprising the base sequence can be used.
Alternatively, if the food allergen is peanut, the primer set comprises the following (ix) oligonucleotides and (x) oligonucleotides:
(Ix) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 22 or consisting of the base sequence (x) an oligonucleotide comprising the base sequence shown in SEQ ID NO: 23 or consisting of the base sequence,
As the probe, a probe containing the base sequence shown in SEQ ID NO: 24 or an oligonucleotide comprising the base sequence can be used.

  Further, in the present invention, it has a base sequence that binds (hybridizes) under stringent conditions to a base sequence complementary to the base sequences shown in SEQ ID NOs: 1 to 11 and 22 to 24, and is also a primer. Alternatively, an oligonucleotide having a function as a probe can also be used as the primer and the probe. Here, the “stringent conditions” refer to the same conditions as the PCR reaction using the primers and probes having the nucleotide sequences shown in SEQ ID NOs: 1 to 11 and 22 to 24, particularly the same conditions as the annealing step. In the present specification, such primers or probes may be described as “mutants” of primers and probes having the nucleotide sequences shown in SEQ ID NOs: 1 to 11 and 22 to 24, but are not particularly described. As long as the primers and probes having the nucleotide sequences shown in SEQ ID NOs: 1 to 11 and 22 to 24 are included, the “mutants” are also included. Such mutants include oligonucleotides consisting of base sequences having additions, substitutions, deletions or insertions of several bases in the base sequences shown in SEQ ID NOs: 1 to 11 and 22 to 24 (here, “several bases”). Means within 4 bases, within 3 bases, or within 2 bases), the base sequences shown in SEQ ID NOs: 1-11 and 22-24, BLAST and the like (for example, default or initial setting parameters) ) May be included, such as an oligonucleotide having a base sequence having an identity of 80% or more, more preferably 90% or more, and most preferably 95% or more.

  In step (a), a real-time PCR reaction is performed using the extracted DNA as a template and the primer set to obtain a Ct value of the amplified signal. Real-time PCR reaction can be performed according to a conventional method, PCR conditions (temperature and length of each step of denaturation, annealing, and extension), composition of reaction solution (dNTP concentration, primer concentration, probe or SYBR (registered trademark)) The concentration of Green I and the like, the type and concentration of DNA polymerase, the concentration of magnesium chloride, etc.) are not particularly limited as long as the specificity and sensitivity necessary for detection of DNA derived from food allergens can be ensured. The apparatus for performing the real-time PCR reaction is not particularly limited, and various models capable of performing a real-time PCR reaction such as ABI PRISM 7900HT (Life Technologies), LightCycler Nano (Roche Diagnostics) can be used. There is no limitation.

  “Ct value” means the number of cycles at which an amplification curve and a threshold (Threshold) cross in real-time PCR, and the number of cycles when the amount of fluorescence derived from the generation of a PCR amplification product reaches a certain amount (threshold). Represents. The smaller the amount of target DNA initially contained in the sample, the smaller. Conversely, the smaller the amount of target DNA contained in the sample, the larger the amount.

  The Ct value can be obtained by using analysis software attached to an apparatus for performing a real-time PCR reaction under default analysis conditions. If it is necessary to manually set the threshold, any known method for testing unappropriated safety-reviewed recombinant DNA technology-applied foods (November 16, 2012 Food Safety 1116 No. 4) The relative fluorescence amount can be specified. In models such as LightCycler Nano, the number of cycles when the amount of fluorescence resulting from the generation of PCR amplification products fluctuates more than a certain standard is called the “Cq value”. May be.

  In the present invention, the “Ct value” is a Ct value of an amplified signal obtained using a primer set for detecting food allergens in real-time PCR.

  In step (b), a real-time PCR reaction is performed under the same conditions as described above except that the DNA derived from the food allergen is used as a template instead of the extracted DNA to obtain a Ct value. Step (a) and step (b) may be in the order of step (a) and then step (b), may be in the order of step (b) and then step (a), or Step (a) and step (b) may be performed simultaneously. Preferably, step (a) and step (b) are performed simultaneously.

  As the “food allergen-derived DNA” used as a template in step (b), those defined above can be used as long as they can contain the target sequence to which the primer or probe is bound. The size is not particularly limited, and it may be composed of a target sequence of a primer set and a region sandwiched between them, or an arbitrary sequence may be added to both ends thereof.

  In addition, the “food allergen-derived DNA” refers to a target sequence in DNA extracted from a food allergen in real-time PCR performed under the same conditions, so that the primer or probe can bind under stringent conditions. As long as a Ct value equivalent to that obtained using the same DNA sequence is obtained, the base sequence of the target sequence of the primer set and the region between them (ie, the region amplified by the PCR reaction) is the original base sequence (for example, Or a sequence registered in a known database such as GenBank) may have addition, substitution, deletion or insertion of 10 or less, 5 or less, 3 or less bases. Furthermore, the “food allergen-derived DNA” includes the target sequence of the primer set and the region between them (that is, the region amplified by the PCR reaction) as long as the primer or probe can bind under stringent conditions. ) When calculated using the original base sequence (for example, a sequence registered in a known database such as GenBank) and BLAST (for example, default or default parameters), More preferably 90% or more, most preferably 95% or more identity. In the present specification, “food allergen-derived DNA” having a base sequence different from these original base sequences (for example, sequences registered in known databases such as GenBank) is referred to as “mutation” of the DNA. Although it may be described as “body”, unless otherwise specified, “DNA derived from food allergen” includes the “variant”.

  In the present invention, the “food allergen-derived DNA” is used as a positive control. In the present specification, the “food allergen-derived DNA” is sometimes referred to as “positive control”, but these terms are used interchangeably.

  The food allergen-derived DNA should give an amplification product and a fluorescent signal when the reaction is performed under the same conditions as the real-time PCR reaction in step (a), as in the case of using the extracted DNA as a template. That's fine. The base sequence of the amplification product obtained in the step (a) may be different from the base sequence of the amplification product obtained in the step (b), and both are different based on addition, substitution, deletion or insertion of several bases. You may have. Here, “several bases” means within 10 bases, within 8 bases, within 6 bases, within 4 bases, within 3 bases, or within 2 bases.

When the food allergen is wheat, as the “food allergen-derived DNA”, DNA comprising the following base sequences, DNA comprising the following base sequences, or variants thereof can be used.
5′-CATGGTGGGCGTCTCCGCGTTTACAATGCAGTGCATCCGGCGCGCAGCTGGGCATTAGGCCCTTT-3 ′ (SEQ ID NO: 19)

When the food allergen is buckwheat, as the “food allergen-derived DNA”, DNA comprising the following base sequences, DNA comprising the following base sequences, or variants thereof can be used.
5'-CGCCAAGGACCACGAACAGAAAGCGCGTCCCGAGCCTCCCGGTCCCCGGGCGGCACGGGCGGCGTCCGTCTGTTTCTACGAAACAGAACGAACTCTCGGCAACG-3 '(SEQ ID NO: 20)

When the food allergen is peanut, as the “food allergen-derived DNA”, DNA comprising the base sequence shown in SEQ ID NO: 21 or 25 below, DNA consisting of the following base sequence, or a variant thereof is used. can do.
5′-CAAAACCCCGGCGCGGAAAGCGCCAAGGAAGCCAAACGTTTCTGCTCTCCCCGCCGCGCTCCGAGACGGGCATCCGGTCGGGGCGAC-3 ′ (SEQ ID NO: 21);
5′-TTGGTTCAAAGAGACGGGCCTCTTGGTGGGGAGCGGCACCGCCGCAGATGTGGGTCGAGAACAACCCTCGTG-3 ′ (SEQ ID NO: 25)

  Preferably, the “food allergen-derived DNA” has an original base sequence (for example, a sequence registered in a known database such as GenBank) in a region different from the target sequence to which the primer or probe binds. It is substituted with a base different from the base. By using this substitution as an index, it can be determined whether or not the amplification product obtained by the PCR reaction is obtained using the “food allergen-derived DNA” as a template. Such substitution (mutation) can be carried out at a predetermined position of the cloned food allergen-derived DNA by performing PCR using a cloning primer having a mutation introduced at a predetermined position. Alternatively, mutations can be introduced at predetermined positions by DNA synthesis.

  “DNA derived from food allergens” can be prepared by performing a PCR reaction using a primer set containing a target sequence, using DNA obtained by extraction from food allergens as a template, and cloning. Alternatively, “food allergen-derived DNA” may be a single-stranded DNA synthesizer or a double strand that is commonly used by methods known in the art as oligonucleotide synthesis methods, such as the phosphotriethyl method, phosphodiester method, etc. It can be synthesized using a strand DNA (artificial gene) synthesizer.

  The “food allergen-derived DNA” may be in a linear form or a circular form. For example, “food allergen-derived DNA” can be in a circular form inserted into a plasmid or vector, or a linear form that is then cleaved with a restriction enzyme or the like. Thereby, the stability of DNA derived from food allergens can be increased, and the plasmid or vector can be produced in the host organism by transforming the host organism with the plasmid or vector. is there. Plasmids or vectors containing “food allergen-derived DNA” can be performed using general molecular biology techniques known to those skilled in the art (Sambrook J. et al., “Molecular Cloning A LABORATORY MANUAL / fourth edition”). ", Cold Spring Harbor Laboratory Press (2012)).

  The “DNA derived from food allergens” may be in the form of separate DNA for each DNA derived from individual food allergens, or may be in the form of one DNA by linking DNAs derived from multiple types of food allergens. Individual DNAs or one linked DNA may have a form inserted into a plasmid or vector. When DNAs derived from multiple types of food allergens are linked, each DNA may be linked directly or indirectly via one or more bases.

  The usage amount of “DNA derived from food allergen” used for the determination criteria can be determined based on the usage amount (ng) of DNA extracted from the food or drink or the raw material for food and drink in step (a). That is, when “DNA derived from food allergen” is in a circular form, the amount of DNA extracted from the food or drink or raw material for food in step (a) (ng): DNA derived from food allergen in step (b) The ratio of the amount used (copy number) is more than 50 (ng): 24 copy number, preferably 25 copies or more, 50 copies or more, or 100 copies or more of the DNA. Can be used in any amount. For example, when the amount of DNA extracted from the food or drink or the raw material of the food in step (a) is 50 ng, the DNA derived from the food allergen in step (b) is used as a template DNA in an amount exceeding 24 copies. Preferably, the DNA is used in an amount of 25 copies or more, 50 copies or more, or 100 copies or more. When the DNA is used in 24 copies or less, in addition to the large variation in Ct value, it is difficult to clearly distinguish the fluorescent signal due to environmentally derived contamination. The presence or absence of food allergens contained in can not be determined correctly. Although the upper limit of the number of copies is not particularly limited, in order to prevent false negatives when food or food or food ingredients contain a food allergen exceeding a trace amount, for example, 1000 copies or less, 500 copies or less, or 300 It can be below the copy. On the other hand, when the “food allergen-derived DNA” is in a linear form, the amount used can be ¼ of the amount used in the circular form (copy number). That is, when “DNA derived from food allergen” is in a linear form, the amount of DNA extracted from the food or drink in the step (a) or the raw material of food or drink (ng): derived from the food allergen in step (b) The ratio of the amount of DNA used (copy number) is more than 50 (ng): 6 copies, preferably 6.25 copies or more, 12.5 copies or more, or 25 copies of the DNA. Or it can use in the quantity used as the quantity beyond it. For example, when the amount of DNA extracted from the food or drink or the raw material for the food in step (a) is 50 ng, the DNA derived from the food allergen in step (b) is used as template DNA in an amount exceeding 6 copies. Preferably, the DNA can be used in an amount of 6.25 copies or more, 12.5 copies or more, or 25 copies or more. Further, the upper limit can be, for example, 250 copies or less, 125 copies or less, or 75 copies or less. In addition, the Ct value obtained from the amount used (copy number) of 1 amount of “DNA derived from food allergen” which is a linear form in the step (b) is “DNA derived from food allergen” which is a circular form. It is confirmed that the Ct value obtained from the ¼ usage amount (copy number) ¼ amount is almost the same.

式中、「Ａ_２６０値」は分光光度計によって得られた波長２６０ｎｍにおける吸光値、「Ｌ」はＤＮＡ（あるいは当該ＤＮＡを含むプラスミド又はベクター）のサイズ（ｂｐ）、「Ｖ」は溶液量（μＬ）を示す。 The copy number of the DNA can be calculated from the following formula (2).

In the formula, “A ₂₆₀ value” is an absorption value at a wavelength of 260 nm obtained by a spectrophotometer, “L” is the size (bp) of DNA (or a plasmid or vector containing the DNA), and “V” is the amount of solution ( μL).

The copy number of the DNA can also be measured using Digital PCR. The advantages of using Digital PCR are the following two points:
1. It is possible to measure only the number of copies of a target sequence that can be amplified by PCR because it does not measure contaminating DNA other than the target sequence that cannot be distinguished by absorbance measurement, or degraded DNA of the target sequence;
2. It can be measured with a lower copy number than absorbance measurement.
Therefore, the difference in measurement principle and 1. From the advantages described in 1., the absorbance measurement and the digital PCR measurement can be calculated as different copy numbers even for the same sample.
In addition, 2. Can be quantified at a concentration (for example, 200-2000 copies / μL) close to the copy number of the DNA derived from the food allergen as a criterion, and variation due to dilution after concentration measurement can be suppressed.

  As described in detail in the Examples below, this copy number is 10 μg / g protein equivalent as a protein concentration in the preparation of processed foods that are difficult to perform qualitative real-time PCR testing of food allergens (test methods require high sensitivity). It is set based on the amount of DNA derived from food allergens extracted from food allergen-containing model processed foods produced by adding food allergens.

  That is, the Ct value of an amplification signal obtained using a primer set for detecting food allergens using DNA extracted from a model processed food containing a food allergen equivalent to 10 μg / g as a protein concentration as a template DNA, a certain amount of template DNA. The amount (copy number) of the food allergen-derived DNA is set so as to be equal to or less than the Ct value obtained in place of the food allergen-derived DNA (positive control). The copy number of the food allergen-derived DNA (positive control) should be as large as possible so as to give a Ct value with less variation and to avoid falsely positive fluorescent signals due to contamination from the test environment. Is desirable.

  The “Ct value or lower” means that the Ct value of the amplification signal obtained using the DNA extracted from the model processed food as a template DNA and using a primer set for detecting food allergens is obtained by replacing the template DNA with a positive control. The Ct value of the amplified signal to be obtained. Specifically, the copy number in the DNA extracted from the model processed food is estimated from a calibration curve obtained by a positive control of multiple concentrations with known copy numbers, and positive so that the copy number is less than the estimated copy number. Just set the controls.

  More preferably, the Ct value of the amplification signal obtained using the DNA extracted from the model processed food as a template DNA and using a primer set for detecting food allergens is the Ct value of the amplification signal obtained by replacing the template DNA with a positive control. It is statistically determined that the Ct value of the amplified signal obtained using the DNA extracted from the model processed food as the template DNA is significantly smaller than the Ct value of the amplified signal obtained from the positive control. A positive control concentration may be set as described above. Note that “significantly smaller” means that the following formula (3) is established from the average value and standard deviation of the Ct values of the respective samples.

In the formula, X ₁ and σ ₁ are the average Ct value and standard deviation of the model processed food extracted DNA, respectively, and X ₂ and σ ₂ are the average Ct value and standard deviation of the positive control, respectively.

  Further, an average value measured at several points may be used, which means that the following formula (4) is established.

式中、標準偏差はσ_１／√Ｎ_１及びσ_２／√Ｎ_２で表わされ、Ｎ_１及びＮ_２はそれぞれモデル加工食品抽出ＤＮＡ及びポジティブコントロールの測定数である。

In the formula, the standard deviation is expressed by σ ₁ / √N ₁ and σ ₂ / √N ₂ , where N ₁ and N ₂ are the measured numbers of the model processed food extracted DNA and the positive control, respectively.

  Further, the probability f (z) that the expression (4) is established can be obtained from the following expression (5), and the probability only needs to be a probability required by the test method.

  DNA extracted from the food or drink or raw materials for food and drink, and a positive control at a predetermined copy number, respectively, as template DNA, and using the same PCR conditions and reaction solution composition, real-time PCR reaction, Obtain a Ct value for each. Next, the obtained Ct values are compared, and the Ct value obtained using the DNA extracted from the food or drink or the raw material of the food as the template DNA is less than or equal to the Ct value obtained using the DNA derived from the food allergen (positive control) as the template DNA. Or, if it is less, DNA derived from food allergens is contained in the DNA sample extracted from the food or drink or raw materials for food or drink at a copy number that is greater than or equal to the copy number of the positive control or greater than the copy number of the positive control. Indicates. Thereby, what contains the food allergen of 10 micrograms / g or more as protein concentration in the said food-drinks or food-drinks raw material can be determined as positive.

  The present invention also relates to a kit used in a method for determining the presence or absence of a food allergen contained in a food or drink or a raw material for food or drink by a real-time PCR method, the kit comprising a primer set for detecting a food allergen and food as a positive control Contains allergen-derived DNA.

  Examples of the primer set for detecting food allergens include the above primer sets, and one or more of them can be included in combination. Each primer or each primer set can be stored in a separate container. Each primer or each primer set may be accommodated in a container for each use amount, or a plurality of doses may be accommodated in one container (the user needs to use one time) Quantity can be taken out and used). Each primer or each primer set may be contained in a container in a dry form, or may be contained in a container in a form dissolved in an appropriate solvent.

  Examples of the food allergen-derived DNA (positive control) include the above-mentioned food allergen-derived DNA, and one or more of them can be included in combination. Each food allergen DNA can be contained in a separate container. DNA derived from food allergens is used in a single use (ie, more than 24 copies if in circular form, preferably 25 copies or more, 50 copies or more, or 100 copies or more, In linear form, more than 6 copies, preferably 6.25 copies or more, 12.5 copies or more, or 25 copies or more) Or the quantity for multiple times may be accommodated in one container (the user can take out and use the quantity required for one use). DNA derived from food allergens may be contained in a container in a dry form, or may be contained in a container in a form dissolved in a suitable solvent.

  The kit of the present invention further comprises a fluorescently labeled probe for detecting the amplification product by real-time PCR. Examples of the probe include the probes described above, and one or more of them can be included in combination. Each probe can be contained in a separate container. The probe may be accommodated in a container for each use amount, or a plurality of doses may be accommodated in one container (the user takes out and uses the amount necessary for one use) be able to). The probe may be accommodated in the container in a dry form, or may be accommodated in the container in a form dissolved in an appropriate solvent.

  The kit of the present invention may further comprise one or more elements selected from dNTP mix, SYBR® Green I, magnesium chloride, and instructions for use.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail using an Example, the technical scope of this invention is not limited to a following example.

Example 1: Selection of processed foods that are difficult to perform real-time PCR inspection 1) Analysis of DNA extraction amount and degree of DNA degradation As indices for selecting processed foods that are difficult to perform real-time PCR inspection, (1) DNA extraction amount and (2) DNA decomposition degree Can be used. Processed foods contain different raw materials, and the amount of DNA extracted from 1 g (or unit weight) differs for each food. Therefore, even if the food contains the same amount of allergen, the greater the amount of extracted DNA, the higher the dilution rate, so the DNA concentration of the food allergen contained in the template DNA sample solution adjusted to 20 ng / μL. Becomes lower. Therefore, it can be said that foods that are extracted more are more difficult to test. Moreover, in many processed foods, DNA is decomposed shortly due to the pH of the food itself, heating due to processing, and the like, and the degree thereof is different. Therefore, even if the food contains the same amount of allergen, the more the degradation of the extracted DNA proceeds, the smaller the residual amount of DNA molecules containing the target sequence derived from the food allergen DNA. Therefore, it can be said that the shorter the DNA fragmented, the more difficult the real-time PCR test is.
For various types of processed foods on the market, the amount of extracted DNA and the degree of DNA degradation were determined by the following methods.

<Calculation of DNA extraction amount>
DNA extraction was performed by the following method using Genomic-tip 20 / G manufactured by QIAGEN.
About 2 g of the finely pulverized sample was placed in a 50 mL tube, 7.5 mL Buffer G2, 20 μL RNase A (100 mg / mL) and 200 μL proteinase K solution were added and mixed, and then incubated at 50 ° C. for 2 hours. The aqueous layer was recovered by centrifugation, and subjected to Genomic-tip 20 / G equilibrated with 1 mL of Buffer QBT in advance to adsorb the DNA onto the column. Thereafter, the column was washed with 6 mL of Buffer QC, DNA was eluted with 1 mL of Buffer QC, and the precipitate was collected by isopropanol precipitation. After dissolving in TE buffer (pH 8.0), the absorbance at 260 nm was measured to determine the DNA concentration, and the amount of DNA (μg) extracted from 2 g of food was calculated.

<Analysis of DNA degradation degree>
The DNA sample extracted by the above method was appropriately diluted with TE buffer (pH 8.0) so that the DNA concentration became 20 ng / μL. These DNA samples were loaded on a DNA analysis microchip electrophoresis apparatus MultiNA (Shimadzu Corporation), and each DNA was separated based on the DNA fragment length. The maximum value of fluorescence intensity obtained by using a compound that intercalates into a DNA double helix, and the DNA fragment length (bp) corresponding to the maximum value were determined. An analysis example is shown in FIG. The DNA fragment length corresponding to the maximum value becomes shorter as the DNA degradation becomes more severe.

2) Evaluation of commercially available processed foods The amount of extracted DNA and DNA fragment length of 38 commercially available processed foods were analyzed by the above method (Table 1).

Processed foods were evaluated using a graph with the extracted DNA amount on the X axis and the DNA fragment length on the Y axis, and processed foods that were difficult to inspect were selected. From the results of each processed food analyzed (FIG. 2), the clam boiled (canned food) plotted at the bottom right of the graph was found as a processed food difficult to inspect. Sterilization conditions of clams boiled is, F ₀ value of about 35 at 120 ℃ as a response to blackening risk (Japan canning Association issued a "can-Bintsume, retort food and beverage manufacturing lecture II (particulars)" edited by 2002 5 20th), which is very strict compared with the F ₀ value of about 5 to 8 which is regarded as a sterilization condition for general seafood canned foods. For this reason, the canned food boiled in clam water is considered to be a processed food that is more difficult to be subjected to real-time PCR testing because its DNA degradation is advanced compared to other foods.

Example 2: Preparation of a model processed food containing food allergens As long as the PCR method has a sensitivity capable of detecting food allergens contained in processed foods that are selected as those for which real-time PCR testing is difficult, most other processed foods It is thought that the food allergen contained can also be detected. Therefore, the “model processed food containing a certain amount of food allergen” prepared by simulating boiled clams selected above can be used for setting a positive / negative determination criterion described later.

  According to the Consumer Affairs Agency's “Handbook for Displaying Processed Foods Containing Allergic Substances (for Businesses)”, 7 items (specific raw materials) with high severity and number of cases among food allergens must be indicated by a ministerial ordinance. When the total protein content of the food allergen contained in the food or drink or the raw material of the food or drink is contained in a certain amount or more, a display is required. In addition, the food allergen positive in the screening test means that the protein content of food allergen per 1 g of food collected weight is 10 μg or more. Asari boiled boiled fish selected as a processed food in which real-time PCR testing is difficult in Example 1 is necessary for food allergen testing if it can be positively determined that the food allergen protein concentration contains a specific raw material equivalent to 10 μg / g. It can be said that sufficient sensitivity is secured.

  Therefore, a clam-boiled processed food processed by adding wheat, buckwheat, and peanuts equivalent to a protein concentration of 10 μg / g was prepared as a model processed food containing food allergens (positive model). It was confirmed whether or not it was positively determined.

<Production and addition amount of wheat, buckwheat and peanut powder>
-Wheat As wheat to be added, whole grains of Agricultural Forest No. 61 were used, and wheat powder was prepared according to "About the inspection method of foods containing allergens" provided by the Consumer Affairs Agency. The amount of wheat powder added to the raw material equivalent to 150 g of the clam boiled model processed food was 15.45 mg.

・ Soba Soba to be added was tart or soba. The main types of buckwheat that are eaten in Japan are Sarashina buckwheat, yabu buckwheat, and tartary buckwheat. Although these three kinds of buckwheat flour were extracted by the same operation as in Example 1, the amount of DNA extracted per unit weight was almost the same. However, as a result of comparing the detection sensitivity of real-time PCR, Since the rise of the amplified signal (Ct value) was slow for tartary buckwheat, it was judged to be the most difficult to inspect. Therefore, in accordance with “About the inspection method for foods containing allergic substances” provided by the Consumer Affairs Agency, tartary soba powder was prepared as one of the added samples. Ordinary buckwheat is a raw material of Sarashina buckwheat flour and yabu buckwheat flour, and since it has the largest distribution, ordinary buckwheat flour was also prepared as one of the added samples. The powder amount of tartary buckwheat or normal buckwheat added to the raw material equivalent to 150 g of clam boiled model processed food was 20.16 mg in all cases.

・ Peanuts As peanuts to be added, peanuts produced in Chiba Prefecture were used, and peanut powder was prepared in accordance with the “Regarding methods for testing foods containing allergens” provided by the Consumer Affairs Agency. The amount of peanut powder added to the raw material equivalent to 150 g of the clam boiled model processed food was 6.75 mg.

<Production of model processed foods containing food allergens>
Asari boiled processed foods are based on the “Can, Bottled, Retort Food and Beverage Manufacturing Lecture II” published by the Japan Canning Association, and in the above amounts, wheat, tartary buckwheat or regular buckwheat, peanut powder The model processed food containing allergen was prepared. That is, 40 g of trisodium citrate and 20 g of disodium hydrogen phosphate were weighed into a 2 L beaker, and a solution obtained by stirring and dissolving in 2 L of distilled water was used as a clear osmotic solution (pH 8.8). Into a 500 mL beaker, 3.56 g of sodium chloride, 2.4 g of citric acid, and 2.4 g of trisodium citrate were weighed, and a solution obtained by stirring and dissolving in 400 mL of distilled water was used as a seasoning solution (pH 3.98). Plenty of water was boiled in a small pan, and 500 g of frozen fresh clam was placed and boiled for 3 minutes. The clam weight after hot water cutting was weighed and immersed in a penetrating liquid twice or more the clam weight for 30 minutes or more. In a retort pouch, 100 g of clam obtained by lightly cutting the osmotic solution, 50 g of seasoning, the above-mentioned amounts of wheat, tartary buckwheat or ordinary buckwheat, and peanut powder were placed and sealed. After sterilization at 122 ° C. for 33 minutes (F ₀ value = 35) in a steam retort sterilizer, water cooling was performed for 10 minutes. The contents were taken out from the retort pouch, pulverized and homogenized with a miller, and stored frozen in 2 g portions.
Hereinafter, this is referred to as a clam boiled model processed food (positive model). Separately, a negative model in which wheat, tartary buckwheat or ordinary buckwheat, and peanut powder were not added was also prepared.

Example 3: Evaluation of clam boiled model processed food The following evaluation was performed to confirm that the clam boiled model processed food obtained in Example 2 was appropriately prepared.

<ELISA measurement>
In order to confirm that 10 μg / g of each food allergen protein was contained in the prepared clam boiled model processed food (positive model), ELISA measurement of wheat, buckwheat, and peanut was performed. Any two samples dispensed into the tube were quantified in accordance with the manual using a commercially available ELISA kit (Morinaga FASPEK specific raw material measurement kit, manufactured by Morinaga Bioscience Laboratories) in duplicate.

  As a result, in the model using tartary buckwheat as the buckwheat flour, the wheat total protein concentration was 7.9 μg / g, 8.5 μg / g, the buckwheat total protein concentration was 5.4 μg / g, 5.9 μg / g, and the whole peanut The protein concentration was 7.0 μg / g and 6.2 μg / g, and it was confirmed that each food allergen protein was contained at an approximate level of 10 μg / g. In the model using ordinary buckwheat as the buckwheat flour, the wheat total protein concentration was 9.9 μg / g, 11.2 μg / g, the buckwheat total protein concentration was 8.7 μg / g, 9.5 μg / g, and peanut total protein. Concentrations were 6.8 μg / g and 7.2 μg / g, and even in this model, it was confirmed that each food allergen protein was included in an amount level of approximately 10 μg / g. In addition, since all the food allergens added are trace amounts, it is difficult to add an accurate amount, and the effects on processing and food allergen protein concentration of the matrix in food are considered. Even when a food allergen equivalent to 10 μg / g was added, it was not always 10 μg / g. On the other hand, it was confirmed that the negative model did not contain wheat, buckwheat and peanut proteins.

<Comparison with commercial products>
Commercially available clam boiled cans sold from three food manufacturers and clam boiled model processed foods (wheat, tartary buckwheat, positive model with added peanuts, and negative model) were prepared by the method of Example 1. As a result of analyzing the amount of extracted DNA and the degree of degradation, and plotting it on a graph for evaluating the difficulty of testing processed food (FIG. 3), it was confirmed that the model processed food was plotted at a position close to a commercial product. In addition, it was confirmed that there was no great difference in the weight ratio between the model processed food and the commercially available product, and the pH measured after pulverization (Table 2). From these results, it was judged that the prepared clam boiled model processed food was appropriate as one of the processed foods that are difficult to perform real-time PCR testing, as in the case of commercial products.

<Animal PCR measurement>
DNA was extracted from the prepared clam boiled model processed food, and DNA quality was confirmed by PCR amplification. DNA extraction was performed in the same manner as the DNA extraction method of Example 1. The PCR amplification was confirmed by using the PCR primers for animal detection and the reaction conditions described in the “Method for testing foods containing allergic substances” notified by the Consumer Affairs Agency.

<Qualitative real-time PCR test>
The above-extracted DNA was subjected to real-time PCR inspection for wheat detection, buckwheat detection, and peanut detection (primers and probes shown in SEQ ID NOs: 9, 10, 11 or SEQ ID NOs: 22, 23, 24), and a prepared clam boiled model It was confirmed that Ct values were obtained / not obtained depending on whether wheat, buckwheat, or peanut powder was added to the processed food.

  Real-time PCR was performed by the following method using two types of real-time PCR apparatuses (ABI PRISM 7900HT manufactured by Life Technologies and LightCycler Nano manufactured by Roche Diagnostics) using a QuantTect Probe PCR Kit manufactured by QIAGEN.

  Template DNA was added so as to be 50 ng DNA. In addition, the measurement was performed at two points in parallel at each template DNA concentration.

  ABI PRISM 7900HT manufactured by Life Technologies was used as the PCR device, and a dedicated 96-well PCR plate was used as a container for the PCR reaction solution. The container containing the PCR reaction solution is set in a real-time PCR apparatus, and after 95 ° C. for 15 minutes, the cycle of 95 ° C. for 30 seconds (denaturation) followed by 68 ° C. for 1 minute (annealing and extension step) is 45 The reaction was repeated twice. However, in the case of the primer / probe set of SEQ ID NOS: 22, 23, and 24, the number of cycles was 40. After completion of the reaction, fluorescence data obtained after the extension step was analyzed. The analysis conditions were the default conditions of the analysis software attached to the device.

・ Wheat In qualitative real-time PCR for wheat detection, 12.5 μL of 2 × QuantiTect Probe PCR Master Mix, SEQ ID NO: 1 primer at a final concentration of 0.2 μM, and SEQ ID NO: 2 primer at a final concentration of 0.1 μM The primers of SEQ ID NO: 3 and SEQ ID NO: 4 were each added at a final concentration of 0.05 μM, the TaqMan MGB probe of SEQ ID NO: 5 was added at a final concentration of 0.1 μM, template DNA was added, and finally, 25 μL was added with sterile ultrapure water. did.

<Primers and probes for wheat detection>
SEQ ID NO: 1: 5'-CATGGTGGGCGTCTC-3 '
SEQ ID NO: 5'-AAAGGCCATAATGCCAGCTG-3 '
Sequence number 3: 5'-TGAGGCCCGTCATGCCCGCTG-3 '
SEQ ID NO: 5'-TGAGGCCATAATGTCGCTG-3 '
Sequence number 5: 5'-CGGATGGCACTGCITTGATAAAAG-3 '

・ In qualitative real-time PCR for buckwheat detection, 12.5 μL of 2 × QuantiTect Probe PCR Master Mix, SEQ ID NO: 6 primer at a final concentration of 0.2 μM, and SEQ ID NO: 7 primer at a final concentration of 0.2 μM The TaqMan MGB probe of SEQ ID NO: 8 was added at a final concentration of 0.1 μM, and template DNA was added to a final concentration of 25 μL with sterile ultrapure water.

<Primers and probes for buckwheat detection>
SEQ ID NO: 6: 5'-CGTTGCCCGAGAGTCGTTCTGTTT-3 '
SEQ ID NO: 7: 5′-CGCCAAGGACCACGAACAGAAG-3 ′
SEQ ID NO: 8: 5′-CGGGACGCGCTTC-3 ′

・ Peanuts In qualitative real-time PCR for peanut detection, 12.5 μL of 2 × QuantTect Probe PCR Master Mix, SEQ ID NO: 9 primer is 0.2 μM in final concentration, and SEQ ID NO: 10 primer is 0.2 μM in final concentration. The TaqMan MGB probe of SEQ ID NO: 11 was added at a final concentration of 0.1 μM, and template DNA was added to a final concentration of 25 μL with sterile ultrapure water. Alternatively, in 12.5 μL of 2 × QuantiTect Probe PCR Master Mix, the primer of SEQ ID NO: 22 is 0.2 μM in final concentration, the primer of SEQ ID NO: 23 is 0.2 μM in final concentration, and the TaqMan MGB probe of SEQ ID NO: 24 Was added to a final concentration of 0.1 μM and template DNA was added, and the final concentration was 25 μL with sterile ultrapure water.

<Primers and probes for peanut detection>
SEQ ID NO: 9: 5′-CAAAACCCCGGCGCGGAAA-3 ′
SEQ ID NO: 10: 5′-GTCGCCCCGACCGGATGC-3 ′
SEQ ID NO: 11: 5′-TGCTCTCCCCGCGCGC-3 ′
SEQ ID NO: 22: 5′-TTGGTTCAAAGAGACGGGCTC-3 ′
SEQ ID NO: 23: 5′-CACGAGGGTTGTTCTCGAACC-3 ′
SEQ ID NO: 24: 5′-ACCGCCGCAGATGGG-3 ′

As a result, positive models with wheat, tartary buckwheat or plain buckwheat, and peanut powder added showed a Ct value due to an increase in fluorescence signal, while negative models without wheat, buckwheat and peanut powder increased fluorescence signal. No Ct value was observed.
From the above evaluation results, it was judged that the clam boiled model processed food added with wheat, buckwheat, and peanut powder was appropriately prepared.

Example 4 Production of Positive Control Plasmid A as Positive / Negative Criteria Three Amplifications Including Wheat PCR, Buckwheat PCR, and Peanut PCR (Primers and Probes Shown in SEQ ID NOs: 9, 10, and 11) The products were ligated together by PCR, introduced into a TA cloning vector, and transformed into E. coli. The plasmid was purified from the transformed E. coli and the introduced nucleotide sequence was confirmed.

1) Preparation of amplification products each containing PCR target DNA sequences of wheat, buckwheat, and peanut PCR to obtain an amplification product containing the PCR target DNA sequence of wheat was performed as a primer set on 12.5 μL of 2 × HotStarTaq Master Mix. SEQ ID NO: 1 (wheat forward primer) and SEQ ID NO: 12 (restriction enzyme digestion site + wheat reverse primer) were each 0.2 μM in final concentration, and normal wheat (Triticum aestivum) -derived DNA was used as a template DNA, and finally Set the container containing the PCR reaction solution to 25 μL with sterilized ultrapure water and set it in the PCR device. After 95 ° C for 15 minutes, 94 ° C for 30 seconds (denaturation) followed by 66 ° C for 1 minute (annealing and extension step) ) Was repeated 45 times for the reaction.

  PCR for obtaining an amplification product containing a buckwheat PCR target DNA sequence was carried out using 12.5 μL of 2 × HotStarTaq Master Mix as a primer set of SEQ ID NO: 13 (restriction enzyme digestion site + buckwheat forward primer) and SEQ ID NO: 14 (restriction). Enzyme digestion site + buckwheat reverse primer) each at a final concentration of 0.2 μM, template buckwheat (Fagopyrum esculentum) -derived DNA was used, and finally the container containing the PCR reaction solution was made up to 25 μL with sterile ultrapure water It was set in a PCR apparatus, and after 95 ° C. for 15 minutes, a cycle of 94 ° C. for 30 seconds (denaturation) followed by 66 ° C. for 1 minute (annealing and extension step) was repeated 45 times.

PCR for obtaining an amplification product containing a peanut PCR target DNA sequence was performed in 12.5 μL of 2 × HotStarTaq Master Mix with SEQ ID NO: 15 (including restriction enzyme digestion site + peanut forward primer of SEQ ID NO: 9) as a primer set. And SEQ ID NO: 10 (above peanut reverse primer) each at a final concentration of 0.2 μM, arachis hypogaea-derived DNA as template DNA, and finally 25 μL with sterilized ultrapure water, a container containing the PCR reaction solution Was set in a PCR apparatus, and the reaction was repeated 45 times at 95 ° C. for 15 minutes followed by 94 ° C. for 30 seconds (denaturation) followed by 64 ° C. for 1 minute (annealing and extension step).
The primer sequences newly synthesized and used in this example are described below.

SEQ ID NO: 12: 5′-GGATCCAAAGGCCATAATGCCAGCTGGGG-3 ′
SEQ ID NO: 13: 5′-TCTAGACGCCCAGAGACCACGAACAGAGAG-3 ′
SEQ ID NO: 14: 5′-AAGCTTCGTTGCCGAGAGTCGTTCTGTTTGG-3 ′
SEQ ID NO: 15: 5′-GCTAGCCAAAACCCCGGCGCGGAAAACCGCCAAGGAAGC-3 ′

2) Ligation of wheat, buckwheat, and peanut PCR amplification products The three PCR products obtained above were conjugated to Jayaraman K, et al. (1992. A PCR-Mediated Gene Synthesis Innovating the Oligogenic Strain of Oligontology. : 392-398), and ligated by the following method using HotStarTaq MasterMix Kit manufactured by QIAGEN to produce ligated DNA.

  First, PCR for ligating wheat PCR product and buckwheat PCR product was performed by adding SEQ ID NO: 12 (restriction enzyme digestion) to 12.5 μL of 2 × HotStarTaq Master Mix and dNTP added to a final concentration of 500 μM. Site + wheat reverse primer) and SEQ ID NO: 13 (restriction enzyme digestion site + buckwheat forward primer) are added as final primers at a final concentration of 1 μM respectively, SEQ ID NO: 16 as a bridge primer at a final concentration of 25 nM, and the above-mentioned wheat as template DNA 1 μL of PCR amplification product and 1 μL of the above buckwheat PCR amplification product were added to prepare a reaction solution that was finally made 25 μL with sterile ultrapure water, and PCR was performed in a 0.2 mL microtube. PCR was performed at 95 ° C. for 15 minutes (enzyme activation), 95 ° C., 1 minute (denaturation), 40 ° C., 1 minute (annealing), 72 ° C., 1 minute (extension) using a thermal cycler Veriti manufactured by Life Technologies. ) Was repeated 15 times, and a cycle of 95 ° C., 1 minute (denaturation), 66 ° C., 1 minute (annealing), 72 ° C., 1 minute (extension) was further repeated 30 times for reaction. The obtained PCR reaction solution was electrophoresed and analyzed by MultiNA MCE-202 manufactured by Shimadzu Corporation.

Next, PCR for ligating the wheat PCR product and buckwheat PCR product produced above and peanut PCR product is 12.5 μL of 2 × HotStarTaq Master Mix, and dNTP is further added to a final concentration of 500 μM. In addition to the above, SEQ ID NO: 12 (restriction enzyme digestion site + wheat reverse primer) and SEQ ID NO: 17 (including restriction enzyme digestion site + peanut forward primer of SEQ ID NO: 9) are used as outer primers, each at a final concentration of 1 μM. Add SEQ ID NO: 18 as a bridge primer to a final concentration of 25 nM, and add 1 μL of the amplified product of the wheat PCR product and buckwheat PCR product and 1 μL of the peanut PCR product as template DNA, and finally sterilize. Prepare a reaction solution of 25 μL with ultrapure water and add 0.2 mL PCR was performed in an ichrotube. PCR was performed under the same conditions as the ligation of the wheat PCR product and buckwheat PCR product. The obtained PCR reaction solution was electrophoresed and analyzed by MultiNA MCE-202 manufactured by Shimadzu Corporation.
As a result, the expected PCR amplification product of about 275 bp was obtained (data not shown).
The primer sequences newly synthesized and used in this example are described below.

SEQ ID NO: 16: 5′-ACTCTCGGCACACAGAGTCTCATGGTGGGCGTCTC-3 ′
SEQ ID NO: 17: 5′-GCTAGCCAAAACCCCGGCGCGGAAAC-3 ′
SEQ ID NO: 18: 5′-TCCGGTCGGGGCGCACTCTAGACGCCCAAGGACCACG-3 ′

3) Introduction of ligated PCR product into plasmid and base sequence analysis The ligated PCR product obtained above was TA cloned into pGEM-T Easy Vector using pGEM-T Easy Vector System (manufactured by Promega), and E. coli ( E. coli DH5α). It was confirmed by colony PCR that an insertion fragment of about 277 bp containing the target DNA sequence of wheat, buckwheat and peanut PCR was included. The transformant having the introduced fragment was subjected to liquid culture in LB medium, and the plasmid was extracted and purified from the cells using QIAprep Spin Miniprep Kit manufactured by QIAGEN. The base sequence of the DNA fragment introduced into the purified plasmid was analyzed by double-stranded sequencing using primers of the sequence on the plasmid, and as a result, the DNA fragment introduced into the plasmid of the transformant was analyzed as intended. It was confirmed that the base sequences contained the target DNA sequences of wheat PCR, buckwheat PCR, and peanut PCR (primers and probes shown in SEQ ID NOs: 9, 10, and 11), respectively.

4) Calculation of copy number of positive control plasmid and concentration adjustment The concentration on the basis of the copy number of the plasmid solution is the absorbance “A ₂₆₀ value” at ₂₆₀ nm measured with a spectrophotometer, and the general relationship between absorbance and DNA concentration. It was calculated by the following formula (2 ′) from “DNA concentration 50 ng / μL at absorbance 1 at 260 nm”, plasmid length “3,292 bp”, and average molecular weight of DNA “660 / base pair”. The concentration of the plasmid solution used as a template for the PCR reaction was adjusted using TE Buffer (pH 8.0) containing 20 ng / μL of salmon sperm DNA.

Example 5 Production of Positive Control Plasmid B as Positive / Negative Criteria Sequences Containing Target DNA Sequences of Wheat PCR, Buckwheat PCR, and Peanut PCR (Primers and Probes Shown in SEQ ID NOs: 22, 23, and 24), respectively Were synthesized in series with an artificial gene synthesizer, introduced into a cloning vector, and transformed into E. coli. The plasmid was purified from the transformed E. coli and the introduced nucleotide sequence was confirmed.

1) Preparation of sequences containing PCR target DNA sequences of wheat, buckwheat, and peanuts A circular plasmid containing the following sequences at the SmaI site of pUC19 was prepared by commissioning an artificial gene production service (Fusmac).
SEQ ID NO: 26: 5'-CATGGTGGGCGTCCTCGCTTTATCAATGCAGTGCATCCGGCGCCCAGCTGGCATTATGGCCTTTCGCCAAGGACCACGAACAGAAGCGCGTCCCGAGCCTCCCGGTCCCCGGGCGGCACGGCGGCGTCGCGTCGTTTCTACCAAACAGAACGACTCTCGGCAACGTTGGTTCAAAGAGACGGGCTCTTCGTGGGGAGCGGCACCGCGGCAGATGGTGGTCGAGAACAACCCTCGTG-3 '

  The nucleotide sequence of the DNA fragment introduced into the prepared plasmid was analyzed by double-stranded sequencing using primers of the sequence on the plasmid. As a result, wheat PCR, buckwheat PCR, and peanut PCR (sequence) It was confirmed that the target DNA sequences of the primers and probes indicated by Nos. 22, 23 and 24 were included.

2) Preparation of a linear plasmid by restriction enzyme digestion of the positive control plasmid B It is known that amplification of the sequence incorporated in the plasmid is amplified at a faster cycle number than the linear plasmid. ing. Therefore, a linear plasmid was prepared by restriction enzyme digestion.

  To 20 μL of the positive control plasmid solution obtained above, 1 μL of BamHI 3-20 U / μL (manufactured by Toyobo Life Science Co., Ltd.), 2.45 μL of 10 × H Buffer are added, and finally 24. The reaction was performed at 37 ° C. for 1 hour at 5 μL. The plasmid after the reaction was purified using MinElute Reaction Cleanup Kit (manufactured by QIAGEN).

3) Calculation of copy number based on absorbance of positive control plasmid and concentration adjustment The concentration on the basis of the copy number of the plasmid solution is the absorbance “A ₂₆₀ value” of ₂₆₀ nm measured with a spectrophotometer, the general absorbance and the DNA concentration. The following formula (2 ″) was calculated from the relational expression “DNA concentration 50 ng / μL at absorbance 1 at 260 nm”, plasmid length “2,922 bp”, and average molecular weight of DNA “660 / base pair”. The concentration of the plasmid solution used as a template for the PCR reaction was adjusted using TE Buffer (pH 8.0) containing 20 ng / μL of salmon sperm DNA.

4) Calculation of Copy Number of Positive Control Plasmid B by Digital PCR The PCR reaction solution is a primer of SEQ ID NO: 6 for detecting buckwheat in 15 μL of QuantStudio ^™ 3D Digital PCR Master Mix, 2X (manufactured by Life Technologies Japan). At a final concentration of 0.2 μM, a primer of SEQ ID NO: 7 at a final concentration of 0.2 μM, a TaqMan MGB probe of SEQ ID NO: 8 at a final concentration of 0.1 μM, and a template DNA using a linear positive control plasmid, The amount calculated from the absorbance was 1000 copy / μL, and a concentration of 12 μL (2/5 amount) was added to the PCR reaction solution. Finally, the amount was adjusted to 30 μL with sterile ultrapure water.

A dedicated chip (Quant Studio ^™ 3D Digital PCR 20K Chip, manufactured by Life Technologies Japan) was used as a container for the PCR reaction solution. Equal amounts of the above PCR reaction solution are placed in two chips, and the container is set in a Digital PCR apparatus (ProFlex ^™ 2x Flat PCR System, manufactured by Life Technologies Japan). After 96 ° C. for 10 minutes (enzyme activation), The cycle of 60 ° C., 2 minutes (annealing), 98 ° C., 0.5 minute (denaturation) was repeated 39 times, and then reacted at 60 ° C. for 2 minutes (annealing). After completion of the reaction, fluorescence data was acquired and analyzed with a dedicated device (Quant Studio ^™ 3D Digital PCR Instrument, Life Technologies Japan).
As a result, in the DNA solution in which the amount calculated from the absorbance was 1000 copies / μL, the concentration of the target sequence detected by Digital PCR was calculated to be 598 copies / μL.

Example 6: Qualitative real-time PCR determination of wheat, buckwheat, and peanuts in model processed foods 1) Qualitative real-time PCR reaction of wheat, buckwheat, and peanuts Model) Wheat PCR, buckwheat PCR, peanut PCR (SEQ ID NOs: 9, 10, 11 for positive control plasmid A) using DNA and positive control plasmid A or B obtained in Example 4 or 5 as templates, respectively Qualitative real-time PCR for the positive control plasmid B (primers and probes of SEQ ID NOs: 22, 23, and 24), and positive for a clam boiled model containing a food allergen equivalent to 10 μg / g protein concentration Positive control plus It was determined de of the number of copies. Real-time PCR was performed by the method shown in Example 3, and the number of cycles was set to 40 only when positive control B was used.

  The template DNA is 50 ng DNA in the case of the clam boiled model processed food extract DNA, and in the case of the plasmid, the number of copies in the reaction solution is 24, 25, 50, 60, 100, 120 copies. added. Moreover, it measured by 16 points | pieces parallel in each template DNA concentration.

  As a container for the PCR reaction solution, a dedicated 96-well PCR plate was used for ABI PRISM 7900HT manufactured by Life Technologies, and a dedicated 8-strip PCR tube was used for LightCycler Nano manufactured by Roche Diagnostics. The container containing the PCR reaction solution was set in a real-time PCR apparatus, and reacted under the PCR temperature conditions shown in Example 3 (the number of cycles was 40 only when positive control B was used). After completion of the reaction, fluorescence data obtained after the extension step was analyzed. The analysis conditions were the default conditions of the analysis software attached to each device. The value called Cq value in LightCycler Nano was read as Ct value.

2) Statistical analysis of PCR results and setting of positive / negative criteria <PCR analysis method>
First, the average value (X) from the “Ct value measured in parallel 16 times” for each sample of 50 ng DNA of the boiled clam model processed food (positive model) DNA and the positive control plasmid 24, 25, 50, 60, 100, 120 copies, Standard deviation (σ) was calculated. Next, assuming that the same sample is measured twice in the actual food allergen test, the average value X of the “average of Ct values measured twice in parallel” and the standard deviation σ / √2 are calculated from these values. Asked. Finally, the maximum coefficient z of the standard deviation in which the lower limit Ct value of the clam boiled model processed food (positive model) and the plasmid upper limit Ct value do not overlap is obtained by the following formula (4 ′), and the formula (4 ′) is established. The probability f (z) was obtained by the following formula (5). The Ct value analysis conditions were the default conditions of the analysis software attached to each device, and the value called Cq value in LightCycler Nano was read as Ct value.

X ₁ , σ ₁ : Asari boiled model processed food (positive model) Extracted average Ct value and standard deviation Asari boiled model processed food (positive model) when compared with the positive control plasmid A of Example 4 A model using tartary buckwheat as the buckwheat flour was used, and when compared with the positive control plasmid B of Example 5, a model using ordinary buckwheat as the buckwheat flour was used.
X ₂ , σ ₂ : average Ct value of positive control plasmid, standard deviation

<Setting positive / negative criteria based on analysis results>
The positive control plasmid 24, 25, 50, 60, 100, 120 copies / reaction solution and the clam boiled model processed food extract DNA were each measured at 16 points in parallel, and from the obtained Ct value, the formula (5) Table 3 below shows the result of calculating the probability that ') is established.

  In addition, for the positive control plasmid B of Example 5, the results of comparing the Ct value and standard deviation of 25 copies / reaction solution in a linear form and 100 copies / reaction solution in a circular form are shown in Table 4 below. Shown in

  7900HT, any of positive control plasmid A (circular) 24, 50, 60, 100, 120 copies / reaction tested in LightCycler Nano, and positive control plasmid B (linear) 25 copies / reaction and (circular) ) In any of 100 copies / reaction liquid, it was shown that the extracted DNA of boiled clam model processed food (positive model) can be determined as positive with high probability (for example, 99.7% or more, 3σ). Part of the positive control plasmid A (circular), buckwheat PCR / 7900HT and wheat PCR / LightCycler Nano were 99.7% less than 3σ, but other results are considered to be within the range of standard deviation variation It was.

  The 25 copies / reaction solution of the positive control plasmid B (linear) has a Ct value and standard deviation equivalent to 100 copies / reaction solution of the positive control plasmid B (circular). As a result, it was shown that an equivalent result can be obtained even with a ¼ copy number in a circular form.

  The 24 copies / reaction solution of plasmid A (circular) was able to achieve 99.7% and 3σ for all three types of real-time PCR, but there was a large variation and a Ct value corresponding to 10 copies or less could be obtained. Therefore, we considered that there is a high possibility that the fluorescence signal resulting from environmental contamination is false positive.

  From the above results, when the positive control plasmid is circular, the Ct value obtained with more than 24 copies, more specifically 50 copies or more, is used as the positive / negative judgment criterion, and the clam boiled model processed food ( (Positive model) It was shown that the extracted DNA can be judged positive with high probability in two types of real-time PCR apparatuses. From this, it is determined that a processed food that is less than or less than the Ct value obtained from an amount of a positive control plasmid that can be determined as positive for a model processed food that is difficult to test (positive model) is 10 μg / g as a protein concentration. It was shown that various processed foods including wheat, buckwheat, and peanut can be judged positive without overlooking them.

  In addition, when the positive control plasmid is linear, even with a ¼ copy number, a result equivalent to a circular one copy number can be obtained, so the circular “copy exceeding 24 copies”, “50 copies or more” can be read as “copy exceeding 6 copies” or “12.5 copies or more” in the linear form.

Example 7: Copy number measurement of wheat, buckwheat and peanuts in model processed food 1) Qualitative real-time PCR reaction of wheat, buckwheat and peanuts Sample processed food (positive model) DNA obtained in Example 3 Using the positive control plasmid A obtained in Example 4 and the linear positive control plasmid B obtained in Example 5 as templates, real-time PCR of wheat, buckwheat and peanut was performed, and the protein concentration was equivalent to 10 μg / g. The number of copies of the target sequence contained in the clam boiled model containing food allergens was measured. Real-time PCR was performed by the method shown in Example 3 using ABI PRISM 7900HT manufactured by Life Technologies, and the number of cycles was set to 40 only when positive control B was used.

The template DNA has 50 ng DNA in the case of the clam boiled model processed food extract DNA, and in the case of the positive control plasmid A obtained in Example 4, the copy number in the reaction solution is 20, 50, 100, In the case of the linear positive control plasmid B obtained in Example 5, the number of copies in the reaction solution was 25,3200,6400,10000 copies so as to be 1000,10000,100,000 copies. . In addition, clam boiled DNA was measured as an unknown sample in parallel with 16 points, and each template DNA of the plasmid was the positive control plasmid A obtained in Example 4 with any copy number of samples in 2 points. In the case of the linear positive control plasmid B obtained in Example 5, 16 copies were combined for 25 copies, and 3200, 6400, and 10000 copies were all measured as a standard sample with 2 points combined.
Moreover, when compared with the positive control plasmid A of Example 4, the clam boiled model processed food (positive model) is a linear positive control of Example 5 using a model using tartary soba in buckwheat powder. When compared with plasmid B, a model using ordinary buckwheat as the buckwheat powder was used.

2) PCR results First, an average Ct value was calculated from "Ct value measured 16 times in parallel" for 50 ng of clam boiled model processed food (positive model) DNA. As a result of calculating the copy number from the average Ct value using the calibration curve obtained from the analysis result, the copy number of the wheat, buckwheat, and peanut target sequences in 50 ng boiled clam DNA was the positive control obtained in Example 4 When calculated from the plasmid A, they were 427, 199, and 485 copies, respectively, and when calculated from the linear positive control plasmid B obtained in Example 5, they were calculated as 140, 146, and 63 copies, respectively.

Claims (22)

A method for determining the presence or absence of a food allergen contained in a food or drink or a raw material for food or drink,
(A) A step of obtaining a Ct value of an amplified signal by performing real-time PCR using a DNA extracted from a food or drink or a raw material for food or drink as a template and using a primer set for detecting food allergens;
(B) using the food allergen-derived DNA as a template, performing real-time PCR under the same conditions as in step (a) to obtain a Ct value of the amplified signal,
(B-1) The DNA is in a circular form including the target sequence of the primer set, and is extracted from the amount (copy number) of the DNA and the food or drink or raw material used in the step (a) Used in real-time PCR in an amount ratio of more than 24 copies: 50 ng, or (b-2) a linear chain containing the target sequence of the primer set Amount that is in the form and the amount (ng) of DNA extracted from the food or drink used in step (a) or the raw material for food or drink (ng) exceeds 6 copies: 50 ng Steps used for real-time PCR in ratios;
(C) A step of comparing the Ct value obtained in step (a) with the Ct value obtained in step (b), wherein the Ct value obtained in step (a) is obtained in step (b). The process which shows that a food allergen is contained in this food-drinks or food-drinks raw materials, when it is below the Ct value made.   The method of Claim 1 which is a method of determining as foodstuffs or foodstuff raw materials a food allergen contained in the quantity of 10 micrograms / g or more as protein concentration as positive.   In the step (a), the DNA extracted from the 50 ng amount of food or drink or the raw material of the food is used as a template, and in the step (b), the amount of food allergen-derived cyclic DNA or the number of copies exceeds 6 copies. The method according to claim 1 or 2, wherein linear DNA derived from an amount of food allergen is used as a template for real-time PCR, respectively.   In step (b), when the food allergen-derived DNA is circular DNA, the amount is 50 copies or more, or when the food allergen-derived DNA is linear DNA, 12.5 copies or The method according to claim 3, which is used in real-time PCR in a larger amount.   In the step (c), when the Ct value obtained in the step (a) is less than the Ct value obtained in the step (b), a food allergen is contained in the food or drink or raw material for food or drink. The method according to any one of claims 1 to 4, wherein:   The method according to any one of claims 1 to 5, wherein the food allergen is one or more food allergens selected from the group consisting of wheat, buckwheat and peanuts. The food allergen is wheat, and the primer set to be used includes the following oligonucleotide (i) or a variant thereof and at least one oligonucleotide selected from (ii)-(iv) or a variant thereof: Item 7. The method according to Item 6.
(I) oligonucleotide containing the base sequence shown in SEQ ID NO: 1 (ii) oligonucleotide containing the base sequence shown in SEQ ID NO: 2 (iii) oligonucleotide containing the base sequence shown in SEQ ID NO: 3 (iv) shown in SEQ ID NO: 4 Oligonucleotide containing base sequence The method according to claim 6, wherein the food allergen is buckwheat and the primer set used comprises the following oligonucleotide (v) or a variant thereof and (vi) an oligonucleotide or a variant thereof.
(V) an oligonucleotide containing the base sequence shown in SEQ ID NO: 6 (vi) an oligonucleotide containing the base sequence shown in SEQ ID NO: 7 The food allergen is peanut, and the primer set used comprises the following oligonucleotide (vii) or a variant thereof, and (viii) an oligonucleotide or a variant thereof, or the following oligonucleotide (ix) or The method according to claim 6, comprising the mutant and the oligonucleotide (x) or a mutant thereof.
(Vii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 9, and (viii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 10, or (ix) an oligonucleotide containing the base sequence shown in SEQ ID NO: 22, and (x ) Oligonucleotide comprising the nucleotide sequence shown in SEQ ID NO: 23   The method according to any one of claims 1 to 9, wherein detection of an amplification product by real-time PCR is performed using a fluorescently labeled probe. A kit used in a method for determining the presence or absence of a food allergen contained in a food or drink or a raw material for food or drink by a real-time PCR method,
A primer set for detecting a food allergen, and a DNA derived from a food allergen, wherein the DNA is in a circular form containing the target sequence of the primer set and is present in an amount exceeding 24 copies, or the DNA Is a linear form containing the target sequence of the primer set, and is present in an amount exceeding 6 copies.
A kit as described above.   The kit according to claim 11, further comprising a fluorescently labeled probe for detecting an amplification product by real-time PCR. The food allergen is wheat, and the primer set comprises the following oligonucleotide (i) or a variant thereof and at least one oligonucleotide selected from (ii)-(iv) or a variant thereof: Or the kit of 12.
(I) oligonucleotide containing the base sequence shown in SEQ ID NO: 1 (ii) oligonucleotide containing the base sequence shown in SEQ ID NO: 2 (iii) oligonucleotide containing the base sequence shown in SEQ ID NO: 3 (iv) shown in SEQ ID NO: 4 Oligonucleotide containing base sequence   Furthermore, the kit of Claim 13 containing the fluorescence labeled probe containing the oligonucleotide containing the base sequence shown to sequence number 5, or its variant.   The kit according to claim 13 or 14, wherein the DNA derived from a food allergen comprises DNA consisting of the nucleotide sequence of SEQ ID NO: 19 or a variant thereof. The kit according to claim 11 or 12, wherein the food allergen is buckwheat, and the primer set comprises the following oligonucleotide (v) or a variant thereof, and (vi) an oligonucleotide or a variant thereof.
(V) an oligonucleotide containing the base sequence shown in SEQ ID NO: 6 (vi) an oligonucleotide containing the base sequence shown in SEQ ID NO: 7   Furthermore, the kit of Claim 16 containing the fluorescence labeled probe containing the oligonucleotide containing the base sequence shown to sequence number 8, or its variant.   The kit according to claim 16 or 17, wherein the food allergen-derived DNA comprises DNA consisting of the nucleotide sequence of SEQ ID NO: 20 or a variant thereof. The food allergen is peanut, and the primer set to be used includes the following oligonucleotide (vii) or a variant thereof and the oligonucleotide (viii) or a variant thereof, or the following oligonucleotide (ix) or The kit according to claim 11 or 12, comprising the mutant and the oligonucleotide (x) or a mutant thereof.
(Vii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 9, and (viii) an oligonucleotide containing the base sequence shown in SEQ ID NO: 10, or (ix) an oligonucleotide containing the base sequence shown in SEQ ID NO: 22, and (x ) Oligonucleotide comprising the nucleotide sequence shown in SEQ ID NO: 23   Furthermore, a fluorescently labeled probe containing an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 11 or a variant thereof, or a fluorescently labeled probe containing an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 24 or a variant thereof The kit according to claim 19.   The kit according to claim 19 or 20, wherein the DNA derived from a food allergen comprises DNA consisting of the base sequence of SEQ ID NO: 21 or a variant thereof, or DNA consisting of the base sequence of SEQ ID NO: 25 or a variant thereof.   Contains DNA from food allergens in a circular form in an amount of 50 copies or more, or contains DNA from food allergens in a linear form in an amount of 12.5 copies or more The kit of any one of Claims 11-21 containing.

Images