JP2014217304A - Microorganism having methanation inhibition ability in reticulo rumen of ruminant, and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide Proteiniphilum acetatigenes SROD1 (Deposition KCCM11219 P) having a methanation inhibition ability in a reticulo rumen of a ruminant as reductive acetogenic bacteria, and to provide a method for use thereof.SOLUTION: When feeding a microorganism preparation comprising Proteiniphilum acetatigenes SROD1 of the invention directly to a ruminant, or allowing a ruminant to ingest a feed for stock raising comprising the microorganism preparation, methanation in the reticulo rumen of the ruminant can be suppressed. And since it is safe with little damage to a human body or an animal, fundamentally reduces methane as a principal offender of global warming, and increases feed utilization efficiency, utility value thereof is very high.

Description

  The present invention relates to a microorganism having an ability to suppress methane production in the ruminant stomach of a ruminant as a reductive acetic acid producing bacterium, a microorganism preparation containing the microorganism, and a livestock feed containing the microorganism preparation. The present invention also relates to a method for suppressing methane production in the ruminant stomach of ruminants by feeding reductive acetic acid producing bacteria to animals.

  Recently, global warming is accelerating as the amount of greenhouse gases in the atmosphere increases. As a result, the Earth's average temperature and sea level have risen, causing weather changes such as desertification, sunshine, floods, and typhoons. One of these causes is methane, which has a greenhouse effect that is about 24 times higher than carbon dioxide and has a great impact on global warming.

  On the other hand, the livestock industry is a key industry in the country that provides meat, leather, etc. to people in the field of agriculture that breeds and raises livestock and supplies meat. However, as concerns about the environment such as the global warming issue have increased, methane generated during the livestock industry and concerns about this problem have increased, and as a result the cause of methane generated in barns There is growing interest in ways to reduce the methane produced during the digestion of food by ruminants, the majority of them.

  Methods for suppressing methane production in ruminants of ruminants can be broadly divided into two. The first method uses compounds such as nitrates and nitrites that can use hydrogen to control the amount of hydrogen that is the precursor of methanogenesis, There is a risk that the supply of necessary oxygen will be insufficient. Another method uses ionophores or antibiotics that are compounds that are toxic to methanogenic microorganisms. However, when they are administered for a long period of time, the methanogenic microorganisms adapt and reduce the methanogenesis inhibitory effect. There is a problem. In addition, since each of the above methods uses a compound, if such a substance remains in the livestock product, there may be a safety problem, and growth of useful microorganisms in the rumen. The feed utilization efficiency is lowered and productivity is weakened.

  In connection with a method for suppressing methane production in the rumen of a ruminant, Korean Patent No. 10-2006-0019062 includes any one or more of ginger, leek extract and complex linoleic acid. Korean Patent No. 10-2007-0033968 discloses a feed composition that selectively reduces protozoa in the rumen of ruminants, and Korean Patent No. 10-2007-0033968 affects rumen fermentation and maintains energy and protein in ruminants. A plant extract for improvement is disclosed, and Korean Patent Publication No. 10-2011-0119370 discloses ruminant containing 35 to 45% by weight of concentrated feed, 35 to 45% by weight of timothy, and 10 to 30% by weight of rice straw. It discloses a feed composition and a ruminant breeding method for suppressing the amount of greenhouse gas generation in animals. Then, Korean Patent No. 2002-0042866 discloses a composition for reducing methane production in ruminants containing polycyclic quinone and ionophore compounds, and Korean Patent No. 10-2011-0036470 Discloses a feed for reducing methane production of ruminants containing garlic. Korean Patent 10-2011-0039540 eliminates all fats of animal origin and exogenously ingests vegetable oil containing saturated fatty acids. Disclosed is a method for reducing and regulating the amount of methane produced by a milking ruminant using methods such as limiting. Korean Patent Publication No. 1995-7004060 discloses a method for inhibiting methane production in ruminants using anthraquinone compounds, and Japanese Patent Laid-Open Publication No. 2003-88301 discloses a group consisting of lactic acid bacteria, yeasts and oligosaccharides. The present invention discloses a composition for suppressing methane production for ruminants, characterized in that it is selected from the group consisting of eucalyptus oil, peppermint oil, wasabi oil, cineol, iodine. And a cyclodextrin clathrate compound containing at least one compound and a feed composition for ruminants, Japanese Patent Publication No. 11-46694 includes fumaric acid. A ruminant methane production inhibitor and a feed composition are disclosed. However, a method for suppressing methane production in the ruminant stomach of ruminants using the microorganisms of the genus Proteininifilm of the present invention is not disclosed.

  Therefore, the present inventors fundamentally suppress the generation of methane, which is a type of greenhouse gas, in the ruminant stomach of ruminants, prevent global warming, and increase methane production while increasing feed utilization efficiency. Attempts have been made to develop microorganisms that do not harm the human body or animals in the process of controlling the disease. As a result, we discovered a new microorganism from microorganisms separated from ruminant fluid of livestock, and confirmed that the microorganism effectively inhibits methanogenesis by producing acetic acid through substrate competition with methanogenic microorganisms, The present invention has been completed.

  One object of the present invention was devised to radically remove or reduce methane, which is one of the causes of global warming and reduces feed utilization efficiency, Proteinifilm acetatigenes SROD1, which is a microorganism that suppresses methane production in the rumen of ruminants as bacteria.

  Another object of the present invention is to provide a microorganism preparation for suppressing the production of methane in the rumen of a ruminant, characterized in that it contains the microorganism.

  Another object of the present invention is to provide a livestock feed for suppressing the production of methane in the rumen of a ruminant, characterized in that it contains the above-mentioned microbial preparation.

  Another object of the present invention is to provide a method for inhibiting methane production in ruminants of ruminants by feeding reductive acetic acid producing bacteria to animals.

  In order to solve the above-mentioned problems, the present invention provides a reductive acetic acid-producing bacterium belonging to the genus Proteinifilm having the ability to suppress methane production in the rumen of ruminants and its use.

  Most preferably, as a reductive acetic acid-producing bacterium, Proteinifilm acetatigenes SROD1 (deposit number KCCM11219P) isolated and identified by the present inventor may be used.

  In addition, the present invention provides a ruminant ruminant containing a reductive acetic acid producing bacterium belonging to the genus Protenyfilm as one aspect of the use of the reductive acetic acid producing bacterium belonging to the genus Protenyfilm having the ability to suppress methane production in the rumen. Provided is a microorganism preparation for suppressing methanogenesis in the stomach.

  As another aspect, there is provided a livestock feed comprising the reductive acetic acid producing bacterium or a microbial preparation containing the reductive acetic acid producing bacterium.

  In another aspect, the present invention provides a method for suppressing methane production in the ruminant stomach of ruminants by feeding the reductive acetic acid producing bacterium or a microbial preparation containing the same to an animal. At this time, the salary may be in the form of providing a ruminant with a microbial preparation containing the reductive acetic acid producing bacteria or a livestock feed containing the microbial preparation.

  In various uses of the reductive acetic acid-producing bacteria belonging to the genus Protenyfilm having the ability to suppress methane formation in the rumen, it is most preferable to use Proteinifilm acetatigenes SROD1 (deposit number KCCM11219P). can do.

  Because the proteinifilm acetatigenes SROD1 (deposit number KCCM11219P) of the present invention is isolated from the rumen of a native goat, it is compared with using a chemical method to suppress methane production. Therefore, it is safe and less harmful to humans and animals, and the cause of producing methane as a reductive acetic acid-producing bacterium is drastically reduced. In addition, if a microorganism preparation, livestock feed, etc. are produced using the microorganism, an additional economic gain can be obtained.

FIG. 1 is a photograph showing the results of agarose gel electrophoresis using an FTHFS primer, which is a specific gene of a reductive acetic acid producing bacterium. FIG. 2 shows a phylogenetic tree for confirming the phylogenetic affiliation of DA02, GA01, GA02, and GA03, which are reductive acetic acid producing bacteria selected in the present invention. 3 and 4 are graphs showing the production of aceto acid in the case of a starch substrate and a casein substrate, respectively, on in vitro fermentation [E. limosum-Eubacterium limosum ATCC 486 (control group), AY4226 (DA02-Proteinophilacetategenes TB107 (99%)), AY4226 (GA01-Proteinophile aceticigenes TB107 (98%), Aix4usroro Af4c (a22%) ), AY4226 (GA03-Proteinophilum acetigenes TB107 (99%))]. FIG. 5 shows the contents of volatile fatty acids of DA02, GA01, GA02 and GA03, which are reductive acetic acid producing bacteria when starch is used as a substrate. FIG. 6 shows the content of volatile fatty acids of DA02, GA01, GA02 and GA03, which are reductive acetic acid producing bacteria when casein is used as a substrate. FIG. 7 is a graph confirming the effect of reducing the amount of methane generated by an in vitro analysis method using GA03, which is a reductive acetic acid producing bacterium. FIG. 8 shows the degree of suppression of methane production by DA02, GA01, GA02 and GA03, which are reductive acetic acid producing bacteria when starch is used as a substrate. FIG. 9 shows the degree of inhibition of methane production by DA02, GA01, GA02 and GA03, which are reductive acetic acid producing bacteria when casein is used as a substrate. FIG. 10 is a graph of measurement results of methane production by an in vivo analysis method utilizing the reductive acetic acid-producing bacteria GA3 and the respiratory chamber. FIG. 11 is a photograph of the respiratory chamber of the National Institute of Animal Science used in one embodiment of the present invention.

  Definitions of terms used in the present invention are as follows.

  As used herein, “animal” or “experimental animal” means any mammal other than a human, in particular a “ruminant”. Ruminants are animals belonging to the mammalian bovine family and are also referred to as re-biting animals. Can be seen in camelid, deer, giraffe and bovine animals. Such an animal has a double stomach from the first stomach to the fourth stomach, and has a very different digestive structure from a monogastric animal such as a pig. Such a plurality of stomachs is called a ruminant stomach. The ruminant is a large stomach (rumen) that holds the eaten food, a second stomach (honeycomb stomach) with a pattern like a honeycomb, and a mucous membrane third. It consists of four chambers such as the stomach (double stomach: omasum) and the fourth stomach (abomasum) in which gastric glands are distributed. Such animals include animals of all ages including embryos, fetuses, newborns and adults.

  “Feed compositions” are suitable for use as animal feed and are a variety of natural- or non-natural bases or raw materials or additives ( additive)). Such feeds can be formulated according to the specific requirements of the target animal. The main ingredients used in commercially produced mixed feeds are wheat bran, rice bran, corn meal, barley, wheat, rye (rye). ) And oats generally include cereal grains, soybean meal, alfalfa meal, wheat powder and the like. Commercial compound feeds can generally include digestible total nutrients that are easily digestible, even though the present invention is not particularly limited in this respect. Liquid, solid animal feed compositions as well as semi-solids are included within the scope of the present invention. Such compositions can generally be manufactured as crushed grain types, pellets or crumbs. In fact, livestock can generally be fed mixed feed combinations such as this one of the present invention and silage or hay. Generally, mixed animal feed is fed in an amount in the range of 0.3 to 10 kg / animal / day. One skilled in the art can determine the appropriate amount of such ingredients that can be included in a mixed animal feed in view of the type of animal and the environment in which it is stored.

  “Feed supplement” can be added to the animal's diet or a relation to form a supplemented feed so that the pre-formulation or supplement is in accordance with the present invention, 1 shows a concentrated additive premix containing active ingredients. The terms “animal feed premix”, “animal feed supplement” and “animal feed additive” are generally considered to have similar or identical meanings, Generally considered to be interchangeable. In general, the animal feed supplement of the present invention is in the form of a powder or compacted or granulated solid. In particular, this is added directly to the distribution to the livestock, for example, the so-called ration is top-dressed and the animal feed supplement is generally eaten or mixed with animal feed ( It can be used in the manufacture or preparation of products such as compounded animal feeds or lick blocks.

  “Reduce gastrointestinal methanogenesis” refers to a decrease in methane gas production in the gastrointestinal tract. The ruminant rumen and gut fermentation of ruminants produces methane gas from so-called methanogens. The present invention is aimed at reducing what is methane exhausted. Assessing methane emissions by animals is within the skill and knowledge of those skilled in the art. Ruminal and visceral methane production is a process commonly occurring in healthy animals, and reducing the methanogenic response can lead to a general state of ruminant health or wellbeing. Do not improve or weaken. Reduced methane formation can increase the efficiency of animals using nutrients and enhance animal growth and / or productivity.

  “Substrate” refers to any substance or compound that is converted to or is converted to another compound by the action of an enzyme. The term encompasses not only single compounds but also combinations of compounds such as solvents, mixtures and other materials including at least one substrate and their derivatives. Furthermore, the term “substrate” refers not only to compounds that provide a carbon source suitable for use as a starting material such as biomass-derived sugar, but also to pathways associated with metabolically engineered microorganisms described herein. Includes intermediate products and end metabolites used. Includes carbon substrates suitable for normal use by microorganisms.

“Function”, “functionality” and the like mean biological or enzymatic functions.

  “Increased” or “increased” refers to a given product or molecule (eg, generic chemicals, biofuels or intermediates thereof) relative to a non-modified microorganism or a control microorganism such as a differently transformed microorganism. Product) means the ability of one or more recombinant microorganisms to produce larger quantities.

  “Obtained from” or “derived from” means, for example, a polynucleotide extract or polypeptide extract isolated from or derived from a specific source, typically a specific source such as a microorganism. Means a sample like It can also mean a situation in which a polynucleotide or polypeptide sequence is isolated from or derived from a particular organism or microorganism.

  “Exogenous” generally does not occur naturally in wild-type cells or organisms, but is typically introduced into cells by molecular biology techniques, ie, engineering processes to produce recombinant microorganisms. Means a polynucleotide sequence or polypeptide.

  “Recombinant” microorganisms typically contain one or more foreign nucleotide sequences, eg, in a plasmid or vector.

  “About” means 30, 25, 20, 25, 10, 9, 8, 7, 6 in reference quantity, level, value, number, frequency, percent, dimension, size, quantity, weight or length. Means an amount, level, value, number, frequency, percent, dimension, size, amount, weight or length that varies by about 5, 4, 3, 2 or 1%.

  Throughout this specification, unless the context requires otherwise, the terms “comprising” and “comprising” include the indicated stage or element, or group of stages or elements, but any other stage or element Or it should be understood to imply that a stage or group of elements is not excluded.

  Unless otherwise defined, all technical terms used in the present invention are used in the same meaning as commonly understood by one of ordinary skill in the relevant arts of the present invention. Further, desirable methods and materials are described in this specification, but similar or equivalent methods are also included in the scope of the present invention. The contents of all publications mentioned in this specification as references are incorporated into the present invention.

  The present invention will be described in detail below.

  The present inventors discovered a new strain as a result of isolating and confirming reductive acetic acid-producing bacteria after collecting and culturing rumen gastric juice of dairy cows and native goats.

  The present invention relates to such a novel reductive acetic acid-producing strain and use thereof, and relates to a microorganism belonging to the genus Proteinifilm having the ability to suppress methane formation in the ruminant ruminant and various uses thereof. is there.

  A “ruminant” used in the present invention is an animal belonging to the mammalian bovine family, and is also called a re-chunked animal as an animal having a characteristic of exhaling once again the food that has been swallowed due to its digestive form. This includes animals of the family, deer, giraffe, bovine, etc. The ruminant of the present invention is an animal having a rumen such as a cow, goat, bull, buffalo, buffalo, deer, camel, sheep, etc. belonging to the family Camelidae, Legionidae, Deerceae, Giraffeidae, Bovineceae However, it is preferably a cow.

  The rumen contains a large number of anaerobic microorganisms such as bacteria, protozoa, and fungi, and these act to digest feed ingested by the ruminant through a fermentation process.

  When ruminants ingest feed containing carbohydrates, they are fermented and decomposed by microorganisms in the rumen to produce volatile fatty acids, hydrogen, carbon dioxide, ammonia, etc. as final decomposition products. Fatty acids and ammonia are not a big problem because they are used by ruminants or microorganisms in the rumen. However, carbon dioxide and hydrogen are produced into methane by methanogenic microorganisms in ruminants, or acetic acid is produced competitively by acetic acid producing microorganisms, particularly when methane is produced. This is a problem because it cannot be absorbed in the animal body and is released to the atmosphere about 15 to 20 times per hour.

  Methane produced in the ruminants of ruminants is generated only in anaerobic conditions without oxygen, but accounts for about 15% of the total methane produced and is a major substance causing global warming. Moreover, since 3 to 12% of the total energy consumed by ruminants from feed is lost due to the production of methane, it is also closely related to feed utilization efficiency.

  Thus, when methane is produced in the ruminants of ruminants, environmental problems occur due to global warming, and feed utilization efficiency is reduced. Various methods for suppressing this production have been studied. It is the actual situation.

  In one aspect, the present invention relates to a reductive acetic acid-producing bacterium that is a Proteini film genus microorganism (strain) having an ability to suppress methane production in the ruminant stomach of ruminants.

  When a ruminant ingests a feed containing carbohydrates, it uses hydrogen or carbon dioxide among the final degradation products after being fermented and degraded by microorganisms in the rumen. A bacterium that produces acetic acid.

  When ruminants ingest feed containing carbohydrates, methane is produced in the rumen by methanogenic microorganisms, which is one of the main offenses that cause global warming and is one of the causes that reduce feed utilization efficiency. Therefore, it is important to suppress methane production in ruminants of ruminants. The reductive acetic acid-producing bacterium of the present invention effectively competes with a methanogenic microorganism to produce acetic acid, and is effective in suppressing methane production in the ruminant ruminant.

  The reductive acetic acid producing bacterium of the present invention is most preferably a Proteinifilm acetatigenes strain as a bacterium belonging to the genus Proteinifilm having the ability to suppress methane formation in the rumen.

  In one embodiment of the present invention, a new proteinifilm acetatigenes strain isolated from native goat rumen was named proteinifilm acetatigenes SROD1.

  Specifically, after collecting and cultivating rumen juice from dairy cows and native goats, the present inventors isolated and confirmed reductive acetic acid producing bacteria, and as a result, discovered new strains, of which methane removal GA3, a strain having an excellent ability, was designated as Proteininifilm acetatigenes SROD1, and was deposited with the Korean Microbiology Conservation Center on November 9, 2011 under the deposit number KCCM11219P.

  As one specific implementation, after inoculating different strains in the AC-B1 medium and cultivating them, the results of specific detection of reductive acetic acid producing bacteria using reductive acetic acid producing genes resulted in a total of 4 strains. DA02, GA01, GA02 and GA03 were selected. Further, as a result of examining the fermentation characteristics of the strains selected above, a large amount of acetic acid was detected in all the selected strains. The largest amount of acetic acid was detected.

  As another specific implementation, as a result of examining the content of volatile fatty acids in an in vitro fermentation system using the four strains selected above, all of the groups using starch and casein as a substrate were used. The highest acetate content appeared, but no lactate was detected unlike the control group.

  As another specific implementation, as a result of examining the methanogenesis inhibiting ability using the four strains selected above, the ability to inhibit methanogenesis appears excellent when starch is used as a substrate. In particular, the suppression degree of methane production of Protein 03 Acetatigenes SROD1, which is GA03, was excellent.

  Thus, the proteinifilm acetatigenes SROD1 of the present invention can be used more effectively than any other microorganisms reported so far to inhibit methane production in the ruminant of ruminants. In particular, it can be effectively used to suppress the production of methane from carbohydrate as a source.

  From another point of view, the present invention relates to a microbial preparation for suppressing methanogenesis containing the reductive acetic acid-producing bacterium.

  The reductive acetic acid producing bacterium is a microorganism belonging to the genus Proteinifilm, and most preferably, it is Proteinifilm acetatigenes SROD1.

  In the present invention, the microbial preparation can be used as a single species of the proteini film acetigenes SROD1 newly discovered by the present inventor, and in a form in which two or more types of microorganisms are mixed. Can be used. When two or more kinds of microorganisms are mixed, one or more microorganisms selected from the group consisting of microorganisms having a known ability to inhibit methane production can be included in addition to Proteinifilm acetatigenes SROD1. However, it is not necessarily limited to this.

  In the present invention, the microorganism preparation may be in a powder or liquid form.

  In the case of the microbial preparation in the powder form, it must be cultured in an anaerobic state due to the characteristics of the microorganism, and after being attached to a carrier, it is dried and powdered so that the water content is 0.1 to 10% by weight. Commercialize. When the water content exceeds 10% by weight, the reactivation efficiency of microorganisms is reduced and the increase in the effect of inhibiting methane production is slight and economically undesirable. The strain of the present invention is an anaerobic microorganism and must be produced and produced under anaerobic conditions when producing a microbial preparation in a powder form or a liquid form.

  As the carrier, one selected from the group consisting of powdered clays, activated carbon, coke, ironworks waste slag, volcanic ash and combustion ash can be used, and the clays One or more selected from the group consisting of zeolite, vermiculite, diatomaceous earth, kaolin, earthenware, feldspar, and talc can be used, but is not necessarily limited thereto.

  An excipient may be added to the microbial preparation in the powder form. In the case of the above-mentioned excipient, amino acids, vitamin C, vitamin E, chitosan and glucose can be used alone or in admixture of two or more, but not necessarily limited thereto.

  In the case of the microbial preparation in the liquid form, the final concentration is 1 to 10% by weight, preferably 1 to 5 after mixing or diluting the culture solution of the microorganism and mixing glucose or glycerin to stabilize the microorganism. Manufactured to a weight percent. When the amount of microorganisms is less than 1% by weight, the methane removal effect of the microorganism preparation may be insignificant. When the amount exceeds 10% by weight, an increase in the effect of inhibiting methane production is minutely economically undesirable. When a microbial preparation is used in a liquid form, it has an advantage that it is quicker and easier to handle than a powder product.

  In another aspect, the present invention relates to a livestock feed or a feed supplement comprising the microbial preparation for suppressing methanogenesis.

  The feed is not necessarily limited thereto, but can be obtained by pulverizing a mixture selected from any one of corn, wheat, soybean meal, beans, rice, etc., or a group comprising two or more thereof. Grinded products and processing by-products such as rice bran, bran and wheat bran obtained in the process of processing these can be used.

  The livestock feed contains 0.3 to 0.5% by weight of the microbial preparation for suppressing methane production, preferably 0.4% by weight, based on the total weight of the feed. When the microbial preparation is contained in an amount of less than 0.3% by weight, the methanogenesis control effect of the livestock feed may be insignificant, and when it exceeds 0.5% by weight, the effect is almost the same as when the effect is less than that. This is because it is uneconomical compared to the effect.

  The feed for livestock is not necessarily limited to this, but is intended to be provided to animals with ruminants such as camelids, sika deer, deer, giraffe, bovine, and preferably bovine. It is for providing to.

  The livestock feed composition of the present invention can include any additional feed additive commonly used in the art. As known by those skilled in the art, a “feed additive” enhances the quality of feed and the quality of food from animal origin, for example, increased feed materials. Fig. 3 shows a product used in an animal nutrition process for the purpose of enhancing the animals' performance to provide digestibility. Non-limiting technologies such as preservatives, antioxidants, emulsifiers, stabilizing agents, acidity regulators, and silage additives, such as, but not limited to, preservatives, antioxidants, emulsifiers, stabilizers, acidity regulators and silage additives. Additive additives; sensory additive, especially flavors and colorants; (additional) nutritional supplements such as vitamins, amino acids and trace elements Additives; and digestibility enhancers and gut flora stabillizers (additional ) May include livestock additives.

  The animal feed supplement of the present invention can include any additional ingredients that do not depart from the scope of the present invention. This can generally include known excipients necessary to produce the desired product form, which improves feed quality and / or Additives aimed at improving the performance of animals consuming supplements can additionally be included. Suitable examples of such excipients are carriers or lactose, sucrose, mannitol, starch crystalline cellulose, sodium hydrogen carbonate, sodium chloride. And fillers such as gum arabic, gum tragacanth, sodium alginate, starch, PVP, cellulose derivatives and the like. Examples of feed additives known to those skilled in the art include vitamins, amino acids and trace elements, digestibility enhancers, and enter flora stabilizers, etc. Can do.

  The microorganisms of the present invention in livestock feeds are non-toxic, have resistance to acids, enzymes and bile and have the property of surviving while going to the intestines. In addition, it exhibits physiological activity even in an anaerobic environment and can be adsorbed and grown on epithelial cells and mucous membranes in the intestine.

  And when ingesting the said livestock feed, the production | generation of the methane in the ruminant ruminant of a ruminant can be suppressed, the global warming effect can be prevented, and feed utilization efficiency can be increased.

  On the other hand, the present invention includes, as another application of the reductive acetic acid-producing bacterium, a method for suppressing methane production in the ruminant stomach of ruminants by feeding it to animals.

  In the present invention, the reductive acetic acid producing bacterium uses hydrogen or carbon dioxide among products after being fermented and decomposed by microorganisms in the rumen when the ruminant ingests a feed containing carbohydrates. A bacterium that produces acetic acid. The reductive acetic acid-producing bacterium is not limited to this type as long as it can suppress methane production in the ruminant stomach of ruminants. The protein film Acetatigenes SROD1 is desirable.

  The Proteinifilm acetatigenes SROD1 is a novel reductive acetic acid-producing bacterium isolated from the rumen of a native goat by the present inventors, and effectively competes with a methanogenic microorganism for acetic acid. It is effective in suppressing methane production in ruminants of ruminants.

  In the method of the present invention, the feed refers to providing the ruminant with a microbial preparation containing the reductive acetic acid-producing bacterium or a livestock feed containing the microbial preparation. The method is not limited to this as long as it is a method for providing a producing bacterium.

  The form of the microbial preparation is not limited to those produced in a powder or liquid form, and the reductive acetic acid-producing bacterium can be used in a form of one kind or a mixture of two or more kinds. The characteristics and content of the microbial preparation are as described above.

  The livestock feed is a feed fed to ruminants for the growth of ruminants, and the livestock feed of the present invention refers to a food containing a microbial preparation containing the reductive acetic acid producing bacteria. Its properties and contents are as described above.

  When the reductive acetic acid producing bacteria are fed to an animal and the ruminant ingests it, methane production in the ruminant stomach of the ruminant can be suppressed to prevent global warming and increase feed utilization efficiency. be able to.

  As described above, the present invention relates to a function of suppressing the methane production of a bacterium belonging to the genus Proteinini film as a reductive acetic acid-producing bacterium. In particular, the proteinifilm acetatigenes SROD1 strain isolated and identified by the present inventors is , Which is superior to any other microorganisms reported so far in suppressing methane formation in ruminants of ruminants, and can be usefully used to suppress methane formation It is.

  Hereinafter, the present invention will be described in more detail by way of examples. These examples are merely illustrative of the present invention, and it is understood by those skilled in the art that the scope of the present invention is not limited by these examples due to the gist of the present invention. It is self-evident.

Example 1: Breeding environment and collection of gastric juice and culture of dairy cows (Nyugu) and native goats 1-1. Breeding environment of dairy cattle and native goats Dairy cattle are bred on a farm attached to Suncheon University, and native goats are bred and bred at Jeollanam-do Courtesy. (Hoste friesian) dairy cows and native goats were used. During the experimental period, dairy cows fed rice straw and concentrate at a ratio of 6: 4 twice a day at a level of 2% of body weight, and traditional goats fed rice straw freely and fed 800g daily of fattening concentrate. did.

1-2. Ruminal fluid collection and culture Ruminal fluid was collected from the dairy cows and native goats of Example 1-1.

  Ruminal fluid was collected from the dairy cows and native goats, and the feed particles were removed using a quadruple cheese cloth, then stored in a heat-retained and anaerobic container and transported to the laboratory.

After adding BES (bromothenesulfonic acid) to 50 mL of rumen fluid collected in each serum bottle (Serum bottle) to a final concentration of 50 mM, 80% N ₂ -20% CO ₂ (vol. %) Gas was bubbled. A culture solution into which 80% N ₂ -20% CO ₂ (vol%) gas was injected was used as a control group, and a culture solution into which 80% H ₂ -20% CO ₂ (vol%) gas was injected was used as an experimental group. Sealed with an aluminum cap. Thereafter, the control group and the experimental group were cultured at 39 ° C. in a shaking incubator for 1 week at a speed of 120 rpm.

Example 2: Isolation of strain and extraction of DNA 2-1. Separation of strains In order to separate reductive acetate generators that effectively compete with the methane-producing microorganisms (methanogens) from the rumen juice collected and cultured in Example 1-2, as a selective medium. After inoculating 5% of the cultured rumen juice into 5 mL of AC-B1 medium (Le Van et al., 1998) having the components shown in Table 1 below, it is cultured at a speed of 120 rpm in a 39 ° C. shaking incubator for 1 week. did.

Thereafter, 0.5 mL of the primary culture solution was subcultured under the same conditions in a fresh AC-B1 medium, and the third subculture was performed. During subculturing, it was injected additionally _{80% H 2 -20% CO 2} (vol%) gas.

For pure separation of reductive acetogenic bacteria was diluted to decimal dilution ¹⁰ 0 ^10-9 using the AC-B1 media 1 to 3 primary cultures were cultivated under the ^{10 -2} to After 10 ⁻⁹ diluted solution was smeared on AC-B1 agar medium, it was cultured for 1 week in a 39 ° C. incubator in an anaerobic chamber (Visionbionex, N ₂ : 90%, H ₂ : 5%, CO ₂ : 5%). Then, in order to finally isolate reductive acetic acid-producing bacteria, after re-smearing and culturing, the isolated strain was stored frozen.

2-2. DNA Extraction After the strain isolated in 2-1 was cultured in a solid medium, colonies were placed in a tube, and then 100 μL of 5% Chelex (Biorad) was added. Then, after 10 minutes at 95 ° C., DNA was extracted from the supernatant.

Example 3: Identification of strain 3-1. Performing PCR and confirming DNA In order to confirm the species of the strain isolated in Example 2-1, a polymerase chain reaction (PCR) experiment was performed using 16S rDNA of the isolated strain. did.

  After taking an appropriate amount of colonies from the AC-B1 agar medium and transferring them to a 1.5 mL tube, 100 μL 5% Chelex 100 Resin (Biorad, USA) was added, heat-treated at 95 ° C. for 10 minutes, and then separated from the center. Then, 1 μL of the supernatant was taken and used as a DNA template for the PCR reaction.

  As primers, universal primers 27F (5′-AGA GTT TGA TCM TGG CTC AG-3 ′; SEQ ID NO: 1) and 1492R (5′-TAC GGY TAC CTT GTT ACG ACT T-3 ′; sequence No. 2) was used (Nubel et al. 1996. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymixa detected by temper.

  PCR conditions were: 1 μL of amplified DNA, 2 μL of reverse primer and 2 μL of amplified DNA, 50 μL of PCR mixed solution, 1 μL of 2.5 mM dNTPs, 1.25 unit of Taq polymerase (Takara, Japan), 0.25 μL, PCR buffer solution ( Distilled water is added to 5 μL of 15 mM MgCl 2, 100 mM Tris-HCl pH 8.3, 500 mM KCl) and pre-denaturation is performed at 94 ° C. for 5 minutes, and then denaturation is performed at 94 ° C. for 45 seconds. The process of annealing at 55 ° C. for 45 seconds and extending at 72 ° C. for 1 minute was repeated a total of 32 times. Post-extension was performed at 72 ° C. for 10 minutes. The experiment was performed using Applied Biosystem's Gene Amp PCR System 2700 thermocycler.

  The final reaction product was electrophoresed with 1% agarose gel for 40 minutes at 100 V and stained with EtBr to confirm the amplification product. After treating the 16S rRNA PCR amplification product with a restriction enzyme, the cleavage mode of each strain was observed. After treatment with Hae III and Hha I (Takara, Japan) at 37 ° C. for 5 hours, the restriction enzyme-treated product was treated with 2.5% Metaphor agarose gel (BioWhittaker, USA) at 170V at 70V. Electrophoresis was performed for minutes, stained with EtBr and confirmed under UV. After clustering the confirmed band patterns and investigating different band types, strains that can be represented were selected.

  As a result, there were 13 reductive acetic acid producing strains isolated from rumen gastric juice and 13 types of dairy cows and 36 types of native goats. The same strains were isolated by treating two restriction enzymes.

3-2. Analysis of DNA base sequence The DNA amplified in Example 3-1 was isolated using QIAgen QIAquick PCR Purification Kits (Qiagen, USA). Thereafter, the separated DNA was sent to Macrogen (Ota, Korea) to analyze the DNA sequence in both directions.

3-3. Detection of reductive acetic acid-related genes For the separation of reductive acetic acid-producing microorganisms, the reductive acetic acid-related gene FTTHS (Formyl tetrahydrofolate synthase) was used for separation and identification. Reductive acetic acid producing bacteria were specifically detected.

  After using FTHFSf (5′-TTYACWGGHGAYTTCCATGC-3 ′; SEQ ID NO: 3) and FTHFSr (5′-GTATTTGDGTYTTRGCCATACA-3 ′; SEQ ID NO: 4) as primers, PCR was performed by the method of Example 3-1 above. .

  That is, 1 μL of the prepared DNA template was taken into a PCR eppendorf tube, where FTHFS primer FTHFSf and FTHFSr were each 1 μL, each 2.5 mM dNTPs 0.5 μL, and 1.25 unit of Taq polymerase (Takara, Japan) 0.125 μL. PCR buffer solution (15 mM MgCl2, 100 mM Tris-HCl pH 8.3, 500 mM KCl) (2.5 μL) was added, and PCR was performed with sterilized distilled water to a total volume of 25 μL. The PCR reaction conditions were as follows: every 5 cycles in touchdown PCR, the temperature was decreased by 1 ° C from 63 ° C to 55 ° C, initial denaturation was 94 ° C for 2 minutes, denaturation was 94 ° C for 30 seconds, and extension was 72 ° C. 1 minute each at ° C. The last cycle was amplified by 25 cycles and extended at 72 ° C. for 10 minutes.

  The final reaction product was electrophoresed with 1% agarose gel for 40 minutes at 100 V, stained with EtBr, and the amplified product was observed to confirm DNA having a size of 1 kb. That is, the FTHFs gene was detected from an existing comparative strain known as reductive acetic acid bacteria and a reductive acetic acid-producing strain isolated from dairy cows and native goats, and showed an amplified product having a size of about 1 kb (FIG. 1). ).

Example 4: Generation of phylogenetic tree of reductive acetic acid producing bacteria Strains classified from 16S rRNA sequence analysis results were re-PCRed using reduced acetic acid producing primer FTHFs gene primers (G Henderson et al., 2010). Crotonoxydans and Paenibacillus acetigenes strains were isolated and identified.

As a result, a total of 4 types of microorganisms having the FTHFS gene were selected from 1 type (DA02) from dairy cattle and 3 types (GA01, GA02, GA03) from native goats, and the base sequence of the selected microorganisms was selected from National. The results of comparison using Blast Network Service of Center Biotechnology Information (NCBI) are shown in Table 2 below, and the analyzed base sequence of GA03 strain is shown in SEQ ID NO: 5.
[SEQ ID NO: 5]
gcacgggtgagtaacacgtatgcaacctgccttcaacaaggggataacccgttgaaagac
ggactaataccctataacacaggggccccgcatggggatatttgttaaagattaatcggt
tgaagatgggcatgcgttccattagctagttggtggggtaatggcccaccaaggcaacga
tggataggggaactgagaggtttatcccccacactggtactgagacacggaccagactcc
tacgggaggcagcagtgaggaatattggtcaatggacgcaagtctgaaccagccacgtcg
cgtgaaggaagacggccctacgggttgtaaacttcttttgcaatgggaataaagtgagtc
acgtgtgacgtttttgcaagtaccttgcgaataaggatcggctaactccgtgccagcagc
cgcggtaatacggaggatccgagcgttatccggatttattgggtttaaagggtgctcagg
cgggcgattaagtcggcggtgaaattttgcggctcaaccgtaaaagtgccttcgaaactg
gttgccttgagtgtggatgaggtaggcggaatttgtggtgtagcggtgaaatgcatagat
atcacgaggaactccgattgcgcaggcagcttactaagccataactgacgctcaagcacg
gaggcgtggggatcagacaggattagataccctggtagtccacgcagtaaacgatgatta
ctggctgtttgcgatataatgtaagcggctgagcgacagcgttaagtaatccacctgggg
agtacgttcgcaagaatgaaactcaaaggaattgacgggggcccgcacaagcggaggaac
atgtggtttaattcgatgatacgcgaggaaccttacccgggcttgaaatgcatctggcgt
ctccagagatggggatttccttcgggacagatgtgtaggtggtgcatggttgtcgtcagc
tcgtgccgtgaggtgtcggcttaagtgccataacgagcgcaaccctcatcgttagttgcc
atcaggtcaagctggggactctaacgagactgccatcgtaagatgcgaggaaggtgggga
tgacgtcaaatcagcacggcccttacgtccggggcgacacacgtgttacaatgggtggta

  The microorganisms selected in Example 4-1 were analyzed for 16S rRNA base sequence, compared with the previously reported reductive acetic acid producing strains containing the FTHFs gene, and the phylogenetic position was examined.

  In order to determine the phylogenetic affiliation, the BLAST program and EzTaxon were used to compare with the base sequence of the 16s rRNA gene in Gene Bank of NCBI (National Center Biotechnology Information).

  Alignment of the base hierarchy was accomplished using the CLUSTAL W version 1.6 (Thompson et al.1994.CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680). Kimura two-parameter model (Kimura, M., 1980.A simple method of estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.J.Mol.Evol.16,111-120) using distance matrix calculated by Then, a phylogenetic tree was prepared by the NJ (neighbor-joining) method, and the bootstrap value was calculated 1000 times. The phylogenetic tree created by the method as described above is shown in FIG.

  As a result of the examination, the DA02, GA01 and GA03 strains were confirmed to belong to the genus Proteiniphylum of the Bacteroidetes group, but the similarity was shown to be 99%, and it was known to date because of low association with other groups. It can be said that there is a high possibility that it is not a new species. GA02 strain belongs to the Almicaliphilus of the Firmicutes group and showed 98% similarity.

Example 5: Measurement of in vitro fermentation characteristics of reductive acetic acid producing bacteria 5-1. Formation of aceto acid

  Among the isolated reductive acetic acid producing strains selected in Example 4, the number of microorganisms having the FTHFs gene was four. As a comparative strain, Eubacterium limosum ATCC 8486 was used as a reductive acetic acid-producing bacterium isolated from the existing rumen.

  All strains were subcultured for 2 passages prior to inoculation and RM02 medium (Kenters et al., 2009) having the composition shown in Table 3 was used for fermentation characteristics analysis at a speed of 100 rpm in a 39 ° C. shaking incubator. For 4 days.

The culture conditions were as follows: a strain grown in a medium infused with 80% N ₂ -20% CO ₂ (vol%) gas was used as a control, and a medium infused with 80% H ₂ -20% CO ₂ (vol%) gas and A strain grown on a medium supplemented with 5 mM glucose was used as an experimental group.

Thereafter, the culture broth of the strain cultured above was separated at 10,000 g for 15 minutes, the supernatant was filtered through a 0.45 μm filter, and the fermentation characteristics of each strain were measured by HPLC (Agilent Technologies 1200 Series, USA). analyzed. The column was METACARB 87H (Varian, USA), the detector was Agilent 1200 Series diode-array detector (210 nm / 220 nm), and the strain sample was moved at a flow rate of 0.6 mL / min at 35 ° C. The mobile phase solvent used was 0.0085N H ₂ SO ₄ , and 10 μL was injected into the column using an autosampler, and the analysis results are shown in Table 4 below.

  And when starch and casein were used as substrates on in vitro fermentation, the case of aceto acid production was observed.

  The in vitro fermentation times of the water-soluble starch and the casein substrate were 0, 3, 6, 9, 12 and 24 hours. The treatment groups per fermentation time for each substrate were the control group (con) to which sterilized AC-B1 medium was added, and the E. coli to which Eubacterium limosum was added as a comparative strain. limosum, DA02 supplemented with Proteiniferium acetatigenes isolated from Holstein dairy cows, GA01 supplemented with Proteiphyllum acetatigenes isolated from Korean native goats, GA02 supplemented with Alkalyphilus crotonatoxidans, and each protein fermented in the fermentation time with GA02 added to each protein substrate. This was carried out in 3 repetitions of 3 substrates and 6 treatment groups.

  The results are shown in FIG. 3 and FIG.

  As can be seen from the above results, all of the selected strains DA02, GA01, GA02 and GA03 produce a larger amount of acetoic acid (acetic acid) than the comparative strains, especially GA03 which is a strain isolated from a conventional goat. Acetic acid was detected, and lactate (dairy) was produced only in the treatment section to which glucose was added.

5-2. Additional experiments Additional experiments were performed to determine the volatile fatty acid content of selected strains.

The anaerobic environment buffer filtered ruminant gastric fluid in were mixed at a ratio of 1: 2, the buffer amount _K 2 _HPO 4 _{5 g} of water _{1l, KH 2 PO 4 4g,} NaCl 0.52g, MgSO 4 -7H 70 mg of ₂ O, 35 mg of CaCl ₂ , 5.9 g of NaHCO ₃ and 174 g of cysteine HCl were mixed and then titrated so that the pH was 6.8. Thereafter, 0.25 g of starch and casein as substrates are put in each sterilized bottle, and then 25 mL of a buffer amount mixed with the rumen gastric juice is added, and each of the four strains selected in Example 4 is added. 5 mL was inoculated. Thereafter, the bottles were placed in a shaking incubator and then subjected to anaerobic culture at 39 ° C. at a speed of 120 rpm, and then volatile fatty acid values were measured after 0, 24 and 48 hours of culture.

  Volatile fatty acids (butyrate, propionate and acetate) and lactate were measured using high performance liquid chromatography (HPLC). As a solvent, 0.0085 normal sulfuric acid was flowed at a rate of 0.6 μL / min, and the column temperature was maintained at 35 ° C. Samples were separated at the 13,000 rpm speed at 13,000 rpm before use for 10 minutes at 4 ° C., and the supernatant was removed, filtered through a 0.2 μm filter from Millipore, and 20 μL was injected.

  The experimental results when starch is used as a substrate are shown in FIG. 5, and the experimental results when casein is used as a substrate are shown in FIG.

  When starch was used as the substrate and casein was used as the substrate, the volatile fatty acid content increased as the culture time increased, and the acetate content was the highest in all groups. In addition, when starch was used as a substrate, butylate was produced after 24 hours of culture in all of the control group and the experimental group. In the case of the control group, lactate was detected after 24 hours of culture, but not in the experimental group.

  When casein was used as a substrate, butylate was detected in the experimental group and the control group except the GA03 group at 0 hour of culture, but no butylrate was detected in all groups after the culture was started. . In the case of the control group, lactate was detected after 24 hours of culture, but not in the experimental group.

5-3 Measurement of Methane Gas Content In order to evaluate the ability of the strain selected in Example 4 to suppress methane production, the degree of methane production suppression of each strain was observed using the method of Example 5-1.

  In the in vitro analysis test in which casein was added as a substrate, the amount of methane generated was reduced in the treatment group (50,185 ppm) to which the reductive strain, Proteiniphyllum acetagenes (GA03) was added, compared to the control group (86,575 ppm). In addition, in the in vitro test in which starch was added as a substrate, the treatment group (8,934 ppm) to which the reductive production strain Proteinophilacetategenes (GA03) was added had a lower methane generation amount than the control group (29,705 ppm). I was able to confirm. Such a result is illustrated in FIG.

  On the other hand, in order to additionally evaluate the ability to suppress methane production, the methane production inhibition degree of each strain was observed using the method of Example 5-2, and as a result, the methane of each strain when starch was used as a substrate. The degree of production inhibition is shown in FIG. 8 below, and the result of observing the degree of methane production inhibition of each strain when casein is used as a substrate is shown in FIG. 9 below.

  As a result of additional experiments, when starch was used as a substrate, it was shown that methane production was effectively suppressed in all experimental groups after 48 hours of culture, and the methane production suppression ability of the GA03 group was the best. Was observed.

  When casein was used as a substrate, the methane concentration in the experimental group increased compared to the control group after 24 hours of culture, but the methane concentration decreased after 48 hours of culture, particularly in the case of GA02 and GA03. It was shown that the methane concentration decreased compared to the group.

Example 6: In Vivo Fermentation Properties Steering Korean beef with an average body weight of 376.75 ± 6.25 kg fitted with a rumen cannula (Bar Diamond, Parma, ID, USA; internal diameter, 120 mm) for fermentation properties testing The rumen fluid necessary for the fermentation property test was collected from the above.

  This test livestock was fed 5 kg of concentrated feed and 1 kg of rice straw twice a day (09: 00, 17:00), and the raw material composition of the mixed feed and the chemical composition of the mixed feed and rice straw were The configuration was as shown in Table 5 below.

This experiment was a 4 × 4 Latin square design, and the period was 21 days. On the 1st to 15th out of 21 days, the amount of CH ₄ generated by feeding the additive was measured every other day, and the fermentation properties were investigated on the 5th. 16-21 days had a recovery period so that the microorganisms and environmental composition in the rumen returned to their original state. Experiments were performed in the control group (control, 3 g of saccharin, 33.6 g of soybean cake, 33.6 g of defatted rice cake); and the group to which Acetogen was added (acetogen mixture 120 g, saccharin 3 g).

  Then, in order to measure the respiratory gas, 4 steers (392 ± 14 kg) in the late fattening period of 29 months after birth were tested in the livestock metabolism experiment building of the National Institute of Livestock Sciences, Rural Promotion Agency. The test feed was fed 5 kg of concentrated feed mainly composed of corn and 1 kg of rice straw twice a day (09:00:00, 17:00). The test period was a feed adaptation period of 6 days and a respiratory gas measurement of 15 days, requiring 21 days per period. However, gas measurement was performed seven times every other day in 15 days. The methane measurement and recovery period by period was designed as shown in Table 6 below.

  The results of measuring in vivo methane production of reductive acetic acid producing bacteria (GA3) isolates using a respiratory chamber (FIG. 11) conducted at the National Institute of Animal Science (RDA) are shown in the figure.

  As a result, 174 (l / day / head) in the control group, 163 (l / day / head) in the acetogen treatment group, and 5.8% methane reduction effect in the treatment group to which reductive acetic acid-producing bacteria were added. Occurred.

  As confirmed in the above examples, when the present inventors confirmed that GA03, which is a strain extracted from a native goat, has excellent methane production-inhibiting ability, the strain was identified as Proteinifilm acetatigenes. It was named SROD1 and was deposited at the Korean Preservation Center on November 9, 2011 under the deposit number KCCM11219P.

Claims (8)

  A proteinase genus reductive acetic acid-producing bacterium having an ability to suppress methane formation in the rumen of ruminants.   The reductive acetic acid-producing bacterium according to claim 1, characterized in that the reductive acetic acid-producing bacterium is Proteininifilm acetatigenes SROD1 (deposit number KCCM11219P).   A microorganism preparation for suppressing methane production in the ruminant stomach of a ruminant animal, comprising the proteini film reductive acetic acid producing bacterium of claim 1.   4. The microbial preparation according to claim 3, wherein the Proteinifilm genus reductive acetic acid producing bacterium is Proteinifilm acetatigenes SROD1 (deposit number KCCM11219P).   A livestock feed comprising the reductive acetic acid-producing bacterium preparation of claim 1 or the microbial preparation of claim 4.   A method for suppressing methane production in the ruminant stomach of a ruminant by feeding an animal with the reductive acetic acid producing bacterium preparation of claim 1 or the microbial preparation of claim 4.   The method according to claim 6, wherein the reductive acetic acid-producing bacterium is Proteinifilm acetatigenes SROD1.   The ruminant in the ruminant according to claim 7, wherein the feed provides the ruminant with a microbial preparation containing the reductive acetic acid-producing bacteria or a livestock feed containing the microbial preparation. To suppress methane production.