JP2015140338A - Anti-aging related gene expression promoter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an anti-aging agent with a life extension or aging preventive action which is safe to ingest as a novel anti-aging approach by a different technique from caloric restriction.SOLUTION: Young leaves of a barley in their natural state, grown to a height of about 20-40 cm before growing fully, belonging to Hordeum vulgare species, such as H. vulgare f. distichon, H. vulgare subsp. vulgare, H. vulgare f. hexastichon, and Hordeum vulgare var. nudum; or processed products thereof, for example, juice products, crushed products, chipped products, dried products, roasted products, extracted products, powdered products, freezed products of barley young leaves, and besides processed products of these combinations, such as juiced and dry powdered products, chipped and dried products, and crushed and filtrated products (purees, juices) are provided as a gene expression promoter of SOD (super-oxide dismutase).

Description

  The present invention relates to a gene expression promoter for super-oxide dismutase (reactive oxygen scavenging enzyme; hereinafter abbreviated as SOD), which is an anti-aging related gene containing young barley leaves as an active ingredient.

  At present, the extension of lifespan is remarkable in developed countries. In particular, Japan is one of the world's leading longevity countries. However, in recent years, the healthy life expectancy has not been extended due to a decrease in exercise amount, an increase in stress, an excessive intake of calories due to westernization of meals, a lack of nutritional balance, and the like.

  Anti-aging is necessary to extend healthy life expectancy. Caloric restriction is cited as one means of anti-aging, in other words, extending the lifespan. Caloric restriction has been established as a life extension model for a wide range of species such as yeast, nematodes, and rodents. In addition, experiments on caloric restriction using rhesus monkeys have shown promising evidence that changes in primate metabolism and enhances the life-prolonging effect (Non-patent Document 1).

  Moreover, in the state of oxidative stress in which the balance between the oxidative reaction and the antioxidant reaction in the living body is leaning toward the former, it has become clear that oxidative stress is involved in the pathogenesis of aging, cancer, and lifestyle-related diseases ( Non-patent document 2).

  It is thought that the lifetime is extended by making it less susceptible to the oxidative stress that is one of the causes of this aging. When the diet is restricted, the expression of several genes encoding SOD increases with an increase in the amount of mRNA of the transcription factor PHA-4 (Non-patent Documents 3 and 4). That is, it is considered that the dietary restriction makes it less susceptible to oxidative stress. Since it has been reported that the life span is extended by overexpression of SOD by gene recombination (Non-patent Document 5), reduction of oxidative stress is effective for anti-aging, that is, the amount of SOD gene expression in cells. It is thought that extending the life can be expected by raising

  The life extension effect by calorie restriction is considered to have a certain effect on humans. However, caloric restriction may increase mental stress and reduce resistance to infection, and the results in rhesus monkeys under controlled conditions may not apply directly to humans. Accordingly, there is a need for the development of a new anti-aging method that replaces calorie restriction.

  Examples of methods for screening anti-aging substances include life-time measurement tests using nematodes (Caenorhabditis elegans, hereinafter referred to as C. elegans) and analysis of expression levels of aging-related genes in various animals. C. elegans is widely known as a model animal suitable for aging research. The aging process has been studied at the gene level, and is an indispensable model system for aging studies of mammals including humans (Non-Patent Document 6). Its life span is genetically controlled and constant (approximately 20 days at 20 ° C.), and the metabolic activity of cells and tissues decreases with age, and peroxides accumulate. After death. That is, the life span of C. elegans can be said to be an indicator of cell and tissue aging. These means that prolonging the lifespan of C. elegans is nothing other than inhibiting aging.

When measuring the expression level of the SOD gene, which is considered to be an aging-related gene, a general quantitative RT-PCR method can be used. SOD is known as an enzyme that eliminates superoxide (.O ₂ ⁻ ), which is one type of active oxygen, and SOD is an enzyme that removes active oxygen generated in mitochondria and the like. It has also been reported that SOD is activated by exercise, and by activating SOD, the possibility of illness and death due to cardiac artery disease is reduced (Non-patent Document 7).

  As materials for increasing the SOD expression level, anthocyanin-containing potato-derived anthocyanin-containing materials (Patent Document 1), flavonoids contained in apples and pears, phloretin, flavonoids contained in propolis and medicinal plant extracts (Patent Documents) 2) has been reported.

  On the other hand, barley young leaves are known to contain a lot of nutrients such as dietary fiber, minerals such as potassium, calcium, magnesium, zinc, iron, copper, vitamins such as vitamin B1, vitamin C, carotene, etc., improving the intestinal environment It is said that it has the effect of inhibiting absorption of cholesterol and preventing a rapid increase in blood sugar level after meals, and is used as a material for health foods (Patent Document 3). In addition, a platelet aggregation inhibitor containing a pentapeptide extracted from barley young leaves is known (Patent Document 4).

JP 2008-120723 A JP 2007-326799 A JP 2004-215578 A Japanese Patent Laid-Open No. 9-249693

Science Vol. 325, Issue 5937 Japanese Pharmacology Journal 2005; 125: 125-128. J Cell Sci 121, 407-412. Nature 2007; 447: 550-555 Genetics. 2002 Jun; 161 (2): 661-72 Nature Cell Biology 11, 1305-1314 (2009) Proc. Nat'l. Acad. Sci., U.S.A., VOL77, 2777; (1980)

  Since it is considered that even when SOD is ingested orally, it is decomposed by gastric acid or the like, rather than ingesting SOD itself, the amount of SOD expression in the body is increased and the SOD activity inherent in humans is increased. It is demanded. The subject of this invention is providing the SOD gene expression promoter which has the effect | action of a life extension or anti-aging which is safe to ingest as a new anti-aging approach by the method different from calorie restriction.

  The present inventors consider that analyzing the gene expression level of SOD, which is an anti-aging related gene, is very effective for screening a substance having an anti-aging effect similar to caloric restriction. The target screening was performed, and it was found that the squeezed barley leaf juice promotes the expression of the SOD gene, which is an anti-aging-related gene, and has an anti-aging effect, thereby completing the present invention.

  That is, the present invention relates to a SOD gene expression promoter characterized by containing young barley leaves as an active ingredient, and a supplement for life extension or prevention of aging, characterized by comprising such a SOD gene expression promoter. About.

  ADVANTAGE OF THE INVENTION According to this invention, the gene expression promoter of SOD which is an anti-aging related gene which can be ingested safely and effectively can be provided.

It is a figure which shows the result of having measured the expression level of intracellular SOD1 and SOD2 when a human normal fibroblast is culture | cultivated in the spray dry powder containing culture medium of the barley young leaf juice. It is a figure which shows the measurement result of a nematode survival rate when a nematode is cultured with the spray dry powder containing culture medium of the barley young leaf juice. It is a figure which shows the measurement result of the number of days in a 10-% nematode survival rate by cultivating a nematode on the spray dry powder containing medium of the barley young leaf juice.

  The SOD gene expression promoter of the present invention is not particularly limited as long as it contains barley young leaves as an active ingredient, and the type of SOD is known to exist in mammals including humans. , SOD2, and SOD3. Further, the promotion of SOD gene expression of the present invention means to increase the expression level of SOD by promoting transcription of SOD gene into mRNA, promoting translation of mRNA, and the like.

  As barley young leaves in the present invention, barley belonging to the Hordeum vulgare species such as Nijo barley, Shijo barley, Rojo barley, and bare barley, the young leaves themselves that have grown to a height of about 20 to 40 cm before the ears grow, and processed products thereof, For example, barley young leaves squeezed processed products, pulverized processed products, shredded processed products, dried processed products, roasted processed products, extracted processed products, powdered processed products, frozen processed products, squeezed and dried powdered processing Examples of these products include processed products, shredded / dried products, pulverized / filtered products (pure, juice), shredded / hot water extraction processed products, and the like. For example, barley young leaf squeezed powder can be prepared by cutting barley young leaves and drying the liquid squeezed by squeezing by spray drying. This squeezed powder can be suitably used as the SOD gene expression promoter of the present invention as it is or with other excipients.

  The SOD gene expression promoter of the present invention can be used as a prophylactic / therapeutic agent, supplement, food additive, or feed additive for life extension or prevention of aging. Here, life extension refers to extending the life of animals including humans, and aging prevention refers to preventing aging phenomena that appear in the body, such as a decrease in the physical abilities of humans, including humans, and a decrease in body functions. To do. Such a life extension or anti-aging effect can be achieved by an SOD gene expression promoter comprising young barley leaves as an active ingredient by increasing the SOD expression level by promoting transcription of the SOD gene into mRNA, promoting translation of mRNA, etc. This is achieved by removing superoxide, which is the cause of

  Examples of the dosage form of the SOD gene expression promoter of the present invention and the above preventive / therapeutic agents, supplements, food additives, or feed additives include powders, tablets, capsules, granules, powders, liquids, and the like. These dosage forms can be prepared by conventional formulation methods conventionally known. For example, it can be molded by mixing with carriers, excipients, fragrances, emulsifiers, preservatives, dispersants and the like that are permitted in the manufacture of pharmaceutical preparations and food and beverage preparations. Examples of the excipient include lactose, dextrose, cellulose, methylcellulose, starch, water, purified water, alcohol, glycerin and the like. These preparations are usually administered orally. Moreover, another active ingredient can also be mix | blended as needed.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, the technical scope of this invention is not limited to these illustrations.

[Barley young leaves]
10 kg of barley young leaves cut out were squeezed, and 8 kg of the resulting juice was dried and powdered by spray drying to obtain 0.5 kg of barley young leaf juice powder. This powder was suspended in M9 buffer, sterilized by filtration through a 0.45 μm filter, and used as an evaluation sample. The evaluation sample was prepared with reference to the production method of Green Bioactive Co., Ltd. (http://green-gbc.co.jp/technology/) and Japanese Patent No. 4600853.

[Medium and buffer]
1) M9 buffer composition (per liter)
Na ₂ HPO ₄ 60 g, KH ₂ PO ₄ 30 g, NaCl 50 g, 1M MgSO ₄ 1 ml, 2% gelatin 10 ml were dissolved in 1 L of ion-exchanged water and sterilized at 121 ° C. for 20 minutes.
2) S-Basal buffer composition (per liter)
5.84 g of NaCl and 6.81 g of KH ₂ PO ₄ were dissolved in 1 L of ion exchange water and sterilized at 121 ° C. for 20 minutes. The solution was allowed to cool to about 60 ° C., and 1 ml of cholesterol / ethanol (5 mg / ml) was added.
3) S-liquid medium (per liter)
To 1 L of S-Basal buffer, 10 ml of 1M KH ₂ PO ₄ (pH 6.0), 3 ml of 1M CaCl _2, 3 ml of 1M MgSO _{4 and} 10 ml of Trace metal solution were added. (Use all sterilized ones)
4) Trace metal solution composition (per liter)
EDTA · 2Na 1.86 g, FeSO ₄ · 7H ₂ O 0.69 g, MnCl ₂ · 4H ₂ O 0.20 g, ZnSO ₄ · 7H ₂ O 0.29 g, CuSO ₄ · 5H ₂ O 0.025 g Dissolved in 1 L and sterilized at 121 ° C. for 20 minutes.

[SOD gene expression analysis]
Gene expression analysis of SOD was performed using human normal fibroblasts (NHDF). NHDF purchased from Lonza Japan Co., Ltd. was passaged 2 times with Dulbecco's minimal medium (DMEM) containing 10% fetal bovine serum, a working cell bank was prepared, and passage 1 was further used for experiments. NHDF was cultured to semi-confluent and replaced with the above medium containing 1% barley squeezed powder. Only medium was used for experimental control. Thereafter, the cells were cultured for 48 hours in a 37 ° C. incubator.

The cultured cells were collected using a cell scraper and used as a gene expression analysis sample. Extraction of total RNA from the gene expression analysis sample was performed using the QIAGEN RNeasy Midi Kit. The extracted total RNA was ethanol precipitated and centrifuged (12,000 rpm, 30 minutes). The supernatant was removed with a pipette and air-dried at room temperature to completely remove ethanol. Thereafter, total RNA was dissolved in 100 μl of RNase Free water, diluted 10-fold with water, absorbance at 260 nm was measured, and the amount of total RNA was calculated from the absorbance. From the calculated value, the total RNA concentration was adjusted to 1 μg / μl. In order to synthesize cDNA from total RNA, 5 μl of total RNA solution (5 μg as total RNA weight), 1 μl of Oligo (dT) _12-18 primer (0.5 μl / ml), 1 μl of 10 mM dNTP mix, RNase 6 μl of Free Water was added and tapped and mixed well. The mixture was heated in a hot water bath set at 65 ° C. for 5 minutes and then left on ice for 1 minute. 4 μl of 5 × First Strand Buffer and 1 μl of 0.1M DTT were added and mixed, 1 μl of Superscript® III Reverse Transcriptase was added, and the mixture was reacted at 50 ° C. for 1 hour. Then, the enzyme reaction was stopped by heating for 15 minutes in a hot water bath set at 70 ° C. After confirming that the solution was cooled, ethanol precipitation was performed. After centrifugation, the supernatant was discarded, and the remaining ethanol was completely volatilized in a vacuum dryer to obtain purified cDNA. The purified cDNA was dissolved in sterilized water and the absorbance at 260 nm was measured. Adjust the concentration from the amount of cDNA calculated from the absorbance value so that the calibration curve during quantitative RT-PCR is 0.0001 μg / μl, 0.001 μg / μl, 0.01 μg / μl, and 0.1 μg / μl. The sample was adjusted to 0.01 μg / μl. Per well of 96-well plate for quantitative RT-PCR, 10 μl of cDNA at the above concentration, 12.5 μl of SYBR Green, primer (L) (sequence: (SOD-1) TGGCCGATGTGTCTATTGAA, (SOD-2) TTGGCCAAGGGAGATGTTAC) 0.1 μl, primer (R) (Sequence: (SOD-1) AACGACTTCCAGCGTTTCCT, (SOD-2) AGTCACGTTTGATGGCTTCC) 0.1 μl, and sterile water 2.3 μl were added. The quantitative RT-PCR conditions were as shown in Table 1. In addition, GAP-DH primer (L) sequence: GTCAGTGGTGGACCTGACCT and primer (R) sequence: TGCTGTAGCCAAATTCGTTG, which are primers for amplifying mRNA, were used as internal standards.

  As a result of gene expression analysis, SOD1 and SOD2 mRNA expression levels increased in cells to which barley young leaves were added (FIG. 1).

[Life extension effect by young barley leaves]
An M9 buffer solution in which 1% of barley young leaf juice powder was suspended was sterilized by filtration using a 0.45 μm filter, and used as an evaluation sample.

Escherichia coli OP50 strain (hereinafter referred to as OP50) was added and prepared in an S-liquid medium so that the value of OD ₆₆₀ was 0.9. About 1 ml of C. elegans solution was added to this medium and cultured in an incubator at 20 ° C. for 4 days to obtain a C. elegans culture.

  In order to unify the generation of C. elegans, synchronized culture was performed. Specifically, C. elegans was bred in large quantities by the above culture method, and C. elegans carrying eggs were collected from the S-liquid medium and transferred to a 15 ml centrifuge tube. The mixture was allowed to stand for 5 to 10 minutes to precipitate C. elegans, and the supernatant was removed. 1 ml of M9 buffer solution was newly added and lightly pipetted and transferred to a 1.5 ml microtube. The mixture was allowed to stand for 5 minutes to precipitate C. elegans, and the supernatant was removed. 1 ml of M9 buffer was newly added, and 266 μl of sodium hypochlorite and 133 μl of NaOH were further added. The mixture was vigorously inverted at room temperature to dissolve the body of C. elegans, and the eggs were collected. Thereafter, the mixture was centrifuged at 800 × g for 5 minutes to precipitate the eggs. The supernatant was discarded and 1.4 ml of M9 buffer was added and centrifuged at 800 × g for 5 minutes. This operation was repeated 5 times to wash the eggs. 1 ml of S-basal buffer was newly added to the recovered eggs after discarding the supernatant, and added to 10 ml of S-liquid medium not containing OP50 using Pipetman, and cultured overnight at 20 ° C. to hatch. . When hatching was confirmed, 10 ml of S-liquid medium containing OP50 was added and further cultured in an incubator at 20 ° C. for 24 hours.

  The nematode survival rate was measured. A general flat-bottomed 6-well plate with a lid was prepared, 30 hatched C. elegans after synchronous culture were added per well, and this was set to n = 1. To increase the reproducibility of the experiment, n = 3 using 3 wells per group. The medium used was an S-liquid medium supplemented with OP50, 5-fluoro-2'-deoxyuridine (final concentration 0.04 mM), and an evaluation sample. Thereafter, every other day using a micropipette, While counting the number of surviving C. elegans, the cells were transferred to wells containing freshly prepared S-liquid medium. The number of C. elegans surviving on the first day of culture was calculated from the number of 30 C. elegans per day, and the percentage of C. elegans continued to survive was calculated as the nematode survival rate. In addition, 5-fluoro-2'-deoxyuridine is a DNA synthesis inhibitor, so that the next day of C. elegans is not mixed during the life test and the accurate survival rate cannot be obtained. Continued to add.

  As a result of measuring the nematode survival rate, the life extension effect was confirmed in the group to which the barley young leaf squeezed powder was administered compared to the control (FIG. 2). Even when the number of days until the survival rate reached 10% was compared, as in FIG. 2, a significant life extension effect was confirmed in the group administered with barley young leaf squeezed powder as compared to the control (FIG. 3).

That is, the present invention provides a barley young leaves contain as an active ingredient, about the gene expression promoter of SOD, characterized in that to increase the SOD expression levels in the body.

That is, the present invention relates to a mammalian SOD gene expression promoter characterized by containing young barley leaves as an active ingredient and increasing the mammalian SOD expression level in the mammalian body.

Claims (2)

A SOD (super-oxide dismutase) gene expression promoter characterized by containing young barley leaves as an active ingredient. A supplement for life extension or prevention of aging, comprising the SOD gene expression promoter according to claim 1.