JP2013500018A - Methods for genome editing - Google Patents

Abstract

The present invention encompasses a method for creating an animal or cell having at least one chromosome edit. In particular, the invention relates to the use of targeted zinc finger nucleases to edit chromosomal sequences. The present invention further encompasses animals or cells created by the methods of the present invention.

Description

A hard copy document of the reference sequence listing to the sequence listing and a computer readable form of the same sequence listing are attached below and incorporated herein by reference. This information recorded in computer readable form is 37 C.I. F. R. Identical to the written sequence listing according to 1.821 (f).

The present invention encompasses a method for creating an animal or cell having at least one chromosome edit. In particular, the invention relates to the use of targeted zinc finger nucleases to edit chromosomal sequences.

Rational genome manipulation has enormous potential across basic research, drug discovery, and cell-based drugs. Existing methods for target gene knockout or site-specific gene insertion rely on homologous recombination. However, the low rate of spontaneous recombination in certain cell types is a major obstacle to universal genome editing. In order to isolate the target event, the scale and time of exaggerated screening efforts are required. Thus, there is a strong need for techniques that can rapidly achieve genome editing with high speed and efficiency in most cell types in order to significantly reduce overall manipulation efforts.

  One aspect of the invention encompasses a method for editing a chromosomal sequence. The method includes, in part, (a) encoding a zinc finger nuclease capable of recognizing a target sequence in a chromosomal sequence and cleaving a cleavage site in the chromosomal sequence in a cell containing the chromosomal sequence, One nucleic acid, and optionally (i) a donor sequence for incorporation, an upstream sequence, and a downstream sequence, wherein the donor sequence is flanked by upstream and downstream sequences, and the upstream and downstream sequences are At least one donor polynucleotide that shares substantial sequence identity with either side of the cleavage site, or (ii) an exchange sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site, at least Introducing at least one exchange polynucleotide further comprising one nucleotide change, and (b) a zinc finger nucleotide Culturing the cells to allow expression of the zinc finger nuclease such that the ase introduces a double-strand break into the chromosomal sequence at the break site, wherein the double-strand break comprises (i ) A non-homologous end-joining repair process such that the mutation is introduced into the chromosomal sequence, or optionally (ii) the donor sequence is integrated into the chromosomal sequence, or the exchange sequence is exchanged for part of the chromosomal sequence It is repaired by a homology-directed repair process.

  Another aspect of the invention encompasses non-human animals. The non-human animal, in part, encodes a zinc finger nuclease capable of recognizing a target sequence in a chromosomal sequence and cleaving a cleavage site in the chromosomal sequence in a cell containing the chromosomal sequence, At least one nucleic acid, and optionally (i) a donor sequence for incorporation, an upstream sequence, and a downstream sequence, wherein the donor sequence is flanked by upstream and downstream sequences, the upstream and downstream sequences Wherein at least one donor polynucleotide shares substantial sequence identity with either side of the cleavage site, or (ii) an exchange sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site, Introducing at least one exchange polynucleotide further comprising at least one nucleotide change; and (b) a zinc finger It may be created by culturing the cells to allow expression of zinc finger nuclease so that the clease introduces a double-strand break into the chromosomal sequence at the break site, where the double-strand break is (I) a non-homologous end-joining repair process in which the mutation is introduced into the chromosomal sequence, or optionally (ii) the donor sequence is integrated into the chromosomal sequence, or the exchange sequence is part of the chromosomal sequence It is repaired by a homology-directed repair process as exchanged.

  Yet another aspect of the invention encompasses cells. The cell partially encodes a zinc finger nuclease capable of recognizing a target sequence in a chromosomal sequence and cleaving a cleavage site in the chromosomal sequence in a cell comprising (a) a chromosomal sequence. One nucleic acid, and optionally (i) a donor sequence for incorporation, an upstream sequence, and a downstream sequence, wherein the donor sequence is flanked by upstream and downstream sequences, and the upstream and downstream sequences are At least one donor polynucleotide that shares substantial sequence identity with either side of the cleavage site, or (ii) an exchange sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site, at least one Introducing at least one exchange polynucleotide further comprising one nucleotide change; and (b) a zinc finger nucleotide It may be created by culturing cells to allow expression of zinc finger nuclease, such that a double stranded break introduces a double stranded break into the chromosomal sequence at the cleavage site, where the double stranded Cleavage can be (i) a non-homologous end-joining repair process, such that the mutation is introduced into the chromosomal sequence, or optionally (ii) the donor sequence is integrated into the chromosomal sequence, or the exchange sequence is part of the chromosomal sequence It is repaired by a homology-directed repair process as exchanged for.

  A further aspect of the invention includes an embryo. Typically, an embryo recognizes a target sequence within a chromosomal sequence and encodes a zinc finger nuclease capable of cleaving a cleavage site within the chromosomal sequence, and optionally (i) integration A donor sequence, an upstream sequence, and a downstream sequence, wherein the donor sequence is flanked by upstream and downstream sequences, wherein the upstream and downstream sequences are substantially on either side of the cleavage site At least one exchange comprising at least one donor polynucleotide sharing sequence identity, or (ii) an exchange sequence substantially identical to a portion of the chromosomal sequence at the cleavage site, further comprising at least one nucleotide change Including polynucleotides.

Other aspects and iterations of the invention are more fully described below.

Reference to color drawing

The application file includes at least one photograph created in color. Copies of this patent application publication, including color photographs, will be provided by the Patent Office upon request and payment of the necessary fee.

Schematic showing repair results after targeted ZEN-induced double strand breaks. Shaded bars represent donor fragments while white bars indicate target sites for ZFN double strand breaks. Schematic showing construction of RFLP donor plasmid. Left and right PCR amplified fragments homologous to the plasmid and the integration target site are shown. The restriction enzymes used for cloning are indicated. The left fragment used KpnI and Notl or Pmel. The right fragment used Notl or Pmel and SacII. Schematic showing the construction of a GFP expressing donor plasmid. The GFP cassette was PCR amplified from an existing plasmid and cloned into a Notl RFLP donor using the Notl site. Schematic showing how to detect (A) RFLP integration and restriction enzyme digestion, and (B) integration of a GFP expression cassette using PCR amplification. Photographic image of fluorescently stained PCR fragments resolved on an agarose gel. The leftmost column contains the DNA ladder. Columns 1-6 contain PCR fragments amplified with mouse Mdr1a specific primers from all or part of mouse blastocysts. Rows 1 and 2 were amplified from 5/6 and 1/6 of the blastocyst, respectively. Row 3 was derived from one whole blastocyst. Rows 4-6 were derived from 1/2, 1/3, and 1/6 of the same blastocyst, respectively. Column 7 contains a positive control PCR fragment amplified with the same primers from extracted mouse toe DNA. Photographic image of a fluorescently stained DNA fragment resolved on an agarose gel. The leftmost column contains the DNA ladder. (A) Columns 1-39 show 37 mouse embryos cultured in vitro after microinjection of RFLP donor with ZFN RNA and Notl site for mouse Mdr1a, along with one positive and negative control for PCR amplification. PCR fragments amplified using a specific primer of mMdr1a. (B) Rows 1-39 contain PCR fragments after A) Surveyor's mutation detection assay. Photographic image of a fluorescently stained DNA fragment resolved on an agarose gel. The leftmost and rightmost columns contain DNA ladders. Column (A) contains PCR fragments that were amplified using mMdr1a specific primers from the mouse embryo of FIG. 6 and digested with Notl without purifying the PCR product. FIG. 7B is a longer reaction of the same gel of FIG. 7A. The uncleaved PCR product is about 1.8 kb and the digested product is two bands of about 900 bp. Photographic image of a fluorescently stained DNA fragment resolved on an agarose gel. The leftmost column contains the DNA ladder. Columns 1-6 show some of the PCR fragments from FIG. 7 that were digested with Notl after the PCR product was column purified so that Notl could work in its optimal buffer. Including. Columns 7 and 8 are two of the Notl digested samples, as in FIG. This gel shows that Notl digestion in the PCR reaction is complete. Photographic image of fluorescently stained PCR fragments resolved on an agarose gel. The leftmost column contains the DNA ladder. Columns 1-5 contain PCR fragments amplified with PXR-specific primers from a whole rat blastocyst, 1/2, 1/6, 1/10, 1/30. Column 6 is a positive control amplified with the same primers from purified Sprague Dawley genomic DNA. Photographic image of a fluorescently stained DNA fragment resolved on an agarose gel. The leftmost and rightmost columns contain DNA ladders. Column (A) contains PCR fragments amplified from rat embryos cultured in vitro after microinjection of PXR ZFN mRNA and Notl RFLP donor and digested with Notl using PXR specific primers. Column (B) contains the same PCR fragment as in FIG. 10A after a surveyor mutation detection assay. Photographic image of a fluorescently stained DNA fragment resolved on an agarose gel. The first four rows are PCR amplifications from four fully developed fetuses 12.5 days after conception from an embryo injected with mMdr1a ZFN mRNA with a Notl RFLP donor. PCR was digested with Notl. Column 4 is that of positive. Rows 5-8 are four deciduas, degenerated implantations. All four were negative. Schematic and photographic image of fluorescently stained DNA fragments resolved on an agarose gel. (A) Schematic showing the location of the primers used. Panels (B) and (C) show the results from primers PF and GR. Panels (D) and (E) show the results from primer PR + GF. The expected fragment size is 2.4 kb. Two of the 40 embryos were positive for GFP. Photographic image of a DNA fragment resolved on an agarose gel. Column 8 represents a 13 dpc fetus that is positive for the Notl site. 2 illustrates ZFN-mediated cleavage of SMAD4 in human and cat cells detected by a Cel-1 surveyor nuclease assay. G = GFP (no ZFN control). Z = SMAD4 ZFN (191160/19159). Arrows indicate cleavage products. Figure 2 shows a Cel-1 assay supporting SMAD4 ZFN activity in feline embryos. Illustrates the cleavage of Fel d1 in AKD cells. A Cel-1 screen of Fel d1 ZFN pair 17, 18 cleavage of strand 1-exon 1 is presented. 2 illustrates Fel d1 chain 1-exon 2 cleavage in AKD cells at Fel d1 ZFN pairs 7,9. FIG. 6 shows Cel-1 analysis of Fel d1ZFN versus 12/13 cleavage of chain 1-exon 2 in AKD cells. Illustrates cleavage of the FeI d1 locus in feline embryos at ZFN pairs 17, 18 and 12,13. Rows 1, 2, 7, and 8 contain samples from individual blastocysts derived from embryos injected with 40 ng / μL ZFN. Row 3 presents samples from blastocysts derived from embryos injected with 20 ng / μL ZFN. Rows 4, 9, and 10 contain samples from individual morulas derived from embryos injected with 40 ng / μL of ZFN. Row 3 presents samples from morulas derived from embryos injected with 20 ng / μL of ZFN. Column 6 presents samples from control blastocysts. The edited Fel d1 locus DNA sequence containing the 4541 bp deletion (SEQ ID NO: 51) between the coding regions for strand 2 and strand 1 is presented. The edited Fel d1 locus (indicated by the red dotted line and labeled “Sample 5”) containing the 4541 bp deletion is aligned with the sequence of the wild type Fel d1 locus (SEQ ID NO: 52). In the edited sample, the binding site for ZFN13 is truncated (and the binding site for ZFN12 is missing), but the binding sites for ZFN pairs 17, 18 are intact. FIG. 4 shows cleavage of the cauxin locus by Aux cells by Cauxin ZFN vs. 1/2 (column 2), ZFN vs. 9/10 (column 4), and ZFN vs. 17/18 (column 5). Columns 1 and 3 contain samples from control (GFP) cells. Illustrates cleavage of the Cauxin locus by Cauxin ZFN pair 29/30 (Row 2). Column 2 contains control (GFP) samples. Incorporation at the TUBA1B locus is shown. (A) shows the chromosomal sequences in the target region for integration of the heterologous coding sequence, the ZFN binding site (yellow sequence) on the chromosome target region, the ZFN cleavage site (yellow arrow), and the integration site (green arrow) ( SEQ ID NO: 85). (B) presents a schematic of the TUBA1B locus, site of integration, SH2 biosensor design, and protein expressed after successful integration. (C) Present images of Western blots of wild type and integrated cells. FIG. 4 shows a map of a donor plasmid containing an SH2 biosensor sequence flanked by TUBA1A sequences in the target region. Presented are differential interference (DIC) and fluorescence microscopy images of individual isolated cell clones expressing GFP-2xSH2-Grb1-2 protein. The fluorescence image shows the time course of biosensor translocation after exposure to 100 ng / mL EGF. Presents a map of the donor plasmid containing the SH2 biosensor sequence flanked by ACTB sequences in the target region. Fluorescence microscopic images of individual isolated cell clones expressing GFP-2xSH2-Grb1-2A (upper panel) and RFP-β-actin (lower panel) are shown. The time course after exposure to 100 ng / mL EGF is presented. The DNA sequences of the two edited LRRK2 loci are presented. The upper sequence (SEQ ID NO: 92) has a 10 bp deletion in the exon 30 target sequence and the lower sequence (SEQ ID NO: 93) has an 8 bp deletion in the exon 30 target sequence. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequences of the two edited ApoE loci are presented. The upper sequence (SEQ ID NO: 114) has a 16 bp deletion in the exon 2 target sequence and the lower sequence (SEQ ID NO: 115) has a 1 bp deletion in the exon 2 target sequence. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited leptin locus is shown. A region of the leptin locus (SEQ ID NO: 116) in which 151 bp have been deleted from exon 1 and intron 1 is presented. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequences of the edited APP loci in two animals are presented. (A) A region of the rat APP locus (SEQ ID NO: 127) from which exons 9 to 292 bp have been deleted is shown. (B) Presents the region of the rat APP locus (SEQ ID NO: 128) where a 309 bp deletion in exon 9 is present. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited Rag1 locus in two animals is presented. The upper sequence (SEQ ID NO: 131) has an 808 bp deletion in exon 2 and the lower sequence (SEQ ID NO: 132) has a 29 bp deletion in exon 2. Exon sequences are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited Rag2 locus in two animals is presented. The upper sequence (SEQ ID NO: 133) has a 13 bp deletion in the exon 3 target sequence and the lower sequence (SEQ ID NO: 134) has a 2 bp deletion in the exon 2 target sequence. Exon sequences are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited Mdr1 locus in two animals is presented. The upper sequence (SEQ ID NO: 157) has a 20 bp deletion in exon 7 and the lower sequence (SEQ ID NO: 158) has a 15 bp deletion and 3 bp insertion (GCT) in exon 7. Exon sequences are shown in green, target sequences are shown in yellow, and deletions are shown in amber. Illustrates knockout of the Mdr1a gene in rats. Western blots of various amounts of colon lysate and control cell lysate from Mdr1a knockout rats are presented. The relative position Mdr1 protein and actin protein are shown on the left of the image. The DNA sequence of the edited Mrp1 locus in two animals is presented. The upper sequence (SEQ ID NO: 159) has a 43 bp deletion in exon 11, and the lower sequence (SEQ ID NO: 160) has a 14 bp deletion in exon 11. Exon sequences are shown in green, target sequences are shown in yellow, deletions are shown in amber, and overlap between target sequences and exons is shown in gray. The DNA sequence of the edited Mrp2 locus is shown. The sequence (SEQ ID NO: 161) has a 726 bp deletion in exon 7. Exons are shown in green, target sequences are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited BCRP locus in two animals is presented. (A) shows the region of the rat BCRP locus (SEQ ID NO: 162) containing a 588 bp deletion in exon 7. (B) Presents a region of the rat BCRP locus (SEQ ID NO: 163) containing a 696 bp deletion in exon 7. Exon sequences are shown in green, target sites are shown in yellow, and deletions are shown in amber. We present the target site and ZFN validation of Mdr1a, and two additional genes, Jag1 and Notch3. (A) shows the ZFN target sequence. The ZFN binding site is underlined. (B) shows the results of a mutation detection assay in NIH 3T3 cells to verify ZFN mRNA activity. Each ZFN mRNA pair was cotransfected into NIH 3T3 cells. Transfected cells were harvested 24 hours later. Genomic DNA was analyzed by a mutation detection assay to detect the NHEJ product, which is an indicator of ZFN activity. M, PCR markers; G (rows 1, 3, and 5): GFP transfected controls; Z (rows 2, 4, and 6), ZFN transfected samples. Uncut and cut bands are marked with the respective size of base pairs. We present the identification of genetically engineered Mdr1a founders using a mutation detection assay. Uncut and cut bands are marked with the respective size of base pairs. The cleaved band indicates that the mutation is present at the target site. M, PCR marker. 1-444, 44 offspring born from injected eggs. The founder number is underlined. Presents an amplification of a large deletion in the Mdr1a founder. The PCR product was amplified using primers located 800 bp upstream and downstream of the ZFN target site. A band significantly smaller than the 1.6 kb wild type band indicates a large deletion at the target locus. The four founders not identified in FIG. 7 are underlined. 44 presents the results of a mutation detection assay at the Mdr1b site in pups injected with 44 Mdr1aZFN. M, PCR markers; WT, toe DNA from FVB / N mice not injected with Mdr1a ZFN; 3T3, NIH3T3 cells transfected with Mdr1a ZFN as controls. We present detection of Mdr1a expression by using RT-PCR in Mdr1a − / − mice. (A) is a schematic representation of the Mdr1a genome and mRNA structure around the target site. Exons are represented by white rectangles with their numbers. The size of each exon in base pairs is directly labeled below. Intron sequences are represented by vertical bars and the size of base pairs is noted below. The ZFN target site in exon 7 is marked with a black rectangle. The position of the 396 bp deletion in founder number 23 is indicated above intron 6 and exon 7. RT-F and RT-R are primers used for RT-PCR located in exons 5 and 9, respectively. In the RT reaction, 40 ng of total RNA was used as a template. Input RNA normalization is supported by GAPDH amplification with or without RT. Presents the results of band isolation following isolation and purification of species at wild-type size in Mdrla-/-samples, followed by use as a template in nested PCR. 2 shows the DNA sequence of the edited BDNF locus in two animals. The upper sequence (SEQ ID NO: 211) has a 14 bp deletion in the exon 2 target sequence and the lower sequence (SEQ ID NO: 212) has a 7 bp deletion in the exon 2 target sequence. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. The DNA sequence of the edited DISC1 locus is presented. A region of rat DISC1 (SEQ ID NO: 225) is presented in which there is a 20 bp deletion in the target sequence of exon 5. Exons are shown in green, target sites are shown in yellow, and deletions are shown in amber. Illustrates editing of the p53 locus in rats. A Cel-1 assay is presented in which the presence of the cleavage product indicated editing of the p53 gene. Illustrates knockout of the p53 gene in rats. Cytoplasmic and nuclear lysate western blots of kidney (K) and liver (L) samples from wild type (WT731RP) and p53 knockout (KO733RP) animals are presented. The relative positions of the p53 and actin proteins are shown to the right of each image.

  The present disclosure provides a method for creating a genetically modified animal or animal cell comprising at least one edited chromosomal sequence. The edited chromosomal sequence can include (1) inactivated, (2) modified, or (3) incorporated sequences. The inactivated chromosomal sequence is altered such that no functional protein is created or that the control sequence no longer functions as well as the wild type control sequence. Thus, a genetically modified animal containing an inactivated chromosomal sequence may be referred to as a “knockout” or “conditional knockout”. Similarly, a genetically modified animal containing an integrated sequence may be referred to as a “knock-in” or “conditional knock-in”. As described in detail below, the knock-in animal may be a humanized animal. In addition, genetically modified animals that contain modified chromosomal sequences may contain target point mutation (s) or other modifications such that altered protein products are produced. In general, chromosomal sequences are edited using a zinc finger nuclease-mediated process. Briefly, the process includes introducing into a cell at least one nucleic acid encoding a targeted zinc finger nuclease, and optionally at least one accessory polynucleotide. The method further includes incubating the cells to allow expression of the zinc finger nuclease, wherein double-strand breaks introduced into the target chromosomal sequence by the zinc finger nuclease are error prone non-homologous ends. Repaired by a ligated DNA repair process or a homology-directed DNA repair process. In an exemplary embodiment, the cell is an embryo. The method of chromosomal sequence editing using the targeted zinc finger nuclease technology described herein is fast, accurate, and very efficient.

Additionally, the present invention includes animals or cells that contain at least one edited chromosomal sequence. The methods of the present invention, the animals of the present invention, the cells of the present invention, and their uses are described in more detail below.

I. Method for chromosome editing

  One aspect of the invention encompasses a method for chromosome editing. As used herein, “chromosomal editing” edits a chromosomal sequence such that the sequence includes (1) inactivated, (2) modified, or (3) incorporated sequences. To do. In general, methods for editing a chromosome include: (a) a zinc finger nuclease capable of recognizing a target sequence in a chromosomal sequence and cleaving a site in the chromosomal sequence in a cell. At least one nucleic acid encoding, and optionally (i) a sequence for integration (this sequence is flanked by upstream and downstream sequences that share substantial sequence identity with either side of the cleavage site) At least one donor polynucleotide, or (ii) a sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site and further comprising at least one nucleotide change Introducing nucleotides, and (b) zinc finger nucleases to introduce double-strand breaks into chromosomal sequences Culturing cells to allow expression of zinc finger nuclease (where double-strand breaks are (i) non-homologous end-joining repair processes, such that mutations are introduced into chromosomal sequences, or (Ii) The donor polynucleotide sequence is incorporated into the chromosomal sequence or repaired by a homology-directed repair process in which the sequence of the exchange polynucleotide is exchanged for a portion of the chromosomal sequence).

The components of the zinc finger nuclease mediated method of editing chromosomal sequences are described in more detail below.

(A) a nucleic acid encoding a zinc finger nuclease

  The method includes, in part, introducing at least one nucleic acid encoding a zinc finger nuclease into the cell. Typically, a zinc finger nuclease includes a DNA binding domain (ie, zinc finger) and a cleavage domain (ie, nuclease). DNA binding and cleavage domains are described below. The nucleic acid encoding a zinc finger nuclease may include DNA or RNA. For example, the nucleic acid encoding a zinc finger nuclease may include mRNA. If the nucleic acid encoding the zinc finger nuclease comprises mRNA, the mRNA molecule may be 5'capped. Similarly, if the nucleic acid encoding a zinc finger nuclease comprises mRNA, the mRNA molecule may be polyadenylated. An exemplary nucleic acid according to this method is a capped and polyadenylated mRNA molecule encoding a zinc finger nuclease. Methods for capping and polyadenylation of mRNA are known in the art.

Generally speaking, the zinc finger nuclease of the present invention, once introduced into a cell, creates a double-strand break within the chromosomal sequence. Double strand breaks may in certain embodiments be repaired by a cellular non-homologous end-joining repair process so that the mutation is introduced into the chromosomal sequence. In other embodiments, a homology-directed repair process is used to edit the chromosomal sequence, as described below.

(I) Zinc finger binding domain

The zinc finger binding domain may be engineered to recognize and bind to any selected nucleic acid sequence. For example, Beerli et al. (2002) Nat. Biotechnol. 20: 135-141, Pabo et al. (2001) Ann. Rev. Biochem. 70: 313-340, Isalan et al. (2001) Nat. Biotechnol. 19: 656-660, Segal et al. (2001) Curr. Opin. Biotechnol. 12: 632-637, Choo et al. (2000) Curr. Opin. Struct. Biol. 10: 411-416, Zhang et al. (2000) J. Org. Biol. Chem. 275 (43): 33850-33860, Doyon et al. (2008) Nat. Biotechnol. 26: 702-708, and Santiago et al. (2008) Proc. Natl. Acad. Sci. USA 105: 5809-5814. Engineered zinc finger binding domains may have novel binding specificities compared to naturally occurring zinc finger proteins. Manipulation methods include, but are not limited to, rational design and various types of selection. Rational designs include, for example, using a database containing doublet, triplet, and / or quadruplet nucleotide sequences, and individual zinc finger amino acid sequences, where doublet, triplet, or quadruplet nucleotide sequences are specific Related to one or more amino acid sequences of a zinc finger that binds to a triplet or quadruplet sequence. For example, see US Pat. Nos. 6,453,242 and 6,534,261, the disclosures of which are hereby incorporated by reference in their entirety. As an example, the algorithm described in US Pat. No. 6,453,242 may be used to design a zinc finger binding domain to target a preselected sequence. Alternatively, alternative methods such as rational design using non-degenerate recognition code tables may be used to design zinc finger binding domains to target specific sequences (Sera et al. (2002) Biochemistry. 41: 7074-7081). Publicly available web-based tools for identifying potential target sites in DNA sequences and designing zinc finger binding domains are available at www. zincfingertools. org and bindr. gdcb. istate. edu / ZiFiT / (Mandell et al. (2006) Nuc. Acid Res. 34: W516-W523, Sander et al. (2007) Nuc. Acid Res. 35: W599-W605).

  Zinc finger DNA binding domains may be designed to recognize DNA sequence ranges from about 3 nucleotides to about 21 nucleotides in length, or from about 8 to about 19 nucleotides in length. In general, the zinc finger binding domains of the zinc finger nucleases disclosed herein comprise at least three zinc finger recognition regions (ie, zinc fingers). In one embodiment, the zinc finger binding domain may comprise four zinc finger recognition regions. In another embodiment, the zinc finger binding domain may comprise five zinc finger recognition regions. In yet another embodiment, the zinc finger binding domain may comprise six zinc finger recognition regions. The zinc finger binding domain may be designed to bind to any suitable target DNA sequence. For example, see US Pat. Nos. 6,607,882, 6,534,261, and 6,453,242, the disclosures of which are hereby incorporated by reference in their entirety.

  Exemplary methods for selecting a zinc finger recognition region may include phage display and a two-hybrid system, which are US Pat. Nos. 5,789,538, 5,925,523, 6,007,988. No. 6,013,453, 6,410,248, 6,140,466, 6,200,759, and 6,242,568, and WO Patent 98/37186 , WO Patent No. 98/53057, WO Patent No. 00/27878, WO Patent No. 01/88197, and British Patent No. 2,338,237, each of which is incorporated by reference in its entirety. Incorporated herein. In addition, enhanced binding specificity for the zinc finger binding domain is described, for example, in WO 02/077727.

  Methods for the design and construction of zinc finger binding domains and fusion proteins (and polynucleotides encoding them) are known to those skilled in the art and are described in detail in US Patent Application Publication Nos. 20050064474 and 20060188987, Each is incorporated herein by reference in its entirety. Zinc finger recognition regions and / or multi-finger zinc finger proteins may be linked together using a suitable linker sequence, including, for example, a linker of 5 or more amino acids in length. For non-limiting examples of linker sequences of six or more amino acids in length, see US Pat. Nos. 6,479,626, 6,903,185, and 7,153,949, The disclosure is incorporated herein by reference in its entirety. The zinc finger binding domains described herein may comprise a suitable linker combination between the individual zinc fingers of the protein.

In some embodiments, the zinc finger nuclease may further comprise a nuclear localization signal or sequence (NLS). NLS is an amino acid sequence that facilitates targeting of the zinc finger nuclease protein into the nucleus to introduce double-strand breaks in the chromosomal target sequence. Nuclear localization signals are known in the art. For example, Makkerh et al. (1996) Current Biology 6: 1025-1027.

(Ii) cleavage domain

  Zinc finger nucleases also contain a cleavage domain. The cleavage domain portion of the zinc finger nuclease disclosed herein can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, eg, 2002-2003 Catalog, New England Biolabs, Beverly, Mass. And Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388 or www. neb. com. Additional enzymes that cleave DNA are known (eg, S1 nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease). Also, Linn et al. (Eds.) See also Nucleases, Cold Spring Harbor Laboratory Press, 1993. One or more of these enzymes (or functional fragments thereof) may be used as a source of cleavage domains.

  The cleavage domain may also be derived from an enzyme or portion thereof that requires dimerization for cleavage activity, as described above. Since each nuclease contains a monomer of an active enzyme dimer, two zinc finger nucleases may be required for cleavage. Alternatively, a single zinc finger nuclease may contain both monomers to create an active enzyme dimer. As used herein, an “active enzyme dimer” is an enzyme dimer that can cleave a nucleic acid molecule. The two cleavage monomers may be derived from the same endonuclease (or functional fragment thereof), or each monomer may be derived from a different endonuclease (or functional fragment thereof).

  If two cleavage monomers are used to form an active enzyme dimer, the recognition sites for the two zinc finger nucleases are preferably such that the binding of the two zinc finger nucleases to each recognition site is For example, by dimerization, the cleavage monomers are arranged to place the cleavage monomers in a mutual spatial orientation that allows them to form active enzyme dimers. As a result, the proximal ends of the recognition sites may be separated by about 5 to about 18 nucleotides. For example, the proximal ends may be separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. However, it will be appreciated that any integer of nucleotides or nucleotide pairs may intervene between two recognition sites (eg, from about 2 to about 50 nucleotide pairs or more). For example, the near ends of the recognition sites for zinc finger nucleases, such as the near ends detailed herein, may be separated by 6 nucleotides. In general, the site of cleavage is between the recognition sites.

  Restriction endonucleases (restriction enzymes) are present in many species and can bind to DNA (at the recognition site) in a sequence-specific manner and cleave DNA at or near the site of binding. Certain restriction enzymes (eg, Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the type IIS enzyme Fok I catalyzes double-strand breaks of DNA at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. See, for example, US Pat. Nos. 5,356,802, 5,436,150, and 5,487,994, and Li et al. (1992) Proc. Natl. Acad. Sci. USA 89: 4275-4279, Li et al. (1993) Proc. Natl. Acad. Sci. USA 90: 2764-768, Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91: 883-887, Kim et al. (1994b) J. MoI. Biol. Chem. 269: 31,978-31,982. Thus, a zinc finger nuclease may comprise a cleavage domain from at least one type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be manipulated. Exemplary Type IIS restriction enzymes are described, for example, in WO 07 / 014,275, the disclosure of which is incorporated herein by reference in its entirety. Additional restriction enzymes also contain separable binding and cleavage domains, which are also contemplated by the present disclosure. For example, Roberts et al. (2003) Nucleic Acids Res. 31: 418-420.

  An exemplary type IIS restriction enzyme whose cleavage domain can be separated from the binding domain is Fok I. This particular enzyme is active as a dimer (Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95:10, 570-10, 575). Thus, for the purposes of this disclosure, the portion of the Fok I enzyme used in zinc finger nucleases is considered a cleavage monomer. Thus, for target double-strand breaks using the Fok I cleavage domain, two zinc finger nucleases, each containing a Fok I cleavage monomer, can be used to reconstitute the active enzyme dimer. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage monomers can be used.

  In certain embodiments, the cleavage domain can be one or more that minimizes or prevents homodimerization, as described, for example, in US Patent Publication Nos. 20050064474, 20060188987, and 20080131962. Engineered cleavage monomers may be included, each of which is incorporated herein by reference in its entirety. As a non-limiting example, the amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of Fok I are All are targets for influencing dimerization of the Fok I cleavage domain. An exemplary engineered cleavage monomer of Fok I that forms an absolute heterodimer includes that the first cleavage monomer includes mutations at amino acid residues 490 and 538 of Fok I; A pair is included in which two cleavage monomers contain mutations at amino acid residues 486 and 499.

  Thus, in one embodiment, a mutation at amino acid position 490 replaces Glu (E) with Lys (K), and a mutation at amino acid position 538 replaces Iso (I) with Lys (K) and amino acid position 486. The mutation in, replaces Gln (Q) with Glu (E), and the mutation at position 499 replaces Iso (I) with Lys (K). Specifically, the engineered cleavage monomer was mutated at positions 490 of E-K and 538 of I-K in one cleavage monomer, and was engineered named “E490K: I538K”. An engineered cleavage unit designated “Q486E: I499L” by producing a cleavage monomer and mutating positions 486 of Q-E and 499 of IL in another cleavage monomer. It may be prepared by producing a mer. The engineered cleavage monomers described above are absolute heterodimeric variants in which abnormal cleavage is minimized or abolished. Engineered cleavage monomers may be prepared using suitable methods, for example, by site-directed mutagenesis of wild type cleavage monomer (Fok I) described in US Patent Publication No. 20050064474. (See Example 5).

The zinc finger nucleases described above may be engineered to introduce double strand breaks at the target site of integration. The double strand break may be at the target site of integration, or it may be up to 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, from the site of integration. It may be 50, 100, or 1000 nucleotides away. In some embodiments, the double strand break may be up to 1, 2, 3, 4, 5, 10, 15, or 20 nucleotides away from the site of integration. In other embodiments, the double stranded break may be up to 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides away from the site of integration. In still other embodiments, the double stranded break may be up to 50, 100, or 1000 nucleotides away from the site of integration.

(Iii) Exemplary zinc finger nuclease

  Non-limiting examples of zinc finger nucleases that recognize and bind to target sequences found in various animal chromosomal sequences are provided herein. For example, the zinc finger nuclease of the present invention is 53, 54, 57-62, 69-76, 104-113, 123-126, 147-156, 201-210, 219-222, 223-224, 230-233, It may have an amino acid sequence that is at least 80% identical to a sequence selected from a zinc finger nuclease having a SEQ ID NO selected from 240-243. In other embodiments, the sequence identity is about 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, Alternatively, it may be 100%.

Furthermore, the sequence selected from 53, 54, 57-62, 69-76, 104-113, 123-126, 147-156, 201-210, 219-222, 223-224, 230-233, 240-243 The zinc finger nucleases encoded by the numbers are chromosome sequence numbers 55, 56, 63-68, 77-84, 86-91, 94-103, 117-122, 129, 130, 135, 136, 137, 138, 139 ~ 146, 164-173, 213-218, 226-229, 234, 235, 236, 237, 238, 239, at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence identity Recognize chromosomal sequences, it can be coupled thereto.

(Iv) Additional methods for targeted cleavage

  Any nuclease having a target site in the chromosome can be used in the methods disclosed herein. For example, homing endonucleases and meganucleases have very long recognition sequences, some of which are likely to exist once in a human-sized genome on a statistical basis. Any such nuclease with a unique target site in the genome may be used instead of or in addition to the zinc finger nuclease for targeted cleavage of the chromosome.

  Non-limiting examples of homing endonucleases include I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-Scell, I-PpoI, I-SceIII , I-CreI, I-TevI, I-TevIl, and I-TevIII. The recognition sequences for these enzymes are known in the art. Also, US Pat. No. 5,420,032, US Pat. No. 6,833,252, Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388, Dujon et al. (1989) Gene 82: 115-118, Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127, Jasin (1996) Trends Genet. 12: 224-228, Gimble et al. (1996) J. MoI. Mol. Biol. 263: 163-180, Argast et al. (1998) J. MoI. Mol. Biol. See also 280: 345-353, and the New England Biolabs catalog.

The cleavage specificity of most homing endonucleases is not absolute to their recognition site, but the site is expressed by expressing the homing endonuclease in cells that contain a single copy of that recognition site. Long enough so that a single cleavage event can be obtained per mammal-sized genome. It has also been reported that the specificity of homing endonucleases and meganucleases can be engineered to bind to non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10: 895-905; Epinat et al. (2003) Nucleic Acids Res. 31: 2952-2962, Ashworth et al. (2006) Nature 441: 656-659, Paques et al. (2007) Current Gene Therapy 7: 49-66.

(B) any exchange polynucleotide

  A method for editing a chromosomal sequence introduces into a cell at least one exchange polynucleotide comprising a sequence that is substantially identical to the chromosomal sequence at the site of cleavage and further comprising at least one specific nucleotide change. It may further include doing.

  Typically, the exchange polynucleotide will be DNA. The exchange polynucleotide is a DNA plasmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), viral vector, linear piece of DNA, PCR fragment, naked nucleic acid, or nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. It may be. An exemplary exchange polynucleotide can be a DNA plasmid.

  The sequence of the exchange polynucleotide is substantially identical to a portion of the chromosomal sequence at the site of cleavage. In general, the sequence of the exchanged polynucleotide will share sufficient sequence identity with the chromosomal sequence so that the two sequences can be exchanged by homologous recombination. For example, the sequence of the exchange polynucleotide comprises at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, and the region of the chromosomal sequence. 97, 98, or 99% identical.

  Importantly, the sequence of the exchange polynucleotide comprises at least one specific nucleotide change relative to the sequence of the corresponding chromosomal sequence. For example, one nucleotide in a specific codon may be changed to another nucleotide such that the codon encodes a different amino acid. In one embodiment, the sequence of the exchange polynucleotide may contain one specific nucleotide change such that the encoded protein contains one amino acid change. In other embodiments, the sequence of the exchange polynucleotide is two, three, four, such that the encoded protein contains one, two, three, four, or more amino acid changes. Or it may contain specific nucleotide changes beyond that. In yet other embodiments, the sequence of the exchange polynucleotide may comprise three nucleotide deletions or insertions so that the reading frame of the code reading is not altered (and so that a functional protein can be produced). However, the expressed protein will contain a single amino acid deletion or insertion.

  The length of the sequence of the exchange polynucleotide that is substantially identical to a portion of the chromosomal sequence at the site of cleavage may and will vary. In general, the sequence of the exchange polynucleotide may range from about 25 bp to about 10,000 bp long. In various embodiments, the sequence of the exchange polynucleotide is about 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, It may be 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, or 5000 bp long. In other embodiments, the sequence of the exchange polynucleotide may be about 5500, 6000, 6500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, or 10,000 bp long.

  One skilled in the art will be able to construct the exchange polynucleotides described herein using known standard recombinant techniques (see, eg, Sambrook et al., 2001 and Ausubel et al., 1996).

In the above-described method for modifying a chromosomal sequence, a double-strand break introduced into the chromosomal sequence by a zinc finger nuclease is caused by the exchange polynucleotide so that the sequence of the exchange polynucleotide can be exchanged for a portion of the chromosomal sequence. Repaired via homologous recombination. The presence of double strand breaks facilitates homologous recombination and break repair. The exchange polynucleotide may be physically incorporated, or alternatively, the exchange polynucleotide is a repair of cleavage that results in the exchange of sequence information of the exchange polynucleotide and sequence information of that portion of the chromosomal sequence. May be used as a template for Thus, a portion of the endogenous chromosomal sequence may be converted to the sequence of the exchange polynucleotide. It may be at or near the site of the altered nucleotide (s) cleavage. Alternatively, the altered nucleotide (s) can be anywhere in the exchanged sequence. However, as a result of the exchange, the chromosomal sequence is modified.

(C) any donor polynucleotide

  A method for editing a chromosomal sequence may alternatively comprise introducing at least one donor polynucleotide comprising a sequence for integration into the cell. The donor polynucleotide comprises at least three components: the upstream and downstream sequences are flanked by upstream and downstream sequences that share sequence similarity with either side of the site of integration within the chromosome. In addition, the sequence to be incorporated.

  Typically, the donor polynucleotide will be DNA. The donor polynucleotide is a DNA plasmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), viral vector, linear piece of DNA, PCR fragment, naked nucleic acid, or nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. It may be. An exemplary donor polynucleotide can be a DNA plasmid.

  The donor polynucleotide includes a sequence for integration. The sequence for integration may be endogenous to the animal or cell, or it may be an exogenous sequence. The sequence for integration can encode a protein or non-coding RNA (eg, microRNA). Thus, sequences for integration can be operably linked to appropriate control sequences or sequences. Alternatively, an array for integration can provide control functions. Thus, the size of the sequence for integration can and will vary. In general, sequences for integration may range from about 1 nucleotide to millions of nucleotides.

  The donor polynucleotide also includes upstream and downstream sequences that flank the sequence to be integrated. The upstream and downstream sequences of the donor polynucleotide are selected to promote recombination between the chromosomal sequence of interest and the donor polynucleotide. As used herein, upstream sequence refers to a nucleic acid sequence that shares sequence similarity with the chromosomal sequence upstream of the target site for integration. Similarly, a downstream sequence refers to a nucleic acid sequence that shares sequence similarity with the chromosomal sequence downstream of the target site for integration. The upstream and downstream sequences of the donor polynucleotide may share about 75%, 80%, 85%, 90%, 95%, or 100% sequence identity with the target chromosomal sequence. In other embodiments, the upstream and downstream sequences of the donor polynucleotide may share about 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the target chromosomal sequence. In exemplary embodiments, the upstream and downstream sequences of the donor polynucleotide may share about 99% or 100% sequence identity with the target chromosomal sequence.

  The upstream or downstream sequence may comprise from about 20 bp to about 2500 bp. In various embodiments, the upstream or downstream arrangement is about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800. 1900, 2000, 2100, 2200, 2300, 2400, or 2500 bp may be included. Exemplary upstream or downstream sequences may comprise about 200 bp to about 2000 bp, about 600 bp to about 1000 bp, or more specifically about 700 bp to about 1000 bp.

  In some embodiments, the donor polynucleotide may further comprise a marker. Such markers can facilitate screening for targeted integration. Non-limiting examples of suitable markers include restriction sites, fluorescent proteins, or selectable markers.

  One skilled in the art will be able to construct the donor polynucleotides described herein using known standard recombinant techniques (see, eg, Sambrook et al., 2001 and Ausubel et al.,). 1996).

In the above-described method for editing a chromosomal sequence by incorporating the sequence, double-strand breaks introduced into the chromosomal sequence by zinc finger nucleases are homologous by the donor polynucleotide so that the sequence is incorporated into the chromosome. Repaired via recombination. The presence of double strand breaks promotes sequence integration. The donor polynucleotide may be physically integrated, or alternatively, the donor polynucleotide is inserted into the chromosome of the donor polynucleotide sequence and all or part of the upstream and downstream sequences of the donor polynucleotide. It may be used as a template for cutting repair, leading to introduction. Thus, the endogenous chromosomal sequence may be converted to the sequence of the donor polynucleotide.

(D) Introducing nucleic acid into cells

  To mediate zinc finger nuclease genome editing, at least one nucleic acid molecule encoding a zinc finger nuclease, and optionally at least one exchange polynucleotide or at least one donor polynucleotide is introduced into the cell. As used herein, the term “cell” encompasses any animal cell that contains a chromosomal sequence. In some embodiments, the term “cell” may refer to an embryo. In certain exemplary embodiments, the embryo is a fertilized single cell stage embryo. In other exemplary embodiments, the embryo may be any stage embryo.

  Suitable methods for introducing nucleic acids into embryos or cells include microinjection, electroporation, sonoporation, gene gun, calcium phosphate mediated transfection, cationic transfection, liposome transfection, dendrimer transfection, heat shock May include transfection, nucleofection transfection, magnetofection, lipofection, imperfection, optical transfection, proprietary drug-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, virosomes, or artificial virions . In one embodiment, the nucleic acid may be introduced into the embryo by microinjection. The nucleic acid may be microinjected into the embryonic nucleus or cytoplasm. In another embodiment, the nucleic acid may be introduced into the cell by nucleofection.

  In embodiments where both a zinc finger nuclease encoding nucleic acid and an exchange (or donor) polynucleotide are introduced into an embryo or cell, the ratio of exchange (or donor) polynucleotide to nucleic acid encoding a zinc finger nuclease is: It may range from about 1:10 to about 10: 1. In various embodiments, the ratio of exchange (or donor) polynucleotide to nucleic acid encoding a zinc finger nuclease is about 1:10, 1: 9, 1: 8, 1: 7, 1: 6, 1: 5. 1: 4, 1: 3, 1: 2, 1: 1, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, or It may be 10: 1. In one embodiment, the ratio may be about 1: 1.

  In embodiments where two or more nucleic acids encoding a zinc finger nuclease, and optionally two or more exchange (or donor) polynucleotides are introduced into an embryo or cell, the nucleic acids may be introduced simultaneously or sequentially. Good. For example, a nucleic acid encoding a zinc finger nuclease, as well as any exchange (or donor) polynucleotide, specific for each unique recognition sequence, may be introduced simultaneously. Alternatively, each nucleic acid encoding a zinc finger nuclease, as well as any exchange (or donor) polynucleotide may be introduced sequentially.

In one embodiment, at least one nucleic acid molecule encoding a zinc finger nuclease is introduced into the cell. In another embodiment, at least 2, 3, 4, 5, or more than 5 nucleic acid molecules encoding a zinc finger nuclease are introduced into the cell. In each of the above embodiments, the one or more corresponding donor or exchange polynucleotide is also from about 1:10 to about 10: 1 ratio of donor or exchange polynucleotide to zinc finger nuclease nucleic acid, as described above. And can be introduced into cells.

(E) culturing cells

  A method for editing a chromosome using the zinc finger nuclease-mediated process described herein may include introducing introduced nucleic acid (s) to allow expression of at least one zinc finger nuclease. Further comprising culturing the cells comprising.

  Cells containing the introduced nucleic acid may be cultured using standard procedures that allow expression of the zinc finger nuclease. Standard cell culture techniques are described, for example, in Santiago et al. (2008) PNAS 105: 5809-5814, Moehle et al. (2007) PNAS 104: 3055-3060, Urnov et al. (2005) Nature 435: 646-651, and Lombardo et al (2007) Nat. Biotechnology 25: 1298-1306. One skilled in the art understands that methods for culturing cells are known in the art and can and will vary depending on the cell type or cell type. In all cases, routine optimization can be used to determine the best technique for a particular cell type.

In one embodiment where the cells are embryos, the embryos may be cultured in vitro (eg, in cell culture). Typically, embryos are cultured for a short period of time in an appropriate temperature and in an appropriate medium, with the O ₂ / CO ₂ ratio required to allow expression of the zinc finger nuclease. One skilled in the art will appreciate that the culture conditions can and will vary depending on the embryo type. In all cases, routine optimization can be used to determine the optimal culture conditions for a particular species of embryo. In some cases, the cell line may be derived from an in vitro cultured embryo (eg, an embryonic stem cell line).

  Preferably, the embryo will be cultured in the body by transferring the embryo into the uterus of a female host. Generally speaking, the female host is derived from the same or similar species as the embryo. Preferably, the female host is pseudopregnant. Methods for preparing pseudopregnant female hosts are known in the art. Additionally, methods for transferring embryos into female hosts are known. Culturing the embryo in the body can allow embryo development and can result in the birth of an animal derived from the embryo. Such animals will generally contain a disrupted chromosomal sequence (s) in every cell of the body.

  When at least one zinc finger nuclease in the cell is expressed, the chromosomal sequence of the cell can be edited. If the cell contains an expressed zinc finger nuclease but no exchange (or donor) polynucleotide, the zinc finger nuclease recognizes, binds to and cleaves the target sequence within the chromosomal sequence of interest. . Double-strand breaks introduced by zinc finger nucleases are repaired by an error-prone non-homologous end-linked DNA repair process. As a result, deletions or insertions that result in missense or nonsense mutations can be introduced into the chromosomal sequence such that the sequence is inactivated.

  If the embryo or cell contains an expressed zinc finger nuclease as well as an exchange (or donor) polynucleotide, the zinc finger nuclease recognizes, binds to and cleaves the target sequence within the chromosomal sequence. Double-strand breaks introduced by zinc finger nucleases are exchange (or donor) such that a portion of the chromosomal sequence is converted to the sequence of the exchange polynucleotide or the sequence of the donor polynucleotide is incorporated into the chromosomal sequence. ) Repaired via homologous recombination with the polynucleotide. As a result, the chromosome sequence is edited.

The genetically modified animals disclosed herein are cross-bred to create an animal that includes two or more edited chromosomal sequences, or one or more edited chromosomal sequences are homozygous You may create animals. One skilled in the art will appreciate that many combinations are possible. In addition, the genetically modified animals disclosed herein can be bred with other animals to combine the edited chromosomal sequence with other genetic backgrounds. By way of non-limiting example, suitable genetic backgrounds include wild type, natural mutations that give rise to a known phenotype, target chromosomal integration, non-targeted integration, and the like.

(F) Chromosome editing type

As described above, the methods of the present invention can be used to (1) inactivate chromosomal sequences, (2) modify chromosomal sequences, or (3) incorporate sequences into chromosomes. Each of these is described in more detail below.

i. Inactivate sequences

In one embodiment, the edited chromosomal sequence can be inactivated such that the sequence is not transcribed, the encoded protein is not produced, or the sequence does not function as well as the wild-type sequence. For example, a protein coding sequence can be inactivated such that no protein is produced. Alternatively, the microRNA coding sequence can be inactivated such that no microRNA is produced. Furthermore, the control sequence can be inactivated so that it no longer functions as a control sequence. As used herein, “control sequence” refers to any nucleic acid sequence that provides transcription, translation, or accessibility of a nucleic acid sequence. As a non-limiting example, promoters, transcription terminators, and enhancers are regulatory sequences. Inactivated chromosomal sequences are introduced with deletion mutations (ie, deletion of one or more nucleotides), insertion mutations (ie, insertion of one or more nucleotides), or nonsense mutations (ie, stop codons are introduced). A single nucleotide substitution for another nucleotide). In some embodiments, a chromosomal sequence that is inactivated may be referred to as a “knockout”. In an iteration of the invention, the “knockout” animal created by the method of the invention does not contain any exogenous sequences.

ii. Modify an array

  In another embodiment, the edited chromosomal sequence can be modified such that it encodes an altered gene product or the function of the sequence is altered. The chromosomal sequence encoding the protein can be modified to include at least one altered nucleotide such that the codon containing the altered nucleotide encodes a different amino acid. Thus, the resulting protein contains at least one amino acid change. In addition, protein coding sequences can be modified by insertion or deletion such that the reading frame of the sequence is not altered and a modified protein is produced. In such embodiments, the modified sequence may result in a phenotypic change.

  Alternatively, chromosomal sequences that function as regulatory sequences may be modified. For example, a promoter can be modified so that it is always active or is controlled by an exogenous signal.

In yet another embodiment, at least one chromosomal sequence encoding the protein of interest can be edited so that the expression pattern of the protein is altered. For example, a control region that regulates protein expression, such as a promoter or transcription factor binding site, can overproduce the protein of interest, or can alter the tissue-specific or temporal expression of the protein, or It can be varied to produce a combination.

iii. Include array

  In yet another embodiment, the edited chromosomal sequence may include an integrated sequence. Such sequences can encode endogenous proteins, foreign or heterologous proteins, wild type proteins, modified proteins, fusion proteins, microRNAs, and the like. The incorporated protein coding sequence may be linked to a reporter sequence (the reporter sequence may be a 5 'or 3' linkage to the protein coding sequence). The incorporated protein coding sequence may also be placed under the control of an endogenous promoter, operably linked to an exogenous promoter, or fused in-frame to the endogenous protein coding sequence. Good. Furthermore, the incorporated sequence can function as a regulatory element. Thus, the integrated sequence can be endogenous or foreign to the cell. An animal or cell containing such an integrated sequence may be referred to as a “knock-in”. It should be understood that in one iteration of the above embodiment, there are no selectable markers.

In certain embodiments, sequences can be incorporated to alter the expression pattern of the protein of interest. For example, a conditional knockout system can be created.

A. Conditional mutation

  In certain embodiments, the sequence can be edited to change the expression pattern of the protein of interest. For example, a conditional knockout system can be created.

  As used herein, a “conditional knockout” system is one in which expression of a nucleic acid molecule is disrupted in a particular organ, tissue, or cell type, not in the whole animal and / or in a temporally regulated manner. Model. Conditional knockouts allow, for example, the study of gene function even when the overall disruption of the gene is lethal.

Non-limiting examples of conditional knockout systems include the Cre-lox recombination system. The Cre-lox recombination system includes a Cre recombinase enzyme, a site-specific DNA recombinase that catalyzes recombination of nucleic acid sequences between specific sites (lox sites) within a nucleic acid molecule. Methods for producing temporal and tissue specific expression using this system are known in the art. In general, genetically modified cells are generated with lox sites located on both sides of the chromosomal sequence of interest. A genetically modified animal comprising cells having the desired chromosomal sequence located on both sides of the lox can then be crossed with another genetically modified animal that expresses Cre recombinase in one or more cells. Good. Progeny animals are then produced that contain one or more cells containing chromosomal sequences where lox is located on both sides and one or more cells containing Cre recombinase. In a cell containing both the chromosomal sequence where lox is located on both sides and Cre recombinase, the chromosomal sequence located on both sides of the lox encoding the protein of interest is recombined and the chromosomal sequence encoding the protein of interest is recombined. It leads to deletion or inversion. Cre recombinase expression may be controlled temporally and conditionally to result in temporally and conditionally controlled recombination of the chromosomal sequence encoding the protein of interest.

A. Integration that disrupts endogenous loci

  In another embodiment, the methods of the invention can be used to incorporate mutations that disrupt the endogenous locus. For example, the chromosomal sequence can be perturbed by replacing the endogenous sequence with the exogenous sequence such that the exogenous sequence is under the control of the endogenous promoter. In these embodiments, the perturbed endogenous sequence will not be expressed and the incorporated foreign sequence will be expressed. The exogenous sequence may be a homologue of the endogenous sequence. For example, if the endogenous sequence is non-human, the foreign sequence can be a human sequence. In some embodiments, the exogenous sequence may not be related to the endogenous sequence that it replaces. For example, an endogenous sequence may be substituted for an exogenous marker so that the marker is detectable when the endogenous promoter is active. In some embodiments, the marker may be an enzymatic marker that can amplify the detectable signal of the marker.

Alternatively, in some embodiments, the methods of the invention can be used to replace an endogenous promoter or other regulatory sequence with an exogenous promoter or regulatory sequence. In these embodiments, the expression pattern of the locus will be determined by the exogenous promoter or control sequence as opposed to the endogenous promoter or control sequence. Such exogenous promoter or regulatory sequence may be a homologue of an endogenous promoter or regulatory sequence. For example, when the endogenous sequence is non-human, the exogenous sequence may be a human sequence. In some embodiments, the exogenous sequence may not be related to the endogenous sequence that it replaces.

C. Integration of foreign nucleic acid sequences

  Alternatively, instead of perturbing the locus, the method of the present invention can be used to convert the exogenous sequence within the chromosomal sequence with or without a promoter and without disrupting the expression of the endogenous locus. Can be incorporated into. In some embodiments, such integration is a “safe harbor” such as the rat Rosa26 locus (or another animal equivalent) or the HPRT locus (or another animal equivalent) on the rat X chromosome. It can be within a locus.

  In one embodiment, a cassette comprising an exogenous promoter operably linked to an exogenous nucleic acid sequence may be incorporated within the safe harbor locus. In certain embodiments, the exogenous promoter may be conditional. For example, the conditional promoter may be a tissue specific promoter, an organ specific promoter, or a cell type specific promoter (such as a stem cell promoter, a B cell promoter, a hair cell promoter, etc.), or an inducible promoter. As used herein, an inducible promoter is a promoter that is only active in the presence of certain substances such as antibiotics, drugs, or other exogenous compounds. In some embodiments, integration of a cassette containing a conditional promoter can be used to track cell lines.

In another embodiment, the exogenous nucleic acid sequence can be incorporated to serve as a detectable marker for a particular nucleic acid sequence.

D. Humanization

In a further embodiment, the genetically modified animal may be a “humanized” animal comprising a sequence integrated into at least one chromosome that encodes a functional human protein. A functional human protein may not have a corresponding ortholog in a genetically modified animal. Alternatively, the wild-type animal from which the genetically modified animal is derived may contain an ortholog corresponding to a functional human protein. In this case, an orthologous sequence in a “humanized” animal does not produce an endogenous functional protein, and the “humanized” animal contains a sequence integrated into at least one chromosome encoding the human protein, Inactivated. One skilled in the art will appreciate that “humanized” animals may be generated by crossing knockout animals with knockin animals that contain sequences integrated into the chromosome.

(G) Compound chromosome editing

  Further embodiments of the above invention include performing the method of the invention sequentially so that the cells are developed by more than one chromosomal editing. For example, embryos from the first edit can be cultured to produce animals that contain the first genome edit. Embryos from this animal can then be used in the methods of the invention to create a second genome edit. The same process can be repeated to produce embryos with more than 3, 4, 5, 6, 7, 8, 9, 10, or 10 genome edits.

Alternatively, cells with complex genome editing can be developed by simultaneously introducing two or more zinc finger nucleases, each specific for a unique editing site. Similarly, a corresponding number of donor and / or exchange polynucleotides may optionally be introduced. The number of zinc finger nucleases and any corresponding donor or exchange polynucleotide introduced into the cell may exceed 2, 3, 4, 5, or 5.

II. Applications resulting from the method of the invention

The methods of the invention can be used to create animals or cells that contain an edited chromosomal sequence. Such animals or cells can be used for a number of different applications including, for example, research applications, livestock applications, companion animal applications, or biomolecule production applications. Non-limiting examples of such applications are detailed in the following sections (a) to (d).

(A) Research use

In certain embodiments, the methods of the invention can be used to create animals or cells that can be used for research applications. Such applications may include disease models, pharmacological models, developmental models, cell function models, and humanized models, each of which is detailed below.

i. Disease model

  The methods of the invention can be used to create animals or cells that can be used as disease models. As used herein, “disease” refers to a disease, disorder, or indication in a subject. For example, in one embodiment, the methods of the invention can be used to create an animal or cell that includes chromosomal editing in one or more nucleic acid sequences associated with a disease. Such a nucleic acid sequence can encode a disease-related protein sequence or it can be a disease-related regulatory sequence.

  In one embodiment, using an animal or cell created by the method of the invention, using measurements commonly used in disease research, the animal or cell, and the mutations that affect the onset and / or progression of the disease. Study the impact. Alternatively, such animals or cells can be used to study the effect of pharmaceutically active compounds on disease.

  In another embodiment, animals or cells created by the methods of the invention can be used to assess the effectiveness of potential gene therapy strategies. That is, a chromosomal sequence encoding a protein associated with a disease can be modified such that disease onset and / or progression is inhibited or reduced. In particular, the method includes editing a chromosomal sequence encoding a protein associated with a disease such that an altered protein is produced and, as a result, the animal or cell has an altered response. Thus, in some embodiments, a genetically modified animal may be compared to an animal predisposed to developing a disease so that the effect of a gene therapy event can be assessed.

In certain embodiments, the methods of the invention can be used to create animals or cells that can be used as disease models for the diseases listed in Table A. Such animals or cells may contain chromosomal edits in the genes listed in Table A. In another embodiment, the methods of the invention can be used to create animals or cells that can be used as disease models for the diseases listed in Table B. Such animals or cells may contain chromosomal edits in the genes listed in Table B. In Table B, the 6-digit number following the entry in the Disease / Disorder / Indication column is the OMIM number (Online Mendelian Inheritance in Man, OMIM (TM). McKusick-Nathans Institute of Genetic Medicine, Johns Humps, United States , MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), World Wide Web, and numbers in parentheses after each disorder name map wild-type genes (1) by mapping the disease phenotype itself (2), or by both approaches (3), for example, “(3)” indicates that the wild type gene combined with the demonstration of a mutation in that gene in the context of the disorder Includes mapping.

Further non-limiting examples of disease models created by the methods of the present invention include Parkinson's disease model, addiction model, inflammation model, cardiovascular disease model, Alzheimer's disease model, autism spectrum disorder model, macular degeneration model, Examples include schizophrenia models, tumor suppression models, trinucleotide repeat disorder models, neurotransmission disorder models, secretase-related disorder models, ALS models, prion disease models, ABC transporter protein-related disorder models, and immunodeficiency models. Each is described in more detail below.

A. Parkinson's disease

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with Parkinson's disease (PD) has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In some embodiments, one or more chromosomal or regulatory sequences encoding proteins associated with PD may be edited. PD-related proteins or regulatory sequences can typically be selected based on experimental association of PD-related proteins or regulatory sequences with PD. As a non-limiting example, the production rate or circulating concentration of PD-related protein can be increased or suppressed in a population with PD compared to a population without PD. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art. By way of non-limiting example, proteins associated with Parkinson's disease include, but are not limited to, α-synuclein, DJ-1, LRRK2, PINK1, parkin, UCHL1, syphilin-1, and NURR1.

In certain embodiments, animals produced by the methods of the invention are used to study the effects of mutations on animals and the onset and / or progression of PD using measurements commonly used in PD studies. be able to. Methods for measuring and studying PD progression in animals are known in the art. Commonly used measurements in PD studies include, without limitation, amyloidogenesis or protein aggregation, dopamine response, neurodegeneration, development of mitochondrial-associated dysfunction phenotype, and functional, pathological, or biochemistry Specific assays may be included. Other relevant indicators for the onset or progression of PD include harmonic motion, balance, gait, movement disorders, tremors and spasms, stiffness, hypoactivity, and cognitive impairment. Such an assay may be performed in comparison to wild type littermates.

B. Addiction

  As used herein, addiction is defined as a chronic disorder of brain reward, motivation, memory, and related neural circuits contained within various brain structures. Specific examples of brain structures that can experience dysfunction associated with toxic disorders include nucleus accumbens, ventral pallidum, dorsal thalamus, prefrontal cortex, striatum, nigra, and reticular striatum. , Amygdala, and ventral tegmental area. Dysfunctions in these neural circuits can lead to various biological, psychological, sociological, and behavioral addiction symptoms.

  Biological symptoms of addiction include overproduction or underproduction of one or more addiction-related proteins; redistribution of one or more addiction-related proteins in the brain; development of tolerance, reverse tolerance, or addiction Other changes in susceptibility to the effects of substances or neurotransmitters in the brain; hypertension; and withdrawal symptoms such as insomnia, restlessness, loss of appetite, depression, weakness, irritability, anger, pain, and craving obtain.

  The psychological symptoms of addiction can vary depending on the specific addictive substance and the duration of the addiction. Non-limiting examples of psychological symptoms of addiction include mood swings, paranoia, insomnia, psychosis, schizophrenia, tachycardia panic attacks, cognitive impairment, and aggressive, obsessive, criminal, and / or Or a personality change that can lead to vagus behavior.

  Sociological symptoms of addiction include low self-esteem, verbal attacks, neglect of interpersonal means, localized anxiety such as fear of crowdedness, stiff interpersonal behavior, very strange behavior, rebellion, and individual behavior and interpersonal relationships A significant problem cognitive decline for can be included.

  Non-limiting examples of behavioral symptoms of addiction include impaired behavioral regulation, reduced ability to consistently refrain from using addictive substances, cycle of recurrence and remission, risk acceptance behavior, pursuit for pleasure, pursuit of novelty Behavior, reassurance pursuit behavior, and reward pursuit behavior.

  Addiction can be a substance addiction that is typically associated with ingestion of addictive substances. Addictive substances may include psychoactive substances that can cross the blood-brain barrier and temporarily change the chemical environment of the brain. Non-limiting examples of addictive substances include: alcohol; opioid compounds such as opium and heroin; sedatives, hypnotics, or anxiolytic compounds such as benzodiazepines, and tranquilizer compounds; cocaine and related compounds; And related compounds; amphetamines and amphetamine-like compounds; hallucinogen compounds; inhalants such as glue or aerosol sprays; phencyclidine or phencyclidine-like compounds; and nicotine. In addition, addiction can be behavioral addiction associated with non-material related impulses such as gambling problems and computer addiction.

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one toxicosis-related chromosomal sequence has been edited. Suitable edits may include, but are not limited to, the types of edits detailed in section I (f) above.

  An addiction-associated nucleic acid sequence is a diverse series of sequences related to the susceptibility to developing an addiction, the presence of an addiction, the severity of an addiction, or any combination thereof. The addiction-associated nucleic acid sequence can typically be selected based on experimental association of the addiction-related nucleic acid sequence with a toxic disorder. The addiction-related nucleic acid sequence can encode an addiction-related protein or can be an addiction-related control sequence. As a non-limiting example, the production rate or circulating concentration of a toxic disorder-related protein can be increased or suppressed in a population having a toxic disorder compared to a population lacking the toxic disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  Non-limiting examples of addiction-related proteins include ABAT (4-aminobutyric acid aminotransferase), ACN9 (ACN9 homologue (budding yeast)), ADCYAP1 (adenylate cyclase activating polypeptide 1), ADH1B (alcohol dehydrogenase) IB (class I), beta polypeptide), ADH1C (alcohol dehydrogenase 1C (class I), gamma polypeptide), ADH4 (alcohol dehydrogenase 4), ADH7 (alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide), ADORA1 (adenosine A1 receptor), ADRA1A (adrenergic, alpha-1A-, receptor), ALDH2 (aldehyde dehydrogenase 2 family), ANKK1 (ankyrin repeat, T qI A1 allele), ARC (activity-regulated cytoskeleton-related protein), ATF2 (adrenocorticotropic hormone releasing factor), AVPR1A (arginine vasopressin receptor 1A), BDNF (brain-derived neurotrophic factor), BMAL1 (aryl hydrocarbon) Receptor nuclear transporter-like), CDK5 (cyclin-dependent kinase 5), CHRM2 (cholinergic receptor, muscarinic 2), CHRNA3 (cholinergic receptor, nicotinic, alpha3), CHRNA4 (cholinergic receptor, Nicotinic, alpha4), CHRNA5 (cholinergic receptor, nicotinic, alpha5), CHRNA7 (cholinergic receptor, nicotinic, alpha7), CHRNB2 (cholinergic receptor, nicotinic, beta2), CLOCK (Clock homologue (mouse)), CNR1 (cannabino) Id receptor 1), CNR2 (cannabinoid receptor type 2), COMT (catechol-O-methyltransferase), CREB1 (cAMP responsive element binding protein 1), CREB2 (activated transcription factor 2), CRHR1 (adrenal cortex stimulation) Hormone-releasing hormone receptor 1), CRY1 (cryptochrome 1), CSNK1E (casenkinase 1, epsilon), CSPG5 (chondroitin sulfate proteoglycan 5), CTNNB1 (catenin (cadherin-related protein), beta 1, 88 kDa), DBI (diazepam binding) Inhibitor), DDN (dendrin), DRD1 (dopamine receptor D1), DRD2 (dopamine receptor D2), DRD3 (dopamine receptor D3), DRD4 (dopamine receptor D4), EGR1 (early growth response 1) ELTD1 (EGF, latrophylline and 7 transmembrane domain containing 1), FAAH (fatty acid amide hydrolase), FOSB (FBJ mouse osteosarcoma virus oncogene homolog), FOSB (FBJ mouse osteosarcoma virus oncogene homolog B), GABBR2 (gamma-aminobutyric acid (GABA) B receptor, 2), GABRA2 (gamma-aminobutyric acid (GABA) A receptor, alpha 2), GABRA4 (gamma-aminobutyric acid (GABA) A receptor, alpha 4), GABRA6 (gamma-aminobutyric acid (GABA) A receptor, alpha 6), GABRB3 (gamma-aminobutyric acid (GABA) A receptor, alpha 3), GABRE (gamma-aminobutyric acid (GABA) A receptor, epsilon), GABRG1 (gamma-aminobutyric acid (GABA) A Body, gamma 1), GAD1 (glutamate decarboxylase 1), GAD2 (glutamate decarboxylase 2), GAL (galan prepropeptide), GDNF (glial cell-derived neurotrophic factor), GRIA1 (glutamate receptor, ionic, AMPA1), GRIA2 (glutamate receptor, ionic, AMPA2), GRIN1 (glutamate receptor, ionic, N-methyl D-aspartate 1), GRIN2A (glutamate receptor, ionic, N-methyl D) -Aspartic acid 2A), GRM2 (glutamate receptor, metabotropic 2, mGluR2), GRM5 (metabotropic glutamate receptor 5), GRM6 (glutamate receptor, metabotropic 6), GRM8 (glutamate receptor, tropic) Metabolic 8), HTR1B (5- Hydroxytryptamine (serotonin) receptor 1B), HTR3A (5-hydroxytryptamine (serotonin) receptor 3A), IL1 (interleukin 1), IL15 (interleukin 15), IL1A (interleukin 1 alpha), IL1B (interleukin) 1 beta), KCNMA1 (potassium large conductance calcium activation channel, subfamily M, alpha member 1), LGALS1 (lectigalactoside-binding soluble 1), MAOA (monoamine oxidase A), MAOB (monoamine oxidase B), MAPK1 (mitogenic activity) Protein kinase 1), MAPK3 (mitogen-activated protein kinase 3), MBP (myelin basic protein), MC2R (melanocortin receptor type 2), M LL (monoglyceride lipase), MOBP (myelin-related oligodendrocyte basic protein), NPY (neuropeptide Y), NR4A1 (nuclear receptor subfamily 4, group A, member 1), NR4A2 (nuclear receptor subfamily 4, Group A, member 2), NRXN1 (neulexin 1), NRXN3 (neulexin 3), NTRK2 (neurotrophic tyrosine kinase, receptor, type 2), NTRK2 (tyrosine kinase B neurotrophin receptor), OPRD1 ( Delta-opioid receptor), OPRK1 (kappa-opioid receptor), OPRM1 (mu-opioid receptor), PDYN (dynorphin), PENK (enkephalin), PER2 (period homolog 2 (Drosophila)), PKNOX2 (PBX) / No Knotted 1 homeobox 2), PLP1 (proteolipid protein 1), POMC (proopiomelanocortin), PRKCE (protein kinase C, epsilon), PROKR2 (prokineticin receptor 2), RGS9 (G-protein signaling) Regulator 9), RIMS2 (regulated synaptic membrane exocytosis 2), SCN9A (sodium channel voltage-gated IX alpha subunit), SLC17A6 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6), SLC17A7 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7), SLC1A2 (solute carrier family 1 (glial cell high affinity glutamate transporter), member 2), SLC 1A3 (solute carrier family 1 (glial cell high affinity glutamate transporter), member 3), SLC29A1 (solute carrier family 29 (nucleoside transporter), member 1), SLC4A7 (solute carrier family 4, sodium bicarbonate cotransporter) , Member 7), SLC6A3 (solute carrier family 6 (neurotransmitter transporter, dopamine), member 3), SLC6A4 (solute carrier family 6 (neurotransmitter transporter, serotonin), member 4), SNCA (synuclein, alpha (Non-A4 component of amyloid precursor)), TFAP2B (transcription factor AP-2beta), and TRPV1 (transient receptor potential cation channel, subfamily V, member 1).

  Preferred addiction related proteins include ABAT (4-aminobutyric acid aminotransferase), DRD2 (dopamine receptor D2), DRD3 (dopamine receptor D3), DRD4 (dopamine receptor D4), GRIA1 (glutamate receptor, counterion) Sex, AMPA1), GRIA2 (glutamate receptor, anionic, AMPA2), GRIN1 (glutamate receptor, anionic, N-methyl D-aspartate 1), GRIN2A (glutamate receptor, anionic, N- Methyl D-aspartate 2A), GRM5 (metabotropic glutamate receptor 5), HTR1B (5-hydroxytryptamine (serotonin) receptor 1B), PDYN (dynorphin), PRKCE (protein kinase C, epsilon), LGALS1 ( Lek Galactoside-binding soluble 1), TRPV1 (transient receptor potential cation channel subfamily V member 1), SCN9A (sodium channel voltage-gated IX alpha subunit), OPRD1 (opioid receptor delta 1), OPRK1 (opioid receptor) Body kappa 1), OPRM1 (opioid receptor mu 1), and any combination thereof may be included.

  In certain embodiments, an animal produced by the methods of the present invention uses an assay measurement obtained from a genetically modified animal comprising at least one edited chromosomal sequence encoding an addiction-associated protein as a wild type. By comparing the measured values of the assay with animals, it can be used as a model for the indication of toxic disorders. Non-limiting examples of assays used to assess indications for addictive disorders include behavioral assays, physiological assays, whole animal assays, tissue assays, cellular assays, biomarker assays, and combinations thereof . Indications for toxic disorders can occur spontaneously or can be facilitated by exposure to exogenous drugs such as addictive substances or addiction-related proteins. Alternatively, indications for toxic disorders can be triggered by withdrawal of addictive substances or other compounds, such as exogenously administered toxicosis-related proteins.

  A further aspect of the present disclosure provides for the effectiveness of a treatment to inhibit addictive behavior and / or reduce withdrawal symptoms of genetically modified animals comprising at least one edited chromosomal sequence associated with addiction. Includes methods to assess. Treatments for addiction that can be assessed include the administration of one or more new candidate therapeutic compounds, new combinations of established therapeutic compounds, new therapeutic methods, and any combination thereof. New treatment methods may include various drug delivery mechanisms, nanotechnology applications in drug therapy, surgery, and combinations thereof.

  Behavioral testing of genetically modified animals and / or wild type animals containing at least one edited addiction-related protein can be used to assess the side effects of a therapeutic compound or combination of therapeutic agents. Genetically modified animals and optionally wild type animals can be treated with therapeutic compounds or combinations of therapeutic agents and subjected to behavioral testing. Behavioral tests can assess behaviors including but not limited to learning, memory, anxiety, depression, addiction, and sensory-motor function.

A further aspect is to contact a genetically modified animal comprising at least one edited chromosomal sequence encoding an addiction-associated protein, and to determine the result of selected parameters as wild-type that is not in contact with the same agent. A method is provided for assessing the therapeutic potential of a drug in an animal that can include comparing to results obtained from the animal. Selected parameters include a) spontaneous behavior, b) performance during behavioral testing, c) physiological abnormalities, d) abnormalities in tissues or cells, e) biochemical function, and f) molecular structure, It is not limited to them.

C. inflammation

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with inflammation has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with inflammation may be edited. Inflammation-related chromosomal sequences can typically be selected based on experimental association of inflammation-related sequences with inflammatory disorders. The inflammation-related sequence can encode an inflammation-related protein or can be an inflammation-related regulatory sequence. For example, the production rate or circulating concentration of an inflammation-related protein can be increased or suppressed in a population having an inflammatory disorder as compared to a population lacking the inflammatory disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  Non-limiting examples of inflammation-related proteins whose chromosomal sequences can be edited include monocyte chemotactic protein-1 (MCP1) encoded by the Ccr2 gene, CC chemokine receptor type 5 encoded by the Ccr5 gene (CCR5), IgG receptor IIB encoded by Fcgr2b gene (also referred to as FCGR2b, CD32), Fc epsilon R1g (FCER1g) protein encoded by Fcer1g gene, forkhead box N1 transcription factor encoded by FOXN1 gene (FOXN1), interferon-gamma (IFN-γ) encoded by the IFNg gene, interleukin 4 (IL-4) encoded by the IL-4 gene, perforated by the PRF-1 gene -1, cyclooxygenase 1 protein (COX1) encoded by the COX1 gene, cyclooxygenase 2 protein (COX2) encoded by the COX2 gene, T box transcription factor (TBX21) protein encoded by the TBX21 gene, encoded by the SH2B1 gene SH2-BP PH domain (also referred to as SH2BPSM1) containing the signaling mediator 1 protein (SH2BPSM1), fibroblast growth factor receptor 2 (FGFR2) protein encoded by the FGFR2 gene, encoded by the OCT1 gene Solute carrier family 22 member 1 (SLC22A1) protein (also referred to as SLC22A1), a peroxyl encoded by the PPARA gene Zome growth factor activated receptor alpha protein (PPAR-alpha, nuclear receptor subfamily 1, group C, also referred to as member 1; NR1C1), phosphatase and tensin homolog protein (PTEN) encoded by the PTEN gene Interleukin 1 alpha (IL-1α) encoded by the IL-1A gene, Interleukin 1 beta (IL-1β) encoded by the IL-1B gene, Interleukin 6 (IL-) encoded by the IL-6 gene 6) Interleukin 10 encoded by IL-10 gene (IL-10), Interleukin 12 alpha encoded by IL-12A gene (IL-12α), Interleukin 12 encoded by IL-12B gene (IL-12β), interleukin 13 encoded by IL-13 gene (IL-13), interleukin 17A encoded by IL-17A gene (also referred to as IL-17A, CTLA8), IL-17B gene Interleukin 17B (IL-17B) encoded by IL-17C, interleukin 17D (IL-17D) encoded by IL-17D gene, interleukin 17D (IL-17D) encoded by IL-17D gene Interleukin 17F encoded (IL-17F), interleukin 23 encoded by IL-23 gene (IL-23), chemokine (C-X3-C motif) receptor 1 protein encoded by CX3CR1 gene (C 3CR1), a chemokine (CX3-C motif) ligand 1 protein (CX3CL1) encoded by the CX3CL1 gene, a recombination activating gene 1 protein (RAG1) encoded by the RAG1 gene, a recombination encoded by the RAG2 gene Activating gene 2 protein (RAG2), protein kinase, DNA activation, catalytic polypeptide 1 (PRKDC) encoded by PRKDC (DNAPK) gene, protein tyrosine phosphatase non-receptor type 22 protein (PTPN22) encoded by PTPN22 gene ), Nucleotide-binding oligos containing tumor necrosis factor alpha (TNFα) encoded by the TNFA gene, two proteins (NOD2) encoded by the NOD2 gene Merization domain (also referred to as CARD15), or cytotoxic T-lymphocyte antigen 4 protein (also referred to as CTLA4, CD152) encoded by the CTLA4 gene.

In certain embodiments, animals produced by the methods of the invention are used to study the effects of mutations on the animals and the onset and / or progression of inflammation using measurements commonly used in inflammation studies. be able to. Alternatively, using animals produced by the methods of the present invention, the effects of mutations on the progression of a disease state or disorder associated with inflammation-related proteins can be determined using measurements commonly used in the study of the disease state or disorder. Can study. Non-limiting examples of measurements that can be used include spontaneous behavior of genetically modified animals, performance during behavioral testing, physiological abnormalities, differential responses to compounds, abnormalities in tissues or cells, and genetically modified animals and Biochemical or molecular differences between wild type animals.

D. Cardiovascular disease

  Cardiovascular diseases generally include hypertension, heart attack, heart failure, and stroke and TIA. In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with cardiovascular disease has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  Any chromosomal sequence involved in cardiovascular disease or a protein encoded by any chromosomal sequence involved in cardiovascular disease may be utilized in the methods of the invention. The cardiovascular-related sequence can typically be selected based on an experimental association of the cardiovascular-related sequence with the onset of cardiovascular disease. The cardiovascular associated nucleic acid sequence can encode a cardiovascular associated protein or can be a cardiovascular associated regulatory sequence. For example, the production rate or circulating concentration of cardiovascular-related protein can be increased or suppressed in a population with cardiovascular disorders as compared to a population lacking cardiovascular disorders. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

For example, chromosomal sequences include IL1B (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin I2 (prostacyclin) synthase), MB (myoglobin), IL4 ( Interleukin 4), ANGPT1 (Angiopoietin 1), ABCG8 (ATP binding cassette, subfamily G (WHITE), member 8), CTSK (cathepsin K), PTGIR (prostaglandin I2 (prostacyclin) receptor (IP)) , KCNJ11 (potassium inward rectifier channel, subfamily J, member 11), INS (insulin), CRP (C-reactive protein, pentraxin related), PDGFRB (platelet-derived growth factor receptor, bae Polypeptide), CCNA2 (cyclin A2), PDGFB (platelet-derived growth factor beta polypeptide (simian sarcoma virus (v-sis) oncogene homolog)), KCNJ5 (potassium inward rectifier channel, subfamily J, member 5 ), KCNN3 (potassium intermediate / small conductance calcium activation channel, subfamily N, member 3), CAPN10 (calpain 10), PTGES (prostaglandin E synthase), ADRA2B (adrenergic, alpha-2B-, receptor) ), ABCG5 (ATP binding cassette, subfamily G (WHITE), member 5), PRDX2 (peroxiredoxin 2), CAPN5 (calpain 5), PARP14 (poly (ADP-ribose) polymerase family -, Member 14), MEX3C (mex-3 homolog C (Caenolabditis elegans)), ACE angiotensin I converting enzyme (peptidyl-dipeptidase A) 1), TNF (tumor necrosis factor (TNF superfamily, member) 2)), IL6 (interleukin 6 (interferon, beta 2)), STN (statin), SERPINE1 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), ALB ( Albumin), ADIPOQ (containing adiponectin, C1Q and collagen domain), APOB (apolipoprotein B (including Ag (x) antigen)), APOE (apolipoprotein E), LEP (leptin), MTHFR (5,10-methyleneteto) Lahydrofolate reductase (NADPH)), APOA1 (apolipoprotein AI), EDN1 (endothelin 1), NPPB (natriuretic peptide precursor B), NOS3 (nitric oxide synthase 3 (endothelial cells)), PPARG (peroxisome) Growth factor activated receptor gamma), PLAT (plasminogen activator, tissue), PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), CETP (cholesterol ester transfer protein, plasma) AGTR1 (Angiotensin II receptor type 1), HMGCR (3-hydroxy-3-methylglutaryl-coenzyme A reductase), IGF1 (insulin-like growth factor 1 (somatomedin C)), S LE (selectin E), REN (renin), PPARA (peroxisome proliferator activated receptor alpha), PON1 (paraoxonase 1), KNG1 (kininogen 1), CCL2 (chemokine (CC motif) ligand 2) , LPL (lipoprotein lipase), VWF (von Willebrand factor), F2 (coagulation factor II (thrombin)), ICAM1 (intercellular adhesion molecule 1), TGFB1 (transforming growth factor, beta 1), NPPA (sodium) Diuretic peptide precursor A), IL10 (interleukin 10), EPO (erythropoietin), SOD1 (superoxide dismutase 1, soluble), VCAM1 (vascular cell adhesion molecule 1), IFNG (interferon, gamma), LPA (lipoprotein, L (A)), MPO (myeloperoxidase), ESR1 (estrogen receptor 1), MAPK1 (mitogen-activated protein kinase 1), HP (haptoglobin), F3 (coagulation factor III (thromboplastin, tissue factor)), CST3 ( Cystatin C), COG2 (component of oligomerized Golgi complex 2), MMP9 (matrix metalloproteinase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)), serpin C1 (serpin peptidase inhibitor, clade C (antithrombin) , Member 1), F8 (coagulation factor VIII, procoagulant component), HMOX1 (heme oxygenase (decycling) 1), APOC3 (apolipoprotein C-III), IL8 (interleukin) Kin 8), PROK1 (prokineticin 1), CBS (cystathionine-beta-synthase), NOS2 (nitric oxide synthase 2, inducible), TLR4 (toll-like receptor 4), SELP (selectin P (granular membrane protein 140 kDa, Antigen CD62)), ABCA1 (ATP binding cassette, subfamily A (ABC1), member 1), AGT (angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), LDLR (low density lipoprotein receptor) GPT (glutamate-pyruvate transaminase (alanine aminotransferase)), VEGFA (vascular endothelial growth factor A), NR3C2 (nuclear receptor subfamily 3, group C, member 2), IL18 (interleukin 18 (interferin 18) -Gamma-inducing factor)), NOS1 (nitrogen monoxide synthase 1 (neurogenic)), NR3C1 (nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)), FGB (fibrinogen beta chain) HGF (hepatocyte growth factor (hepapoietin A; scatter factor)), IL1A (interleukin 1, alpha), RETN (resistin), AKT1 (v-akt mouse thymoma virus oncogene homolog 1), LIPC (Lipase, hepatic), HSPD1 (heat shock 60 kD protein 1 (chaperonin)), MAPK14 (mitogen-activated protein kinase 14), SPP1 (secretory phosphoprotein 1), ITGB3 (integrin, beta3 (platelet glycoprotein IIIa, Antigen CD61)), CA (Catalase), UTS2 (urotensin 2), THBD (thrombomodulin), F10 (coagulation factor X), CP (ceruloplasmin (ferrooxidase)), TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b), EDNRA (endothelin) Receptor type A), EGFR (epidermal growth factor receptor (erythroblastic leukemia virus (v-erb-b) oncogene homolog, bird)), MMP2 (matrix metalloproteinase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa IV) Type collagenase)), PLG (plasminogen), NPY (neuropeptide Y), RHOD (ras homologue gene family, member D), MAPK8 (mitogen-activated protein kinase 8), MYC (v-myc myeloma) ILS oncogene homolog (bird)), FN1 (fibronectin 1), CMA1 (chymase 1, mast cell), PLAU (plasminogen activator, urokinase), GNB3 (guanine nucleotide binding protein (G protein), beta polypeptide 3) , ADRB2 (adrenergic, beta-2-, receptor, surface), APOA5 (apolipoprotein AV), SOD2 (superoxide dismutase 2, mitochondria), F5 (coagulation factor V (proacelelin, unstable factor) )), VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor), ALOX5 (arachidonic acid 5-lipoxygenase), HLA-DRB1 (major histocompatibility complex, class II, DR beta 1), PARP1 ( Poly (ADP-ribose Polymerase 1), CD40LG (CD40 ligand), PON2 (paraoxonase 2), AGER (glycation end product specific receptor), IRS1 (insulin receptor substrate 1), PTGS1 (prostaglandin-endoperoxide synthase 1 (prosta) (Grandin G / H synthase and cyclooxygenase)), ECE1 (endothelin converting enzyme 1), F7 (coagulation factor VII (serum prothrombin conversion promoting factor)), IL1RN (interleukin 1 receptor antagonist), EPHX2 (epoxide hydrolase 2, Cytoplasm), IGFBP1 (insulin-like growth factor binding protein 1), MAPK10 (mitogen-activated protein kinase 10), FAS (Fas (TNF receptor superfamily, member 6)), AB B1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), JUN (jun oncogene), IGFBP3 (insulin-like growth factor binding protein 3), CD14 (CD14 molecule), PDE5A (phosphodiesterase 5A, cGMP specific AGTR2 (Angiotensin II receptor, type 2), CD40 (CD40 molecule, TNF receptor superfamily member 5), LCAT (lecithin cholesterol acyltransferase), CCR5 (chemokine (CC motif) receptor 5), MMP1 (matrix metalloproteinase 1 (interstitial collagenase)), TIMP1 (TIMP metallopeptidase inhibitor 1), ADM (adrenomedullin), DYT10 (dystonia 10), STAT3 (signa) Transmissible transcription activator 3 (acute phase reaction factor)), MMP3 (matrix metalloproteinase 3 (stromelysin 1, progelatinase)), ELN (elastin), USF1 (upstream transcription factor 1), CFH (complement factor H) ), HSPA4 (heat shock 70 kD protein 4), MMP12 (matrix metalloproteinase 12 (macrophaselase)), MME (membrane metallo-endopeptidase), F2R (coagulation factor II (thrombin) receptor), SELL (selectin) L), CTSB (cathepsin B), ANXA5 (annexin A5), ADRB1 (adrenergic, beta-1-, receptor), CYBA (cytochrome b-245, alpha polypeptide), FGA (fibrinogen alpha chain), GGT1 ( Gamma-gluta 1), LIPG (lipase, endothelial), HIF1A (hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)), CXCR4 (chemokine (CXC motif) reception) Body 4), PROC (protein C (activator of coagulation factor Va and factor VIIIa)), SCARB1 (scavenger receptor class B, member 1), CD79A (CD79a molecule, immunoglobulin-related alpha), PLTP (phosphorus) Lipid transport protein), ADD1 (aducine 1 (alpha)), FGG (fibrinogen gamma chain), SAA1 (serum amyloid A1), KCNH2 (potassium voltage-gated channel, subfamily H (eag related), member 2), DPP4 ( Dipeptidyl-Pepti 4), G6PD (glucose-6-phosphate dehydrogenase), NPR1 (natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic peptide receptor A)), VTN (vitronectin), KIAA0101 (KIAA0101) , FOS (FBJ mouse osteosarcoma oncogene homolog), TLR2 (Tall-like receptor 2), PPIG (peptidylprolyl isomerase G (cyclophilin G)), IL1R1 (interleukin 1 receptor, type I), AR ( Androgen receptor), CYP1A1 (cytochrome P450, family 1, subfamily A, polypeptide 1), serpin A1 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1), MTR (5-methyltetrahydrofolate-homocysteine methyltransferase), RBP4 (retinol binding protein 4, plasma), APOA4 (apolipoprotein A-IV), CDKN2A (cyclin-dependent kinase inhibitor 2A (malignant melanoma, p16, CDK)
4)), FGF2 (fibroblast growth factor 2 (basic)), EDNRB (endothelin receptor type B), ITGA2 (integrin, alpha2 (CD49B, alpha2 subunit of VLA-2 receptor) ), CABIN1 (calcineurin binding protein 1), SHBG (sex hormone binding globulin), HMGB1 (high mobility group box 1), HSP90B2P (heat shock protein 90 kDa beta (Grp94), member 2 (pseudogene)), CYP3A4 (cytochrome P450) , Family 3, subfamily A, polypeptide 4), GJA1 (gap junction protein, alpha 1, 43 kDa), CAV1 (caveolin 1, caveola protein, 22 kDa), ESR2 (estrogen receptor 2 (ER beta)), L A (Lymphoxin alpha (TNF superfamily, member 1)), GDF15 (growth differentiation factor 15), BDNF (brain-derived neurotrophic factor), CYP2D6 (cytochrome P450, family 2, subfamily D, polypeptide 6) , NGF (nerve growth factor (beta polypeptide)), SP1 (Sp1 transcription factor), TGIF1 (TGFB inducible factor homeobox 1), SRC (v-src sarcoma (Schmidt-Rupin A-2) virus oncogene homologue (Bird)), EGF (epidermal growth factor (beta-urogastrone)), PIK3CG (phosphoinositide-3-kinase, catalyst, gamma polypeptide), HLA-A (major histocompatibility complex, class I, A), KCNQ1 (Potassium potential open channel, KQT-like subfamily , Member 1), CNR1 (cannabinoid receptor 1 (brain)), FBN1 (fibrillin 1), CHKA (choline kinase alpha), BEST1 (bestrophin 1), APP (amyloid beta (A4) precursor protein), CTNNB1 ( Catenin (cadherin-related protein), beta 1, 88 kDa), IL2 (interleukin 2), CD36 (CD36 molecule (thrombospondin receptor)), PRKAB1 (protein kinase, AMP activation, beta 1 non-catalytic subunit), TPO (thyroid peroxidase), ALDH7A1 (aldehyde dehydrogenase 7 family, member A1), CX3CR1 (chemokine (C-X3-C motif) receptor 1), TH (tyrosine hydroxylase), F9 (coagulation factor IX) GH1 (growth hormone 1), TF (transferrin), HFE (hemochromatosis), IL17A (interleukin 17A), PTEN (phosphatase and tensin homolog), GSTM1 (glutathione S-transferase mu1), DMD (dystrophin) , GATA4 (GATA binding protein 4), F13A1 (coagulation factor XIII, A1 polypeptide), TTR (transthyretin), FABP4 (fatty acid binding protein 4, adipocyte), PON3 (paraoxonase 3), APOC1 (apolipoposome) Protein CI), INSR (insulin receptor), TNFRSF1B (tumor necrosis factor receptor superfamily, member 1B), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A), CS 3 (colony stimulating factor 3 (granulocyte)), CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9), TXN (thioredoxin), CYP11B2 (cytochrome P450, family 11, subfamily B, polypeptide 2) , PTH (parathyroid hormone), CSF2 (colony stimulating factor 2 (granulocyte-macrophage)), KDR (kinase insertion domain receptor (type III receptor tyrosine kinase)), PLA2G2A (phospholipase A2, group IIA (platelet, symphrin) Liquid)), B2M (beta-2-microglobulin), THBS1 (thrombospondin 1), GCG (glucagon), RHOA (ras homolog gene family, member A), ALDH2 (aldehyde dehydrogenase 2 family) -(Mitochondrion)), TCF7L2 (transcription factor 7-like 2 (T cell specific, HMG box)), BDKRB2 (bradykinin receptor B2), NFE2L2 (nuclear factor (erythrocyte-derived 2) like 2), NOTCH1 (notch homolog) 1, translocation-related (Drosophila)), UGT1A1 (UDP glucuronosyltransferase 1 family, polypeptide A1), IFNA1 (interferon, alpha 1), PPARD (peroxisome proliferator activated receptor delta), SIRT1 (sirtuin (silent) Mating type information control 2 homologue) 1 (budding yeast)), GNRH1 (gonadotropin releasing hormone 1 (luteinizing releasing hormone)), PAPPA (pregnancy-related plasma protein A, paparicin 1), ARR3 (arrestin 3, retina (X- Arrestin )), NPPC (natriuretic peptide precursor C), AHSP (alpha hemoglobin stabilizing protein), PTK2 (PTK2 protein tyrosine kinase 2), IL13 (interleukin 13), MTOR (mechanistic target of rapamycin (serine / threonine kinase) )), ITGB2 (integrin, beta 2 (complement component 3 receptor 3 and 4 subunits)), GSTT1 (glutathione S-transferase theta 1), IL6ST (interleukin 6 signaling (gp130, oncostatin M receptor) )), CPB2 (carboxypeptidase B2 (plasma)), CYP1A2 (cytochrome P450, family 1, subfamily A, polypeptide 2), HNF4A (hepatocyte factor 4, alpha), SLC6A4 (dissolved) Carrier family 6 (neurotransmitter transporter, serotonin), member 4), PLA2G6 (phospholipase A2, group VI (cytosol, calcium independent)), TNFSF11 (tumor necrosis factor (ligand) superfamily, member 11), SLC8A1 (solute carrier family 8 (sodium / calcium exchanger), member 1), F2RL1 (coagulation factor II (thrombin) receptor-like 1), AKR1A1 (aldo-ketoreductase family 1, member A1 (aldehyde reductase)), ALDH9A1 (aldehyde dehydrogenase 9 family, member A1), BGLAP (bone gamma-carboxyglutamate (gla) protein), MTTP (microsomal triglyceride transport protein), MTRR (5-methyl) Trahydrofolate-homocysteine methyltransferase reductase), SULT1A3 (sulfotransferase family, cytosol, 1A, phenol selection, member 3), RAGE (renal tumor antigen), C4B (complement component 4B (sid blood group), P2RY12 (Purinergic receptor P2Y, G-protein binding, 12), RNLS (linalase, FAD-dependent amine oxidase), CREB1 (cAMP responsive element binding protein 1), POMC (proopiomelanocortin), RAC1 (lass-related C3) Botulinum toxin substrate 1 (Rho family, small GTP binding protein Rac1)), LMNA (lamin A / C), CD59 (CD59 molecule, complement regulatory protein), SCN5A (sodium channel, voltage-gated, V type, alpha subunit), CYP1B1 (cytochrome P450, family 1, subfamily B, polypeptide 1), MIF (macrophage migration inhibitory factor (glycosylation inhibitor)), MMP13 (matrix metalloproteinase 13 (collagenase 3) ), TIMP2 (TIMP metallopeptidase inhibitor 2), CYP19A1 (cytochrome P450, family 19, subfamily A, polypeptide 1), CYP21A2 (cytochrome P450, family 21, subfamily A, polypeptide 2), PTPN22 (protein tyrosine) Phosphatase, non-receptor type 22 (lymphocyte)), MYH14 (myosin, heavy chain 14, non-muscle), MBL2 (mannose-binding lectin (protein C) 2, soluble (opsonin) )), SELPLG (selectin P ligand), AOC3 (amine oxidase, copper-containing 3 (vascular adhesion protein 1)), CTSL1 (cathepsin L1), PCNA (proliferating cell nuclear antigen), IGF2 (insulin-like growth factor 2 (somatomedin A) )), ITGB1 (integrin, beta1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), CAST (calpastatin), CXCL12 (chemokine (CX-C motif) ligand 12 ( Stromal cell-derived factor 1)), IGHE (immunoglobulin heavy constant epsilon), KCNE1 (potassium voltage-gated channel, Isk-related family, member 1), TFRC (transferrin receptor (p90, CD71)), COL1A1 (collagen) Type I, alpha 1), COL1A2 (collagen, type I, alpha 2), IL2RB (interleukin 2 receptor, beta), PLA2G10 (phospholipase A2, group X), ANGPT2 (angiopoietin 2), PROCR (protein C receptor) , Endothelial (EPCR)), NOX4 (NADPH oxidase 4), HAMP (hepcidin antimicrobial peptide), PTPN11 (protein tyrosine phosphatase, non-receptor type 1), SLC2A1 (solute carrier family 2 (promoted glucose transporter) , Member 1), IL2RA (interleukin 2 receptor, alpha), CCL5 (chemokine (CC motif) ligand 5), IRF1 (interferon regulatory factor 1), CFLAR (CASP8 and FADD-like apoptosis regulator) CALCA (calcitonin related polypeptide alpha), EIF4E (eukaryotic translation initiation factor 4E), GSTP1 (glutathione S-transferase pi1), JAK2 (Janus kinase 2), CYP3A5 (cytochrome P450, family 3, subfamily) A, polypeptide 5), HSPG2 (heparan sulfate proteoglycan 2), CCL3 (chemokine (CC motif) ligand 3), MYD88 (myeloid cell differentiation primary reaction gene (88)), VIP (vasoactive intestinal peptide), SOAT1 (Sterol O-acyltransferase 1), ADRBK1 (adrenergic, beta, receptor kinase 1), NR4A2 (nuclear receptor subfamily 4, group A, member 2), MMP8 (matrix metalloproteinase (Neutrophil collagenase)), NPR2 (natriuretic peptide receptor B / guanylate cyclase B (atrial natriuretic peptide receptor B)), GCH1 (GTP cyclohydrase 1), EPRS (glutamyl-prolyl-tRNA synthetase), PPARGC1A (peroxisome proliferator activated receptor gamma, coactivator 1 alpha), F12 (coagulation factor XII (Hageman factor)), PECAM1 (platelet / endothelial cell adhesion molecule), CCL4 (chemokine (CC motif) ) Ligand 4), serpin A3 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3), CASR (calcium sensing receptor), GJA5 (gap junction protein, alpha 5, 40 kD) ), FABP2 (fatty acid binding protein 2, enteric), TTF2 (transcription termination factor, RNA polymerase II), PROS1 (protein (alpha)), CTF1 (cardiotrophin 1), SGCB (sarcoglycan, beta (43 kDa dystrophin) Related glycoproteins)), YME1L1 (YME1-like 1 (budding yeast)), CAMP (cathelicidin antibacterial peptide), ZC3H12A (12A containing zinc finger CCCH type), AKR1B1 (Aldo-ketoreductase family 1, member B1 (aldose reductase) )), DES (desmin), MMP7 (matrix metalloproteinase 7 (matrilysine, uterine)), AHR (aryl hydrocarbon receptor), CSF1 (colony stimulating factor 1 (macrophage)), HDA C9 (histone deacetylase 9), CTGF (connective tissue growth factor), KCNMA1 (potassium large conductance calcium activation channel, subfamily M, alpha member 1), UGT1A (UDP glucuronosyltransferase 1 family, polypeptide)
Complex locus), PRKCA (protein kinase C, alpha), COMT (catechol-O-methyltransferase), S100B (S100 calcium binding protein B), EGR1 (early growth response 1), PRL (prolactin), IL15 ( Interleukin 15), DRD4 (dopamine receptor D4), CAMK2G (calcium / camodulin-dependent protein kinase II gamma), SLC22A2 (solute carrier family 22 (organic cation transporter), member 2), CCL11 (chemokine (C- C motif) ligand 11), PGF (B321 placental growth factor), THPO (thrombopoietin), GP6 (glycoprotein VI (platelet)), TACR1 (tachykinin receptor 1), NTS (neurotensin), HNF A (HNF1 homeobox A), SST (somatostatin), KCND1 (potassium voltage-gated channel, Shal-related subfamily, member 1), LOC646627 (phospholipase inhibitor), TBXAS1 (thromboxane A synthase 1 (platelet)) ), CYP2J2 (cytochrome P450, family 2, subfamily J, polypeptide 2), TBXA2R (thromboxane A2 receptor), ADH1C (alcohol dehydrogenase 1C (class I), gamma polypeptide), ALOX12 (arachidonic acid 12-lipoxygenase) ), AHSG (alpha-2-HS-glycoprotein), BHMT (betaine-homocysteine methyltransferase), GJA4 (gap junction protein, alpha 4, 3) kDa), SLC25A4 (solute carrier family 25 (mitochondrial carrier; adenine nucleotide transporter), member 4), ACLY (ATP citrate lyase), ALOX5AP (arachidonic acid 5-lipoxygenase activating protein), NUMA1 (mitotic apparatus protein 1) , CYP27B1 (cytochrome P450, family 27, subfamily B, polypeptide 1), CYSLTR2 (cysteinyl leukotriene receptor 2), SOD3 (superoxide dismutase 3, extracellular), LTC4S (leukotriene C4 synthase), UCN (urocortin) ), GHRL (ghrelin / obstatin prepropeptide), APOC2 (apolipoprotein C-II), CLEC4A (C-type lectin domain family 4, men Bar A), KBBTBD10 (10 containing Kelchirepeat and BTB (POZ) domains), TNC (tenascin C), TYMS (thymidylate synthetase), SHC1 (SHC (containing Src homology 2 domain) transforming protein 1), LRP1 (Low density lipoprotein receptor-related protein 1), SOCS3 (inhibitor of cytokine signaling 3), ADH1B (alcohol dehydrogenase 1B (class I), beta polypeptide), KLK3 (kallikrein-related peptidase 3), HSD11B1 (hydroxysteroid) (11-beta) dehydrogenase 1), VKORC1 (vitamin K epoxide reductase complex, subunit 1), serpin B2 (serpin peptidase inhibitor, clade B (ovalbumin), men -2), TNS1 (tensin 1), RNF19A (ring finger protein 19A), EPOR (erythropoietin receptor), ITGAM (integrin, alpha M (complement component 3 receptor 3 subunit)), PITX2 (pair-like homeo Domain 2), MAPK7 (mitogen-activated protein kinase 7), FCGR3A (Fc fragment of IgG, low affinity IIIa, receptor (CD16a)), LEPR (leptin receptor), ENG (endoglin), GPX1 (glutathione peroxidase) 1), GOT2 (glutamate-oxaloacetate transaminase 2, mitochondria (aspartate aminotransferase 2)), HRH1 (histamine receptor H1), NR1I2 (nuclear receptor subfamily 1, group I, member 2) CRH (corticotropin releasing hormone), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), VDAC1 (voltage-dependent anion channel 1), HPSE (heparanase), SFTPD (surfactant protein D), TAP2 (transport) Body 2, ATP binding cassette, subfamily B (MDR / TAP)), RNF123 (ring finger protein 123), PTK2B (PTK2B protein tyrosine kinase 2 beta), NTRK2 (neurotrophic tyrosine kinase, receptor, type 2), IL6R (interleukin 6 receptor), ACHE (acetylcholinesterase (Yt blood group)), GLP1R (glucagon-like peptide 1 receptor), GHR (growth hormone receptor), GSR (glutathione reductase) ), NQO1 (NAD (P) H dehydrogenase, quinone 1), NR5A1 (nuclear receptor subfamily 5, group A, member 1), GJB2 (gap junction protein, beta 2, 26 kDa), SLC9A1 (solute carrier family 9 ( Sodium / hydrogen exchanger), member 1), MAOA (monoamine oxidase A), PCSK9 (proprotein convertase subtilisin / kexin type 9), FCGR2A (Fc fragment of IgG, low affinity IIa, receptor (CD32)), Serpin F1 (serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1), EDN3 (endothelin 3), DHFR (dihydrofolate reductase), GAS6 (growth arrest specific 6), SMPD1 (Sphingomyelinho Hodiesterase 1, acid lysolimal), UCP2 (uncoupling protein 2 (mitochondrion, proton carrier)), TFAP2A (transcription factor AP-2alpha (activation enhancer binding protein 2alpha)), C4BPA (complement component 4 binding protein) , Alpha), serpin F2 (serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium-derived factor), member 2), TYMP (thymidine phosphorylase), ALPP (alkaline phosphatase, placenta (regan isozyme)), CXCR2 (Chemokine (C—X—C motif) receptor 2), SLC39A3 (solute carrier family 39 (zinc transporter), member 3), ABCG2 (ATP binding cassette, subfamily G (WHITE), member 2), DA (adenosine deaminase), JAK3 (Janus kinase 3), HSPA1A (heat shock 70 kD protein 1A), FASN (fatty acid synthase), FGF1 (fibroblast growth factor 1 (acidic)), F11 (coagulation factor XI), ATP7A (ATPase, Cu ++ transport, alpha polypeptide), CR1 (complement component (3b / 4b) receptor 1 (Knop blood group)), GFAP (glial fiber acidic protein), ROCK1 (Rho related, coiled coil-containing protein kinase) 1), MECP2 (methyl CpG binding protein 2 (Rett syndrome)), MYLK (myosin light chain kinase), BCHE (butyrylcholinesterase), LIPE (lipase, hormone sensitivity), PRDX5 (peroxiredoxin 5), ADORA1 (a) Denosine A1 receptor), WRN (Warner syndrome, RecQ helicase-like), CXCR3 (chemokine (CX-C motif) receptor 3), CD81 (CD81 molecule), SMAD7 (SMAD family member 7), LAMC2 (laminin, Gamma 2), MAP3K5 (mitogen-activated protein kinase kinase kinase 5), CHGA (chromogranin A (parathyroid secreted protein 1)), IAPP (islet amyloid polypeptide), RHO (rhodopsin), ENPP1 (ectonucleotipyrophosphatase / phosphodiesterase 1), PTHHL (parathyroid hormone-like hormone), NRG1 (neuregulin 1), VEGFC (vascular endothelial growth factor C), ENPEP (glutamylaminopeptidase (aminopeptidase A)), EBPB (CCAAT / enhancer binding protein (C / EBP), beta), NAGLU (N-acetylglucosaminidase, alpha-), F2RL3 (coagulation factor II (thrombin) receptor-like 3), CX3CL1 (chemokine (C-X3- C motif) Ligand 1), BDKRB1 (bradykinin receptor B1), ADAMTS13 (ADAM metallopeptidase having thrombospondin type 1 motif 13), ELANE (elastase, neutrophil expression), ENPP2 (ectonucleotiropyrophosphatase / phosphodiesterase 2 ), CISH (cytokine-inducible SH2-containing protein), GAST (gastrin), MYOC (myosin, trabecular meshwork-induced glucocorticoid reaction), ATP1A2 (ATPase, Na + / + Transport, alpha2 polypeptide), NF1 (neurofibromin 1), GJB1 (gap junction protein, beta 1, 32 kDa), MEF2A (myocyte enhancer factor 2A), VCL (vinculin), BMPR2 (bone morphogenetic protein receptor) Body, type II (serine / threonine kinase)), TUBB (tubulin, beta), CDC42 (cell division cycle 42 (GTP binding protein, 25 kDa)), KRT18 (keratin 18), HSF1 (heat shock transcription factor 1), MYB (v-myb myeloblastosis virus oncogene homolog (bird)), PRKAA2 (protein kinase, AMP activation, alpha 2 catalytic subunit), ROCK2 (Rho-related, coiled-coil-containing protein kinase 2), TFPI (tissue) factor Pathway inhibitor (lipoprotein-related coagulation inhibitor)), PRKG1 (protein kinase, cGMP-dependent, type I), BMP2 (bone morphogenetic protein 2), CTNND1 (catenin (cadherin-related protein), delta 1), CTH ( Cystathionase (cystathionine gamma-lyase)), CTSS (cathepsin S), VAV2 (vav2 guanine nucleotide exchanger), NPY2R (neuropeptide Y receptor Y2), IGFBP2 (insulin-like growth factor binding protein 2, 36 kDa), CD28 (CD28) Molecule), GSTA1 (glutathione S-transferase alpha 1), PPIA (peptidylprolyl isomerase A (cyclophilin A)), APOH (apolipoprotein H (beta-2-glycoprotein I)), S 00A8 (S100 calcium binding protein A8), IL11 (interleukin 11), ALOX15 (arachidonic acid 15-lipoxygenase), FBLN1 (fibulin 1), NR1H3 (nuclear receptor subfamily 1, group H, member 3), SCD (stearoyl) -CoA desaturase (delta-9-desaturase)), GIP (gastric inhibitory polypeptide), CHGB (chromogranin B (secretogranin 1)), PRKCB (protein kinase C, beta), SRD5A1 (steroid-5-alpha- Reductase, alpha polypeptide 1 (3-oxo-5alpha-steroid delta 4-dehydrogenase alpha 1)), HSD11B2 (hydroxysteroid (11-beta) dehydrogenase 2), CALC L (calcitonin receptor-like), GALNT2 (UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)), ANGPTL4 (angiopoietin-like 4), KCNN4 (potassium intermediate) Body / small conductance calcium activation channel, subfamily N, member 4), PIK3C2A (phosphoinositide-3-kinase, class 2, alpha polypeptide), HBEGF (heparin-binding EGF-like growth factor), CYP7A1 (cytochrome P450, family 7) , Subfamily A, polypeptide 1), HLA-DRB5 (major histocompatibility complex, class II, DR beta 5), BNIP3 (BCL2 / adenovirus E1B 19 kDa interaction protein) Click protein 3), GCKR (glucokinase (hexokinase 4) regulator), S100A12 (S100 calcium-binding protein A12), PADI4 (peptidyl arginine deiminase, I type V), HSPA14 (heat shock 70kD protein 14), CXC
R1 (chemokine (C—X—C motif) receptor 1), H19 (H19, maternal imprinted expression transcription (non-protein coding)), KRTAP 19-3 (keratin related protein 19-3), IDDM2 (insulin-dependent) Diabetes 2), RAC2 (ras-related C3 botulinum toxin substrate 2 (Rho family, small GTP-binding protein Rac2)), RYR1 (ryanodine receptor 1 (skeleton)), clock (clock homologue (mouse)), NGFR (nerve growth) Factor receptor (TNFR superfamily, member 16)), DBH (dopamine beta-hydroxylase (dopamine beta-monooxygenase)), CHRNA4 (cholinergic receptor, nicotinic, alpha 4), CACNA1C (calcium channel, voltage dependent) Sex, L , Alpha1C subunit), PRKAG2 (protein kinase, AMP activation, gamma2 non-catalytic subunit), CHAT (choline acetyltransferase), PTGDS (prostaglandin D2 synthase 21 kDa (brain)), NR1H2 (nuclear receptor subunit) Family 1, group H, member 2), TEK (TEK tyrosine kinase, endothelial), VEGFB (vascular endothelial growth factor B), MEF2C (myocyte enhancer factor 2C), MAPKAPK2 (mitogen-activated protein kinase activated protein kinase 2) ), TNFRSF11A (tumor necrosis factor receptor superfamily, member 11a, NFKB activator), HSPA9 (heat shock 70 kD protein 9 (mortarin)), CYSLTR1 (cysteinyllo) Cotriene receptor 1), MAT1A (methionine adenosyltransferase I, alpha), OPRL1 (morphine receptor-like 1), IMPA1 (inositol (myo) -1 (or 4) -monophosphatase 1), CLCN2 (chloride channel 2) , DLD (dihydrolipoamide dehydrogenase), PSMA6 (proteasome (prosome, macropain) subunit, alpha type, 6), PSMB8 (proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) ), CHI3L1 (chitinase 3-like 1 (cartilage glycoprotein-39)), ALDH1B1 (aldehyde dehydrogenase 1 family, member B1), PARP2 (poly (ADP-ribose) polymerase 2), S TAR (steroid-producing acute regulatory protein), LBP (lipopolysaccharide binding protein), ABCC6 (ATP binding cassette, subfamily C (CFTR / MRP), member 6), RGS2 (regulator of G-protein signaling 2, 24 kDa), EFNB2 (ephrin-B2), GJB6 (gap junction protein, beta 6, 30 kDa), APOA2 (apolipoprotein A-II), AMPD1 (adenosine monophosphate deaminase 1), DYSF (disferrin, limb muscular dystrophy 2B (autosomal recessive)) ), FDFT1 (farnesyl-diphosphate farnesyltransferase 1), EDN2 (endothelin 2), CCR6 (chemokine (C-C motif) receptor 6), GJB3 (gap junction protein, base) 3, 31 kDa), IL1RL1 (interleukin 1 receptor-like 1), ENTPD1 (ectonucleoside triphosphate diphosphohydrolase 1), BBS4 (Valday-Beidol syndrome 4), CELSR2 (cadherin, EGF LAG7 transmembrane G-type receptor) Body 2 (Flamingo homologue, Drosophila)), F11R (F11 receptor), RAPGEF3 (Rap guanine nucleotide exchanger (GEF) 3), HYAL1 (hyaluronoglucosaminidase 1), ZNF259 (zinc finger protein 259), ATOX1 (ATX1) Antioxidant protein 1 homolog (yeast)), ATF6 (activated transcription factor 6), KHK (ketohexokinase (fructokinase)), SAT1 (spermidine / spermine N1-acetyltransferase 1) , GGH (gamma-glutamyl hydrolase (conjugase, folyl polygamma glutamyl hydrolase)), TIMP4 (TIMP metallopeptidase inhibitor 4), SLC4A4 (solute carrier family 4, sodium bicarbonate symporter, member 4), PDE2A ( Phosphodiesterase 2A, cGMP stimulating), PDE3B (phosphodiesterase 3B, cGMP inhibitory), FADS1 (fatty acid desaturase 1), FADS2 (fatty acid desaturase 2), TMSB4X (thymosin beta 4, X-linked), TXNIP (thioredoxin interacting protein), LIMS1 (LIM and senescent cell antigen-like domain 1), RHOB (Las homologue gene family, member B), LY96 (lymphocyte antigen 96), FOXO1 (fork) Box 1), PNPLA2 (patatin-like phospholipase domain-containing 2), TRH (thyrotropin releasing hormone), GJC1 (gap junction protein, gamma 1, 45 kDa), SLC17A5 (solute carrier family 17 (anion / sugar transporter), member 5 ), FTO (fat mass and obesity related), GJD2 (gap junction protein, Delta 2, 36 kDa), PSRC1 (proline / serine rich coiled coil 1), CASP12 (caspase 12 (gene / pseudogene)), GPBAR1 (G protein binding) Bile acid receptor 1), PXK (PX domain-containing serine / threonine kinase), IL33 (interleukin 33), TRIB1 (tribull homolog 1 (Drosophila)), PBX4 (pre-B cell leukemia homeobot 4), NUPR1 (nuclear protein, transcription regulator, 1), 15-Sep (15 kDa selenium protein), CILP2 (cartilage intermediate layer protein 2), TERC (telomerase RNA component), GGT2 (gamma-glutamyltransferase 2) MT-CO1 (cytochrome c oxidase I encoded by mitochondria), and UOX (urate oxidase, pseudogene), but are not limited to these.

  In a further embodiment, the chromosomal sequence is Pon1 (paraoxonase 1), LDLR (LDL receptor), ApoE (apolipoprotein E), Apo B-100 (apolipoprotein B-100), ApoA (apolipoprotein (a). ), ApoA1 (apolipoprotein A1), CBS (cystathion B-synthase), glycoprotein IIb / IIb, MTHRF (5,10-methylenetetrahydrofolate reductase (NADPH)), and combinations thereof. In one iteration, the chromosomal sequence involved in cardiovascular disease and the protein encoded by the chromosomal sequence may be selected from Cacna1C, Sod1, Pten, Ppar (alpha), Apo E, leptin, and combinations thereof .

In certain embodiments, using animals produced by the methods of the present invention, using measurements commonly used in cardiovascular disease research, mutations affecting the onset and / or progression of animals and cardiovascular diseases. Study the impact. For example, suitable disease measurements may include behavioral, electrophysiological, neurochemical, biochemical, or cellular dysfunction that can be assessed using any of several well-known diagnostic tests or assays. Good.

E. Alzheimer's disease

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with Alzheimer's disease (AD) has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In some embodiments, one or more chromosomal sequences associated with AD may be edited. An AD-related nucleic acid sequence can typically be selected based on an experimental association of an AD-related nucleic acid sequence with an AD disorder. The AD-related nucleic acid sequence can encode an AD-related protein or can be an AD-related regulatory sequence. For example, the production rate or circulating concentration of AD-related protein can be increased or suppressed in a population with AD disorder compared to a population lacking AD disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  As a non-limiting example, proteins associated with AD include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene. NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) encoded by the UBA3 gene, aquaporin 1 protein (AQP1) encoded by the AQP1 gene, a biquitin carboxyl terminal esterase L1 protein (UCHL1) encoded by the UCHL1 gene, Ubiquitin carboxyl-terminal hydrolase isozyme L3 protein (UCHL3) encoded by UCHL3 gene, ubiquitin B protein encoded by UBB gene UBB), microtubule-associated protein tau (MAPT) encoded by the MAPT gene, protein tyrosine phosphatase receptor protein (PTPRA) encoded by the PTPRA gene, phosphatidylinositol-binding clathrin-associated protein (PICALM) encoded by the PICALM gene Clusterin protein encoded by CLU gene (also known as apolipoprotein J), presenilin 1 protein encoded by PSEN1 gene, presenilin 2 protein encoded by PSEN2 gene, sortilin related receptor encoded by SORL1 gene L (DLR class) A repeat-containing protein (SORL1) protein, encoded by the APP gene Amyloid precursor protein (APP), apolipoprotein E precursor (APOE) encoded by the APOE gene, or brain-derived neurotrophic factor (BDNF) encoded by the BDNF gene, or combinations thereof, It is not limited to them.

  In certain embodiments, animals created by the methods of the invention are used to study the effects of mutations on animals and the onset and / or progression of AD using measurements commonly used in AD research. be able to. Measurements commonly used in AD research include, without limitation, learning and memory, anxiety, depression, addiction, and sensory-motor function, and functional, pathological, metabolic, or biochemical Assays are included. Those skilled in the art are familiar with other suitable measurements or indicators of AD. In general, such measurements may be made relative to wild-type littermates.

  Other measures of behavior may include assessment of voluntary behavior. Spontaneous behavior can be assessed using any one or more methods of spontaneous behavioral observations known in the art. In general, any spontaneous behavior within the animal's known behavioral repertoire can be observed, including exercise, posture, social interaction, breeding, sleep, blinking, eating, drinking, urination, defecation, mating, and attack . Detailed battery of observations to quantify spontaneous behaviors in mice and rats are well known in the art and include abnormal postures such as posture, breathing, tonic involuntary movements, gait or shaking, tension Includes, but is not limited to, home cage observations such as pathogenic behavior, occurrence, eyelid closure, mating frequency, wheeling behavior, nesting, and frequency of aggressive interactions.

  In another embodiment, the animals of the invention are used to develop disease states or disorders that are other than AD but also related to AD-related proteins, using measurements commonly used in the study of the condition or disorder. Study the effects of mutations on Non-limiting examples of non-AD conditions or disorders related to AD-related proteins include dementia, congenital cerebellar ataxia, mental retardation such as learning and memory deficits, spondylosis, tauopathy or fibrosis, amyloidosis Neurodegeneration, parkinsonism, progressive supranuclear palsy, Pick's disease, male infertility, prostate and breast cancer, squamous cell carcinoma, lymphoma, leukemia, and atherosclerosis.

Yet another aspect includes a method for assessing the effectiveness of potential gene therapy strategies. That is, a chromosomal sequence encoding a protein associated with AD is modified such that a genetically modified animal can have an altered response to the onset and / or progression of AD compared to an untreated animal. be able to. In other words, mutated genes that predispose animals to AD can be “corrected” through gene therapy.

F. Autism spectrum disorder

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with autism spectrum disorder (ASD) has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with ASD may be edited. ASD-related proteins or regulatory sequences can typically be selected based on experimental association of proteins or regulatory sequences with the occurrence or adaptation of ASD. For example, the production rate or circulating concentration of a protein associated with ASD can be increased or suppressed in a population with ASD compared to a population lacking ASD. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  What is the protein associated with ASD whose chromosomal sequence is edited can and will vary. In a preferred embodiment, the protein associated with ASD whose chromosomal sequence is edited is benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1) encoded by the BZRAP1 gene, AF4 / FMR2 family member 2 encoded by the AFF2 gene Protein (AFF2) (also referred to as MFR2), fragile X mental retardation autosomal homologue 1 protein (FXR1) encoded by the FXR1 gene, fragile X mental retardation autosomal homologue 2 protein (FXR2) encoded by the FXR2 gene ), MAM domain-containing glycosylphosphatidylinositol anchor 2 protein (MDGA2) encoded by the MDGA2 gene, methyl CpG binding protein 2 encoded by the MECP2 gene ( ECP2), metabotropic glutamate receptor 5 encoded by MGLUR5-1 gene (MGLUR5) (also referred to as GRM5), neulexin 1 protein encoded by NRXN1 gene, or semaphorin-5 encoded by SEMA5A gene It can be a protein (SEMA5A).

  Edited or integrated chromosomal sequences may be modified to encode altered proteins associated with ASD. Non-limiting examples of mutations in proteins associated with ASD include the L18Q mutation in Neulexin 1 in which leucine at position 18 is replaced with glutamine, the R451C mutation in Neurolysin 3 in which arginine at position 451 is replaced with cysteine, 87 R87W mutation in Neurolysine 4 where arginine at position is replaced with tryptophan and I425V mutation in serotonin transporter where leucine at position 425 is replaced with valine. Several other mutations and chromosomal translocations in ASD-related chromosomal sequences have been associated with ASD and are known in the art. For example, Freitag et al. (2010) Eur. Child. Adolesc. Psychiatry 19: 169-178, and Bucan et al. (2009) PLoS Genetics 5: e10000536, the disclosures of which are incorporated herein by reference in their entirety.

In certain embodiments, animals produced by the methods of the present invention are used to study the effects of mutations on animals and the development and / or progression of ASD using measurements commonly used in ASD studies. be able to.

G. Macular degeneration

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with macular degeneration (MD) has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with MD may be edited. MD-related proteins or regulatory sequences can typically be selected based on experimental association of MD-related proteins with MD disorders. For example, the production rate or circulating concentration of a protein associated with MD can be increased or suppressed in a population with MD disorder compared to a population lacking MD disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  What is the protein associated with MD whose chromosomal sequence is edited can and will vary. In a preferred embodiment, the protein associated with MD whose chromosomal sequence is edited is the ATP binding cassette, the subfamily A (ABC1) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein encoded by the APOE gene By E protein (APOE), chemokine (CC motif) ligand 2 protein (CCL2) encoded by CCL2 gene, chemokine (CC motif) receptor 2 protein (CCR2) encoded by CCR2 gene, CP gene Inhibitor of metalloproteinase encoded by the encoded ceruloplasmin protein (CP), cathepsin D protein (CTSD) encoded by the CTSD gene, or TIMP3 gene 3 may be a protein (TIMP3).

In certain embodiments, using genetically modified animals produced by the methods of the present invention, using the measurements commonly used in MD studies to study the effects of mutations on MD progression Can do. Alternatively, using the genetically modified animals of the present invention, using the measurements commonly used in the study of the disease state or disorder, the mutations that affect the progression of the disease state or disorder associated with the protein associated with MD Study the impact. Non-limiting examples of measurements that may be used include drusen accumulation, lipofuscin accumulation, Bruch membrane thickening, retinal degeneration, choroidal neovascularization, differential response to compounds, abnormalities in tissues or cells, genetically modified animals and wild-type animals Biochemical or molecular differences between, or a combination thereof.

H. schizophrenia

  In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with schizophrenia has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with schizophrenia may be edited. Schizophrenia-related proteins or regulatory sequences can typically be selected based on experimental association of proteins associated with schizophrenia with the onset or progression of schizophrenia. For example, the production rate or circulating concentration of a protein associated with schizophrenia can be increased or suppressed in a population with schizophrenia compared to a population without schizophrenia. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art. Illustrative non-limiting examples of chromosomal sequences associated with schizophrenia include NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF, DISC1, GSK3B, and combinations thereof, each of which Are described in more detail below.

  In certain embodiments, animals produced by the methods of the invention are used to study the effects of mutations on animals and the onset and / or progression of MD using measurements commonly used in MD studies. be able to.

The occurrence or signs of schizophrenia or related disorders can occur spontaneously in genetically modified animals. Alternatively, the occurrence or adaptation of schizophrenia or related disorders may be facilitated by exposure to a disturbing factor. Non-limiting examples of perturbing factors include proteins, drugs, toxicants, chemicals, activated retroviruses, and environmental stress associated with schizophrenia, such as any of the aforementioned drugs. Non-limiting examples of environmental stress include forced swimming, cold swimming, platform vibration stimulation, loud noise, and immobilization stress.

I. Tumor suppression

  A tumor suppressor gene is a gene whose protein product protects cells from one step leading to cancer. Mutations in tumor suppressor genes, usually in combination with other genetic changes, can cause loss or reduction of the protective function of the protein product, thereby increasing the likelihood that a tumor will form and lead to cancer. Proteins encoded by tumor suppressor genes have a blunting or inhibitory effect on cell cycle control, or promote apoptosis and sometimes perform both functions. Tumor control proteins suppress genes that are essential for the ongoing cell cycle, i.e. link the cell cycle with DNA damage so that the cell cycle can continue, and if the damage is irreparable, It is involved in blocking the loss of contact inhibition and inhibiting metastasis by initiating apoptosis in and cell adhesion to prevent tumors from spreading.

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with tumor suppression has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with tumor suppression may be edited. Tumor suppression related proteins or regulatory sequences can typically be selected based on experimental association of the protein of interest with cancer. For example, the production rate or circulating concentration of a protein associated with tumor suppression can be increased or suppressed in a population with cancer compared to a population without cancer. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

For example, proteins involved in tumor suppression include TNF (tumor necrosis factor (TNF superfamily, member 2)), TP53 (tumor protein p53), ERBB2 (v-erb-b2 erythrocytic leukemia virus oncogene homology) Body 2, neuro / glioblastoma derived oncogene homolog (bird), FN1 (fibronectin 1), TSC1 (tuberous sclerosis 1), PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G / H) Synthase and cyclooxygenase)), PTEN (phosphatase and tensin homologs), PCNA (proliferating cell nuclear antigen), COL18A1 (collagen, type XVIII, alpha 1), TSSC4 (tumor suppressor subtransferable candidate 4), JU (Jun oncogene), MAPK8 (mitogen-activated protein kinase 8), TGFB1 (transforming growth factor, beta 1), IL6 (interleukin 6 (interferon, beta 2)), IFNG (interferon, gamma), BRCA1 (breast cancer) 1, early onset), TSPAN32 (tetraspanin 32), BCL2 (B cell CLL / lymphoma 2), NF2 (neurofibromin 2 (merlin)), GJB1 (gap junction protein, beta 1, 32 kDa), MAPK1 (mitogenic activity) Protein kinase 1), CD44 (CD44 molecule (Indian blood group)), PGR (progesterone receptor), TNS1 (tensin 1), PROK1 (prokineticin 1), SIAH1 (seven in seven absentia) homolog 1 (Drosophila)), ENG (endoglin), TP73 (tumor protein p73), APC (colon adenomatosis), BAX (BCL2-related X protein), SRC (v-src sarcoma (Schmidt-Rupin A-) 2) Virus oncogene homologue (bird)), VHL (von Hippel-Lindau tumor control), FHIT (fragile histidine triple residue gene), NFKB1 (nuclear factor 1 of kappa light polypeptide gene enhancer in B cells), IFNA1 (interferon, alpha 1), TGFBR1 (transforming growth factor, beta receptor 1), PRKCD (protein kinase C, delta), TGIF1 (TGFB-inducible factor homeobox 1), DLC1 (deletion 1 in liver cancer) , SLC22A18 Solute carrier family 22, member 18), VEGFA (vascular endothelial growth factor A), MME (membrane metallo-endopeptidase), IL3 (interleukin 3 (colony stimulating factor, multiple)), MKI67 (by monoclonal antibody Ki-67) Identified antigen), HSPD1 (heat shock 60 kD protein 1 (chaperonin)), HSPB1 (heat shock 27 kD protein 1), HSP90B2P (heat shock protein 90 kDa beta (Grp94), member 2 (pseudogene)), MBL2 (mannose binding) Lectin (protein C) 2, soluble (opsonin defect)), ZFYVE9 (zinc finger, FYVE domain containing 9), TERT (telomerase reverse transcription), PML (promyelocytic leukemia), SKP2 (S phase kinase related) Protein 2 (p45)), CYCS (cytochrome c, somatic), MAPK10 (mitogen-activated protein kinase 10), PAX7 (paired box 7), YAP1 (Yes-related protein 1), PARP1 (poly (ADP-)) Ribose) polymerase 1), MIR34A (microRNA 34a), PRKCA (protein kinase C, alpha), FAS (Fas (TNF receptor superfamily, member 6)), SYK (spleen tyrosine kinase), GSK3B (glycogen synthase kinase 3 beta) ), PRKCE (protein kinase C, epsilon), CYP19A1 (cytochrome P450, family 19, subfamily A, polypeptide 1), ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B cell inhibitory factor, alpha), RUNX1 (runt-related transcription factor 1), PRKCG (protein kinase C, gamma), RELA (v-rel) Reticuloendotheliosis virus oncogene homolog A (bird)), PLAU (plasminogen activator, urokinase), BTK (breton agammaglobulinemia tyrosine kinase), PRKCB (protein kinase C, beta), CSF1 (colony stimulating factor) 1 (macrophages)), POMC (proopiomelanocortin), CEBPB (CCAAT / enhancer binding protein (C / EBP), beta), ROCK1 (Rho-related, coiled-coil-containing protein kinase 1), KDR (kinner) Insertion domain receptor (type III receptor tyrosine kinase)), NPM1 (nucleophosmin (nuclear phosphate protein B23, numatrine)), ROCK2 (Rho-related, coiled-coil-containing protein kinase 2), PRKAB1 (protein kinase, AMP) Activation, beta 1 non-catalytic subunit), BAK1 (BCL2-antagonist / killer 1), AURKA (Aurora kinase A), NTN1 (netrin 1), FLT1 (fms-related tyrosine kinase 1 (vascular endothelial growth factor / vascular permeability) Factor receptor)), NBN (nibrin), DNM3 (dynamin 3), PRDM10 (PR domain containing 10), PAX5 (paired box 5), EIF4G1 (eukaryotic translation initiation factor 4 gamma, 1), KAT2B (K (Lysine) acetylto Transferase 2B), TIMP3 (TIMP metallopeptidase inhibitor 3), CCL22 (chemokine (CC motif) ligand 22), GRIN2B (glutamate receptor, counterionic, N-methyl D-aspartate 2B), CD81 ( CD81 molecule), CCL27 (chemokine (CC motif) ligand 27), MAPK11 (mitogen-activated protein kinase 11), DKK1 (Dickkovian homologue 1 (Xenopus laevis)), HYAL1 (hyaluronoglucosaminidase 1), CTSL1 ( Cathepsin L1), PKD1 (poly polycystic kidney disease 1 (autosomal dominant)), BUB1B (budding 1 homologue beta (yeast) not inhibited by benzimidazole), MPP1 (membrane protein, palmitoylated 1, 55 kDa) , SIAH2 (Absence 7 homolog 2 (Drosophila)), DUSP13 (bispecific phosphatase 13), CCL21 (chemokine (CC motif) ligand 21), RTN4 (reticulon 4), SMO (Smoond homolog ( Drosophila)), CCL19 (chemokine (CC motif) ligand 19), CSTF2 (cleavage stimulating factor, 3 \ 'preRNA, subunit 2, 64 kDa), RSF1 (remodeling and spacing factor 1), EZH2 (Zest (Zeste) enhancer of homologue 2 (Drosophila)), AK1 (adenylate kinase 1), CKM (creatine kinase, muscle), HYAL3 (hyaluronoglucosaminidase 3), ALOX15B (arachidonic acid 15-lipoxygenase, type B) , PAG1 (phosphate-related protein glycosphingolipid microdomain 1), MIR21 (microRNA21), S100A2 (S100 calcium binding protein A2), HYAL2 (hyaluronoglucosaminidase 2), CSTF1 (cleavage stimulating factor, 3 \ 'preRNA, Subunit 1, 50 kDa), PCGF2 (polycomb group ring finger 2), THSD1 (thrombospondin, type I, domain containing 1), HOPX (HOP homeobox), SLC5A8 (solute carrier family 5 (iodinated transporter)), Member 8), EMB (envidin homologue (mouse)), PAX9 (paired box 9), ARMCX3 (armadillo repeat-containing, X-linked 3), ARMCX2 (armadillo repeat-containing, X-linked 2), ARMCX1 (Al Magiro repeat-containing, X-linked 1), RASSF4 (Ras association (RalGDS / AF-6) domain family member 4), MIR34B (microRNA34b), MIR205 (microRNA205), RB1 (retinoblastoma 1), DYT10 (dystonia) 10), CDKN2A (cyclin-dependent kinase inhibitor 2A (malignant melanoma, p16, inhibits CDK4)), CDKN1A (cyclin-dependent kinase inhibitor 1A (p21, Cip1)), CCND1 (cyclin D1), AKT1 (v -Akt mouse thymoma virus oncogene homolog 1), MYC (v-myc myelocytosis virus oncogene homolog (bird)), CTNNB1 (catenin (cadherin related protein), beta 1, 88 kDa), MDM2 (Mdm2) p5 3 binding protein homologue (mouse)), serpin B5 (serpin peptidase inhibitor, clade B (ovalbumin), member 5), EGF (epidermal growth factor (beta-urogastron)), FOS (FBJ mouse osteosarcoma virus oncogene) Homologs), NOS2 (nitric oxide synthase 2, inducible), CDK4 (cyclin-dependent kinase 4), SOD2 (superoxide dismutase 2, mitochondrion), SMAD3 (SMAD family member 3), CDKN1B (cyclin-dependent kinase inhibition) Factor 1B (p27, Kip1)), SOD1 (superoxide dismutase 1, soluble), CCNA2 (cyclin A2), LOX (lysyl oxidase), SMAD4 (SMAD family member 4), HGF (hepatocyte growth) Child (hepapoietin A; scattering factor)), THBS1 (thrombospondin 1), CDK6 (cyclin-dependent kinase 6), ATM (vasodilatory schizophrenia mutation), STAT3 (signal transduction transcriptional activator 3 (acute phase) Reaction factor)), HIF1A (hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)), IGF1R (insulin-like growth factor 1 receptor), MTOR (mechanistic target of rapamycin (serine) / Threonine kinase)), TSC2 (tuberous sclerosis 2), CDC42 (cell division cycle 42 (GTP binding protein, 25 kDa)), ODC1 (ornithine decarboxylase 1), SPARC (secreted protein, acidic, cysteine-rich (ostoneonectin) )), HDAC1 (Histone Deacetyl) 1), CDK2 (cyclin-dependent kinase 2), BARD1 (BRCA1-related RING domain 1), CDH1 (cadherin 1, type 1, E-cadherin (epithelium)), EGR1 (early proliferative response 1), INSR (insulin) Receptor), IRF1 (interferon regulatory factor 1), PHB (prohibitin), PXN (paxillin), HSPA4 (heat shock 70 kD protein 4), TYR (tyrosinase (skin albinism IA)), CAV1 (caveolin 1, caveolae protein) 22 kDa), CDKN2B (cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), FOXO3 (forkhead box O3), HDAC9 (histone deacetylase 9), FBXW7 (F box and WD repeat domain containing 7) , F OXO1 (forkhead box O1), E2F1 (E2F transcription factor 1), STK11 (serine / threonine kinase 11), BMP2 (bone morphogenic genetic protein 2), HSP90AA1 (heat shock protein 90 kDa alpha (cytosol), class A Member 1), HNF4A (hepatocyte nuclear factor 4, alpha), CAMK2G (calcium / calmodulin-dependent protein kinase II gamma), TP53BP1 (tumor protein p53 binding protein 1), CRYAB (crystallin, alpha B), HMGCR (3-hydroxy -3-methylglutaryl-coenzyme A reductase), PLAUR (plasminogen activator, urokinase receptor), MCL1 (bone marrow cell leukemia sequence 1 (BCL2-related)), NOTCH1 (notch Homologue 1, translocation-related (Drosophila)), RASSF1 (Ras association (RalGDS / AF-6) domain family member 1), GSN (gelsolin), CADM1 (cell adhesion molecule 1), ATF2 (activated transcription factor 2), IFNB1 (interferon, beta 1, fibroblast), DAPK1 (cell death-related protein kinase 1), CHFR (check point with forkhead and ring finger domains), KITLG (KIT ligand), NDUFA13 (NADH dehydrogenase (ubiquinone) 1 Alpha subcomplex, 13), DPP4 (dipeptidyl-peptidase 4), GLB1 (galactosidase, beta 1), IKZF1 (Icarus family zinc finger 1 (Icarus)), ST5 (tumor) Suppression of formation ability 5), TGFA (transforming growth factor, alpha), EIF4EBP1 (eukaryotic translation initiation factor 4E binding protein 1), TGFBR2 (transforming growth factor, beta receptor II (70/80 kDa)), EIF2AK2 (Eukaryotic cell translation initiation factor 2-alpha kinase 2), GJA1 (gap junction protein, alpha 1, 43 kDa), MYD88 (myeloid differentiation primary reaction gene (88)), IFI27 (interferon, alpha-inducible protein 27), RBMX (RNA binding motif protein, X-linked), EPHA1 (EPH receptor A1), TWSG1 (twisted gastrulation homolog 1 (Drosophila)), H2AFX (H2A histone family, member X), LGALS3 (lectin , Galactoside bond, soluble, 3), MUC3A (mucin 3A, cell surface-bound type), ILK (integrin chain kinase), APAF1 (apoptotic peptidase activator 1), MAOA (monoamine oxidase A), ERBB3 (v-erb -B2 erythroblastic leukemia virus oncogene homolog 3 (bird)), EIF2S1 (eukaryotic translation initiation factor 2, subunit 1 alpha, 35 kDa), PER2 (period homolog 2 (Drosophila)), IGFBP7 (insulin) Like growth factor binding protein 7), KDM5B (lysine (K) -specific demethylase 5B), SMARAC4 (SWI / SNF-related, matrix-bound, chromatin actin-dependent regulator, subfamily a, member 4), NME1 (non-metastatic) Cell 1, Expressed protein (NM23A)), F2RL1 (coagulation factor II (thrombin) receptor-like 1), ZFP36 (zinc finger protein 36, C3H type, homologue (mouse)), HSPA8 (heat shock 70 kD protein 8) ), WNT5A (wingless MMTV integration site family, member 5A), ITGB4 (integrin, beta 4), RARB (retinoic acid receptor, beta), VEGFC (vascular endothelial growth factor C), CCL20 (chemokine (CC) Motif) Ligand 20), EPHB2 (EPH receptor B2), CSNK2A1 (Kazen kinase 2, alpha 1 polypeptide), PSMD9 (proteasome (prosome, macropine) 26S subunit, non-ATPase, 9), serpin B2 (se Pinpeptidase inhibitor, clade B (ovalbumin), member 2), RHOB (ras homolog gene family, member B), DUSP6 (bispecific phosphatase 6), CDKN1C (cyclin-dependent kinase inhibitor 1C (p57, Kip2)), SLIT2 (slit homolog 2 (Drosophila)), CEACAM1 (carcinoembryonic antigen-related cell adhesion molecule 1 (bile glycoprotein)), UBC (ubiquitin C), STS (steroid sulfatase (microsome), isozyme S) , FST (follistatin), KRT1 (keratin 1), EIF6 (eukaryotic translation initiation factor 6), JUP (junction placoglobin), HDAC4 (histone deacetylase 4), NEDD4 (neural precursor cell expression, developmental Down 4), KRT14 (keratin 14), GLI2 (GLI family zinc finger 2), MYH11 (myosin, heavy chain 11, smooth muscle), MAPKAPK5 (mitogen-activated protein kinase activated protein kinase 5), MAD1L1 (MAD1 thread) Mitotic arrest-like 1 (yeast)), TNFAIP3 (tumor necrosis factor, alpha-inducible protein 3), WEE1 (WEE1 homologue (fission yeast)), BTRC (containing beta-transducin repeat), NKX3-1 (NK3) Homeobox 1), GPC3 (glypican 3), CREB3 (cAMP responsive element binding protein 3), PLCB3 (phospholipase C, beta 3 (phosphatidylinositol specific)), DMPK (myotonic dystrophy-protein kinase), BL K (B cell linker), PPIA (peptidylprolyl isomerase A (cyclophilin A)), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), KLF4 (Kruppel-like factor 4 ( Intestine)), RUNX3 (runt-related transcription factor 3), FLG (filaggrin), IVL (involucrin), CCT5 (chaperonin containing TCP1, subunit 5 (epsilon)), LRPAP1 (low-density lipoprotein receptor-related protein-related) Protein 1), IGF2R (insulin-like growth factor 2 receptor), PER1 (period homolog 1 (Drosophila)), BIK (BCL2 interaction killer (apoptosis induction)), PSMC4 (proteasome (prosome, maize) Lopain) 26S subunit, ATPase, 4), USF2 (upstream transcription factor 2, c-fos interaction), GAS1 (growth arrest specific 1), LAMP2 (lysosome-related membrane protein 2), PSMD10 (proteasome (prosome, macrosome) Pine) 26S subunit, non-ATPase, 10), IL24 (interleukin 24), GADD45G (growth arrest and DNA damage induction, gamma), ARHGAP1 (Rho GTPase activating protein 1), CLDN1 (Claudin 1), ANXA7 (Annexin A7), CHN1 (chimerin (chimerin) 1), TXNIP (thioredoxin interacting protein), PEG3 (paternal expression 3), EIF3A (eukaryotic translation initiation factor 3, subunit A), CASC5 (cancer susceptibility) Supplement 5), TCF4 (transcription factor 4), CSNK2A2 (Kazen kinase 2, alpha prime polypeptide), CSNK2B (Kazen kinase 2, beta polypeptide), CRY1 (cryptochrome 1 (photolyase-like)), CRY2 (cryptochrome 2 ( Photolyase-like)), EIF4G2 (eukaryotic translation initiation factor 4 gamma, 2), LOXL2 (lysyl oxidase-like 2), PSMD13 (proteasome (prosome, macropain) 26S subunit, non-ATPase, 13), ANP32A (acidic) (Leucine-rich) nuclear phosphate protein 32 family, member A), COL4A3 (collagen, type IV, alpha 3 (goodpasture antigen)), SCGB1A1 (secretoglobin, family 1A, member 1 (utelog) Robin)), BNIP3L (BCL2 / Adenovirus E1B 19 kDa interacting protein 3-like), MCC (mutation in colorectal cancer), EFNB3 (Ephrin-B3), RBBP8 (retinoblastoma binding protein 8), PALB2 (BRCA2) Partners and localizers), HBP1 (HMG box transcription factor 1), MRPL28 (mitochondrial ribosomal protein L28), KDM5A (lysine (K) specific demethylase 5A), QSOX1 (quecin Q6 sulfhydryl oxidase 1), ZFR (zinc finger RNA binding protein) ), MN1 (meningiomas (destroyed in equilibrium transposition) 1), SMYD4 (containing SET and MYND domains 4), USP7 (ubiquitin-specific peptidase 7 (herpesvirus-related) STK4 (serine / threonine kinase 4), THY1 (Thy-1 cell surface antigen), PTPRG (protein tyrosine phosphatase, receptor type, G), E2F6 (E2F transcription factor 6), STX11 (syntaxin 11), CDC42BPA (CDC42 binding protein kinase alpha (DMPK-like)), MYOCD (myocardin), DAP (cell death-related protein), LOXL1 (lysyl oxidase-like 1), RNF139 (ring finger protein 139), HTATIP2 (HIV-1 Tat interacting protein) 2, 30 kDa), AIM1 (not present in malignant melanoma 1), BCCIP (BRCA2 and CDKN1A interacting protein), LOXL4 (lysyl oxidase-like 4), WWC1 (WW and C 2 domains containing 1), LOXL3 (lysyl oxidase-like 3), CENPN (centromere protein N), TNS4 (tensin 4), SIK1 (salt-inducible kinase 1), PCGF6 (polycomb group ring finger 6), PHLDA3 (plextrin homology) Sexual domain, family A, member 3), IL32 (interleukin 32), LATS1 (LATS, large tumor regulator, homolog 1 (Drosophila)), COMMD7 (COMM domain containing 7), CDHR2 (cadherin-related family member 2) ), LELP1 (late keratinocyte-like proline rich 1), NCRNA00188 (non-protein-encoding RNA 188), and ENSG00000131023, but are not limited thereto.

  Non-limiting examples of exemplary tumor suppressor proteins include ATM (vasodilatory ataxia mutation), ATR (vasodilatory ataxia and Rad3-related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb -B2 erythroblastic leukemia virus oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia virus oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia virus oncogene) Homologue 4), Notch1, Notch2, Notch3, Notch4, ATK1 (V-akt mouse thymoma virus oncogene homolog 1), ATK2 (v-akt mouse thymoma virus oncogene homolog 2), ATK3 (V-akt mouse thymoma virus oncogene homolog 3), HIF1a (hypoxia-inducible factor 1a), HIF3a (hypoxia-inducible factor 1) ), Met (met pronto-oncogene), HRG (histidine-rich glycoprotein), Bc12, PPAR (alpha) (peroxisome proliferator activated receptor alpha), Ppar (gamma) (peroxisome proliferator activated receptor) Gamma), WT1 (Wilms tumor 1), FGF1R (fibroblast growth factor 1 receptor), FGF2R (fibroblast growth factor 1 receptor), FGF3R (fibroblast growth factor 3 receptor), FGF4R (fibroblast) Cell growth factor 4 receptor), FGF5R (fibroblast growth factor 5 receptor), CDKN2a (cyclin-dependent kinase inhibitor 2A), APC (colon adenomatosis), Rb1 (retinoblastoma 1), MEN1 (multiple Endocrine gland tumor 1), VHL (von Hippel-Lindau tumor control), BRCA1 (breast cancer 1) BRCA2 (breast cancer 2), AR (androgen receptor), TSG101 (tumor susceptibility gene 101), Igf1 (insulin-like growth factor 1), Igf2 (insulin-like growth factor 2), Igf 1R (insulin-like growth factor 1 receptor) Igf 2R (insulin-like growth factor 2 receptor) Bax (BCL-2 binding X protein), CASP 1 (caspase 1), CASP 2 (caspase 2), CASP 3 (caspase 3), CASP 4 (caspase 4), CASP 6 (caspase 6), CASP 7 (caspase 7), CASP 8 (caspase 8), CASP 9 (caspase 9), CASP 12 (caspase 12), Kras (v-Ki-ras2 Kasten rate) sarcoma Viral oncogene homologue), PTE N (phosphate and tensin homologs), BCRP (breast cancer receptor protein), p53, and combinations thereof.

  In certain embodiments, animals produced by the methods of the present invention can be used to study the effects of mutations on animals and tumor suppression using measurements commonly used in tumor suppression studies. In one embodiment, genetically modified animals that contain inactivated chromosomal sequences involved in tumor suppression can be used to determine susceptibility to tumor development. The method includes exposing genetically modified animals and wild-type animals containing inactivated tumor control sequences to carcinogens and then monitoring tumor development. Animals containing inactivated tumor control sequences may have an increased risk of tumor formation. Furthermore, animals with inactivated tumor control sequences homozygous may have an increased risk compared to animals with the same inactivated sequence heterozygous, which is similar May have an increased risk compared to wild-type animals. Similar methods can be used to screen for spontaneous tumors when the aforementioned animals are not exposed to carcinogens.

In another embodiment, animals containing inactivated chromosomal sequences associated with tumor suppression can be used to assess the carcinogenic potential of a test agent. The method includes contacting genetically modified animals and wild-type animals containing inactivated tumor control sequences with a test agent and then monitoring tumor development. A test agent may be carcinogenic if an animal containing an inactivated tumor control sequence has increased tumor development compared to a wild-type animal.

J. et al. Secretase-related disorders

  Secretases constitute a group of diverse series of proteins that affect susceptibility to multiple disorders, the presence of the disorder, the severity of the disorder, or any combination thereof. A secretase is an enzyme that cleaves smaller pieces of another transmembrane protein. Secretase is involved in many disorders, including, for example, Alzheimer's disease. In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with a secretase-related disorder has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with a secretase-related disorder may be edited. A secretase-related disorder-related protein or regulatory sequence can typically be selected based on an experimental association of a secretase-related protein with the onset of a secretase disorder. For example, the production rate or circulating concentration of a protein associated with a secretase disorder can be increased or suppressed in a population with a secretase disorder compared to a population without a secretase disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  By way of non-limiting example, proteins associated with secretase disorders include PSENEN (Presenilin Enhancer 2 homolog (Caenolabditis elegans)), CTSB (cathepsin B), PSEN1 (Presenilin 1), APP (Amyloid beta ( A4) precursor protein), APH1B (anterior pharyngeal defect 1 homologue B (Caenolabditis elegans)), PSEN2 (presenilin 2 (Alzheimer's disease 4)), BACE1 (beta site APP-cleaving enzyme 1), ITM2B ( Integrated membrane protein 2B), CTSD (cathepsin D), NOTCH1 (Notch homologue 1, translocation associated (Drosophila)), TNF (tumor necrosis factor (TNF superfamily, member 2)), INS (insulin), DYT10 (dystonia 10) ), A AM17 (ADAM metallopeptidase domain 17), APOE (apolipoprotein E), ACE (angiotensin I converting enzyme (peptidyl-dipeptidase A) 1), STN (statin), TP53 (tumor protein p53), IL6 (interleukin 6 ( Interferon, beta 2)), NGFR (nerve growth factor receptor (TNFR superfamily, member 16)), IL1B (interleukin 1, beta), ACHE (acetylcholinesterase (Yt blood group)), CTNNB1 (catenin (cadherin related) Protein), beta 1, 88 kDa), IGF1 (insulin-like growth factor 1 (somatomedin C)), IFNG (interferon, gamma), NRG1 (neuregulin 1), CASP3 (caspase 3) Apoptosis-related cysteine peptidase, MAPK1 (mitogen-activated protein kinase 1), CDH1 (cadherin 1, type 1, E-cadherin (epithelium)), APBB1 (amyloid beta (A4) precursor protein binding, family B, member 1 ( Fe65)), HMGCR (3-hydroxy-3-methylglutaryl-coenzyme A reductase), CREB1 (cAMP responsive element binding protein 1), PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G / H) Synthase and cyclooxygenase)), HES1 (split hair-like and enhancer 1, (Drosophila)), CAT (catalase), TGFB1 (transforming growth factor, beta 1), ENO2 (enola) Ase 2 (gamma, neural type)), ERBB4 (v-erb-a erythroblastic leukemia virus oncogene homolog 4 (bird)), TRAPPC10 (transport protein particle complex 10), MAOB (monoamine oxidase B) , NGF (nerve growth factor (beta polypeptide)), MMP12 (matrix metallopeptidase 12 (macrophaselase)), JAG1 (Jagid 1 (Alagille syndrome)), CD40LG (CD40 ligand), PPARG (peroxisome growth factor activity) Receptor gamma), FGF2 (fibroblast growth factor 2 (basic)), IL3 (interleukin 3 (colony stimulating factor, multiple)), LRP1 (low density lipoprotein receptor-related protein 1), NOTCH4 ( Notch homolog 4 (Drosophila)), M PK8 (mitogen-activated protein kinase 8), PREP (prolyl endopeptidase), NOTCH3 (Notch homolog 3 (Drosophila)), PRNP (prion protein), CTSG (cathepsin G), EGF (epidermal growth factor (beta-urogastron) )), REN (renin), CD44 (CD44 molecule (Indian blood group)), SELP (selectin P (granular membrane protein 140 kDa, antigen CD62)), GHR (growth hormone receptor), ADCYAP1 (adenylate cyclase activation) Polypeptide 1 (pituitary)), INSR (insulin receptor), GFAP (glial fiber acidic protein), MMP3 (matrix metallopeptidase 3 (stromelysin 1, progelatinase)), MAPK10 (mitogenic activity) Protein kinase 10), SP1 (Sp1 transcription factor), MYC (v-myc myelocytosis virus oncogene homolog (bird)), CTSE (cathepsin E), PPARA (peroxisome proliferator activated receptor alpha), JUN (jun oncogene), TIMP1 (TIMP metallopeptidase inhibitor 1), IL5 (interleukin 5 (colony stimulating factor, eosinophil)), IL1A (interleukin 1, alpha), MMP9 (matrix metallopeptidase 9 (gelatinase) B, 92 kDa gelatinase, 92 kDa type IV collagenase)), HTR4 (5-hydroxytryptamine (serotonin) receptor 4), HSPG2 (heparan sulfate proteoglycan 2), KRAS (v-Ki-ras2 casten rat sarcoma virus) Gene homologue), CYCS (cytochrome c, somatic), SMG1 (SMG1 homologue, phosphatidylinositol 3-kinase related kinase (Caenolabditis elegans)), IL1R1 (interleukin 1 receptor, type I), PROK1 (prokineticin 1), MAPK3 (mitogen-activated protein kinase 3), NTRK1 (neurotrophic tyrosine kinase, receptor type 1), IL13 (interleukin 13), MME (membrane metallo-endopeptidase), TKT (trans Ketolase), CXCR2 (chemokine (C—X—C motif) receptor 2), IGF1R (insulin-like growth factor 1 receptor), RARA (retinoic acid receptor, alpha), CREBBP (CREB binding protein), PTGS1 ( Prostagland Gin-endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)), GALT (galactose-1-phosphate uridyltransferase), CHRM1 (cholinergic receptor, muscarinic 1), ATXN1 (Ataxin 1) , PAWR (PRKC, apoptosis, WT1, regulator), NOTCH2 (Notch homolog 2 (Drosophila)), M6PR (mannose-6-phosphate receptor (anion-dependent)), CYP46A1 (cytochrome P450, family 46, sub) Family A, polypeptide 1), CSNK1D (kazen kinase 1, delta), MAPK14 (mitogen-activated protein kinase 14), PRG2 (proteoglycan 2, bone marrow (natural killer cell activator, Eosinophil granule main basic protein)), PRKCA (protein kinase C, alpha), L1CAM (L1 cell adhesion molecule), CD40 (CD40 molecule, TNF receptor superfamily member 5), NR1I2 (nuclear receptor subfamily 1) , Group I, member 2), JAG2 (jaggide 2), CTNND1 (catenin (cadherin-related protein), delta 1), CDH2 (cadherin 2, type 1, N-cadherin (neural type)), CMA1 (chymase 1, mast) Cells), SORT1 (sortilin 1), DLK1 (delta-like 1 homolog (Drosophila)), THEM4 (thioesterase superfamily member 4), JUP (junction placoglobin), CD46 (CD46 molecule, complement regulatory protein), CCL11 (Chemokai (CC motif) ligand 11), CAV3 (caveolin 3), RNASE3 (ribonuclease, RNase A family, 3 (eosinophil anionic protein)), HSPA8 (heat shock 70 kD protein 8), CASP9 (caspase 9, Apoptosis-related cysteine peptidase), CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4), CCR3 (chemokine (CC motif) receptor 3), TFAP2A (transcription factor AP-2 alpha (activation enhancer binding) Protein 2 alpha)), SCP2 (sterol carrier protein 2), CDK4 (cyclin-dependent kinase 4), HIF1A (hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Child)), TCF7L2 (transcription factor 7-like 2 (T cell-specific, HMG box)), IL1R2 (interleukin 1 receptor, type II), B3GALTL (beta1,3-galactosyltransferase-like), MDM2 (Mdm2 p53 Binding protein homolog (mouse)), RELA (v-rel reticuloendotheliosis virus oncogene homolog A (bird)), CASP7 (caspase 7, apoptosis-related cysteine peptidase), IDE (insulin-degrading enzyme), FABP4 (fatty acid) Binding protein 4, adipocytes), CASK (calcium / calmodulin-dependent serine protein kinase (MAGUK family)), ADCYAP1R1 (adenylate cyclase-activating polypeptide 1 (pituitary) receptor type I), ATF4 (activation) Transcription factor (Tax responsive enhancer element B67)), PDGFA (platelet-derived growth factor alpha polypeptide), C21orf33 (chromosome 21 open reading frame 33), SCG5 (secretogranin V (7B2 protein)), RNF123 (ring finger protein 123) NFKB1 (nuclear factor 1 of kappa light polypeptide gene enhancer in B cells), ERBB2 (v-erb-b2 erythroblastic leukemia virus oncogene homolog 2, neuro / glioblastoma oncogene homolog (bird) ), CAV1 (caveolin 1, caveolae protein, 22 kDa), MMP7 (matrix metallopeptidase 7 (matrilidine, uterine)), TGFA (transforming growth factor, alpha), RXRA (retinoid X receptor, a Rufa), STX1A (syntaxin 1A (brain)), PSMC4 (proteasome (prosome, macropain) 26S subunit, ATPase, 4), P2RY2 (purinergic receptor P2Y, G-protein binding, 2), TNFRSF21 (tumor) Necrosis factor receptor superfamily, member 21), DLG1 (disc, large homolog 1 (Drosophila)), NUMBL (num homolog (Drosophila) -like), SPN (sialophorin), PLSCR1 (phospholipid scramblase 1) ), UBQLN2 (ubiquitin 2), UBQLN1 (ubiquitin 1), PCSK7 (proprotein convertase subtilisin / kexin type 7), SPON1 (spondin 1, extracellular matrix protein), SILV (silver phase) Body (mouse)), QPCT (glutaminyl - peptide cyclo transferase), HES5 (split ciliary and enhancer 5 (Drosophila)), GCC1 (GRIP and coiled-coil domain containing 1), and any combination thereof.

  Preferred proteins associated with secretase disorders include APH-1A (anterior pharyngeal defect 1, alpha), APH-1B (anterior pharyngeal defect 1, beta), PSEN-1 (presenilin-1), NCSTN (nicastrin), PEN-2 (Presenilin Enhancer 2), and any combination thereof are included.

  In certain embodiments, using animals produced by the methods of the present invention, using the measurements commonly used in the study of secretase disorders, the effects of mutations on the onset and / or progression of animals and secretase-related disorders Can be studied.

The occurrence or sign of a secretase disorder may occur spontaneously in a genetically modified animal. Alternatively, the occurrence or adaptation of a secretase disorder may be facilitated by exposure to a disrupting agent. Non-limiting examples of disrupting agents include proteins, drugs, toxicants, chemicals, activated retroviruses, and environmental stress associated with secretase disorders, such as any of the aforementioned drugs. Non-limiting examples of environmental stress include forced swimming, cold swimming, platform vibration stimulation, loud noise, and immobilization stress.

K. Amyotrophic lateral sclerosis

  Certain nucleic acid sequences, and the proteins encoded by them, are associated with motor neuron disorders. These sequences constitute a diverse series of sequences that affect susceptibility to motoneuron disorders, the presence of motoneuron disorders, the severity of motoneuron disorders, or any combination thereof. In one embodiment, the method of the invention is used to create an animal or cell in which at least one chromosomal sequence associated with a specific motor neuron disorder, amyotrophic lateral sclerosis (ALS) has been edited. Can do. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with ALS may be edited. Chromosomal sequences associated with ALS can typically be selected based on experimental association of ALS-related sequences with ALS. The ALS-related nucleic acid sequence can encode an ALS-related protein or can be an ALS-related regulatory sequence. For example, the production rate or circulating concentration of an ALS-related protein can be increased or suppressed in a population with ALS compared to a population without ALS. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  As non-limiting examples, proteins related to ALS include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused to sarcoma), TARDBP (TAR DNA binding protein) ), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.

In certain embodiments, animals produced by the methods of the invention are used to study the effects of mutations on animals and the development and / or progression of ALS, using measurements commonly used in ALS studies. be able to.

L. Prion disease

  Prion disorder appears to be a protein conformation disorder that results in abnormal protein aggregation. In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with prion disease has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal or regulatory sequences encoding a protein associated with a prion disorder may be compiled. A prion disorder-related nucleic acid sequence can typically be selected based on an experimental association of a prion disorder-related nucleic acid sequence with a prion disorder. The prion disorder-related nucleic acid sequence can encode a prion disorder-related protein or an isoform thereof, or can be a prion disorder-related regulatory sequence. For example, the production rate or circulating concentration of a prion disorder-related protein or isoform can be increased or suppressed in a population having a prion disorder compared to a population lacking a prion disorder. Differences in protein or certain isoform levels can be assessed using proteomic techniques including but not limited to Western blots, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA), and mass spectrometry. it can. Alternatively, prion disorder-related proteins can be expressed using genomic techniques including, but not limited to, DNA microarray analysis, continuous analysis of gene expression (SAGE), and quantitative real-time polymerase chain reaction (Q-PCR). It can be identified by obtaining a gene expression profile of the encoding gene.

Non-limiting examples of prion disorders related proteins, PrP ^C and its isoforms, ^{PrP Sc} and its isoforms, HECTD2 (e3- ubiquitin ligase protein), STI1 (stress-inducible protein 1), DPL (residues Doppel protein , Encoded by Prnd), APOA1 (apolipoprotein A1), BCL-2 (B cell lymphoma 2), HSP60 (heat shock 60 kD protein), BAX inhibitory peptide (Bcl-2 related X protein inhibitor), NRF2 (nuclear) Respiratory factor 2), NCAM (nerve cell adhesion molecule), heparin, laminin and laminin receptor.

Furthermore, non-limiting examples of genes that may be associated with neurodegenerative conditions of prion disorders include A2M (alpha-2-macroglobulin), AATF (apoptotic antagonist transcription factor), ACPP (prostatic acid phosphatase), ACTA2 (actin Alpha2 aortic smooth muscle), ADAM22 (ADAM metallopeptidase domain), ADORA3 (adenosine A3 receptor), ADRA1D (alpha-1D adrenoceptor to alpha-1D adrenoceptor), AHSG (alpha-2-HS-sugar) Protein), AIF1 (allograft inflammatory factor 1), ALAS2 (delta-aminolevulinate synthase 2), AMBP (alpha-1-microglobulin / bikunin precursor), ANK3 (ankyrin 3), ANXA3 (annexin A3), PCS (amyloid P component serum), APOA1 (apolipoprotein A1), APOA12 (apolipoprotein A2), APOB (apolipoprotein B), APOC1 (apolipoprotein C1), APOE (apolipoprotein E), APOH (apolipoprotein H), APP (amyloid precursor protein), ARC (activity-regulated cytoskeleton-related protein), ARF6 (ADP-ribosylation factor 6), ARHGAP5 (Rho GTPase activating protein 5), ASCL1 (Achaete-scute homologue) 1), B2M (beta-2 microglobulin), B4GALNT1 (beta-1,4-N-acetyl-galactosaminyltransferase 1), BAX (Bcl-2 related X protein), BC T (branched chain amino acid transaminase 1 cytosol), BCKDHA (branched chain keto acid dehydrogenase E1 alpha), BCKDK (branched chain alpha-keto acid dehydrogenase kinase), BCL2 (B cell lymphoma 2), BCL2L1 (BCL2-like 1), BDNF (Brain-derived neurotrophic factor), BHLHE40 (class E basic helix-loop-helix protein 40), BHLHE41 (class E basic helix-loop-helix protein 41), BMP2 (bone morphogenic genetic protein 2A), BMP3 (bone morphogenic genetic protein 3), BMP5 (bone morphogenic genetic protein 5), BRD1 (bromodomain-containing 1), BTC (betacellulin), BTNL8 (butyrophyllin-like protein 8), CALB1 Calbindin 1), CALM1 (calmodulin 1), CAMK1 (calcium / calmodulin-dependent protein kinase type I), CAMK4 (calcium / calmodulin-dependent protein kinase type IV), CAMKIIB (calcium / calmodulin-dependent protein kinase type IIB), CAMKIIG (calcium / calmodulin-dependent protein kinase type IIG), CASP11 (caspase 10), CASP8 (caspase 8 apoptosis-related cysteine peptidase), CBLN1 (cerebellin 1 precursor), CCL2 (chemokine (CC motif) ligand 2), CCL22 (chemokine (CC motif) ligand 22), CCL3 (chemokine (CC motif) ligand 3), CCL8 (chemokine (C -C motif) ligand 8), CCNG1 (cyclin-G1), CCNT2 (cyclin T2), CCR4 (CC chemokine receptor type 4 (CD194)), CD58 (CD58), CD59 (protectin), CD5L (CD5 antigen) ), CD93 (CD93), CDKN2AIP (CDKN2A interacting protein), CDKN2B (cyclin-dependent kinase inhibitor 2B), CDX1 (homeobox protein CDX-1), CEA (carcinoembryonic antigen), CEBPA (CCAAT / enhancer) Binding protein alpha), CEBPB (CCAAT / enhancer binding protein C / EBP beta), CEBPB (CCAAT / enhancer binding protein beta), CEBPD (CCAAT / enhancer binding protein delta) , CEBPG (CCAAT / enhancer binding protein gamma), CENPB (centromere protein B), CGA (glycoprotein hormone alpha chain), CGGBP1 (CGG triplet repeat binding protein 1), CHGA (chromogranin A), CHGB (secretneurin), CHN2 (Beta-chimerin), CHRD (chodin), CHRM1 (cholinergic receptor muscarinic 1), CITED2 (Cbp / p300-interacting transactivator 2), CLEC4E (C-type lectin domain family 4 member E), CMTM2 (CKLF-like MARVEL transmembrane domain-containing protein 2), CNTN1 (contactin 1), CNTNAP1 (contactin-related protein-like 1), CR1 (erythrocyte complement receptor 1) , CREM (cAMP responsive element modulator), CRH (corticotropin releasing hormone), CRHR1 (corticotropin releasing hormone receptor 1), CRKRS (cell division cycle 2 related protein kinase 7), CSDA (DNA binding protein) A), CSF3 (granulocyte colony stimulating factor 3), CSF3R (granulocyte colony stimulating factor 3 receptor), CSP (chemically sensitive protein), CSPG4 (chondroitin sulfate proteoglycan 4), CTCF (CCCTC binding factor zinc finger protein), CTGF (connective tissue growth factor), CXCL12 (chemokine C—X—C motif ligand 12), DAD1 (protection factor 1 against cell death), DAXX (cell death related protein 6), DBN1 (drebrin 1), DBP (Arbumi) Promoter D site-albumin D box binding protein), DDR1 (discoidin domain receptor family member 1), DDX14 (DEAD / DEAH box helicase), DEFA3 (defencin alpha 3 neutrophil specific), DVL3 ( Disheveled dsh homolog 3), EDN1 (endothelin 1), EDNRA (endothelin receptor type A), EGF (epidermal growth factor), EGFR (epidermal growth factor receptor), EGR1 (early growth response protein 1), EGR2 (Early growth response protein 2), EGR3 (Early growth response protein 3), EIF2AK2 (Eukaryotic translation initiation factor 2-alpha kinase 2), ELANE (Elastase neutrophil expression), ELK1 (EL of ETS oncogene family) 1 member), ELK3 (ELK3 ETS domain protein (SRF accessory protein 2)), EML2 (Echinoderm microtubule associated protein-like 2), EPHA4 (EPH receptor A4), ERBB2 (V-erb-b2 erythrocytic leukemia) Virus oncogene homolog 2), ERBB3 (receptor tyrosine-protein kinase erbB-3), ESR2 (estrogen receptor 2), ESR2 (estrogen receptor 2), ETS1 (V-ets erythroblastosis virus E26 oncogene Homologue 1), ETV6 (Ets variant 6), FASLG (Fas ligand TNF superfamily member 6), FCAR (Fc fragment of IgA receptor), FCER1G (Fc fragment of IgE high affinity I receptor for gamma polypeptide) ), FCGR2A (IgG low Compatible IIa receptor-Fc fragment of CD32), FCGR3B (IgG low affinity IIIb receptor-Fc fragment of CD16b), FCGRT (Fc fragment of IgG receptor transporter alpha), FGA (basic fibrinogen), FGF1 ( Acidic fibroblast growth factor 1), FGF14 (fibroblast growth factor 14), FGF16 (fibroblast growth factor 16), FGF18 (fibroblast growth factor 18), FGF2 (basic fibroblast growth factor 2) FIBP (acidic fibroblast growth factor intracellular binding protein), FIGF (C-fos inducible growth factor), FMR1 (fragile X mental retardation 1), FOSB (FBJ mouse osteosarcoma virus oncogene homolog B), FOXO1 (Fork head box O1), FSHB (follicle stimulating hormone beta polypeptide), FTH1 Ferritin heavy polypeptide 1), FTL (ferritin light polypeptide), G1P3 (interferon alpha-inducible protein 6), G6S (N-acetylglucosamine-6-sulfatase), GABRA2 (gamma-aminobutyric acid A receptor alpha 2), GABRA3 (gamma-aminobutyric acid A receptor alpha 3), GABRA4 (gamma-aminobutyric acid A receptor alpha 4), GABRB1 (gamma-aminobutyric acid A receptor beta 1), GABRG1 (gamma-aminobutyric acid A receptor gamma 1) ), GADD45A (growth arrest and DNA damage inducible alpha), GCLC (glutamate-cysteine ligase catalytic subunit), GDF15 (growth differentiation factor 15), GDF9 (growth differentiation factor 9), GFRA1 (GDNF family receptor alpha) A), GIT1 (G protein-coupled receptor kinase interactor 1), GNA13 (guanine nucleotide binding protein / G protein alpha 13), GNAQ (guanine nucleotide binding protein / G protein q polypeptide), GPR12 (G protein binding) Receptor 12), GPR18 (G protein coupled receptor 18), GPR22 (G protein coupled receptor 22), GPR26 (G protein coupled receptor 26), GPR27 (G protein coupled receptor 27), GPR77 (G protein coupled) Receptor 77), GPR85 (G protein-coupled receptor 85), GRB2 (growth factor receptor-binding protein 2), GRLF1 (glucocorticoid receptor DNA-binding factor 1), GST (glutathione S-transferase), GTF2B Basic transcription factor II), GZMB (granzyme B), HAND1 (cardiac and neural crest derivative expression 1), HAVCR1 (hepatitis A virus cell receptor 1), HES1 (split hair-like and enhancer 1), HES5 ( Split ciliary and enhancer 5), HLA-DQA1 (major histocompatibility complex class II DQ alpha), HOXA2 (homeobox A2), HOXA4 (homeobox A4), HP (haptoglobin), HPGDS (prostaglandin- D synthase), HSPA8 (heat shock 70 kD protein 8), HTR1A (5-hydroxytryptamine receptor 1A), HTR2A (5-hydroxytryptamine receptor 2A), HTR3A (5-hydroxytryptamine receptor 3A), ICAM1 (cells) Adhesion molecule 1 (CD54)), IFIT2 (interferon-inducible protein 2 with tetratricopeptide repeats), IFNAR2 (interferon alpha / beta / omega receptor 2), IGF1 (insulin-like growth factor 1), IGF2 (insulin-like growth) Factor 2), IGFBP2 (insulin-like growth factor binding protein 2, 36 kDa), IGFBP7 (insulin-like growth factor binding protein 7), IL10 (interleukin 10), IL10RA (interleukin 10 receptor alpha), IL11 (interleukin 11) ), IL11RA (interleukin 11 receptor alpha), IL11RB (interleukin 11 receptor beta), IL13 (interleukin 13), IL15 (interleukin 15), IL 7A (interleukin 17A), IL17RB (interleukin 17 receptor B), IL18 (interleukin 18), IL18RAP (interleukin 18 receptor accessory protein), IL1R2 (interleukin 1 receptor type II), IL1RN (interleukin) 1 receptor antagonist), IL2RA (interleukin 2 receptor alpha), IL4R (interleukin 4 receptor), IL6 (interleukin 6), IL6R (interleukin 6 receptor), IL7 (interleukin 7), IL8 ( Interleukin 8), IL8RA (interleukin 8 receptor alpha), IL8RB (interleukin 8 receptor beta), ILK (integrin-binding kinase), INPP4A (inositol polyphosphate-4- Phosphatase type I, 107 kDa), INPP4B (inositol polyphosphate-4-phosphatase type I beta), INS (insulin), IRF2 (interferon regulatory factor 2), IRF3 (interferon regulatory factor 3), IRF9 (interferon regulatory factor 9), IRS1 (insulin receptor substrate 1), ITGA4 (integrin alpha-4), ITGA6 (integrin alpha-6), ITGAE (integrin alpha-V), ITGAV (integrin alpha-V), JAG1 (jagide 1), JAK1 (Janus kinase 1) ), JDP2 (Jun dimerization protein 2), JUN (Jun oncogene), JUNB (Jun B proto-oncogene), KCNJ15 (potassium inward rectifier channel subfamily J member) -15), KIF5B (kinesin family member 5B), KLRC4 (killer cell lectin-like receptor subfamily C member 4), KRT8 (keratin 8), LAMP2 (lysosome-associated membrane protein 2), LEP (leptin), LHB (luteal) Forming hormone beta polypeptide), LRRN3 (leucine-rich repeat nerve type 3), MAL (Mal T cell differentiation protein), MAN1A1 (mannosidase alpha class 1A member 1), MAOB (monoamine oxidase B), MAP3K1 (mitogen-activated protein kinase) Kinase kinase 1), MAPK1 (mitogenic activated protein kinase 1), MAPK3 (mitogenic activated protein kinase 3), MAPRE2 (microtubule-related protein RP / EB family) -Member 2), MARCKS (myristoylated alanine-rich protein kinase C substrate), MAS1 (MAS1 oncogene), MASL1 (MAS1 oncogene-like), MBP (myelin basic protein), MCL1 (myeloid leukemia sequence 1), MDMX ( MDM2-like p53 binding protein), MECP2 (methyl CpG binding protein 2), MFGE8 (milk fat globule-EGF factor 8 protein), MIF (macrophage migration inhibitory factor), MMP2 (matrix metallopeptidase 2), MOBP (myelin-related oligodendrocyte) Site basic protein), MUC16 (cancer antigen 125), MX2 (myxovirus (influenza virus) resistance 2), MYBBP1A (MYB binding protein 1a), NBN (nibrin), NCAM1 Neural cell adhesion molecule 1), NCF4 (neutrophil cytosolic factor 4 40 kDa), NCOA1 (nuclear receptor coactivator 1), NCOA2 (nuclear receptor coactivator 2), NEDD9 (neural precursor cell expression) Developmentally down-regulated 9), NEUR (neuraminidase), NFATC1 (nuclear factor cytoplasmic calcineurin dependence 1 of activated T cells), NFE2L2 (nuclear factor erythrocyte-derived 2-like 2), NFIC (nuclear factor I / C), NFKBIA (Kappa light polypeptide gene enhancer nuclear factor inhibitor alpha in B cells), NGFR (nerve growth factor receptor), NIACR2 (niacin receptor 2), NLGN3 (neurolidine 3), NPFFR2 (neuropeptide FF receptor 2) ), NPY (neuropeptide Y), NR3C2 (nuclear receptor subfamily 3 group C group) 2), NRAS (neuroblastoma RAS virus (v-ras) oncogene homolog), NRCAM (neural cell adhesion molecule), NRG1 (neuregulin 1), NRTN (neurturin), NRXN1 (neulexin 1), NSMAF (neutral sphingomyelinase activation-related factor), NTF3 (neurotrophin 3), NTF5 (neurotrophin 4/5), ODC1 (ornithine decarboxylase 1), or 10A1 (olfactory receptor 10A1), or 1A1 (Olfactory receptor family 1 subfamily A member 1), or 1N1 (olfactory receptor family 1 subfamily N member 1), or 3A2 (olfactory receptor family 3 subfamily A member 2), or 7A17 (olfactory receptor family 7 subfamily A Bar 17), or M1 (orosomucoid 1), OXTR (oxytocin receptor), P2RY13 (purinergic receptor P2Y G-protein binding 13), P2Y12 (purinergic receptor P2Y G-protein binding 12), P70S6K ( P70S6 kinase), PAK1 (P21 / Cdc42 / Rac1 activated kinase 1), PAR1 (Prada-Willi / Anselman region-1), PBEF1 (pre-B cell colony enhancing factor 1), PCAF (P300 / CBP-related factor), PDE4A (CAMP specific 3 ′, 5′-cyclic phosphodiesterase 4A), PDE4B (phosphodiesterase 4B cAMP specific), PDE4B (phosphodiesterase 4B cAMP specific), PDE4D (phosphodiesterase 4D cAMP specific) PDGFA (platelet-derived growth factor alpha polypeptide), PDGFB (platelet-derived growth factor beta polypeptide), PDGFC (platelet-derived growth factor C), PDGFRB (beta-type platelet-derived growth factor receptor), PDPN (podopranin) , PENK (enkephalin), PER1 (period homolog 1), PLA2 (phospholipase A2), PLAU (plasminogen activator urokinase), PLXNC1 (plexin C1), PMVK (phosphomevalonate kinase), PNOC (prepronociceptin), POLH (POLH) Polymerase (DNA-directed eta), POMC (proopiomelanocortin (adreno-adrenocorticotropic hormone / beta-lipotropin / alpha-melanocyte stimulating hormone / beta-melanocyte stimulating) Rumon / beta-endorphin)), POU2AF1 (POU domain class 2 related factor 1), PRUKA1 (5′-AMP-activated protein kinase catalytic subunit alpha-1), PRL (prolactin), PSCDBP (cytohesin 1 interacting protein) ), PSPN (percefin), PTAFR (platelet activating factor receptor), PTGS2 (prostaglandin-endoperoxide synthase 2), PTN (pleiotrophin), PTPN11 (protein tyrosine phosphatase non-receptor type 11), PYY ( Peptide YY), RAB11B (RAB11B member RAS oncogene family), RAB6A (RAB6A member RAS oncogene family), RAD17 (RAD17 homolog), RAF1 (RAF1) -Oncogene serine / threonine-protein kinase), RANBP2 (RAN binding protein 2), RAP1A (RAP1A member of RAS oncogene family), RB1 (retinoblastoma 1), RBL2 (retinoblastoma-like 2 (p130) )), RCVRN (Recovelin), REM2 (RAS / RAD / GEM-like GTP binding 2), RFRP (RFamide-related peptide), RPS6KA3 (ribosomal protein 6 kinase 90 kDa polypeptide 3), RTN4 (Reticulon 4), RUNX1 (Runt Related transcription factor 1), S100A4 (S100 calcium binding protein A4), S1PR1 (sphingosine-1-phosphate receptor 1), SCG2 (secretogranin II), SCYE1 (small inducible cytokine subfamily E 1), SERENBP1 (selenium-binding protein 1), SGK (serum / glucocorticoid-regulated kinase), SKD1 (suppressor 1 of K + transport growth defect), SLC14A1 (solute carrier family 14 (urea transporter) member 1 ( Kid blood group)), SLC25A37 (solute carrier family 25 member 37), SMAD2 (SMAD family member 2), SMAD5 (SMAD family member 5), SNAP23 (synaptosome related protein 23 kDa), SNCB (synuclein beta), SNF1LK (SNF1 like Kinase), SORT1 (Sortilin 1), SSB (Sjogren's syndrome antigen B), STAT1 (signaling transcription activator 1, 91 kDa), STAT5A (signaling transcription activator) 5A), STAT5B (signal transduction transcriptional activator 5B), STX16 (syntaxin 16), TAC1 (tachykinin precursor 1), TBX1 (T box 1), TEF (thyroid embryonic factor), TF (transferrin), TGFA (transforming growth factor alpha), TGFB1 (transforming growth factor beta 1), TGFB2 (transforming growth factor beta 2), TGFB3 (transforming growth factor beta 3), TGFBR1 (transforming growth factor beta receptor I) , TGM2 (transglutaminase 2), THPO (thrombopoietin), TIMP1 (TIMP metallopeptidase inhibitor 1), TIMP3 (TIMP metallopeptidase inhibitor 3), TMEM129 (transmembrane protein) 129), TNFRC6 (TNFR / NGFR cysteine-rich region), TNFRSF10A (tumor necrosis factor receptor superfamily member 10a), TNFRSF10C (tumor necrosis factor receptor superfamily member 10c decoy without intracellular domain), TNFRSF1A (Tumor necrosis factor receptor superfamily member 1A), TOB2 (ERBB2 transmitter 2), TOP1 (topoisomerase (DNA) I), TOPOII (topoisomerase 2), TRAK2 (transport protein kinesin binding 2), TRH (thyroid stimulating hormone) Release hormone), TSH (thyroid stimulating hormone alpha), TUBA1A (tubulin alpha 1a), TXK (TXK tyrosine kinase), TYK2 (tyrosine kinase 2), UCP1 (uncoupled protein 1), UCP2 (uncoupled protein 2), ULIP (Unc-33-like phosphate protein), UTRN (utrophin), VEGF (vascular endothelial growth factor), VGF (VGF nerve growth factor inducible), VIP (vasoactive intestinal peptide), VNN1 (vanin 1), VTN (vitronectin), WNT2 (wingless MMTV integration site family member 2), XRCC6 (X-ray repair cross-supplement 6), ZEB2 (zinc finger E box binding) Homeobox 2), and ZNF461 (zinc finger protein 461).

Exemplary prion disorders related protein, PrP ^C and its isoforms, ^{PrP Sc} and its isoforms, HECTD2 (e3- ubiquitin ligase protein), STI1 (stress-inducible protein 1), DPL (residues Doppel protein, by Prnd encoded), APOA1 (apolipoprotein A1), BCL-2 (B cell lymphoma 2), HSP60 (heat shock 60 kD protein), BAX inhibitory peptide (Bcl-2 related X protein inhibitor), NRF2 (nuclear respiratory factor) 2) NCAMs (nerve cell adhesion molecules), heparin, laminin and laminin receptors, and any combination thereof.

In certain embodiments, animals produced by the methods of the invention are used to measure the effects of mutations on the development and / or progression of animals and prion disorders using measurements commonly used in the study of prion disorders. Can study.

M.M. Immunodeficiency

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with immunodeficiency has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with immunodeficiency may be compiled. An immunodeficiency protein or regulatory sequence is a protein or regulatory sequence to which a change in activity is associated with an immunodeficiency, which is an animal disease or condition, preferably a mammal, eg, a primary or secondary symptom of a human disease or condition It can be. The immunodeficiency sequence can typically be selected based on an experimental association of the immunodeficiency sequence with an immunodeficiency disease or condition, particularly a mammal, eg, a human disease or condition. For example, expression of immunodeficiency protein in a particular tissue can be enhanced or suppressed in a population having an immunodeficiency disease or condition compared to a population lacking the disease or condition. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

Non-limiting examples of human immunodeficiency genes include A2M [alpha-2-macroglobulin], AANAT [arylalkylamine N-acetyltransferase], ABCA1 [ATP binding cassette, subfamily A (ABC1), member 1], ABCA2 [ATP binding cassette, subfamily A (ABC1), member 2], ABCA3 [ATP binding cassette, subfamily A (ABC1), member 3], ABCA4 [ATP binding cassette, subfamily A (ABC1), member 4] , ABCB1 [ATP binding cassette, subfamily B (MDR / TAP), member 1], ABCC1 [ATP binding cassette, subfamily C (CFTR / MRP), member 1], ABCC2 [ATP binding cassette, subfamily (CFTR / MRP), member 2], ABCC3 [ATP binding cassette, subfamily C (CFTR / MRP), member 3], ABCC4 [ATP binding cassette, subfamily C (CFTR / MRP), member 4], ABCC8 [ ATP binding cassette, subfamily C (CFTR / MRP), member 8], ABCD2 [ATP binding cassette, subfamily D (ALD), member 2], ABCD3 [ATP binding cassette, subfamily D (ALD), member 3] , ABCG1 [ATP binding cassette, subfamily G (WHITE), member 1], ABCG2 [ATP binding cassette, subfamily G (WHITE), member 2], ABCG5 [ATP binding cassette, subfamily G (WHITE), member ], ABCG8 [ATP binding cassette, subfamily G (WHITE), member 8], ABHD2 [ab hydrolase domain containing 2], ABL1 [c-abl oncogene 1, receptor tyrosine kinase], ABO [ABO blood group (transferase) A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase)], ABP1 [amylolide binding protein 1 (amine oxidase (copper-containing))], ACAA1 [acetyl-coenzyme A acyltransferase 1], ACACA [acetyl-coenzyme A carboxylase alpha], ACAN [aggrecan], ACAT1 [acetyl-coenzyme A acetyltransferase 1], ACAT2 [acetylene] -Coenzyme A acetyltransferase 2], ACCN5 [amylolide-sensitive cation channel 5, intestine], ACE [angiotensin I converting enzyme (peptidyl-dipeptidase A) 1], ACE2 [angiotensin I converting enzyme (peptidyl-dipeptidase A) 2), ACHE [acetylcholinesterase (Yt blood group)], ACLY [ATP citrate lyase], ACOT9 [acyl-CoA thioesterase 9], ACOX1 [acyl-coenzyme A oxidase 1, palmitoyl], ACP1 [acid phosphatase] 1, soluble], ACP2 [acid phosphatase 2, lysosome], ACP5 [acid phosphatase 5, tartrate resistant], ACPP [acid phosphatase, prostate], ACSL3 [acyl-CoA synthetase long chain family members -3], ACSM3 [acyl-CoA synthetase medium chain family member 3], ACTA1 [actin, alpha1, skeletal muscle], ACTA2 [actin, alpha2, smooth muscle, aorta], ACTB [actin, beta], ACTC1 [ Actin, alpha, myocardium 1], ACTG1 [actin, gamma 1], ACTN1 [actinin, alpha 1], ACTN2 [actinin, alpha 2], ACTN4 [actinin, alpha 4], ACTR2 [ARP2 actin-related protein 2 homologue ( Yeast)], ACVR1 [activin A receptor, type I], ACVR1B [activin A receptor, type IB], ACVRL1 [activin A receptor type I-like 1], ACY1 [aminoacylase 1], ADA [adenosine deaminase ], ADAM10 [A AM metallopeptidase domain 10], ADAM12 [ADAM metallopeptidase domain 12], ADAM17 [ADAM metallopeptidase domain 17], ADAM23 [ADAM metallopeptidase domain 23], ADAM33 [ADAM metallopeptidase domain 33], ADAM8 [ADAM metallopeptidase domain 8 ] ADAM9 [ADAM metallopeptidase domain 9 (meltrin gamma)], ADAMTS1 [ADAM metallopeptidase having thrombospondin type 1 motif, 1], ADAMTS12 [ADAM metallopeptidase having thrombospondin type 1 motif, 12], ADAMTS13 [ADAM metallopeptidase with thrombospondin type 1 motif, 13], ADAM TS15 [ADAM metallopeptidase having thrombospondin type 1 motif, 15], ADAMSL1 [ADAMTS-like 1], ADAMSL4 [ADAMTS-like 4], ADAR [adenosine deaminase, RNA-specific], ADCY1 [adenylate cyclase 1 (brain )], ADCY10 [adenylate cyclase 10 (soluble)], ADCY3 [adenylate cyclase 3], ADCY9 [adenylate cyclase 9], ADCYAP1 [adenylate cyclase activating polypeptide 1 (pituitary gland)] ADCYAP1R1 [adenylate cyclase activating polypeptide 1 (pituitary) receptor type I], ADD1 [adducin 1 (alpha)], ADH5 [alcohol dehydrogenase 5 (class III), chipolypeptide (ch polypeptide)], ADIPOQ [containing adiponectin, C1Q and collagen domain], ADIPOR1 [adiponectin receptor 1], ADK [adenosine kinase], ADM [adrenomedullin], ADORA1 [adenosine A1 receptor], ADORA2A [adenosine A2a receptor], ADORA2B [adenosine A2b receptor], ADORA3 [adenosine A3 receptor], ADRA1B [adrenergic, alpha-1B-, receptor], ADRA2A [adrenergic, alpha-2A-, receptor], ADRA2B [adrenergic, alpha -2B-, receptor], ADRB1 [adrenergic, beta-1-, receptor], ADRB2 [adrenergic, beta-2-, receptor, surface], ADSL [adenylo Succinate lyase], ADSS [adenylosuccinate synthase], AEBP1 [AE-binding protein 1], AFP [alpha-fetal protein], AGER [final glycation product specific receptor], AGMAT [agmatine ureohydrolase (agmatinase)] , AGPS [alkyl glycerone phosphate synthase], AGRN [Agrin], AGRP [Agouti related protein homologue (mouse)], AGT [Angiotensinogen (serpin peptidase inhibitor, Clade A, member 8)], AGTR1 [Angiotensin II Receptor, type 1], AGTR2 [angiotensin II receptor, type 2], AHCY [adenosyl homocysteinase], AHI1 [Abelson helper integration site 1], AHR [aryl hydrocarbon receptor], AHSP [Alpha hemoglobin stabilizing protein], AICDA [activation-inducing cytidine deaminase], AIDA [Axin interaction factor, dorsalization-related], AIMP1 [Aminoacyl-tRNA synthetase complex interaction multifunctional protein 1], AIRE [autoimmunity Regulator], AK1 [adenylate kinase 1], AK2 [adenylate kinase 2], AKR1A1 [aldo-ketoreductase family 1, member A1 (aldehyde reductase)], AKR1B1 [aldo-ketoreductase family 1, member B1 (aldose reductase) ] AKR1C3 [Aldo-ketoreductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], AKT1 [v-akt mouse thymoma Luz oncogene homolog 1], AKT2 [v-akt murine thymoma virus oncogene homolog 2], AKT3 [v-akt murine thymoma virus oncogene homolog 3 (protein kinase B, gamma)], ALB [albumin ], ALCAM [activated leukocyte cell adhesion molecule], ALDH1A1 [aldehyde dehydrogenase 1 family, member A1], ALDH2 [aldehyde dehydrogenase 2 family (mitochondrion)], ALDH3A1 [aldehyde dehydrogenase 3 family, member A1], ALDH7A1 [aldehyde dehydrogenase 7 Family, member A1], ALDH9A1 [aldehyde dehydrogenase 9 family, member A1], ALG1 [asparagine-linked glycosylation 1, beta-1,4-man Syltransferase homologue (budding yeast)], ALG12 [asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homologue (budding yeast)], ALK [anaplastic lymphoma receptor tyrosine kinase], ALOX12 [arachidonic acid 12 -Lipoxygenase], ALOX15 [arachidonic acid 15-lipoxygenase], ALOX15B [arachidonic acid 15-lipoxygenase, type B], ALOX5 [arachidonic acid 5-lipoxygenase], ALOX5AP [arachidonic acid 5-lipoxygenase activating protein], ALPI [alkaline phosphatase , Intestine], ALPL [alkaline phosphatase, liver / bone / kidney], ALPP [alkaline phosphatase, placenta (regan isozyme)], AMACR [alpha Methylacyl-CoA racemase], AMBP [alpha-1-microglobulin / bikunin precursor], AMPD3 [adenosine monophosphate deaminase 3], ANG [angiozenin, ribonuclease, RNase A family, 5], ANGPT1 [angiopoietin 1], ANGPT2 [Angiopoietin 2], ANK1 [Ankyrin 1, red blood cells], ANKH [Ankylosis, progressive homologue (mouse)], ANKRD1 [Ankyrin repeat domain 1 (myocardial)], AMPEP [alanyl (membrane) aminopeptidase], ANTXR2 [Anthrax] Fungal toxin receptor 2], ANXA1 [Annexin A1], ANXA2 [Annexin A2], ANXA5 [Annexin A5], ANXA6 [Annexin A6], AOAH [Acyloxyacylamine Rollase (neutrophil)], AOC2 [amine oxidase, copper-containing 2 (retinal specific)], AP2B1 [adaptor-related protein complex 2, beta 1 subunit], AP3B1 [adapter-related protein complex 3, beta 1 sub Unit], APC [colon adenoma], APCS [amyloid P component, serum], APEX1 [APEX nuclease (multifunctional DNA repair enzyme) 1], APLNR [apellin receptor], APOA1 [apolipoprotein AI], APOA2 [Apolipoprotein A-II], APOA4 [Apolipoprotein A-IV], APOB [Apolipoprotein B (including Ag (x) antigen)], APOBEC1 [Apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1], APOBEC3G [ Apolipoprotein B RNA editing enzyme, catalytic polypeptide-like 3G], APOC3 [apolipoprotein C-III], APOD [apolipoprotein D], APOE [apolipoprotein E], APOH [apolipoprotein H (beta-2-glycoprotein I)], APP [Amyloid beta (A4) precursor protein], APRT [Adenine phosphoribosyltransferase], APTX [Aprataxin], AQP1 [Aquaporin 1 (Colton blood group)], AQP2 [Aquaporin 2 (collecting tube)], AQP3 [Aquaporin 3 (Gill blood group)], AQP4 [Aquaporin 4], AQP5 [Aquaporin 5], AQP7 [Aquaporin 7], AQP8 [Aquaporin 8], AR [androgen receptor], AREG [Amphiregulin], ARF6 [ADP] Ribosylation factor 6], ARG1 [arginase, liver], ARG2 [arginase, II type], ARHGAP6 [Rho GTPase activating protein 6], ARHGEF2 [Rho / Rac guanine nucleotide exchanger (GEF) 2], ARHGEF6 [Ra
c / Cdc42 guanine nucleotide exchanger (GEF) 6], ARL13B [ADP-ribosylation factor-like 13B], ARNT [aryl hydrocarbon receptor nuclear transporter], ARNTL [aryl hydrocarbon receptor nuclear transporter-like], ARRB1 [Arrestin, beta 1], ARRB2 [arrestin, beta 2], ARSA [arylsulfatase A], ARSB [arylsulfatase B], ARSH [arylsulfatase family, member H], ART1 [ADP-ribosyltransferase 1], ASAH1 [ N-acyl sphingosine amide hydrolase (acid ceramidase) 1], ASAP1 [ArfGAP1 with SH3 domain, ankyrin repeat, and PH domain], ASGR2 [Asialoglycoprotein receptor 2] ASL [Argininosuccinate lyase], ASNS [Asparagine synthetase], ASPA [Aspart acylase (canavan disease)], ASPG [Asparaginase homologue (budding yeast)], ASPH [Aspartate beta-hydroxylase], ASRGL1 [Asparaginase-like 1 ], ASS1 [Argininosuccinate synthase 1], ATF1 [activated transcription factor 1], ATF2 [activated transcription factor 2], ATF3 [activated transcription factor 3], ATF4 [activated transcription factor 4 (tax responsive enhancer element) B67)], ATG16L1 [ATG16 autophagy-related 16-like 1 (budding yeast)], ATM [vasodilatory ataxia mutation], ATMIN [ATM interacting factor], ATN1 [Atrophin 1], ATOH1 [Atonal homolog 1 ( show Drosophila)], ATP2A2 [ATPase, Ca ++ transport, myocardium, slow muscle 2], ATP2A3 [ATPase, Ca ++ transport, ubiquitous], ATP2C1 [ATPase, Ca ++ transport, type 2C, member 1], ATP5E [ATP synthase, H + transport, Mitochondrial F1 complex, epsilon subunit], ATP7B [ATPase, Cu ++ transport, beta polypeptide], ATP8B1 [ATPase, class I, type 8B, member 1], ATPAF2 [ATP synthase mitochondrial F1 complex association factor 2], ATR [Vasodilatory ataxia and Rad3-related], ATRIP [ATR interacting protein], ATRN [Attractin], AURKA [Aurora kinase A], AURKB [Aurora kinase B], AURKC [Auro Lakinase C], AVP [arginine vasopressin], AVPR2 [arginine vasopressin receptor 2], AXL [AXL receptor tyrosine kinase], AZGP1 [alpha-2-glycoprotein 1, zinc binding], B2M [beta-2-microglobulin ], B3GALTL [beta1,3-galactosyltransferase-like], B3GAT1 [beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)], B4GALNT1 [beta-1,4-N-acetyl-galactosa Minyltransferase 1], B4GALT1 [UDP-Gal: beta GlcNAc beta 1,4-galactosyltransferase, polypeptide 1], BACE1 [beta-site APP cleaving enzyme 1], BACE2 [beta APP cleavage enzyme 2], BACH1 [BTB and CNC homology 1, basic leucine zipper transcription factor 1], BAD [cell death BCL2-related agonist], BIAAP2 [BAI1-related protein 2], BAK1 [BCL2-antagonist / killer 1], BARX2 [BARX homeobox 2], BAT1 [HLA-B-related transcription 1], BAT2 [HLA-B-related transcription 2], BAX [BCL2-related X protein], BBC3 [BCL2-binding component 3], BCAR1 [ Breast cancer anti-estrogen resistance 1], BCAT1 [branched chain aminotransferase 1, cytosol], BCAT2 [branched chain aminotransferase 2, mitochondria], BCHE [butyrylcholinesterase], BCL10 [B cell CLL / lymphoma 10], BCL1 B [B cell CLL / lymphoma 11B (zinc finger protein)], BCL2 [B cell CLL / lymphoma 2], BCL2A1 [BCL2-related protein A1], BCL2L1 [BCL2-like 1], BCL2L11 [BCL2-like 11 (apoptosis promoting factor) ], BCL3 [B cell CLL / lymphoma 3], BCL6 [B cell CLL / lymphoma 6], BCR [breakpoint cluster region], BDKRB1 [bradykinin receptor B1], BDKRB2 [bradykinin receptor B2], BDNF [brain derived] Neurotrophic factor], BECN1 [beclin 1, autophagy-related], BEST1 [bestrophin 1], BFAR [bifunctional apoptosis regulator], BGLAP [bone gamma-carboxyglutamate (gla) protein], BHMT [Betaine-homocysteine methyltransferase], BID [BH3 interaction domain cell death agonist], BIK [BCL2-interaction killer (apoptosis induction)], BIRC2 [including baculovirus IAP repeat 2], BIRC3 [containing baculovirus IAP repeat] 3], BIRC5 [5 containing baculovirus IAP repeats], BLK [B lymphocyte tyrosine kinase], BLM [Bloom syndrome, RecQ helicase-like], BLNK [B cell linker], BLVRB [biliverdin reductase B (flavin reductase (NADPH)) )], BMI1 [BMI1 polycombing finger oncogene], BMP1 [bone morphogenic genetic protein 1], BMP2 [bone morphogenic genetic protein 2], BMP4 [bone morphology Adult genetic protein 4], BMP6 [bone morphogenic genetic protein 6], BMP7 [bone morphogenic genetic protein 7], BMPR1A [bone morphogenetic genetic protein receptor, type IA], BMPR1B [bone morphogenic genetic Protein receptor, type IB], BMPR2 [bone morphogenic genetic protein receptor, type II (serine / threonine kinase)], BPI [bactericidal / permeability enhancing protein], BRCA1 [breast cancer 1, early onset] , BRCA2 [breast cancer 2, early-onset], BRCC3 [BRCA1 / BRCA2-containing complex, subunit 3], BRD8 [bromodomain-containing 8], BRIP1 [BRCA1-interacting protein C-terminal helicase 1], BSG [basidin (Ok Blood type)], BSN [Bathoon (presynaptic cell matrix protein)] BSX [brain-specific homeobox], BTD [biotinidase], BTK [Breton agammaglobulinemia tyrosine kinase], BTLA [B and T lymphocyte-related], BTNL2 [butyrophilin-like 2 (MHC class II-related)], BTRC [Containing beta-transducin repeat], C10orf67 [chromosome 10 open reading frame 67], C11orf30 [chromosome 11 open reading frame 30], C11orf58 [chromosome 11 open reading frame 58], C13orf23 [chromosome 13 open reading frame 23], C13orf31 [chromosome 13 open reading frame 31], C15orf2 [chromosome 15 open reading frame 2], C16orf75 [staining Body 16 open reading frame 75], C19orf10 [chromosome 19 open reading frame 10], C1QA [complement component 1, q subcomponent, A chain], C1QB [complement component 1, q subcomponent, B chain] ], C1QC [complement component 1, q subcomponent, C chain], C1QTNF5 [C1q and tumor necrosis factor-related protein 5], C1R [complement component 1, r subcomponent], C1S [complement configuration] Component 1, s subcomponent], C2 [complement component 2], C20orf29 [chromosome 20 open reading frame 29], C21orf33 [chromosome 21 open reading frame 33], C3 [complement component 3], C3AR1 [complement Body component 3a receptor 1], C3orf27 [Chromosome 3 open reading frame 27], C4A [complement component 4A (Rogers blood group)], C4B [complement component 4B (sid blood group)], C4BPA [complement component 4 binding protein, alpha], C4BPB [complement component] 4-binding protein, beta], C5 [complement component 5], C5AR1 [complement component 5a receptor 1], C5orf56 [chromosome 5 open reading frame 56], C5orf62 [chromosome 5 open reading frame 62], C6 [ Complement component 6], C6orf142 [chromosome 6 open reading frame 142], C6orf25 [chromosome 6 open reading frame 25], C7 [complement component 7], C7orf72 [chromosome 7 open reading frame 72], C8A [complement Component 8, alpha polypeptide C8B [complement component 8, beta polypeptide], C8G [complement component 8, gamma polypeptide], C8orf38 [chromosome 8 open reading frame 38], C9 [complement component 9], CA2 [carbonic acid dehydration] Enzyme II], CA6 [carbonic anhydrase VI], CA8 [carbonic anhydrase VIII], CA9 [carbonic anhydrase IX], CABIN1 [calcineurin binding protein 1], CACNA1C [calcium channel, voltage-dependent, L-type, alpha 1C Subunit], CACNA1S [calcium channel, voltage-dependent, L-type, alpha 1S subunit], CAD [carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase], CALB1 [calbindin 1, 28 kDa], C ALB2 [calbindin 2], CALCA [calcitonin-related polypeptide alpha], CALCL [calcitonin receptor-like], CALD1 [caldesmon 1], CALM1 [calmodulin 1 (phosphorylase kinase, delta)], CALM2 [calmodulin 2 (phosphorylase kinase, Delta)], CALM3 [calmodulin 3 (phosphorylase kinase, delta)], CALR [calreticulin], CAMK2G [calcium / calmodulin-dependent protein kinase II gamma], CAMP [cathelicidin antimicrobial peptide], CANT1 [calcium activated nucleotidase. 1], CANX [calnexin], CAPN1 [calpain 1, (mu / I) large subunit], CARD10 [caspase mobilization domain Family, member 10], CARD16 [caspase mobilization domain family, member 16], CARD8 [caspase mobilization domain family, member 8], CARD9 [caspase mobilization domain family, member 9], CASP1 [caspase 1, apoptosis-related cysteine peptidase (inter Leukin 1, beta, convertase)], CASP10 [caspase 10, apoptosis related cysteine peptidase], CASP2 [caspase 2, apoptosis related cysteine peptidase], CASP3 [caspase 3, apoptosis related cysteine peptidase], CASP5 [caspase 5, apoptosis related cysteine Peptidase], CASP6 [caspase-6, apoptosis-related cysteine peptider ], CASP7 [caspase 7, apoptosis-related cysteine peptidase], CASP8 [caspase 8, apoptosis-related cysteine peptidase], CASP8AP2 [caspase 8-related protein 2], CASP9 [caspase 9, apoptosis-related cysteine peptidase], CASR [calcium sensing receptor] ], CAST [carpastatin], CAT [catalase], CAV1 [caveolin 1, caveolae protein, 22 kDa], CAV2 [caveolin 2], CBL [Cas-Br-M (mouse) allotrophic retrovirus transforming sequence], CBS [cystathionine-beta-synthase], CBX5 [chromobox homolog 5 (HP1 alpha homolog, Drosophila)], CC2D2A [coiled coil And C2 domain containing 2A], CCBP2 [chemokine binding protein 2], CCDC144A [coiled coil domain containing 144A], CCDC144B [coiled coil domain containing 144B], CCDC68 [coiled coil domain containing 68], CCK [colle
Cystokinin], CCL1 [chemokine (CC motif) ligand 1], CCL11 [chemokine (CC motif) ligand 11], CCL13 [chemokine (CC motif) ligand 13], CCL14 [chemokine (CC motif) ) Ligand 14], CCL17 [chemokine (CC motif) ligand 17], CCL18 [chemokine (CC motif) ligand 18 (lung and activation suppression)], CCL19 [chemokine (CC motif) ligand 19] CCL2 [chemokine (CC motif) ligand 2], CCL20 [chemokine (CC motif) ligand 20], CCL21 [chemokine (CC motif) ligand 21], CCL22 [chemokine (CC motif) ligand 22], CCL24 [chemokai (CC motif) ligand 24], CCL25 [chemokine (CC motif) ligand 25], CCL26 [chemokine (CC motif) ligand 26], CCL27 [chemokine (CC motif) ligand 27], CCL28 [Chemokine (CC motif) ligand 28], CCL3 [chemokine (CC motif) ligand 3], CCL4 [chemokine (CC motif) ligand 4], CCL4L1 [chemokine (CC motif) ligand 4-like 1], CCL5 [chemokine (CC motif) ligand 5], CCL7 [chemokine (CC motif) ligand 7], CCL8 [chemokine (CC motif) ligand 8], CCNA1 [cyclin A1], CCNA2 [ Cyclin A2], CCNB1 [Cyclin B1 CCNB2 [cyclin B2], CCNC [cyclin C], CCND1 [cyclin D1], CCND2 [cyclin D2], CCND3 [cyclin D3], CCNE1 [cyclin E1], CCNG1 [cyclin G1], CCNH [cyclin H], CCNT1 [Cyclin T1], CCNT2 [cyclin T2], CCNY [cyclin Y], CCR1 [chemokine (CC motif) receptor 1], CCR2 [chemokine (CC motif) receptor 2], CCR3 [chemokine (C -C motif) receptor 3], CCR4 [chemokine (CC motif) receptor 4], CCR5 [chemokine (CC motif) receptor 5], CCR6 [chemokine (CC motif) receptor 6] , CCR7 [chemokine (CC motif) receptor 7 ], CCR8 [chemokine (CC motif) receptor 8], CCR9 [chemokine (CC motif) receptor 9], CCRL1 [chemokine (CC motif) receptor-like 1], CD14 [CD14 molecule] , CD151 [CD151 molecule (Raph blood group)], CD160 [CD160 molecule], CD163 [CD163 molecule], CD180 [CD180 molecule], CD19 [CD19 molecule], CD1A [CD1a molecule], CD1B [CD1b molecule] , CD1C [CD1c molecule], CD1D [CD1d molecule], CD2 [CD2 molecule], CD200 [CD200 molecule], CD207 [CD207 molecule, Langerin], CD209 [CD209 molecule], CD22 [CD22 molecule], CD226 [CD226 molecule] CD24 [CD24 molecule], D244 [CD244 molecule, natural killer cell receptor 2B4], CD247 [CD247 molecule], CD27 [CD27 molecule], CD274 [CD274 molecule], CD28 [CD28 molecule], CD2AP [CD2 related protein], CD300LF [CD300 molecule-like family Member f], CD34 [CD34 molecule], CD36 [CD36 molecule (thrombospondin receptor)], CD37 [CD37 molecule], CD38 [CD38 molecule], CD3E [CD3e molecule, epsilon (CD3-TCR complex)], CD4 [CD4 molecule], CD40 [CD40 molecule, TNF receptor superfamily member 5], CD40LG [CD40 ligand], CD44 [CD44 molecule (Indian blood group)], CD46 [CD46 molecule, complement regulatory tamper Quality], CD47 [CD47 molecule], CD48 [CD48 molecule], CD5 [CD5 molecule], CD52 [CD52 molecule], CD53 [CD53 molecule], CD55 [CD55 molecule, complement decay factor for complement (chromer blood group)] , CD58 [CD58 molecule], CD59 [CD59 molecule, complement regulatory protein], CD63 [CD63 molecule], CD68 [CD68 molecule], CD69 [CD69 molecule], CD7 [CD7 molecule], CD70 [CD70 molecule], CD72 [ CD72 molecule], CD74 [CD74 molecule, major histocompatibility complex, class II invariant chain], CD79A [CD79a molecule, immunoglobulin associated alpha], CD79B [CD79b molecule, immunoglobulin associated beta], CD80 [CD80 molecule], CD81 [CD81 molecule], CD82 [CD82 molecule], CD83 [CD83 molecule], CD86 [CD86 molecule], CD8A [CD8a molecule], CD9 [CD9 molecule], CD93 [CD93 molecule], CD97 [CD97 molecule], CDC20 [cell division cycle 20 homologue ( Budding yeast)], CDC25A [cell division cycle 25 homolog A (fission yeast)], CDC25B [cell division cycle 25 homolog B (fission yeast)], CDC25C [cell division cycle 25 homolog C (fission yeast)], CDC42 [cell division cycle 42 (GTP binding protein, 25 kDa)], CDC45 [CDC45 cell division cycle 45 homologue (budding yeast)], CDC5L [CDC5 cell division cycle 5-like (fission yeast)], CDC6 [cell division cycle 6 Homologue (budding yeast)], CDC7 [cell division cycle 7 homologue (budding yeast)], CDH1 [kappa Herin 1, type 1, E-cadherin (epithelium)], CDH2 [cadherin 2, type 1, N-cadherin (neural type)], CDH26 [cadherin 26], CDH3 [cadherin 3, type 1, P-cadherin (placenta) )], CDH5 [cadherin 5, type 2 (vascular endothelium)], CDIPT [CDP-diacylglycerol-inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)], CDK1 [cyclin-dependent kinase 1], CDK2 [cyclin-dependent Kinase 2], CDK4 [cyclin dependent kinase 4], CDK5 [cyclin dependent kinase 5], CDK5R1 [cyclin dependent kinase 5, regulatory subunit 1 (p35)], CDK7 [cyclin dependent kinase 7], CDK9 [ Cyclin dependence Kinase 9], CDKAL1 [CDK5 regulatory subunit related protein 1-like 1], CDKN1A [cyclin-dependent kinase inhibitor 1A (p21, Cip1)], CDKN1B [cyclin-dependent kinase inhibitor 1B (p27, Kip1)], CDKN1C [Cyclin dependent kinase inhibitor 1C (p57, Kip2)], CDKN2A [Cyclin dependent kinase inhibitor 2A (malignant melanoma, inhibits p16, CDK4)], CDKN2B [Cyclin dependent kinase inhibitor 2B (p15, CDK4) CDKN3 [cyclin-dependent kinase inhibitor 3], CDR2 [cerebellar degeneration-related protein 2, 62 kDa], CDT1 [chromatin licensing and DNA replication factor 1], CDX2 [tail type homeobox 2], CEACAM1 [carcinoembryonic antigen-related cell adhesion molecule 1 (bile glycoprotein)], CEACAM3 [carcinoembryonic antigen-related cell adhesion molecule 3], CEACAM5 [carcinoembryonic antigen-related cell adhesion molecule 5], CEACAM6 [carcinoembryonic antigen] Related cell adhesion molecule 6 (non-specific cross-reactive antigen)], CEACAM7 [carcinoembryonic antigen-related cell adhesion molecule 7], CEBPB [CCAAT / enhancer binding protein (C / EBP), beta], CEL [carboxyl ester lipase ( Bile salt-stimulating lipase)], CENPJ [centromere protein J], CENPV [centromere protein V], CEP290 [centrosome protein 290 kDa], CERK [ceramide kinase], CETP [cholesterol ester transfer protein, plasma], CFB [complement] Factor B] CFD [complement factor D (adipsin)], CFDP1 [craniofacial onset protein 1], CFH [complement factor H], CFHR1 [complement factor H related 1], CFHR3 [complement factor H related 3], CFI [ Complement factor I], CFL1 [cofilin 1 (non-muscle)], CFL2 [cofilin 2 (muscle)], CFLAR [CASP8 and FADD-like apoptosis regulator], CFP [complement factor properdin], CFTR [cystic fibrosis Transmembrane conductance regulator (ATP binding cassette subfamily C, member 7)], CGA [glycoprotein hormone, alpha polypeptide], CGB [chorionic gonadotropin, beta polypeptide], CGB5 [chorionic gonadotropin, beta polypeptide 5] , CHAD [Kondoro Adherin], CHAF A [chromatin associated factor 1, subunit A (p150)], CHAF1B [chromatin associated factor 1, subunit B (p60)], CHAT [choline acetyltransferase], CHD2 [chromodomain helicase DNA binding protein 2], CHD7 [ Chromodomain helicase DNA binding protein 7], CHEK1 [CHK1 checkpoint homologue (fission yeast)], CHEK2 [CHK2 checkpoint homologue (fission yeast)], CHGA [chromogranin A (parathyroid secreted protein 1)], CHGB [ Chromogranin B (secretogranin 1)], CHI3L1 [chitinase 3-like 1 (cartilage glycoprotein-39)], CHIA [chitinase, acidic], CHIT1 [chitinase 1 (chitotriosidase)], CHKA [Coli Kinase alpha], CHML [colloideremia-like (Rab escort protein 2)], CHRD [codein], CHRDL1 [codein-like 1], CHRM1 [cholinergic receptor, muscarinic 1], CHRM2 [cholinergic receptor, muscarinic 2], CHRM3 [cholinergic receptor, muscarinic 3], CHRNA3 [cholinergic receptor, nicotinic, alpha3], CHRNA4 [cholinergic receptor, nicotinic, alpha4], CHRNA7 [cholinergic receptor, Nicotinic, alpha 7], CHUK [conserved helix-loop-helix ubiquitous kinase], CIB1 [calcium and integrin binding 1 (carmyrin)], CIITA [class II, major histocompatibility complex, transactive factor], CILP [cartilage Middle layer protein, Nucleotide pyrophosphohydrolase], CISH [cytokine-inducible SH2-containing protein], CKB [creatine kinase, brain], CKLF [chemokine-like factor], CKM [creatine kinase, muscle], CLC [Charcot-Leiden crystal protein], CLCA1 [ Chloride channel accessory 1], CLCN1 [chloride channel 1, skeletal muscle], CLCN3 [chloride channel 3], CLDN1 [claudin 1], CLDN11 [claudin 11], CLDN14 [claudin 14], CLDN16 [claudin 16] CLDN19 [Claudin 19], CLDN2 [Claudin 2], CLDN3 [Claudin 3], CLDN4 [Claudin 4], CLDN5 [Claudin 5], and CLDN7 [Chrodin 7] Din 7], CLDN8 [Clodin 8], CLEC12A [C-type lectin domain family 12, member A], CLEC16A [C-type lectin domain family 16, member A], CLEC4A [C-type lectin domain family 4, member A], CLEC4D [C-type lectin domain family 4, member D], CLEC4M [C-type lectin domain family 4, member M], CLEC7A [C-type lectin domain family 7, member A], CLIP2 [CAP-GLY domain-containing linker protein 2] , CLK2 [CDC-like kinase 2], CLSPN [claspin homologue (Xenopus laevis)], CLSTN2 [calcinetenin 2], CLTCL1 [clasprin, heavy chain-like 1], CLU [clusterin] CMA 1 [chymase 1, mast cells], CMKLR1 [chemokine-like receptor 1], CNBP [CCHC type zinc finger nucleic acid binding protein], CNDP2 [CNDP dipeptidase 2 (metallopeptidase M20 family)], CNN1 [calponin 1, base
Sex, smooth muscle], CNP [2 ′, 3′-cyclic nucleotide 3 ′ phosphodiesterase], CNR1 [cannabinoid receptor 1 (brain)], CNR2 [cannabinoid receptor 2 (macrophage)], CNTF [ciliary nerve] Nutritional factor], CNTN2 [Contactin 2 (axon)], COG1 [Component 1 of oligomer Golgi complex], COG2 [Component 2 of oligomer Golgi complex], COIL [Coylin], COL11A1 [Collagen, XI type , Alpha 1], COL11A2 [collagen, type XI, alpha2], COL17A1 [collagen, type XVII, alpha1], COL18A1 [collagen, type XVIII, alpha1], COL1A1 [collagen, type I, alpha1], COL1A2 [Collagen, Type I, Alpha 2 COL2A1 [collagen, type II, alpha 1], COL3A1 [collagen, type III, alpha 1], COL4A1 [collagen, type IV, alpha 1], COL4A3 [collagen, type IV, alpha 3 (Goodpasture antigen)], COL4A4 [collagen, type IV, alpha 4], COL4A5 [collagen, type IV, alpha 5], COL4A6 [collagen, type IV, alpha 6], COL5A1 [collagen, type V, alpha 1], COL5A2 [collagen, type V , Alpha 2], COL6A1 [collagen, type VI, alpha 1], COL6A2 [collagen, type VI, alpha 2], COL6A3 [collagen, type VI, alpha 3], COL7A1 [collagen, type VII, alpha 1], COL8A2 [ Lagen, type VIII, alpha 2], COL9A1 [collagen, type IX, alpha 1], COMT [catechol-O-methyltransferase], COQ3 [coenzyme Q3 homologue, methyltransferase (budding yeast)], COQ7 [coenzyme Q7 homologue, ubiquinone (yeast)], CORO1A [coronin, actin binding protein, 1A], COX10 [COX10 homologue, cytochrome c oxidase-associated protein, heme A: farnesyltransferase (yeast)], COX15 [COX15 homologue, cytochrome c oxidase-associated protein (yeast)], COX5A [cytochrome c oxidase subunit Va], COX8A [cytochrome c oxidase subunit VIIIA (unevenly distributed)], CP [ceruloplasmin (Fe Roxidase)], CPA1 [carboxypeptidase A1 (pancreas)], CPB2 [carboxypeptidase B2 (plasma)], CPN1 [carboxypeptidase N, polypeptide 1], CPOX [coproporphyrinogen oxidase], CPS1 [carbamoyl-phosphate Salt synthetase 1, mitochondria], CPT2 [carnitine palmitoyltransferase 2], CR1 [complement component (3b / 4b) receptor 1 (Knops blood group)], CR2 [complement component (3d / Epstein Barr virus)] Body 2], CRAT [carnitine O-acetyltransferase], CRB1 [crumbs homolog 1 (Drosophila)], CREB1 [cAMP responsive element binding protein 1], CREBBP [CRE Binding protein], CREM [cAMP responsive element modulator], CRH [corticotropin releasing hormone receptor], CRHR1 [corticotropin releasing hormone receptor 1], CRHR2 [corticotropin releasing hormone receptor 2], CRK [V-crk sarcoma virus CT10 oncogene homologue (bird)], CRKL [v-crk sarcoma virus CT10 oncogene homologue (bird) -like], CRLF2 [cytokine receptor-like factor 2], CRLF3 [cytokine receptor-like] Factor 3], CROT [carnitine O-octanoyltransferase], CRP [C-reactive protein, pentraxin related], CRX [cone rod cone homeobox], CRY2 [cryptochrome 2 (photolyase-like)], CRYAA [crystallin, alpha ], CRYAB [crystallin, alpha B], CS [citrate synthase], CSF1 [colony stimulating factor 1 (macrophage)], CSF1R [colony stimulating factor 1 receptor], CSF2 [colony stimulating factor 2 (granulocyte-macrophage) ], CSF2RB [colony stimulating factor 2 receptor, beta, low affinity (granulocyte-macrophage)], CSF3 [colony stimulating factor 3 (granulocyte)], CSF3R [colony stimulating factor 3 receptor (granulocyte)], CSK [c-src tyrosine kinase], CSMD3 [CUB and sushi multiple domain 3], CSN1S1 [Kazen alpha s1], CSN2 [Kazen beta], CSNK1A1 [Kazen kinase 1, alpha 1], CSNK2A1 [Kazen kinase 2, alpha 1 poly Peptide], CSNK2B [Kazen kinase 2, beta polypeptide], CSPG4 [chondroitin sulfate proteoglycan 4], CST3 [cystatin C], CST8 [cystatin 8 (cystatin-related epididymis specific)], CSTA [cystatin A (stephin A)], CSTB [ Cystatin B (Stephin B)], CTAGE1 [skin T cell lymphoma-associated antigen 1], CTF1 [Cardiotrophin 1], CTGF [connective tissue growth factor], CTH [cystathionase (cystathionine gamma-lyase)], CTLA4 [cell Injury T lymphocyte-related protein 4], CTNNA1 [catenin (cadherin-related protein), alpha 1, 102 kDa], CTNNA3 [catenin (cadherin-related protein), alpha 3], CTNNAL1 [catenin (cadherin) Related protein), alpha-like 1], CTNNB1 [catenin (cadherin-related protein), beta 1, 88 kDa], CTNND1 [catenin (cadherin-related protein), delta 1], CTNS [cystinosis, nephropathy], CTRL [chymotrypsin ], CTSB [cathepsin B], CTSC [cathepsin C], CTSD [cathepsin D], CTSE [cathepsin E], CTSG [cathepsin G], CTSH [cathepsin H], CTSK [cathepsin K], CTSL1 [cathepsin L1] , CTTN [cortactin], CUL1 [calin 1], CUL2 [calin 2], CUL4A [calin 4A], CUL5 [calin 5], CX3CL1 [chemokine (C-X3-C motif) ligand 1], CX3CR1 [chemokine (C -X3- Motif) receptor 1], CXADR [coxsackievirus and adenovirus receptor], CXCL1 [chemokine (CX-C motif) ligand 1 (malignant melanoma growth stimulating activity, alpha)], CXCL10 [chemokine (C-X- C motif) ligand 10], CXCL11 [chemokine (C—X—C motif) ligand 11], CXCL12 [chemokine (C—C—C motif) ligand 12 (stromal cell-derived factor 1)], CXCL13 [chemokine (C -XC motif) ligand 13], CXCL2 [chemokine (CXC motif) ligand 2], CXCL5 [chemokine (CXC motif) ligand 5], CXCL6 [chemokine (CXC motif) ) Ligand 6 (granulocyte chemotactic protein 2)], CXCL9 [chemo Caine (C—X—C motif) ligand 9], CXCR1 [chemokine (C—C—C motif) receptor 1], CXCR2 [chemokine (C—C—C motif) receptor 2], CXCR3 [chemokine (C -X-C motif) receptor 3], CXCR4 [chemokine (C-X-C motif) receptor 4], CXCR5 [chemokine (C-X-C motif) receptor 5], CXCR6 [chemokine (C-X -C motif) receptor 6], CXCR7 [chemokine (CX-C motif) receptor 7], CXorf40A [chromosome X open reading frame 40A], CYB5A [cytochrome b5A type (microsome)], CYB5R3 [cytochrome b5 reductase 3], CYBA [cytochrome b-245, alpha polypeptide], CYBB [cytokine B-245, beta polypeptide], CYC1 [cytochrome c-1], CYCS [cytochrome c, somatic], CYFIP2 [cytoplasmic FMR1 interacting protein 2], CYP11A1 [cytochrome P450, family 11, subfamily A, Polypeptide 1], CYP11B1 [cytochrome P450, family 11, subfamily B, polypeptide 1], CYP11B2 [cytochrome P450, family 11, subfamily B, polypeptide 2], CYP17A1 [cytochrome P450, family 17, subfamily A , Polypeptide 1], CYP19A1 [cytochrome P450, family 19, subfamily A, polypeptide 1], CYP1A1 [cytochrome P450, family 1, subfamily A, poly Peptide 1], CYP1A2 [cytochrome P450, family 1, subfamily A, polypeptide 2], CYP1B1 [cytochrome P450, family 1, subfamily B, polypeptide 1], CYP21A2 [cytochrome P450, family 21, subfamily A, Polypeptide 2], CYP24A1 [cytochrome P450, family 24, subfamily A, polypeptide 1], CYP27A1 [cytochrome P450, family 27, subfamily A, polypeptide 1], CYP27B1 [cytochrome P450, family 27, subfamily B , Polypeptide 1], CYP2A6 [cytochrome P450, family 2, subfamily A, polypeptide 6], CYP2B6 [cytochrome P450, family 2, sa Family B, polypeptide 6], CYP2C19 [cytochrome P450, family 2, subfamily C, polypeptide 19], CYP2C8 [cytochrome P450, family 2, subfamily C, polypeptide 8], CYP2C9 [cytochrome P450, family 2 , Subfamily C, polypeptide 9], CYP2D6 [cytochrome P450, family 2, subfamily D, polypeptide 6], CYP2E1 [cytochrome P450, family 2, subfamily E, polypeptide 1], CYP2J2 [cytochrome P450, family 2, subfamily J, polypeptide 2], CYP2R1 [cytochrome P450, family 2, subfamily R, polypeptide 1], CYP3A4 [cytochrome P450, family -3, subfamily A, polypeptide 4], CYP3A5 [cytochrome P450, family 3, subfamily A, polypeptide 5], CYP4F3 [cytochrome P450, family 4, subfamily F, polypeptide 3], CYP51A1 [cytochrome P450 , Family 51, subfamily A, polypeptide 1], CYP7A1 [cytochrome P450, family 7, subfamily A, polypeptide 1], CYR61 [cysteine-rich, angiogenesis inducer, 61], CYSLTR1 [cysteinyl leukotriene receptor Body 1], CYSLTR2 [cysteinyl leukotriene receptor 2], DAO [D-amino acid oxidase], DAOA [D-amino acid oxidase activator], DAP3 [cell death-related protein 3], APK1 [cell death-related protein kinase 1], DARC [Duffy blood group, chemokine receptor], DAZ1 [deletion in azoospermia 1], DBH [dopamine beta-hydroxylase (dopamine beta-monooxygenase)], DCK [ Deoxycytidine kinase], DCLRE1C [DNA cross-link repair 1C (PSO2 homologue, budding yeast)], DCN [decorin], DCT [dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)], DCTN2 [dynactin 2 (p50)], DDB1 [damage-specific DNA binding protein 1, 127 kDa], DDB2 [damage-specific DNA binding protein 2, 48 kDa], DDC [dopa decarboxylase (aromatic L-amino acid decarboxyla) )], DDIT3 [DNA damage-inducible transcription 3], DDR1 [discoidin domain receptor tyrosine kinase 1], DDX1 [DEAD (Asp-Glu-Ala-Asp) box polypeptide 1], DDX41 [DEAD (Asp -Glu-Ala-Asp)
Box polypeptide 41], DDX42 [DEAD (Asp-Glu-Ala-Asp) box polypeptide 42], DDX58 [DEAD (Asp-Glu-Ala-Asp) box polypeptide 58], DEFA1 [defensin, alpha 1], DEFA5 [defencin, alpha5, panate cell specific], DEFA6 [defencin, alpha6, panate cell specific], DEFB1 [defencin, beta 1], DEFB103B [defensin, beta 103B], DEFB104A [defensin, beta 104A], DEFB4A [defensin, beta 4A], DEK [DEK oncogene], DENND1B [DENN / MADD domain-containing 1B], DES [desmin], DGAT1 [diacylglycerol -Acyltransferase homolog 1 (mouse)], DGCR14 [DiGeorge syndrome essential region gene 14], DGCR2 [DiGeorge syndrome essential region gene 2], DGCR6 [DiGeorge syndrome essential region gene 6], DGCR6L [DiGeorge syndrome essential] Region gene 6-like], DGCR8 [DiGeorge syndrome essential region gene 8], DGUOK [deoxyguanosine kinase], DHFR [dihydrofolate reductase], DHODH [dihydroorotate dehydrogenase], DHPS [deoxyhypsin synthase], DHRS7B [dehydrogenase / Reductase (SDR family) member 7B], DHRS9 [dehydrogenase / reductase (SDR family) member 9], DIAPH1 [diaphan us) homolog 1 (Drosophila)], DICER1 [Dicer 1, ribonuclease type III], DIO2 [deiodonase, iodothyronine, type II], DKC1 [congenital keratosis 1, dyskerin], DKK1 [Dick Kopf homolog 1 (Xenopus laevis)], DLAT [dihydrolipoamide S-acetyltransferase], DLG2 [disc, large homolog 2 (Drosophila)], DLG5 [disc, large homolog 5 (Drosophila)], DMBT1 [deleted in malignant brain tumors 1], DMC1 [DMC1 mck1 homologue amount control, meiosis-specific homologous recombination (yeast)], DMD [dystrophin], DMP1 [ivory substrate acidic phosphate protein 1], DMPK [myotonic dystrophy-protein kinase ], DM T1 [amphoteric and mab-3-related transcription factor 1], DMXL2 [Dmx-like 2], DNA2 [DNA replication helicase 2 homolog (yeast)], DNAH1 [dynein, axial thread, heavy chain 1], DNAH12 [dynein, axis Thread, heavy chain 12], DNAI1 [dynin, axial thread, intermediate strand 1], DNAI2 [dynin, axial thread, intermediate strand 2], DNASE1 [deoxyribonuclease I], DNM2 [dynamin 2], DNM3 [dynamin 3], DNMT1 [DNA (cytosine-5-)-methyltransferase 1], DNMT3B [DNA (cytosine-5-)-methyltransferase 3 beta], DNTT [deoxynucleotidyl transferase, terminal], DOCK1 [contributing factor 1 for cytokinesis] , DOCK3 [Contributing factor 3 of cytokinesis], DOCK8 [ Factors that contribute to cytokinesis 8], DOK1 [docking protein 1, 62 kDa (downstream of tyrosine kinase)], DOLK [dorichol kinase], DPAGT1 [dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosamine phospho Transferase 1 (GlcNAc-1-P transferase)], DPEP1 [dipeptidase 1 (kidney)], DPH1 [DPH1 homologue (budding yeast)], DPM1 [drikyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit] , DPP10 [dipeptidyl-peptidase 10], DPP4 [dipeptidyl-peptidase 4], DPYD [dihydropyrimidine dehydrogenase], DRD2 [dopamine receptor D2], DRD3 [dopamine receptor D3 DRD4 [Dopamine Receptor D4], DSC2 [Desmocollin 2], DSG1 [Desmoglein 1], DSG2 [Desmoglein 2], DSG3 [Desmoglein 3 (Acne vulgaris antigen)], DSP [Desmoplakin], DTNA [ Dystrobrevin, alpha], DTYMK [deoxythymidylate kinase (thymidylate kinase)], DUOX1 [double oxidase 1], DUOX2 [double oxidase 2], DUSP1 [bispecific phosphatase 1], DUSP14 [double Specific phosphatase 14], DUSP2 [bispecific phosphatase 2], DUSP5 [bispecific phosphatase 5], DUT [deoxyuridine triphosphatase], DVL1 [Dishvelled], dsh homolog 1 (show Drosophila)], DYNC2H1 [Dynein, cytoplasm 2, heavy chain 1], DYNLL1 [Dynein, light chain, LC8-1 type], DYRK1A [bispecific tyrosine- (Y) -phosphorylated kinase 1A], DYSF [ Dysferlin, limb muscular dystrophy 2B (autosomal recessive)], E2F1 [E2F transcription factor 1], EBF2 [early B cell factor 2], EBI3 [Epstein-Barr virus inducible 3], ECE1 [endothelin converting enzyme 1], ECM1 [Extracellular matrix protein 1], EDA [Ectodysplasin A], EDAR [Ectodysplasin A receptor], EDN1 [endothelin 1], EDNRA [endothelin receptor A type], EDNRB [endothelin receptor B type], EEF1A1 [eukaryotic translation elongation factor 1 alpha 1], EEF 1A2 [eukaryotic translation elongation factor 1 alpha 2], EFEMP2 [EGF-containing fibrin-like extracellular matrix protein 2], EFNA1 [ephrin-A1], EFNB2 [ephrin-B2], EFS [embryonic Fyn-related substrate], EGF [Epidermal growth factor (beta-urogastrone)], EGFR [epidermal growth factor receptor (erythroblastic leukemia virus (v-erb-b) oncogene homolog, bird)], EGR1 [early growth response 1], EGR2 [Early growth response 2], EHF [ets homologous factor], EHMT2 [true chromatin histone-lysine N-methyltransferase 2], EIF2AK2 [eukaryotic translation initiation factor 2-alpha kinase 2], EIF2S1 [eukaryotic translation Initiation factor 2, subunit 1 alpha, 35 kDa], EIF2S2 [eukaryotic translation initiation Child 2, subunit 2 beta, 38 kDa], EIF3A [eukaryotic translation initiation factor 3, subunit A], EIF4B [eukaryotic translation initiation factor 4B], EIF4E [eukaryotic translation initiation factor 4E], EIF4EBP1 [ Eukaryotic translation initiation factor 4E binding protein 1], EIF4G1 [eukaryotic translation initiation factor 4 gamma, 1], EIF6 [eukaryotic translation initiation factor 6], ELAC2 [elaC homolog 2 (E. coli)], E column [Elastase, neutrophil expression], ELAVL1 [ELAV (embryonic lethal, abnormal vision, Drosophila) -like 1 (Hu antigen R)], ELF3 [E74-like factor 3 (ets domain transcription factor, epithelial specific)], ELF5 [E74-like factor 5 (ets domain transcription factor)], ELN [elastin], ELOVL4 [extension of very long chain fatty acids (FEN1 / El) 2, SUR4 / Elo3, yeast) -like 4], EMD [Emerin], EMILIN1 [elastin microfibril interfacer 1], EMR2 [egf-like module-containing, mucin-like, hormone receptor-like 2], EN2 [engrailed] Homeobox 2], ENG [endoglin], ENO1 [enolase 1, (alpha)], ENO2 [enolase 2 (gamma, neural type)], ENO3 [enolase 3 (beta, muscle)], ENPP2 [ectonucleotide pyrophosphatase / Phosphodiesterase 2], ENPP3 [ectonucleotide pyrophosphatase / phosphodiesterase 3], ENTPD1 [ectonucleoside triphosphate diphosphohydrolase 1], EP300 [E1A binding protein p300], E PAS1 [endothelial PAS domain protein 1], EPB42 [erythrocyte membrane protein band 4.2], EPCAM [epithelial cell adhesion molecule], EPHA1 [EPH receptor A1], EPHA2 [EPH receptor A2], EPHB2 [EPH receptor B2 ], EPHB4 [EPH receptor B4], EPHB6 [EPH receptor B6], EPHX1 [epoxide hydrolase 1, microsome (xenobiotic)], EPHX2 [epoxide hydrolase 2, cytoplasm], EPO [erythropoietin], EPOR [erythropoietin receptor] ], EPRS [glutamyl-prolyl-tRNA synthetase], EPX [eosinophil peroxidase], ERBB2 [v-erb-b2 erythroblastic leukemia virus oncogene homolog 2, neuro / glioblastoma-derived oncogene homolog ( Tri)), ERB 2IP [erbb2 interacting protein], ERBB3 [v-erb-b2 erythroblastic leukemia virus oncogene homolog 3 (bird)], ERBB4 [v-erb-a erythroblastic leukemia virus oncogene homolog 4 ( Bird)], ERCC1 [cleave repair cross-complementing rodent repair defect, complementation group 1 (including overlapping antisense sequences)], ERCC2 [cleave repair cross-complementing rodent repair defect, complementation group 2], ERCC3 [cleavage repair] Cross-supplemented rodent repair deficiency, complementation group 3 (Xeroderma pigmentosum group B supplement)], ERCC4 [Cut repair cross-supplement rodent repair deficiency, complementation group 4], ERCC5 [Cleavage repair cross-supplement rodent repair Defect, complementation group 5], ERCC6 [cleave repair cross-complementing rodent repair defect, complementation group 6], ERCC6L [cleave repair cross-complementing rodent repair defect, complement group 6-like], E CC8 [Cross-repair cross-complemented rodent repair defect, complementation group 8], ERO1LB [ERO1-like beta (budding yeast)], ERVK6 [endogenous retroviral sequence K, 6], ERVWE1 [endogenous retroviral family W, env (C7), Member 1], ESD [Esterase D / Formylglutathione hydrolase], ESR1 [Estrogen receptor 1], ESR2 [Estrogen receptor 2 (ERbeta)], ESRRA [Estrogen-related receptor alpha], ESRRB [Estrogen Related Receptor Beta], ETS1 [v-ets erythroblastosis virus E26 oncogene homolog 1 (bird)], ETS2 [v-ets erythroblastosis virus E26 oncogene homolog 2 (bird)], EWSR1 [ Ewing sarcoma breakpoint area 1], EXO1 [Ex Sonuclease 1], EYA1 [eyes absent homolog 1 (Drosophila)], EZH2 [Zest homolog enhancer 2 (Drosophila)], EZR [Ezrin], F10 [Coagulation factor X] F11 [coagulation factor XI], F12 [coagulation factor XII (Hageman factor)], F13A1 [coagulation factor XIII, A1 polypeptide], F13B [coagulation factor XIII, B polypeptide], F2 [coagulation factor II Factor (thrombin)], F2R [coagulation factor II (thrombin) receptor], F2RL1 [coagulation factor II (thrombin) receptor-like 1], F2RL3 [coagulation factor II (thrombin) receptor-like 3], F3 [Coagulation factor III (thromboplastin, tissue factor)], F5 [Coagulation factor V (proaccessor) Relin, unstable factor)], F7 [coagulation factor VII (serum prothrombin conversion promoting factor)], F8 [coagulation factor VIII, procoagulant component], F9 [coagulation factor IX], FABP1 [fatty acid binding protein 1 , Liver], FABP2 [fatty acid binding protein 2, intestine], FABP4 [fatty acid binding protein 4, adipocyte], FADD [Fas (TNFRSF6) -related cell death mediating domain], FADS1 [fatty acid desaturase 1], FADS2 [fatty acid desaturase 2 ], FAF1 [Fas (TNFRSF6) -related factor 1], FAH [Fumaryl acetoacetate hydrolase (Fumaryl acetoacetate)], FAM189B [Family 189 with sequence similarity, member B], FAM92B [Family 92 with sequence similarity, member ], FANCA [Fanconi anemia, A complementation group], FANCB [Fanconi anemia, B complementation group], FANCC [Fanconi anemia, C complementation group], FANCD2 [Fanconi anemia, D complementation group 2], FANCE [Fanconi anemia, E complementation] Group], FANCF [Fanconi anemia, F
Complementary group], FANCG [Fanconi anemia, G complementation group], FANCI [Fanconi anemia, I complementation group], FANCL [Fanconi anemia, L complementation group], FANCM [Fanconi anemia, M complementation group], FANK1 [Fibronectin type III and Ankyrin repeat domain 1], FAS [Fas (TNF receptor superfamily, member 6)], FASLG [Fas ligand (TNF superfamily, member 6)], FASN [fatty acid synthase], FASTK [Fas activated serine / threonine kinase ], FBLN5 [fibrin 5], FBN1 [fibrin 1], FBP1 [fructose-1,6-bisphosphatase 1], FBXO32 [F box protein 32], FBXW7 [F box and WD repeat domain contained ] FCAR [Fc fragment of IgA, receptor for it], FCER1A [Fc fragment of IgE, high affinity I, receptor for it, alpha polypeptide], FCER1G [Fc fragment of IgE, high affinity I, it Receptor, gamma polypeptide], FCER2 [Fc fragment of IgE, low affinity II, receptor for it (CD23)], FCGR1A [Fc fragment of IgG, high affinity Ia, receptor (CD64)], FCGR2A [Fc fragment of IgG, low affinity IIa, receptor (CD32)], FCGR2B [Fc fragment of IgG, low affinity IIb, receptor (CD32)], FCGR3A [Fc fragment of IgG, low affinity IIIa, receptor Body (CD16a)], FCGR3B [Fc fragment of IgG, low affinity IIIb, receptor (CD16b)], F N2 [Ficollin (collagen / fibrinogen domain-containing lectin) 2 (fucoline)], FCN3 [Ficollin (collagen / fibrinogen domain-containing) 3 (Hakata antigen)], FCRL3 [Fc receptor-like 3], FCRL6 [Fc receptor-like 6 ], FDFT1 [farnesyl-diphosphate farnesyltransferase 1], FDPS [farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyl transferase, geranyl transferase)], FDX1 [ferredoxin 1], FEN1 [flap structure] Specific endonuclease 1], FERMT1 [fermitin family homolog 1 (Drosophila)], FERMT3 [fermitin (fe) rmitin) family homologue 3 (Drosophila)], FES [feline sarcoma oncogene], FFAR2 [free fatty acid receptor 2], FGA [fibrinogen alpha chain], FGB [fibrinogen beta chain], FGF1 [fibroblast growth factor 1 (Acidic)], FGF2 [fibroblast growth factor 2 (basic)], FGF5 [fibroblast growth factor 5], FGF7 [fibroblast growth factor 7 (keratinocyte growth factor)], FGF8 [fibroblast growth Factor 8 (androgen inducible)], FGFBP2 [fibroblast growth factor binding protein 2], FGFR1 [fibroblast growth factor receptor 1], FGFR1OP [FGFR1 oncogene partner], FGFR2 [fibroblast growth factor receptor 2], FGFR3 [fibroblast growth factor receptor 3], FGFR [Fibroblast growth factor receptor 4], FGG [fibrinogen gamma chain], FGR [Gardner-Rashed feline sarcoma virus (v-fgr) oncogene homologue], FHIT [fragile histidine triple gene] FHL1 [four half LIM domain 1], FHL2 [four half LIM domain 2], FIBP [fibroblast growth factor (acidic) intracellular binding protein], FIG. F [c-fos inducible growth factor (vascular endothelium) Growth factor D)], FKBP1A [FK506 binding protein 1A, 12 kDa], FKBP4 [FK506 binding protein 4, 59 kDa], FKBP5 [FK506 binding protein 5], FLCN [follicular hormone], FLG [filaggrin], FLG2 [filaggrin family members 2], FLNA Filamin A, alpha], FLNB [filamin B, beta], FLT1 [fms-related tyrosine kinase 1 (vascular endothelial growth factor / vascular permeability factor receptor)], FLT3 [fms-related tyrosine kinase 3], FLT3LG [fms-related tyrosine Kinase 3 ligand], FLT4 [fms-related tyrosine kinase 4], FMN1 [formin 1], FMOD [fibrojuline], FMR1 [fragile X mental retardation 1], FN1 [fibronectin 1], FOLH1 [folate hydrolase (prostate specific Membrane antigen) 1], FOLR1 [folic acid receptor 1 (adult)], FOS [FBJ mouse osteosarcoma virus oncogene homologue], FOXL2 [forkhead box L2], FOXN1 [forkhead box N1], FOXN2 [forkhead] Box N2] FOXO3 [fork head box O3], FOXP3 [fork head box P3], FPGS [folyl polyglutamate synthase], FPR1 [formyl peptide receptor 1], FPR2 [formyl peptide receptor 2], FRAS1 [Fraser syndrome 1] FREM2 [FRAS1-related extracellular matrix protein 2], FSCN1 [fasin homologue 1, actin-binding protein (American urchin)], FSHB [follicle stimulating hormone, beta polypeptide], FSHR [follicle stimulating hormone receptor], FST [follistatin], FTCD [formiminotransferase cyclodeaminase], FTH1 [ferritin, heavy polypeptide 1], FTL [ferritin, light polypeptide], FURIN [furin (paired) Basic amino acid cleaving enzyme)], FUT1 [fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)], FUT2 [fucosyltransferase 2 (including secretory state)], FUT3 [fucosyltransferase 3 ( Galactoside 3 (4) -L-fucosyltransferase, Lewis blood group)], FUT4 [fucosyltransferase 4 (alpha (1,3) fucosyltransferase, bone marrow specific)], FUT7 [fucosyltransferase 7 (alpha (1,3)) Fucosyltransferase)], FUT8 [fucosyltransferase 8 (alpha (1,6) fucosyltransferase)], FXN [frataxin], FYN [SRC, FGR, YES related to YES Oncogenic gene], FZD4 [frizzled homolog 4 (Drosophila)], G6PC3 [glucose 6 phosphatase, catalyst, 3], G6PD [glucose-6-phosphate dehydrogenase], GAA [glucosidase, alpha, acid], GAB2 [GRB2-related binding protein 2], GABBR1 [gamma-aminobutyric acid (GABA) B receptor, 1], GABRB3 [gamma-aminobutyric acid (GABA) A receptor, beta 3], GABRE [gamma-aminobutyric acid (GABA) A receptor, epsilon], GAD1 [glutamate decarboxylase 1 (brain, 67 kDa)], GAD2 [glutamate decarboxylase 2 (islets and brain, 65 kDa)], GADD45A [growth arrest and DNA damage induction, alpha], GA L [Galanin prepropeptide], GALC [Galactosylceramidase], GALK1 [Galactokinase 1], GALR1 [Galanin receptor 1], GAP43 [Growth-related protein 43], GAPDH [Glyceraldehyde-3-phosphate dehydrogenase], GART [Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase], GAST [gastrin], GATA1 [GATA binding protein 1 (globin transcription factor 1)], GATA2 [GATA binding protein 2], GATA3 [ GATA-binding protein 3], GATA4 [GATA-binding protein 4], GATA6 [GATA-binding protein 6], GBA [glucosidase, Bae , Acid], GBA3 [glucosidase, beta, acid 3 (cytosol)], GBE1 [glucan (1 [4-alpha-), branching enzyme 1], GC [branch-specific component (vitamin D binding protein)], GCG [glucagon], GCH1 [GTP cyclohydrolase 1], GCKR [glucokinase (hexokinase 4) regulator], GCLC [glutamic acid-cysteine ligase, catalytic subunit], GCLM [glutamic acid-cysteine ligase, modifier subunit], GCNT2 [Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)], GDAP1 [ganglioside-induced differentiation-related protein 1], GDF15 [growth differentiation factor 15], GDNF [glial cell-derived neurotrophic factor] , GFAP [God Gliary fiber acidic protein], GGH [gamma-glutamyl hydrolase (conjugase, folyl polygamma glutamyl hydrolase)], GGT1 [gamma-glutamyltransferase 1], GGT2 [gamma-glutamyltransferase 2], GH1 [growth hormone 1], GHR [growth hormone receptor], GHRH [growth hormone releasing hormone], GHRL [ghrelin / obstatin prepropeptide], GHSR [growth hormone secretagogue receptor], GIF [gastric intrinsic factor (vitamin B synthesis)], GIP [gastric inhibitory polypeptide], GJA1 [gap junction protein, alpha 1, 43 kDa], GJA4 [gap junction protein, alpha 4, 37 kDa], GJB2 [gap junction protein, beta 2, 26 kDa ], GLA [galactosidase, alpha], GLB1 [galactosidase, beta 1], GLI2 [GLI family zinc finger 2], GLMN [glomulin, FKBP-related protein], GLRX [glutaredoxin (thioltransferase)], GLS [glutaminase], GLT25D1 [Glycosyltransferase 25 domain-containing 1], GLUL [glutamate-ammonia ligase (glutamine synthetase)], GLYAT [glycine-N-acyltransferase], GM2A [GM2 ganglioside activator], GMDS [GDP-mannose 4 [6-dehydratase] , GNA12 [guanine nucleotide binding protein (G protein) alpha 12], GNA13 [guanine nucleotide binding protein Protein (G protein), alpha 13], GNAI1 [guanine nucleotide binding protein (G protein), active polypeptide 1 inhibiting alpha], GNAO1 [guanine nucleotide binding protein (G protein), alpha activating active polypeptide O ], GNAQ [guanine nucleotide binding protein (G protein), q polypeptide], GNAS [GNAS complex locus], GNAZ [guanine nucleotide binding protein (G protein), alpha z polypeptide], GNB1 [guanine nucleotide binding protein (G protein), beta polypeptide 1], GNB1L [guanine nucleotide binding protein (G protein), beta polypeptide 1-like], GNB2L1 [guanine nucleotide binding tag] Protein (G protein), beta polypeptide 2-like 1], GNB3 [guanine nucleotide binding protein (G protein), beta polypeptide 3], GNE [glucosamine (UDP-N-acetyl) -2-epimerase / N-acetyl Mannosamine kinase], GNG2 [guanine nucleotide binding protein (G protein), gamma 2], GNLY [granulincin], GNPAT [glycerone phosphate O-acyltransferase], GNPDA2 [glucosamine-6-phosphate deaminase 2] , GNRH1 [gonadotropin-releasing hormone 1 (luteinogenic releasing hormone)], GNRHR [gonadotropin-releasing hormone receptor], GOLGA8B [Golgin A8 family, member B], GOLGB1 [Golgin B1], GOT 1 [glutamate-oxaloacetate transaminase 1, soluble (aspartate aminotransferase 1)], GOT2 [glutamate-oxaloacetate transaminase 2, mitochondria (aspartate aminotransferase 2)], GP1BA [sugar tag
Protein Ib (platelet), alpha polypeptide], GP2 [glycoprotein 2 (zymogen granule membrane)], GP6 [glycoprotein VI (platelet)], GPBAR1 [G protein-binding bile acid receptor 1], GPC5 [glypican 5 ], GPI [glucose phosphate isomerase], GPLD1 [glycosylphosphatidylinositol-specific phospholipase D1], GPN1 [GPN loop GTPase 1], GPR1 [G protein-coupled receptor 1], GPR12 [G protein-coupled receptor 12], GPR123 [G protein coupled receptor 123], GPR143 [G protein coupled receptor 143], GPR15 [G protein coupled receptor 15], GPR182 [G protein coupled receptor 182], GPR44 [G protein coupled receptor 44], GPR77 [G protein-coupled receptor 77], GPRASP1 [G protein-coupled receptor-related sorting protein 1], GPRC6A [G protein-coupled receptor, family C, group 6, member A], GPT [glutamate-pyruvate transaminase (alanine) Aminotransferase)], GPX1 [glutathione peroxidase 1], GPX2 [glutathione peroxidase 2 (gastrointestinal)], GPX3 [glutathione peroxidase 3 (plasma)], GRAP2 [GRB2-related adapter protein 2], GRB2 [growth factor receptor binding protein 2] ], GRIA2 [glutamate receptor, anionic, AMPA2], GRIN1 [glutamate receptor, anionic, N-methyl D-aspartate 1], GRIN2A [glutami Acid receptor, anionic, N-methyl D-aspartate 2A], GRIN2B [glutamate receptor, ionic, N-methyl D-aspartate 2B], GRIN2C [glutamate receptor, anionic, N- Methyl D-aspartate 2C], GRIN2D [glutamate receptor, ionic, N-methyl D-aspartate 2D], GRIN3A [glutamate receptor, ionic, N-methyl-D-aspartate 3A], GRIN3B [Glutamate receptor, anionic, N-methyl-D-aspartate 3B], GRK5 [G protein-coupled receptor kinase 5], GRLF1 [glucocorticoid receptor DNA binding factor 1], GRM1 [glutamate receptor, Metabolic 1], GRP [Gastrin-releasing peptide], GRPR [Gas Phosphorus-releasing peptide receptor], GSC [Gouscoid homeobox], GSC2 [Guscoid homeobox 2], GSDMB [Gassermin B], GSK3B [Glycogen synthase kinase 3 beta], GSN [Gerzoline], GSR [Glutathione reductase] GSS [glutathione synthetase], GSTA1 [glutathione S-transferase alpha 1], GSTA2 [glutathione S-transferase alpha 2], GSTM1 [glutathione S-transferase mu1], GSTM3 [glutathione S-transferase mu3 (brain)], GSTO2 [Glutathione S-transferase omega 2], GSTP1 [Glutathione S-transferase pi 1], GSTT1 [Glutathione S] -Transferase theta 1], GTF2A1 [basic transcription factor II A, 1, 19/37 kDa], GTF2F1 [basic transcription factor II F, polypeptide 1, 74 kDa], GTF2H2 [basic transcription factor II H, polypeptide 2 44 kDa], GTF2H4 [basic transcription factor II H, polypeptide 4, 52 kDa], GTF2H5 [basic transcription factor II H, polypeptide 5], GTF2I [basic transcription factor II i], GTF3A [basic transcription factor III Factor A], GUCA2A [guanylate cyclase activator 2A (guanylin)], GUCA2B [guanylate cyclase activator 2B (uroguanylin)], GUCY2C [guanylate cyclase 2C (heat-stable enterotoxin receptor)], GUK1 [ Guanylate kinase 1], G LP1 [GULP, phagocytic adapter containing PTB domain 1], GUSB [glucuronidase, beta], GYPA [glycophorin A (MNS blood group)], GYPB [glycophorin B (MNS blood group)], GYPC [glycophorin C (Zelvician blood group)] ], GYPE [Glycophorin E (MNS blood group)], GYS1 [Glycogen synthase 1 (muscle)], GZMA [Granzyme A (Granzyme 1, cytotoxic T lymphocyte-related serine esterase 3)], GZMB [Granzyme B (Granzyme) 2, cytotoxic T lymphocyte-related serine esterase 1)], GZMK [granzyme K (granzyme 3, tryptase II)], H1F0 [H1 histone family, member 0], H2AFX [H2A histone family, member X HABP2 [hyaluronan-binding protein 2], HACL1 [2-hydroxyacyl-CoA lyase 1], HADHA [hydroxyacyl-coenzyme A dehydrogenase / 3-ketoacyl-coenzyme A thiolase / enoyl-coenzyme A hydratase (trifunctional Protein), alpha subunit], HAL [histidine ammonia-lyase], HAMP [hepcidin antimicrobial peptide], HAPLN1 [hyaluronan and proteoglycan binding protein 1], HAVCR1 [hepatitis A virus cell receptor 1], HAVCR2 [type A] Hepatitis virus cell receptor 2], HAX1 [HCLS1-related protein X-1], HBA1 [hemoglobin, alpha 1], HBA2 [hemoglobin, alpha 2], HBB [hemoglobin, beta], H BE1 [hemoglobin, epsilon 1], HBEGF [heparin-binding EGF-like growth factor], HBG2 [hemoglobin, gamma G], HCCS [holocytochrome c synthase (cytochrome c heme] -lyase)], HCK [hematopoietic cell kinase], HCRT [Hypocretin (orexin) neuropeptide precursor], HCRTR1 [hypocretin (orexin) receptor 1], HCRTR2 [hypocretin (orexin) receptor 2], HCST [hematopoietic cell signaling factor], HDAC1 [histone deacetylase 1] , HDAC2 [histone deacetylase 2], HDAC6 [histone deacetylase 6], HDAC9 [histone deacetylase 9], HDC [histidine decarboxylase], HERC2 [hect domain and R D2], HES1 [split hair and enhancer 1, (Drosophila)], HES6 [Split hair and enhancer 6 (Drosophila)], HESX1 [HESX homeobox 1], HEXA [hexosaminidase A (alpha) Polypeptide)], HEXB [hexosaminidase B (beta polypeptide)], HFE [hemochromatosis], HGF [hepatocyte growth factor (hepatopoietin A, dispersion factor)], HGS [hepatocyte growth factor-regulated tyrosine Kinase substrate], HGSNAT [heparan-alpha-glucosaminide N-acetyltransferase], HIF1A [hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)], HINFP [histone H4 transcription factor], INT1 [histidine triple nucleotide binding protein 1], HIPK2 [homeodomain interacting protein kinase 2], HIRA [HIR histone cell cycle control deficient homologue A (budding yeast)], HIST1H1B [histone cluster 1, H1b], HIST1H3E [ Histone cluster 1, H3e], HIST2H2AC [histone cluster 2, H2ac], HIST2H3C [histone cluster 2, H3c], HIST4H4 [histone cluster 4, H4], HJURP [holiday linked recognition protein], HK2 [hexokinase 2], HLA- A [major histocompatibility complex, class I, A], HLA-B [major histocompatibility complex, class I, B], HLA-C [major histocompatibility complex, class I, C], HLA -DMA [ Histocompatibility complex, class II, DM alpha], HLA-DMB [major histocompatibility complex, class II, DM beta], HLA-DOA [major histocompatibility complex, class II, DO alpha], HLA-DOB [major histocompatibility complex, class II, DO beta], HLA-DPA1 [major histocompatibility complex, class II, DPalpha1], HLA-DPB1 [major histocompatibility complex, class II , DP beta 1], HLA-DQA1 [major histocompatibility complex, class II, DQ alpha 1], HLA-DQA2 [major histocompatibility complex, class II, DQ alpha 2], HLA-DQB1 [major tissue Compatible complex, class II, DQ beta 1], HLA-DRA [major histocompatibility complex, class II, DR alpha], HLA-DR B1 [major histocompatibility complex, class II, DR beta 1], HLA-DRB3 [major histocompatibility complex, class II, DR beta 3], HLA-DRB4 [major histocompatibility complex, class II, DRbeta4], HLA-DRB5 [major histocompatibility complex, class II, DRbeta5], HLA-E [major histocompatibility complex, class I, E], HLA-F [major histocompatibility complex Body, class I, F], HLA-G [major histocompatibility complex, class I, G], HLCS [holocarboxylase synthetase (biotin- (propionyl-coenzyme A-carboxylase (ATP-hydrolyzed)) ligase) ], HLTF [helicase-like transcription factor], HLX [H2.0-like homeobox], HMBS [hydroxymethylbilan synthase], HMG 1 [high mobility group A T-hook 1], HMGB1 [high mobility branch box 1], HMGCR [3-hydroxy-3-methylglutaryl-coenzyme A reductase], HMOX1 [heme oxygenase (decycling) 1] , HMOX2 [heme oxygenase (decycling) 2], HNF1A [HNF1 homeobox A], HNF4A [hepatocyte nuclear factor 4, alpha], HNMT [histamine N-methyltransferase], HNRNPA1 [heteronuclear ribonucleoprotein A1], HNRNPA2B1 [Heteronuclear ribonucleoprotein A2 / B1], HNRNPH2 [heteronuclear ribonucleoprotein H2 (H ′)], HNRNPUL1 [heteronuclear ribonucleoprotein U-like 1], HOXA13 [homeobox A13], HOXA [Homeobox A4], HOXA9 [Homeobox A9], HOXB4 [Homeobox B4], HP [haptoglobin], HPGDS [hematopoietic prostaglandin D synthase], HPR [haptoglobin related protein], HPRT1 [hypoxanthine phosphoribosyltransferase 1 ], HPS1 [Hermansky-Pudrack Syndrome 1], HPS3 [Hermansky-Pudrack Syndrome 3], HPS4 [Hermansky-Pudrack Syndrome 4], HPSE [Heparanase], HPX [Hemopexin], HRAS [v-Ha-ras Harvey] Rat sarcoma virus oncogene homologue], HRG [histidine-rich glycoprotein], HRH1 [histamine receptor H1], HRH2 [histamine receptor H2], HRH3 [histami Receptor H3], HRH4 [histamine receptor H4], HSD11B1 [hydroxysteroid (11-beta) dehydrogenase 1], HSD11B2 [hydroxysteroid (11-beta) dehydrogenase 2], HSD17B1 [hydroxysteroid (17-beta) dehydrogenase 1 ], HSD17B4 [hydroxysteroid (17-beta) dehydrogenase 4], HSF1 [heat shock transcription factor 1], HSP90AA1 [heat shock protein 90 kDa alpha (cytosol), class A member 1], HSP90AB1 [heat shock protein 90 kDa alpha ( Cytosol), class B member 1], HSP90B1 [heat shock protein 90 kDa beta (Grp94), member 1], HSPA14 [heat system Yock 70kD protein 14], HSPA1A [heat shock 70kD protein 1A], HSPA1B [heat shock 70kD protein 1B], HSPA2 [heat shock 70kD protein 2], HSPA4 [heat shock 70kD protein 4], HSPA5 [heat
Shock 70 kD protein 5 (glucose-regulated protein, 78 kDa)], HSPA8 [heat shock 70 kD protein 8], HSPB1 [heat shock 27 kD protein 1], HSPB2 [heat shock 27 kD protein 2], HSPD1 [heat shock 60 kD protein 1 (chaperonin) )], HSPE1 [heat shock 10 kD protein 1 (chaperonin 10)], HSPG2 [heparan sulfate proteoglycan 2], HTN3 [histatin 3], HTR1A [5-hydroxytryptamine (serotonin) receptor 1A], HTR2A [5-hydroxytryptamine (Serotonin) receptor 2A], HTR3A [5-hydroxytryptamine (serotonin) receptor 3A], HTRA1 [HtrA serine peptidase 1], HTT [han Ntin], HUS1 [HUS1 checkpoint homologue (fission yeast)], HUWE1 [HECT, UBA and WWE domain-containing 1], HYAL1 [hyaluronoglucosaminidase 1], HYLS1 hydrolethalus syndrome 1], IAPP [island Amyloid polypeptide], IBSP [integrin-binding sialoprotein], ICAM1 [intracellular adhesion molecule 1], ICAM2 [intracellular adhesion molecule 2], ICAM3 [intracellular adhesion molecule 3], ICAM4 [intracellular adhesion molecule 4 (Landsteiner) -Wiener blood group)], ICOS [inducible T cell costimulatory factor], ICOSLG [inducible T cell costimulatory ligand], ID1 [DNA binding inhibitor 1, dominant inhibitory helix-loop-helix protein], ID2 Inhibitor 2 of DNA binding, dominant inhibition helix-loop-helix protein], IDO1 [indoleamine 2 [3-dioxygenase 1], IDS [iduronate 2-sulfatase], IDUA [iduronidase, alpha-L-], IFI27 [interferon , Alpha-inducible protein 27], IFI30 [interferon, gamma-inducible protein 30], IFITM1 [interferon-induced transmembrane protein 1 (9-27)], IFNA1 [interferon, alpha1], IFNA2 [interferon, alpha2] IFNAR1 [interferon (alpha, beta, and omega) receptor 1], IFNAR2 [interferon (alpha, beta, and omega) receptor 2], IFNB1 [in Terferon, beta 1, fibroblast], IFNG [interferon, gamma], IFNGR1 [interferon gamma receptor 1], IFNGR2 [interferon gamma receptor 2 (interferon gamma transfer factor 1)], IGF1 [insulin-like growth factor 1 ( Somatomedin C)], IGF1R [insulin-like growth factor 1 receptor], IGF2 [insulin-like growth factor 2 (somatomedin A)], IGF2R [insulin-like growth factor 2 receptor], IGFBP1 [insulin-like growth factor binding protein 1] , IGFBP2 [insulin-like growth factor binding protein 2, 36 kDa], IGFBP3 [insulin-like growth factor binding protein 3], IGFBP4 [insulin-like growth factor binding protein 4], IGFBP5 [insulin-like growth factor] Compound 5], IGHA1 [immunoglobulin heavy constant alpha 1], IGHE [immunoglobulin heavy constant epsilon], IGHG1 [immunoglobulin heavy constant gamma 1 (G1m marker)], IGHG3 [immunoglobulin heavy constant gamma 3 (G3m marker) ], IGHG4 [immunoglobulin heavy constant gamma 4 (G4m marker)], IGHM [immunoglobulin heavy constant mu], IGHMBP2 [immunoglobulin mu binding protein 2], IGKC [immunoglobulin kappa constant], IGKV2D-29 [immunoglobulin kappa Variable 2D-29], IGLL1 [immunoglobulin lambda-like polypeptide 1], IGSF1 [immunoglobulin superfamily, member 1], IKBKAP [inhibition of kappa light polypeptide gene enhancer in B cells Child, kinase complex-related protein], IKBKB [inhibitor of kappa light polypeptide gene enhancer in B cells, kinase beta], IKBKE [inhibitor of kappa light polypeptide gene enhancer in B cells, kinase epsilon], IKBKG [ Inhibitor of kappa light polypeptide gene enhancer in B cells, kinase gamma], IKZF1 [Icarus family zinc finger 1 (Icarus)], IKZF2 [Icarus family zinc finger 2 (Helios)], IL10 [Interleukin 10], IL10RA [ Interleukin 10 receptor, alpha], IL10RB [interleukin 10 receptor, beta], IL11 [interleukin 11], IL12A [interleukin 12A (natural key) Lull cell stimulating factor 1, cytotoxic lymphocyte maturation factor 1, p35)], IL12B [interleukin 12B (natural killer cell stimulating factor 2, cytotoxic lymphocyte maturation factor 2, p40)], IL12RB1 [inter Leukin 12 receptor, beta 1], IL12RB2 [interleukin 12 receptor, beta 2], IL13 [interleukin 13], IL13RA1 [interleukin 13 receptor, alpha 1], IL13RA2 [interleukin 13 receptor, alpha 2 IL15 [interleukin 15], IL15RA [interleukin 15 receptor, alpha], IL16 [interleukin 16 (lymphocyte chemoattractant factor)], IL17A [interleukin 17A], IL17F [interleukin 17F], I 17RA [interleukin 17 receptor A], IL17RB [interleukin 17 receptor B], IL17RC [interleukin 17 receptor C], IL18 [interleukin 18 (interferon-gamma inducer)], IL18BP [interleukin 18 binding] Protein], IL18R1 [interleukin 18 receptor 1], IL18RAP [interleukin 18 receptor accessory protein], IL19 [interleukin 19], IL1A [interleukin 1, alpha], IL1B [interleukin 1, beta], IL1F9 [Interleukin 1 family, member 9], IL1R1 [interleukin 1 receptor, type I], IL1RAP [interleukin 1 receptor accessory protein], IL1RL1 Interleukin 1 receptor-like 1], IL1RN [interleukin 1 receptor antagonist], IL2 [interleukin 2], IL20 [interleukin 20], IL21 [interleukin 21], IL21R [interleukin 21 receptor], IL22 [Interleukin 22], IL23A [interleukin 23, alpha subunit p19], IL23R [interleukin 23 receptor], IL24 [interleukin 24], IL25 [interleukin 25], IL26 [interleukin 26], IL27 [ Interleukin 27], IL27RA [interleukin 27 receptor, alpha], IL29 [interleukin 29 (interferon, lambda 1)], IL2RA [interleukin 2 receptor, alpha ], IL2RB [interleukin 2 receptor, beta], IL2RG [interleukin 2 receptor, gamma (severe combined immunodeficiency)], IL3 [interleukin 3 (colony stimulating factor, multiple)], IL31 [interleukin 31 ], IL32 [interleukin 32], IL33 [interleukin 33], IL3RA [interleukin 3 receptor, alpha (low affinity)], IL4 [interleukin 4], IL4R [interleukin 4 receptor], IL5 [ Interleukin 5 (colony stimulating factor, eosinophil)], IL5RA [interleukin 5 receptor, alpha], IL6 [interleukin 6 (interferon, beta 2)], IL6R [interleukin 6 receptor], IL6ST [inter Leukine 6 signaling factor (g 130, Oncostatin M receptor)], IL7 [interleukin 7], IL7R [interleukin 7 receptor], IL8 [interleukin 8], IL9 [interleukin 9], IL9R [interleukin 9 receptor], ILK [Integrin-binding kinase], IMP5 [intramembrane protease 5], INCENP [inner centromere protein antigen 135/155 kDa], ING1 [growth family inhibitor, member 1], INHA [inhibin, alpha], INHBA [inhibin, beta A ], INPP4A [inositol polyphosphate-4-phosphatase, type I, 107 kDa], INPP5D [inositol polyphosphate-5-phosphatase, 145 kDa], INPP5E [inositol polyphosphate-5-phosphine] Enzyme, 72 kDa], INPPL1 [inositol polyphosphate phosphatase-like 1], INS [insulin], INSL3 [insulin-like 3 (Leydig cells)], INSR [insulin receptor], IPO13 [importin 13], IPO7 [importin 7] IQGAP1 [IQ motif-containing GTPase activating protein 1], IRAK1 [interleukin-1 receptor-related kinase 1], IRAK3 [interleukin-1 receptor-related kinase 3], IRAK4 [interleukin-1 receptor-related kinase 4] ], IRF1 [interferon regulator 1], IRF2 [interferon regulator 2], IRF3 [interferon regulator 3], IRF4 [interferon regulator 4], IRF5 [interferon regulator] Factor 5], IRF7 [interferon regulatory factor 7], IRF8 [interferon regulatory factor 8], IRGM [immunity-related GTPase family, M], IRS1 [insulin receptor substrate 1], IRS2 [insulin receptor substrate 2], IRS4 [Insulin receptor substrate 4], ISG15 [ISG15 ubiquitin-like modifier], ITCH [itchy E3 ubiquitin protein ligase homologue (mouse)], ITFG1 [integrin alpha FG-GAP repeat-containing 1], ITGA1 [integrin, Alpha1], ITGA2 [integrin, alpha2 (CD49B, alpha2 subunit of VLA-2 receptor)], ITGA2B [integrin, alpha2b (IIb / IIIa complex platelet glycoprotein IIb) Antigen CD41)], ITGA3 [integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)], ITGA4 [integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)] ITGA5 [integrin, alpha5 (fibronectin receptor, alpha polypeptide)], ITGA6 [integrin, alpha6], ITGA8 [integrin, alpha8], ITGAE [integrin, alphaE (antigen CD103, human mucosal lymphocyte antigen 1) , Alpha polypeptide)], ITGAL [integrin, alpha L (antigen CD11A (p180), lymphocyte function-related antigen 1, alpha polypeptide)], ITGAM [integrin, alpha M (complement component 3 receptor Subunit)], ITGAV [integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)], ITGAX [integrin, alpha X (complement component 3 receptor 4 subunit)], ITGB1 [integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)], ITGB2 [integrin, beta 2 (complement component 3 receptors 3 and 4 subunits)], ITGB3 [integrin, beta 3 ( Platelet glycoprotein IIIa, antigen CD61)], ITGB3BP [integrin beta3-binding protein (beta3-endonexin)], ITGB4 [integrin, beta4], ITGB6 [integrin, beta6], ITGB7 [integrate Phosphorus, beta 7], ITIH4 [inter-alpha (globulin) inhibitor H4 (plasma kallikrein sensitive glycoprotein)], ITK [IL2-inducible T cell kinase], ITLN1 [intellectin 1 (galactofuranose binding)], ITLN2 [ Intelctin 2]
ITPA [Inosine triphosphatase (nucleoside triphosphate pyrophosphatase)], ITPR1 [Inositol 1,4,5-triphosphate receptor, type 1], ITPR3 [Inositol 1,4,5-triphosphate receptor, Type 3], IVD [isovaleryl coenzyme A dehydrogenase], IVL [involucrin], IVNS1ABP [influenza virus NS1A binding protein], JAG1 [Jagid 1 (Alagille syndrome)], JAK1 [Janus kinase 1], JAK2 [Janus kinase 2] , JAK3 [Janus kinase 3], JAKMIP1 [Janus kinase and microtubule interacting protein 1], JMJD6 [cross-letter domain-containing 6], JPH4 [junctophilin 4], JRKL [Jerky homologue like (mouse)], JUN [ j n oncogene], JUND [junD proto-oncogene], JUP [junction placoglobin], KARS [lysyl-tRNA synthetase], KAT5 [K (lysine) acetyltransferase 5], KCNA2 [potassium voltage-gated channel, shaker-related Subfamily, member 2], KCNA5 [potassium voltage-gated channel, shaker-related subfamily, member 5], KCND1 [potassium voltage-gated channel, Shal-related subfamily, member 1], KCNH2 [potassium voltage-gated channel Channel, subfamily H (eag related), member 2], KCNIP4 [Kv channel interacting protein 4], KCNMA1 [potassium large conductance calcium activation channel, subfamily M, alpha member 1], KCNMB1 [potassium large conductance calcium activation channel, subfamily M, beta member 1], KCNN3 [potassium intermediate / small conductance calcium activation channel, subfamily N, member 3], KCNS3 [potassium Voltage-gated channel, delayed rectification type, subfamily S, member 3], KDR [kinase insertion domain receptor (type III receptor tyrosine kinase)], KHDRBS1 [KH domain containing, RNA binding, signal transduction related 1], KHDRBS3 [KH domain containing, RNA binding, signal transduction related 3], KIAA0101 [KIAA0101], KIF16B [kinesin family member 16B], KIF20B [kinesin family member 20B], K IF21B [kinesin family member 21B], KIF22 [kinesin family member 22], KIF2B [kinesin family member 2B], KIF2C [kinesin family member 2C], KIR2DL1 [killer cell immunoglobulin-like receptor, two domains, cytoplasmic long tail, 1 ], KIR2DL2 [killer cell immunoglobulin-like receptor, two domains, cytoplasmic long tail, 2], KIR2DL3 [killer cell immunoglobulin-like receptor, two domains, cytoplasmic long tail, 3], KIR2DL5A [killer cell immunoglobulin-like receptor Body, two domains, cytoplasmic long tail, 5A], KIR2DS1 [killer cell immunoglobulin-like receptor, two domains, cytoplasmic short tail, 1], KIR2DS2 [killer cell immunoglobulin-like receptor, two Main, cytoplasmic short tail, 2], KIR2DS5 [killer cell immunoglobulin-like receptor, two domains, cytoplasmic short tail, 5], KIR3DL1 [killer cell immunoglobulin-like receptor, three domains, cytoplasmic long tail, 1], KIR3DS1 [killer cell immunoglobulin-like receptor, 3 domains, cytoplasmic short tail, 1], KISS1 [KiSS-1 metastasis suppression], KISS1R [KISS1 receptor], KIT [v-kit Hardy-Zuckerman 4 feline sarcoma virus carcinogenesis Gene homologue], KITLG [KIT ligand], KLF2 [Kruppel-like factor 2 (lung)], KLF4 [Kruppel-like factor 4 (intestine)], KLK1 [kallikrein 1], KLK11 [kallikrein-related peptidase 11], KLK3 [kallikrein] Related peptidase 3], KLKB1 [ Recrein B, plasma (Fletcher factor) 1], KLRB1 [killer cell lectin-like receptor subfamily B, member 1], KLRC1 [killer cell lectin-like receptor subfamily C, member 1], KLRD1 [killer cell lectin-like receptor Body subfamily D, member 1], KLRK1 [killer cell lectin-like receptor subfamily K, member 1], KNG1 [kininogen 1], KPNA1 [karyoferrin alpha 1 (importin alpha 5)], KPNA2 [karyoferrin alpha] 2 (RAG cohort 1, importin alpha 1)], KPNB1 [cariopherin (importin) beta 1], KRAS [v-Ki-ras2 casten rat sarcoma virus oncogene homologue], KRT1 [keratin 1], KRT10 [ Keratin 10], KRT13 [keratin 13], KRT14 [keratin 14], KRT16 [keratin 16], KRT18 [keratin 18], KRT19 [keratin 19], KRT20 [keratin 20], KRT5 [keratin 5], KRT7 [keratin 7 ], KRT8 [keratin 8], KRT9 [keratin 9], KRTAP19-3 [keratin-related protein 19-3], KRTAP2-1, keratin-related protein 2-1], L1CAM [L1 cell adhesion molecule], LACTB [lactamase, Beta], LAG3 [Lymphocyte-Activating Gene 3], LALBA [Lactalbumin, Alpha-], LAMA1 [Laminin, Alpha1], LAMA2 [Laminin, Alpha2], LAMA3 [Laminin, Alpha3], LAMA4 [Laminin A Fa4], LAMB1 [Laminin, Beta1], LAMB2 [Laminin, Beta2 (Laminin S)], LAMB3 [Laminin, Beta3], LAMC1 [Laminin, Gamma1 (former LAMB2)], LAMC2 [Laminin, Gamma2] ], LAMP1 [lysosome-related membrane protein 1], LAMP2 [lysosome-related membrane protein 2], LAMP3 [lysosome-related membrane protein 3], LAP3 [leucine aminopeptidase 3], LAPTM4A [lysosomal protein transmembrane 4 alpha], LAT [T Linker for cell activation], LBP [lipopolysaccharide binding protein], LBR [lamin B receptor], LBXCOR1 [Lbxcor1 homologue (mouse)], LCAT [lecithin-cholesterol acyltransferase], LCK [Li Lymphocyte specific protein tyrosine kinase], LCN1 [lipocalin 1 (tear prealbumin)], LCN2 [lipocalin 2], LCP1 [lymphocyte cytosolic protein 1 (L-plastin)], LCT [lactase], LDLR [low density Lipoprotein receptor], LDLRAP1 [low density lipoprotein receptor adapter protein 1], LECT2 [leukocyte cell-derived chemotaxin 2], LELP1 [late keratinocyte-like proline rich 1], LEMD3 [LEM domain containing 3], LEP [ Leptin], LEPR [leptin receptor], LGALS1 [lectin, galactoside binding, soluble, 1], LGALS3 [lectin, galactoside binding, soluble, 3], LGALS3BP [lectin, galactoside binding, soluble, 3-binding protein], LG ALS4 [lectin, galactoside bond, soluble, 4], LGALS9 [lectin, galactoside bond, soluble, 9], LGALS9B [lectin, galactoside bond, soluble, 9B], LGR4 [leucine rich repeat-containing G protein-coupled receptor 4], LHCGR [Luteinizing hormone / coriogonadotropin receptor], LIF [Leukemia inhibitory factor (cholinergic differentiation factor)], LIFR [Leukemia inhibitory factor receptor alpha], LIG1 [Ligase I, DNA, ATP dependent], LIG3 [Ligase III, DNA, ATP dependent], LIG4 [Ligase IV, DNA, ATP dependent], LILRA3 [Leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3], LILRB4 [ Leukocyte immunoglobulin-like Receptor, subfamily B (with TM and ITIM domains), member 4], LIMS1 [LI and senescent cell antigen-like domain 1], LIPA [lipase A, lysosomal acid, cholesterol esterase], LIPC [lipase, liver], LIPE [lipase, hormone sensitivity], LIPG [lipase, endothelium], LMAN1 [lectin, mannose binding, 1], LMNLN [leishmanolidine-like (metallopeptidase M8 family)], LMNA [lamin A / C], LMNB1 [lamin B1], LMNB2 [lamin B2], LOC646627 [phospholipase inhibitor], LOX [lysyl oxidase], LOXHD1 [lipoxygenase homology domain 1], LOXL1 [lysyl oxidase-like 1], LPA [lipoprotein Lp (a)], LPAR3 [lysophosphatidic acid receptor 3], LPCAT2 [lysophosphatidylcholine acyltransferase 2], LPL [lipoprotein lipase], LPO [lactoperoxidase], LPP [LIM domain-containing preferential translocation partner in Lipoma] , LRBA [LPS responsive vesicle transport, beach and anchor containing], LRP1 [low density lipoprotein receptor related protein 1], LRP6 [low density lipoprotein receptor related protein 6], LRPAP1 [low density lipoprotein receptor Related protein related protein 1], LRRC32 [containing leucine rich repeat 32], LRRC37B [containing leucine rich repeat 37B], LRRC8A [8 family containing leucine rich repeat, member A], LRRK2 [leucine-rich repeat kinase 2], LRTOMT [containing leucine-rich transmembrane and 0-methyltransferase domain], LSM1 [LSM1 homologue, U6 micronuclear RNA associated (budding yeast)], LSM2 [LSM2 homologue, U6 micronuclear RNA-related (budding yeast)], LSP1 [lymphocyte-specific protein 1], LTA [lymphotoxin alpha (TNF superfamily, member 1)], LTA4H [leukotriene A4 hydrolase], LTB [lymphotoxin beta (TNF superfamily, member 3)], LTB4R [leukotriene B4 receptor], LTB4R2 [leukotriene B4 receptor 2], LTBR [lymphotoxin beta receptor (TNFR superfamily, member 3)], LTC4S [Leukotriene C4 synthase], LTF [lactotransferrin], LY86 [lymphocyte antigen 86], LY9 [lymphocyte antigen 9], LYN [v-yes-1 oncogenic gene homologue of Yamaguchi sarcoma virus], LYRM4 [LYR motif-containing 4], LYST [lysosome transport regulator], LYZ [lysozyme (renal amyloidosis)], LYZL6 [lysozyme-like 6], LZTR1 [leucine-zipper-like transcription regulator 1], M6PR [mannose-6-phosphate receptor (negative) Ion dependent)], MAGCAM1 [mucosal vascular addressin cell adhesion molecule 1], MAF [v-maf muscle aponeurosis fibrosarcoma oncogene homologue (bird)], MAG [myelin-related glycoprotein], MAN2A1 [mannosidase, alpha , Class 2A, member 1], M N2B1 [mannosidase, alpha, class 2B, member 1], MANBA [mannosidase, beta A, lysosome], MANF [midbrain astrocyte-derived neurotrophic factor], MAOB [monoamine oxidase B], MAP2 [microtubule-related protein 2 ], MAP2K1 [mitogen-activated protein kinase kinase 1], MAP2K2 [mitogen-activated protein kinase kinase 2], MAP2K3 [mitogen-activated protein kinase kinase 3], MAP2K4 [mitogen-activated protein kinase kinase 4], MAP3K1 [mitogenic activity Protein kinase kinase kinase 1], MAP3K11 [mitogenic activated protein kinase kinase kinase 11], MAP3K14 [mitogenic activated protein Park protein kinase kinase kinase 14], MAP3K5 [Maitozen activated protein kinase kinase kinase 5], MAP3K7 [Maitozen activated protein kinase kinase kinase 7], MAP3K9 [Maitozen activated protein kinase kinase kinase
Z9], MAPK1 [mitogen-activated protein kinase 1], MAPK10 [mitogen-activated protein kinase 10], MAPK11 [mitogen-activated protein kinase 11], MAPK12 [mitogen-activated protein kinase 12], MAPK13 [mitogen-activated protein] Kinase 13], MAPK14 [mitogen-activated protein kinase 14], MAPK3 [mitogen-activated protein kinase 3], MAPK8 [mitogen-activated protein kinase 8], MAPK9 [mitogen-activated protein kinase 9], MAPKAP1 [mitogen-activated protein] Kinase-related protein 1], MAPKAPK2 [mitogen-activated protein kinase-activated protein kinase 2], MAPKAPK5 [ Itozen-activated protein kinase activated protein kinase 5], MAPT [microtubule-related protein tau], MARCKS [myristoylated alanine rich protein kinase C substrate], MASP2 [mannan-binding lectin serine peptidase 2], MATN1 [matrilin 1, cartilage matrix Protein], MAVS [mitochondrial antiviral signaling protein], MB [myoglobin], MBD2 [methyl-CpG binding domain protein 2], MBL2 [mannose binding lectin (protein C) 2, soluble (opsonin defect)], MBP [myelin] Basic protein], MBTPS2 [membrane-bound transcription factor peptidase, site 2], MC2R [melanocortin 2 receptor (adrenocorticotropic hormone)], MC3R [melanocor 3 receptor], MC4R [melanocortin 4 receptor], MCCC2 [methylcrotonoyl-coenzyme A carboxylase 2 (beta)], MCHR1 [melanin-concentrating hormone receptor 1], MCL1 [bone marrow cell leukemia sequence 1 (BCL2-related) )], MCM2 [minichromosome maintenance complex component 2], MCM4 [minichromosome maintenance complex component 4], MCOLN1 [mucolipin 1], MCPH1 [microcephalin 1], MDC1 [DNA damage checkpoint mediator 1 ], MDH2 [malate dehydrogenase 2, NAD (mitochondrion)], MDM2 [Mdm2 p53 binding protein homologue (mouse)], ME2 [malate enzyme 2, NAD (+) dependent, mitochondria], MECOM [MDS1 and EVI1 Complex locus], ED1 [mediator complex subunit 1], MED12 [mediator complex subunit 12], MED15 [mediator complex subunit 15], MED28 [mediator complex subunit 28], MEFV [Mediterranean fever], MEN1 [polyendocrine Gland tumor I], MEPE [matrix extracellular phosphoglycoprotein], MERTK [c-mer proto-oncogene tyrosine kinase], MESP2 [posterior mesoderm 2 homologue (mouse)], MET [met proto-oncogene (liver) Cell growth factor receptor)], MGAM [maltase-glucoamylase (alpha-glucosidase)], MGAT1 [mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase], MGAT2 [Man Nosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase], MGLL [monoglyceride lipase], MGMT [O-6-methylguanine-DNA methyltransferase], MGST2 [microsomes] Glutathione S-transferase 2], MICA [MHC class I polypeptide-related sequence A], MICB [MHC class I polypeptide-related sequence B], MIF [macrophage migration inhibitory factor (glycosylation inhibitory factor)], MKI67 [monoclonal antibody Antigens Ki-67], MKS1 [Meckel syndrome, type 1], MLH1 [mutL homologue 1, colon cancer, nonpolyp type 2 (E. coli)], MLL [myeloid / lymphoid or mixed leukemia] (Trisolax homology , Drosophila)], MLLT4 [Myeloid / lymphoid or mixed leukemia (Trisolax homologue, Drosophila), translocated to it, 4], MLN [Motilin], MLXIPL [MLX interacting protein-like], MMAA [ Methylmalonic aciduria (cobalamin deficiency) cblA type], MMAB [methylmalonic aciduria (cobalamin deficiency) cblB type], MMACHC [methylmalonic aciduria (cobalamin deficiency) cblC type, with homocysteineuria], MME [membrane metallo-endopeptidase], MMP1 [matrix metallopeptidase 1 (interstitial collagenase)], MMP10 [matrix metallopeptidase 10 (stromelysin 2)], MMP12 [matrix metallopeptidase 12 (macrophaselase) MMP13 [Matrix metallopeptidase 13 (collagenase 3)], MMP14 [Matrix metallopeptidase 14 (membrane insertion type)], MMP15 [Matrix metallopeptidase 15 (membrane insertion type)], MMP17 [Matrix metallopeptidase 17 (membrane insertion type) ], MMP2 [matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV collagenase)], MMP20 [matrix metallopeptidase 20], MMP21 [matrix metallopeptidase 21], MMP28 [matrix metallopeptidase 28], MMP3 [matrix metallopeptidase 3 (stromelysin 1, progelatinase)], MMP7 [matrix metallopeptidase 7 (matrilysine, Uterine)], MMP8 [Matrix metallopeptidase 8 (neutrophil collagenase)], MMP9 [Matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)], MMRN1 [multimerin 1], MNAT1 [three Humanoid (manage a trois) homologue 1, cyclin H associated factor (Xenopus laevis)], MOG [myelin oligodendrocyte glycoprotein], MOGS [mannosyl-oligosaccharide glucosidase], MPG [N-methylpurine-DNA glycosylase] , MPL [myeloproliferative leukemia virus oncogene], MPO [myeloperoxidase], MPZ [zero myelin protein], MR1 [major histocompatibility complex, class I related], RC1 [mannose receptor, C1 type], MRC2 [mannose receptor, C2 type], MRE11A [MRE11 meiotic recombination 11 homolog A (budding yeast)], MRGPRX1 [MAS-related GPR, member X1], MRPL28 [mitochondria Ribosomal protein L28], MRPL40 [mitochondrial ribosomal protein L40], MRPS16 [mitochondrial ribosomal protein 16], MRPS22 [mitochondrial ribosomal protein 22], MS4A1 [membrane spanning 4-domain, subfamily A, member 1], MS4A2 [membrane spanning 4 -Domain, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for it, beta polypeptide)], MS4A3 [membrane spanning 4-domain , Subfamily A, member 3 (hematopoietic cell specific)], MSH2 [mutS homolog 2, colon cancer, non-polyp type 1 (E. coli)], MSH5 [mutS homolog 5 (E. coli)], MSH6 [mutS homologue] Body 6 (E. coli)], MSLN [mesoterin], MSN [moesin], MSR1 [macrophage scavenger receptor 1], MST1 [macrophage stimulation 1 (hepatocyte growth factor-like)], MST1R [macrophage stimulation 1 receptor (c- met-related tyrosine kinase)], MSTN [myostatin], MSX2 [msh homeobox 2], MT2A [metallothionein 2A], MTCH2 [mitochondrial carrier homolog 2 (Caenolabditis elegans)], MT-CO2 [coded by mitochondria] Cytochrome c oxidase I], MTCP1 [mature T cell proliferation 1], MT-CYB [cytochrome b encoded by mitochondria], MTHFD1 [methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase] MTHFR [5 [10-methylenetetrahydrofolate reductase (NADPH)], MTMR14 [myotubularin-related protein 14], MTMR2 [myotubularin-related protein 2], MT-ND1 [NADH dehydrogenase 1 encoded by mitochondria], MT-ND2 [NADH dehydrogenase 2 encoded by mitochondria], MTOR [mechanistic target of rapamycin (serine / threonine kinase)], M R [5-methyltetrahydrofolate-homocysteine methyltransferase], MTRR [5-methyltetrahydrofolate-homocysteine methyltransferase reductase], MTTP [microsomal triglyceride transfer protein], MTX1 [metaxin 1], MUC1 [mucin 1, cell surface Binding type], MUC12 [mucin 12, cell surface binding type], MUC16 [mucin 16, cell surface binding type], MUC19 [mucin 19, oligomer], MUC2 [mucin 2, oligomer mucus / gel formation], MUC3A [mucin 3A , Cell surface binding type], MUC3B [mucin 3B, cell surface binding type], MUC4 [mucin 4, cell surface binding type], MUC5AC [mucin 5AC, oligomer mucus / gel formation], MUC5B [mucin 5B, oligomer Mucus / gel formation], MUC6 [mucin 6, oligomer mucus / gel formation], MUC7 [mucin 7, secretion], MUS81 [MUS81 endonuclease homologue (budding yeast)], MUSK [muscle, skeleton, receptor tyrosine kinase] MUT [methylmalonyl coenzyme A mutase], MVK [mevalonate kinase], MVP [major vault protein], MX1 [myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], MYB [v−] myb myeloblastosis virus oncogene homolog (bird)], MYBPH [myosin binding protein H], MYC [v-myc myelocytosis virus oncogene homolog (bird)], MYCN [v-myc myeloma Virus-related oncogene, derived from neuroblastoma (bird)] MYD88 [myeloid differentiation primary reaction gene (88)], MYH1 [myosin, heavy chain 1, skeletal muscle, adult], MYH10 [myosin, heavy chain 10, non-muscle], MYH11 [myosin, heavy chain 11, smooth muscle] MYH14 [myosin, heavy chain 14, non-muscle], MYH2 [myosin, heavy chain 2, skeletal muscle, adult], MYH3 [myosin, heavy chain 3, skeletal muscle, embryonic], MYH6 [myosin, heavy chain 6, Myocardium, alpha], MYH7 [myosin, heavy chain 7, myocardium, beta], MYH8 [myosin, heavy chain 8, skeletal muscle, perinatal period], MYH9 [myosin, heavy chain 9, non-muscle], MYL2 [myosin, light chain 2, control, heart, slow muscle type], MYL3 [myosin, light chain 3, alkali, ventricular, skeletal, slow muscle type], MYL7 [myosin, light chain 7, control], MYL9 [myosin, light chain 9, control] MYLK [myosin light chain kinase], MYO15A [myosin XVA], MYO1A [myosin IA], MYO1F [myosin IF], MYO3A [myosin IIIA], MYO5A [myosin VA (heavy chain 12, myoxin [myoxin]), MYO6 Myosin VI], MYO7A [myosin VIIA], MYO9B [myosin IXB], MYOC [myosillin, trabecular meshwork-induced glucocorticoid reaction], MYOD1 [myogenic differentiation 1], MYOM2 [myomesin (M-protein) 2, 165 kDa], MYST1 [MYST histone acetyltransferase 1], MYST2 [MYST histone acetyltransferase 2], MYST3 [MYST histone acetyltransferase (mononuclear leukemia) 3], MYST4 [MYST histone acetyltransferase (mononuclear leukemia) 4], NAGA [N-acetylgalactosaminidase, alpha-], NAGLU [N-acetylglucosaminidase, alpha-], NAMPT [nicotinamide phosphoribosyltransferase]
NANOG [Nanog homeobox], Nanos 1 [Nanos homolog 1 (Drosophila)], NAPA [N-ethylmaleimide sensitive factor binding protein, alpha], NAT1 [N-acetyltransferase 1 (Arylamine N-acetyltransferase)], NAT2 [N-acetyltransferase 2 (arylamine N-acetyltransferase)], NAT9 [N-acetyltransferase 9 (GCN5-related, presumed)], NBEA [Neulobatin], NBN [Niblin], NCAM1 [Neuron cell adhesion molecule 1], NCF1 [neutrophil cytosolic factor 1], NCF2 [neutrophil cytosolic factor 2], NCF4 [neutrophil cytosolic factor 4, 40 kDa], NCK1 [ NCK Adapt -Protein 1], NCL [nucleolin], NCOA1 [nuclear receptor coactivator 1], NCOA2 [nuclear receptor coactivator 2], NCOR1 [nuclear receptor coactivator 1], NCR3 [natural cell injury Induced receptor 3], NDUFA13 [NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13], NDUFAB1 [NADH dehydrogenase (ubiquinone) 1, alpha / beta subcomplex, 1, 8 kDa], NDUFAF2 [NADH dehydrogenase (ubiquinone) 1 alpha Subcomplex, association factor 2], NEDD4 [neural precursor cell expression, developmentally down-regulated 4], NEFL [neurofilament, light polypeptide], NEFM [neurofilament, medium polypeptide], N GR1 [neural growth regulator 1], NEK6 [NIMA (never in mitosis gene a) -related kinase 6], NELF [nasal embryonic LHRH factor], NELL1 [NEL-like 1 (chicken)] ], NES [nestin], NEU1 [sialidase 1 (lysosomal sialidase)], neuro D1 [neurogenic differentiation 1], NF1 [neurofibromin 1], NF2 [neurofibromin 2 (merlin)], NFAT5 [activation T cell nuclear factor 5, tension responsiveness], NFATC1 [activated T cell nuclear factor, cytoplasm, calcineurin dependent 1], NFATC2 [activated T cell nuclear factor, cytoplasm, calcineurin dependent 2], NFATC4 [ Nuclear factor of activated T cells, cytoplasm, calcineurin dependence 4], FE2L2 [nuclear factor (red blood cell derived 2) -like 2], NFKB1 [kappa light polypeptide gene enhancer nuclear factor 1 in B cells], NFKB2 [kappa light polypeptide gene enhancer nuclear factor 2 in B cells (p49 / p100) ], NFKBIA [nuclear factor inhibitor of kappa light polypeptide gene enhancer in B cells, alpha], NFKBIB [nuclear factor inhibitor of kappa light polypeptide gene enhancer in B cells, beta], NFKBIL1 [kappa light poly in B cells Peptide gene enhancer nuclear factor inhibitory factor-like 1], NFU1 [NFU1 iron-sulfur cluster scaffold homologue (budding yeast)], NGF [nerve growth factor (beta polypeptide)], NGFR [nerve growth factor receptor (TNFR super) family Member 16)], NHEJ1 [non-homologous end joining factor 1], NID1 [nitrogen 1], NKAP [NFkB activating protein], NKX2-1, NK2 homeobox 1], NKX2-3 [NK2 transcription factor-related, gene locus 3 (Drosophila)], NLRP3 [NLR family, pyrin domain-containing 3], NMB [neuromedin B], NME1 [non-metastatic cell 1, protein (NM23A) expression therein], NME2 [non-metastatic cell 2, protein in it ( NM23B) expression], NMU [neuromedin U], NNAT [neuronatin], NOD1 [nucleotide binding oligomerization domain containing 1], NOD2 [nucleotide binding oligomerization domain containing 2], NONO [non-POU domain containing, octamer binding], NOS1 [Nitric oxide synthase 1 (neural type)], NOS2 [Nitric oxide synthase 2, inducible], NOS3 [Nitric oxide synthase 3 (endothelial cells)], NOTCH1 [Notch homologue 1, translocation-related (Drosophila)] , NOTCH2 [Notch homolog 2 (Drosophila)], NOTCH3 [Notch homolog 3 (Drosophila)], NOTCH4 [Notch homolog 4 (Drosophila)], NOX1 [NADPH oxidase 1], NOX3 [NADPH oxidase 3], NOX4 [ NADPH oxidase 4], NOX5 [NADPH oxidase, EF hand calcium binding domain 5], NPAT [nucleoprotein, vasodilator ataxia locus], NPC1 [Niemann-Pick disease, type C1], NPC1L1 [NPC1 (Niemann- Pi Kuh disease, C1 type, gene) -like 1], NPC2 [Niemann-Pick disease, type C2], NPHP1 [medullary cyst kidney 1 (juvenile)], NPHS1 [nephropathy 1, congenital, Finnish type (nephrin) ], NPHS2 [nephropathy 2, idiopathic, steroid resistance (podosin)], NPLOC4 [nucleoprotein localization 4 homologue (budding yeast)], NPM1 [nucleophosmin (nucleolar phosphate protein B23, numatrine) ], NPPA [Natriuretic peptide precursor A], NPPB [Natriuretic peptide precursor B], NPPC [Natriuretic peptide precursor C], NPR1 [Natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic A) Peptide receptor A)], NPR3 [natriuretic peptide receptor C / guanylate cyclase C (heart Natriuretic peptide receptor C)], NPS [neuropeptide S], NPSR1 [neuropeptide S receptor 1], NPY [neuropeptide Y], NPY2R [neuropeptide Y receptor Y2], NQO1 [NAD (P) H dehydrogenase, quinone 1], NR0B1 [nuclear receptor subfamily 0, group B, member 1], NR1H2 [nuclear receptor subfamily 1, group H, member 2], NR1H3 [nuclear receptor subfamily 1, group H] , Member 3], NR1H4 [nuclear receptor subfamily 1, group H, member 4], NR1I2 [nuclear receptor subfamily 1, group I, member 2], NR1I3 [nuclear receptor subfamily 1, group I, member 3], NR2F2 [nuclear receptor subfamily 2, group F, member 2], NR3C1 [nuclear receptor subfamily 3, Group C, member 1 (glucocorticoid receptor)], NR3C2 [nuclear receptor subfamily 3, group C, member 2], NR4A1 [nuclear receptor subfamily 4, group A, member 1], NR4A3 [nuclear receptor] Body subfamily 4, group A, member 3], NR5A1 [nuclear receptor subfamily 5, group A, member 1], NRF1 [nuclear respiratory factor 1], NRG1 [neuregulin 1], NRIP1 [nuclear receptor interaction] Protein 1], NRIP2 [nuclear receptor interacting protein 2], NRP1 [neuropilin 1], NSD1 [nuclear receptor binding SET domain protein 1], NSDHL [NAD (P) -dependent steroid dehydrogenase-like], NSF [N -Ethylmaleimide sensitive factor], NT5E [5'-nucleotidase, ecto (CD73)], NT AN1 [N-terminal asparagine amidase], NTF3 [neurotrophin 3], NTF4 [neurotrophin 4], NTN1 [netrin 1], NTRK1 [neurotrophic tyrosine kinase, receptor, type 1], NTRK2 [neurotrophic] Tyrosine kinase, receptor, type 2], NTRK3 [neurotrophic tyrosine kinase, receptor, type 3], NTS [neurotensin], NUCB2 [nucleobindin 2], NUDT1 [nudix (nucleoside diphosphate binding) Part X) type motif 1], NUDT2 [Nudix (nucleoside diphosphate binding part X) type motif 2], NUDT6 [Nudix (nucleoside diphosphate binding part X) type motif 6], NUFIP2 [nuclear vulnerability X mental retardation protein interacting protein 2], N P98 [nucleoporin 98 kDa], NXF1 [nuclear RNA export factor 1], OCA2 [oculocutaneous albinism II], OCLN [Occludin], ODC1 [ornithine decarboxylase 1], OFD1 [mouth-face-finger syndrome 1], OGDH [Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)], OGG1 [8-oxoguanine DNA glycosylase], OGT [O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine: polypeptide-N- Acetylglucosaminyltransferase)], OLR1 [oxidized low density lipoprotein (lectin-like) receptor 1], OMP [olfactory marker protein], ONECUT2 [one-cut homeobox 2], OPN3 Opsin 3], OPRK1 [opioid receptor, kappa 1], OPRM1 [opioid receptor, mu1], OPTN [optineurin], OR2B11 [olfactory receptor, family 2, subfamily B, member 11], OMDL3 [ORM1 Like 3 (budding yeast)], OSBP [oxysterol-binding protein], OSGIN2 [oxidative stress-induced growth inhibitor family member 2], OSM [oncostatin M], OTC [ornithine carbamoyltransferase], OTOP2 [otopetrin 2], OTOP3 [Otopetrin 3], OTUD1 [OTU domain-containing 1], OXA1L [oxidase (cytochrome c) associated 1-like], OXER1 [oxoeicosanoid (OXE) receptor 1], OXT [oxytocin, prep B-peptide], OXTR [oxytocin receptor], P2RX7 [purinergic receptor P2X, ligand-sensitive ion channel, 7], P2RY1 [purinergic receptor P2Y, G-protein binding, 1], P2RY12 [purinergic receptor P2Y, G-protein binding, 12], P2RY14 [purinergic receptor P2Y, G-protein binding, 14], P2RY2 [purinergic receptor P2Y, G-protein binding, 2], P4HA2 [prolyl 4- Hydroxylase, alpha polypeptide II], P4HB [prolyl 4-hydroxylase, beta polypeptide], P4HTM [prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)], PABPC1 [poly (A) binding protein, cytoplasm 1] , PACSIN3 [Tain in neuron Protein kinase C and kazen kinase substrate 3], PAEP [progestagen-related endometrial protein], PAFAH1B1 [platelet activating factor acetylhydrolase 1b, regulatory subunit 1 (45 kDa)], PAH [phenylalanine hydroxylase], PAK1 [ p21 protein (Cdc42 / Rac) activated kinase 1], PAK2 [p21 protein (Cdc42 / Rac) activated kinase 2], PAK3 [p21 protein (Cdc42 / Rac) activated kinase 3], PAM [peptidylglycine alpha-amide Monooxygenase], PAPPA [pregnancy-related plasma protein A, paparicin 1], PARG [poly (ADP-ribose) glycohydrolase], PARK2 [Parkinson's disease (autosomal recessive, juvenile) ) 2, Parkin], PARP1 [poly (ADP-ribose) polymerase 1], PAWR [PRKC, apoptosis, WT1, regulator], PAX2 [pairing box 2], PAX3 [pairing box 3], PAX5 [pairing box 5], PAX6 [pairing box 6], PAXIP1 [PAX interaction (with transcriptional activation domain) protein 1], PC [pyruvate carboxylase], PCCA [propionyl coenzyme A carboxylase, alpha polypeptide], PCCB [ Propionyl coenzyme A carboxylase, beta polypeptide], PCDH1 [protocadherin 1], PCK1 [phosphoenolpyruvate carboxykinase 1 (soluble)], PCM1 [peripheral substance 1], PCNA [proliferating cell nuclear antigen], PC NT [pericentrin], PCSK1 [proprotein convertase subtilisin / kexin type 1], PCSK6 [proprotein convertase subtilisin / kexin type 6], PCSK7 [proprotein convertase subtilisin / kexin type 7], PCYT1
A [phosphate cytidylyltransferase 1, choline, alpha], PCYT2 [phosphate cytidylyltransferase 2, ethanolamine], PDCD1 [programmed cell death 1], PDCD1LG2 [programmed cell death 1 ligand 2], PDCD6 [Programmed cell death 6], PDE3B [phosphodiesterase 3B, cGMP inhibition], PDE4A [phosphodiesterase 4A, cAMP specific (phosphodiesterase E2 dance homologue, Drosophila)], PDE4B [phosphodiesterase 4B, cAMP specific (phosphodiesterase E4 dance) (Dunce) homologue, Drosophila)], PDE4D [phosphodiesterase 4D, cAMP specific (phosphodiesterase E3 dance homology) Drosophila)], PDE7A [phosphodiesterase 7A], PDGFA [platelet-derived growth factor alpha polypeptide], PDGFB [platelet-derived growth factor beta polypeptide (simian sarcoma virus (v-sis) oncogene homolog)], PDGFRA [platelet Derived growth factor receptor, alpha polypeptide], PDGFRB [platelet derived growth factor receptor, beta polypeptide], PDIA2 [protein disulfide isomerase family A, member 2], PDIA3 [protein disulfide isomerase family A, member 3], PDK1 [Pyruvate dehydrogenase kinase, isozyme 1], PDLIM1 [PDZ and LIM domain 1], PDLIM5 [PDZ and LIM domain 5], PDLIM [PDZ and LIM domain 7 (enigma)], PDP1 [pyruvate dehydrogenase phosphatase catalytic subunit 1], PDX1 [pancreas and duodenal homeobox 1], PDXK [pyridoxal (pyridoxine, vitamin B6) kinase], PDYN [prodynorphin ], PECAM1 [platelet / endothelial cell adhesion molecule], PEMT [phosphatidylethanolamine N-methyltransferase], PENK [proenkephalin], PEPD [peptidase D], PER1 [period homolog 1 (Drosophila)], PEX1 [peroxisome production] Synthesis factor 1], PEX10 [peroxisome biosynthesis factor 10], PEX12 [peroxisome biosynthesis factor 12], PEX13 [peroxisome biosynthesis factor 13] PEX14 [peroxisome biosynthesis factor 14], PEX16 [peroxisome biosynthesis factor 16], PEX19 [peroxisome biosynthesis factor 19], PEX2 [peroxisome biosynthesis factor 2], PEX26 [peroxisome biosynthesis factor 26], PEX3 [peroxisome biosynthesis Synthesis factor 3], PEX5 [peroxisome biosynthesis factor 5], PEX6 [peroxisome biosynthesis factor 6], PEX7 [peroxisome biosynthesis factor 7], PF4 [platelet factor 4], PFAS [phosphoribosylformylglycine amidine synthase], PFDN4 [Prefoldin subunit 4], PFN1 [Profilin 1], PGC [Progastrixin (Pepsinogen C)], PGD [Phosphogluconate dehydrogenase], PGF [Placental growth factor ], PGK1 [phosphoglycerate kinase 1], PGM1 [phosphoglucomutase 1], PGR [progesterone receptor], PHB [prohibitin], PHEX [phosphate-regulated endopeptidase homologue, X-linked], PHF11 [PHD finger protein 11], PHOX2B [Pairing-like homeobox 2b], PHTF1 [putative homeodomain transcription factor 1], PHYH [phytanoyl-CoA2-hydroxylase], PHYHIP [phytanoyl-CoA2-hydroxylase interacting protein], PI3 [peptidase inhibition Factor 3, skin-derived], PIGA [phosphatidylinositol glycan anchor biosynthesis, class A], PIGR [polymeric immunoglobulin receptor], PIK3C2A [phosphoinositide-3-kinase, Ras2, alpha polypeptide], PIK3C2B [phosphoinositide-3-kinase, class 2, beta polypeptide], PIK3C2G [phosphoinositide-3-kinase, class 2, gamma polypeptide], PIK3C3 [phosphoinositide-3-kinase, class 3 ], PIK3CA [phosphoinositide-3-kinase, catalyst, alpha polypeptide], PIK3CB [phosphoinositide-3-kinase, catalyst, beta polypeptide], PIK3CD [phosphoinositide-3-kinase, catalyst, delta polypeptide], PIK3CG [phosphoinositide -3-kinase, catalyst, gamma polypeptide], PIK3R1 [phosphoinositide-3-kinase, regulatory subunit 1 (alpha)], PIK3R2 [phosphoinositide-3-ki Kinase, regulatory subunit 2 (beta)], PIK3R3 [phosphoinositide-3-kinase, regulatory subunit 3 (gamma)], PIKFYVE [phosphophosphoinositide kinase, containing FYVE finger], PIN1 [peptidylprolyl cis / trans isomerase, NIMA-interaction 1], PINK1 [PTEN-inducible putative kinase 1], PIP [prolactin-inducible protein], PIP5KL1 [phosphatidylinositol-4-phosphate 5-kinase-like 1], PITPNM1 [phosphatidylinositol transfer protein, membrane Related 1], PITRM1 [Pitrilysin metallopeptidase 1], PITX2 [Pairing-like homeodomain 2], PKD2 [Polycystic kidney disease 2 (autosomal dominant)], PKLR [Pyruvate kinase, liver And RBC], PKM2 [pyruvate kinase, muscle], PKN1 [protein kinase N1], PL-5283 [PL-5283 protein], PLA2G1B [phospholipase A2, group IB (pancreas)], PLA2G2A [phospholipase A2, group IIA ( Platelet, symphrin solution)], PLA2G2D [phospholipase A2, IID group], PLA2G4A [phospholipase A2, IVA group (cytosol, calcium-dependent)], PLA2G6 [phospholipase A2, VI group (cytosol, calcium-independent) ], PLA2G7 [phospholipase A2, group VII (platelet activating factor acetylhydrolase, plasma)], PLA2R1 [phospholipase A2 receptor 1, 180 kDa], PLAT [plasminogen activator, tissue], PL U [plasminogen activator, urokinase], PLAUR [plasminogen activator, urokinase receptor], PLCB1 [phospholipase C, beta1 (phosphoinositide specific)], PLCB2 [phospholipase C, beta2], PLCB4 [phospholipase C, beta4 ], PLCD1 [phospholipase C, delta 1], PLCG1 [phospholipase C, gamma 1], PLCG2 [phospholipase C, gamma 2 (phosphatidylinositol specific)], PLD1 [phospholipase D1, phosphatidylcholine specific], PLEC [p lectin] , PLEK [pleckstrin], PLG [plasminogen], PLIN1 [perilipin 1], PLK1 [Polo-like kinase 1 (Drosophila)], PLK2 [Polo-like kinase 2 (show) Drosophila)], PLK3 [Polo-like kinase 3 (Drosophila)], PLP1 [Proteolipid protein 1], PLTP [phospholipid transfer protein], PMAIP1 [Phorbol-12-myristate-13-acetate-inducible protein 1], PMCH [Pro-melanin-concentrating hormone], PML [promyelocytic leukemia], PMP22 [peripheral myelin protein 22], PMS2 [PMS2 post-meiosis increase 2 (budding yeast)], PNLIP [pancreatic lipase], PNMA3 [tumor associated Disease antigen MA3], PNMT [phenylethanolamine N-methyltransferase], PNP [purine nucleoside phosphorylase], POLB [polymerase (DNA-directed), beta], POLD3 [polymerase (DNA-directed), delta3, access Lee subunit], POLD4 [polymerase (DNA directional), delta 4], POLL [polymerase (DNA directional), eta], POLL [polymerase (DNA directional), lambda], POLR2A [polymerase (RNA) II ( DNA-directed) polypeptide A, 220 kDa], POLR2B [polymerase (RNA) II (DNA-directed) polypeptide B, 140 kDa], POLR2C [polymerase (RNA) II (DNA-directed) polypeptide C, 33 kDa], POLR2D [Polymerase (RNA) II (DNA-directed) polypeptide D], POLR2E [Polymerase (RNA) II (DNA-directed) polypeptide E, 25 kDa], POLR2F [Polymerase (RNA) II (DNA-directed) polypeptide ], POLR2G [polymerase (RNA) II (DNA-directed) polypeptide G], POLR2H [polymerase (RNA) II (DNA-directed) polypeptide H], POLR2I [polymerase (RNA) II (DNA-directed) polypeptide I, 14.5 kDa], POLR2J [Polymerase (RNA) II (DNA-directed) polypeptide J, 13.3 kDa], POLR2K [Polymerase (RNA) II (DNA-directed) polypeptide K, 7.0 kDa], POLR2L [Polymerase (RNA) II (DNA-directed) polypeptide L, 7.6 kDa], POMC [proopiomelanocortin], POMT1 [protein-O-mannosyltransferase 1], PON1 [paraoxonase 1], PON2 [paraoxo Nase 2], PON3 [paraoxonase 3], POSTN [periostin, osteoblast-specific factor], POT1 [protection of telomere 1 homologue POT1 (fission yeast)], POU2AF1 [POU class 2-related factor 1], POU2F1 [ POU class 2 homeobox 1], POU2F2 [POU class 2 homeobox 2], POU5F1 [POU class 5 homeobox 1], PPA1 [pyrophosphatase (inorganic) 1], PPARA [peroxisome proliferator activated receptor alpha] , PPARD [peroxisome proliferator activated receptor delta], PPARG [peroxisome proliferator activated receptor gamma], PPARGC1A [peroxisome proliferator activated receptor gamma, coactivator 1 alpha], PPAT [phospho Ribosyl pylori Acid amide transferase], PPBP [pro-platelet basic protein (chemokine (C—X—C motif) ligand 7)], PPFIA1 [protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (ripin ), Alpha 1], PPIA [peptidylprolyl isomerase A (cyclophilin A)], PPIB [peptidylprolyl isomerase B (cyclophilin B)], PPIG [peptidylprolyl isomerase G (cyclophilin G)], PPOX [protoporphyri Norogen oxidase], PPP1CB [protein phosphatase 1, catalytic subunit, beta isozyme], PPP1R12A [protein phosphatase 1, regulatory (inhibitor) subunit 12A , PPP1R2 [protein phosphatase 1, regulatory (inhibitor) subunit 2], PPP2R1B [protein phosphatase 2, regulatory subunit A, beta], PPP2R2B [protein phosphatase 2, regulatory subunit B, beta], PPP2R4 [protein phosphatase 2A Active factor, regulatory subunit 4], PPP6C [protein phosphatase 6, catalytic subunit], PPT1 [palmitoyl-protein thioesterase 1], PPY [pancreatic polypeptide], PRDM1 [containing PR domain 1, having ZNF domain], PRDM2 [PR domain containing 2, having ZNF domain], PRDX2 [peroxiredoxin 2], PRDX3 [peroxiredoxin 3], PRDX5 [peroxiredoxy 5], PRF1 [perforin 1 (membrane pore forming protein)], PRG2 [proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule main basic protein)], PRG4 [proteoglycan 4], PRIM1 [primase , DNA, polypeptide 1 (
49 kDa)], PRKAA1 [protein kinase, AMP activation, alpha 1 catalytic subunit], PRKAA2 [protein kinase, AMP activation, alpha 2 catalytic subunit], PRKAB1 [protein kinase, AMP activation, beta 1 non-catalytic subunit Unit], PRKACA [protein kinase, cAMP-dependent, catalyst, alpha], PRKACB [protein kinase, cAMP-dependent, catalyst, beta], PRKACG [protein kinase, cAMP-dependent, catalyst, gamma], PRKAR1A [protein kinase, cAMP dependence, regulation, type I, alpha (tissue specific extinction factor 1)], PRKAR2A [protein kinase, cAMP dependence, regulation, type II, alpha], PRKAR B [protein kinase, cAMP-dependent, regulation, type II, beta], PRKCA [protein kinase C, alpha], PRKCB [protein kinase C, beta], PRKCD [protein kinase C, delta], PRKCE [protein kinase C, Epsilon], PRKCG [protein kinase C, gamma], PRKCH [protein kinase C, eta], PRKCI [protein kinase C, iota], PRKCQ [protein kinase C, theta], PRKCZ [protein kinase C, zeta], PRKD1 [ Protein kinase D1], PRKD3 [protein kinase D3], PRKDC [protein kinase, also known as DNA activation, catalytic polypeptide, DNAPK], PRKG1 [protein kinase] , CGMP-dependent, type I], PKRIR [protein-kinase, interferon-inducible double-stranded RNA-dependent inhibitor, its inhibitor (P58 inhibitor)], PRL [prolactin], PRLR [prolactin receptor], PRNP [Prion protein], PROC [protein C (inactivator of coagulation factor Va and factor VIIIa)], PRODH [proline dehydrogenase (oxidase) 1], PROK1 [prokineticin 1], PROK2 [prokineticin 2], PROM1 [prominin] 1], PROS1 [protein (alpha)], PRPH [peripherin], PRSS1 [protease, serine, 1 (trypsin 1)], PRSS2 [protease, serine, 2 (trypsin 2)], PRSS21 [protease, cell Phosphorus, 21 (Testisin)], PRSS3 [Protease, Serine, 3], PRTN3 [Proteinase 3], PSAP [Prosaposin], PSEN1 [Presenilin 1], PSEN2 [Presenilin 2 (Alzheimer's disease 4)], PSMA1 [Proteasome (Prosome) , Macropine) subunit, alpha type, 1], PSMA2 [proteasome (prosome, macropine) subunit, alpha type, 2], PSMA3 [proteasome (prosome, macropine) subunit, alpha type, 3], PSMA5 [Proteasome (prosome, macropine) subunit, alpha type, 5], PSMA6 [proteasome (prosome, macropine) subunit, alpha type, 6], PSMA7 [proteasome Prosome, macropine) subunit, alpha type, 7], PSMB10 [proteasome (prosome, macropine) subunit, beta type, 10], PSMB2 [proteasome (prosome, macropine) subunit, beta type, 2], PSMB4 [proteasome (prosome, macropine) subunit, beta type, 4], PSMB5 [proteasome (prosome, macropine) subunit, beta type, 5], PSMB6 [proteasome (prosome, macropine) subunit, beta type 6], PSMB8 [proteasome (prosome, macropine) subunit, beta type, 8 (large multifunctional peptidase 7)], PSMB9 [proteasome (prosome, macropine) subunit, Type 9 (large multifunctional peptidase 2)], PSMC3 [proteasome (prosome, macropain) 26S subunit, ATPase, 3], PSMC4 [proteasome (prosome, macropain) 26S subunit, ATPase, 4], PSMC6 [Proteasome (Prosome, Macropine) 26S subunit, ATPase, 6], PSMD4 [Proteasome (Prosome, Macropine) 26S subunit, non-ATPase, 4], PSMD9 [Proteasome (Prosome, Macropine) 26S subunit, non ATPase, 9], PSME1 [proteasome (prosome, macropain) activator subunit 1 (PA28alpha)], PSME3 [proteasome (prosome, macropie) ) Activator subunit 3 (PA28 gamma, Ki)], PSMG2 [proteasome (prosome, macropain) -associated chaperone 2], PSORS1C1 [psoriasis sensitive 1 candidate 1], PSTPIP1 [proline-serine-threonine phosphatase interacting protein 1], PTAFR [platelet activating factor receptor], PTBP1 [polypyrimidine tract binding protein 1], PTCH1 [patched homolog 1 (Drosophila)], PTEN [phosphatase and tensin homologue], PTGDR [prostagland Gin D2 receptor (DP)], PTGDS [prostaglandin D2 synthase 21 kDa (brain)], PTGER1 [prostaglandin E receptor 1 (subtype EP1), 42 kDa], PTGER2 [pro Staglandin E receptor 2 (subtype EP2), 53 kDa], PTGER3 [prostaglandin E receptor 3 (subtype EP3)], PTGER4 [prostaglandin E receptor 4 (subtype EP4)], PTGES [prostaglandin Gin E synthase], PTGFR [prostaglandin F receptor (FP)], PTGIR [prostaglandin I2 (prostacyclin) receptor (IP)], PTGS1 [prostaglandin-endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)], PTGS2 [prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)], PTH [parathyroid hormone], PTHLH [parathyroid hormone-like pho] Mon], PTK2 [PTK2 protein tyrosine kinase 2], PTK2B [PTK2B protein tyrosine kinase 2 beta], PTK7 [PTK7 protein tyrosine kinase 7], PTMS [parathymosin], PTN [pleotrophin], PTPN1 [protein tyrosine phosphatase, non- Receptor type 1], PTPN11 [protein tyrosine phosphatase, non-receptor type 11], PTPN12 [protein tyrosine phosphatase, non-receptor type 12], PTPN2 [protein tyrosine phosphatase, non-receptor type 2], PTPN22 [protein tyrosine phosphatase, Non-receptor type 22 (lymphocytes)], PTPN6 [protein tyrosine phosphatase, non-receptor type 6], PTPRC [protein tyrosine phosphatase, Receptor type, C], PTPRD [protein tyrosine phosphatase, receptor type, D], PTPRE [protein tyrosine phosphatase, receptor type, E], PTPRJ [protein tyrosine phosphatase, receptor type, J], PTPRN [protein tyrosine phosphatase, receptor type , N], PTPRT [protein tyrosine phosphatase, receptor type, T], PTPRU [protein tyrosine phosphatase, receptor type, U], PTRF [polymerase I and transcription release factor], PTS [6-pyruvoyltetrahydropterin synthase], PTTG1 [Pituitary tumor-transforming 1], PTX3 [Pentraxin 3, long], PUS10 [Pseudouridate synthase 10], PXK [PX In-containing serine / threonine kinase], PXN [paxillin], PYCR1 [pyrroline-5-carboxylic acid reductase 1], PYCR2 [pyrroline-5-carboxylic acid reductase family, member 2], PYGB [phosphorylase, glycogen, brain], PYGM [Phosphorylase, glycogen, muscle], PYY [peptide YY], PZP [gestational plasma protein], QDPR [quinoid dihydropteridine reductase], RAB11A [RAB11A, member RAS oncogene family], RAB11FIP1 [RAB11 family interacting protein 1 ( Class I)], RAB27A [RAB27A, member RAS oncogene family], RAB37 [RAB37, member RAS oncogene family], RA 39 [RAB39, member RAS oncogene family], RAB7A [RAB7A, member RAS oncogene family], RAB9A [RAB9A, member RAS oncogene family], RAC1 [ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein) Rac1)], RAC2 [ras-related C3 botulinum toxin substrate 2 (rho family, small GTP-binding protein Rac2)], RAD17 [RAD17 homologue (fission yeast)], RAD50 [RAD50 homologue (budding yeast)], RAD51 [RAD51 Homologue (RecA homologue, E. coli) (budding yeast)], RAD51C [RAD51 homologue C (budding yeast)], RAD51L1 [RAD51-like 1 (budding yeast)], RAD51L3 [RAD51-like 3 (budding yeast) Bud yeast)], RAD54L [RAD54-like (budding yeast)], RAD9A [RAD9 homolog A (fission yeast)], RAF1 [v-raf-1 murine leukemia virus oncogene homolog 1], RAG1 [recombination activation Gene 1], RAG2 [recombinant activation gene 2], RAN [RAN, member RAS oncogene family], RANBP1 [RAN binding protein 1], RAP1A [RAP1A, member of RAS oncogene family], RAPEF4 [Rap guanine nucleotide Exchanger (GEF) 4], RARA [retinoic acid receptor, alpha], RARB [retinoic acid receptor, beta], RARG [retinoic acid receptor, gamma], RARRES2 [retinoic acid receptor responder (tazarotene-inducible) 2], RARS [Arginini -TRNA synthetase], RASA1 [RAS p21 protein activator (GTPase activating protein) 1], RASGRP1 [RAS guanyl releasing protein 1 (calcium and DAG regulating)], RASGRP2 [RAS guanyl releasing protein 2 (calcium and DAG regulating) )], RASGRP4 [RAS guanyl releasing protein 4], RASSF1 [Ras association (RalGDS / AF-6) domain family member 1], RB1 [retinoblastoma 1], RBBP4 [retinoblastoma binding protein 4], RBBP8 [Retinoblastoma binding protein 8], RBL1 [retinoblastoma-like 1 (p107)], RBL2 [retinoblastoma-like 2 (p130)], RBP4 [retinol binding protein 4, plasma], RBX1 [ringbo 1], RCBTB1 [Regulator of chromosome condensation (RCC1) and BTB (POZ) domain-containing protein 1], RCN1 [Reticulocarbin 1, EF hand calcium binding domain], RCN2 [Reticulocarbin 2, EF hand calcium binding domain ], RDX [radixin], RECK [reversion-inducing cysteine-rich protein having a casal motif], RECQL [RecQ protein-like (DNA helicase Q1-like)], RECQL4 [RecQ protein-like 4], RECQL5 [RecQ protein-like 5], REG1A [regenerated island-derived 1 alpha], REG3A [regenerated island-derived 3 alpha], REG4 [regenerated island-derived family, member 4], REL [v-rel reticuloendotheliosis virus oncogene homologue (bird) RELA [v-rel reticuloendotheliosis virus oncogene homolog A (bird)], RELB [v-rel reticuloendotheliosis virus oncogene homolog B], REN [renin], RET [ret proto-oncogene ], RETN [resistin], RETNLB [resistin-like beta]
], RFC1 [replication factor C (activation factor 1) 1, 145 kDa], RFC2 [replication factor C (activation factor 1) 2, 40 kDa], RFC3 [replication factor C (activation factor 1) 3, 38 kDa], RFX1 [regulated factor X, 1 (influencing HLA class II expression)], RFX5 [regulated factor X, 5 (influencing HLA class II expression)], RFXANK [regulated factor X-related ankyrin-containing protein], RFXAP [ Regulatory factor X-related protein], RGS18 [regulator of G-protein signaling 18], RHAG [Rh-related glycoprotein], RHD [Rh blood group, D antigen], RHO [rhodopsin], RHOA [ras homolog gene family , Member A], RHOD [ras homologue gene family, member D], RIF1 [RAP1 interaction] Factor homologue (yeast)], RIPK1 [receptor (TNFRSF) -interacting serine-threonine kinase 1], RIPK2 [receptor-interacting serine-threonine kinase 2], RLBP1 [retinaldehyde binding protein 1], RLN1 [ Relaxin 1], RLN2 [relaxin 2], RMI1 [RMI1, RecQ-mediated genomic instability 1, homologue (budding yeast)], RNASE1 [ribonuclease, RNase A family, 1 (pancreas)], RNASE2 [ribonuclease, RNase A Family 2 (liver, eosinophil-derived neurotoxin)], RNASE3 [ribonuclease, RNase A family, 3 (eosinophil anionic protein)], RNASEH1 [ribonuclease H1], RNASEH2A [ribonuclease ZH2, subunit A], RNASEL [ribonuclease L (2 ′ [5′-oligoisoadenylate synthetase dependence)], RNASEN [ribonuclease type III, nucleus], RNF123 [ring finger protein 123], RNF13 [ring finger Protein 13], RNF135 [ring finger protein 135], RNF138 [ring finger protein 138], RNF4 [ring finger protein 4], RNH1 [ribonuclease / angiozenin inhibitor 1], RNPC3 [RNA binding region (RNP1, RRM) containing 3 ], RNPEP [Arginylaminopeptidase (aminopeptidase B)], ROCK1 [Rho-related, coiled-coil-containing protein kinase 1], ROM1 [Retina l body outer segment Protein 1], ROR2 [receptor tyrosine kinase-like orphan receptor 2], RORA [RAR-related orphan receptor A], RPA1 [replicated protein A1, 70 kDa], RPA2 [replicated protein A2, 32 kDa], RPGRIP1L [RPGRIP1 RPLP1 [ribosomal protein, large, P1], RPS19 [ribosomal protein 19], RPS6KA3 [ribosomal protein 6 kinase, 90 kDa, polypeptide 3], RPS6KB1 [ribosomal protein 6 kinase, 70 kDa, polypeptide 1], RPSA [ Ribosomal protein A], RRBP1 [ribosome-binding protein 1 homolog 180 kDa (dog)], RRM1 [ribonucleotide reductase M1], RRM2B [ribonucleotide repo] Cutase M2 B (TP53 inducible)], RUNX1 [Runt-related transcription factor 1], RUNX3 [Runt-related transcription factor 3], RXRA [retinoid X receptor, alpha], RXRB [retinoid X receptor, beta], RYR1 [ Ryanodine receptor 1 (skeleton)], RYR3 [ryanodine receptor 3], S100A1 [S100 calcium binding protein A1], S100A12 [S100 calcium binding protein A12], S100A4 [S100 calcium binding protein A4], S100A7 [S100 calcium binding protein A7], S100A8 [S100 calcium binding protein A8], S100A9 [S100 calcium binding protein A9], S100B [S100 calcium binding protein B], S100G [S100. Lucium binding protein G], S1PR1 [sphingosine-1-phosphate receptor 1], SAA1 [serum amyloid A1], SAA4 [serum amyloid A4, constitutive], SAFB [scaffold binding factor B], SAG [S-antigen, Retina and pineal gland (arrestin)], SAGE1 [sarcoma antigen 1], SARDH [sarcosine dehydrogenase], SART3 [squamous cell carcinoma antigen 3 recognized by T cells], SBDS [Schwahimann-Bodien-Diamond syndrome], SBNO2 [Strawberry Notch homolog 2 (Drosophila)], SCAMP3 [secretory carrier membrane protein 3], SCAP [SREBF chaperone], SCARB1 [scavenger receptor class B, member 1], SCD [stearoyl-CoA desaturase (delta-9-) De Saturase)], SCG2 [secretogranin II], SCG3 [secretogranin III], SCG5 [secretogranin V (7B2 protein)], SCGB1A1 [secretoglobulin, family 1A, member 1 (uteroglobin)], SCGB3A2 [secret] Globin, family 3A, member 2], SCN4A [sodium channel, voltage-gated, type IV, alpha subunit], SCNN1A [sodium channel, non-potential-gated 1 alpha], SCNN1G [sodium channel, non-voltage-gated 1, Gamma], SCO1 [SCO cytochrome oxidase deficient homolog 1 (yeast)], SCO2 [SCO cytochrome oxidase deficient homolog 2 (yeast)], SCP2 [sterol carrier protein 2], SCT [secretin] SDC1 [syndecan1], SDC2 [syndecan2], SDC4 [syndecan4], SDHB [succinate dehydrogenase complex, subunit B, iron sulfur (Ip)], SDHD [succinate dehydrogenase complex, subunit D, integration Membrane protein], SEC14L2 [SEC14-like 2 (budding yeast)], SEC16A [SEC16 homologue A (budding yeast)], SEC23B [Sec23 homologue B (budding yeast)], SELE [selectin E], SELL [selectin L] SELP [selectin P (granular membrane protein 140 kDa, antigen CD62)], SELPLG [selectin P ligand], SEPT5 [Septin 5], SEPP1 [selenoprotein P, plasma, 1], SEPSECS [Sep (O-phosphoserine) tRNA: Sec Selenocysteine) tRNA synthase], SERBP1 [serpin E1 mRNA binding protein 1], serpin A1 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1], serpin A2 [serpin peptidase inhibitor, Clade A (alpha-1 antiproteinase, antitrypsin), member 2], serpin A3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3], serpin A5 [serpin peptidase inhibitor, Clade A (alpha-1 antiproteinase, antitrypsin), member 5], serpin A6 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), men -6], serpin A7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], serpin B1 [serpin peptidase inhibitor, clade B (ovalbumin), member 1], serpin B2 [Serpin peptidase inhibitor, clade B (ovalbumin), member 2], serpin B3 [serpin peptidase inhibitor, clade B (ovalbumin), member 3], serpin B4 [serpin peptidase inhibitor, clade B (ovalbumin) , Member 4], serpin B5 [serpin peptidase inhibitor, clade B (ovalbumin), member 5], serpin B6 [serpin peptidase inhibitor, clade B (ovalbumin), member 6], serpin B9 [ Serpin peptidase inhibitor, clade B (ovalbumin), member 9], serpin C1 [serpin peptidase inhibitor, clade C (antithrombin), member 1], serpin D1 [serpin peptidase inhibitor, clade D (heparin cofactor) , Member 1], serpin E1 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1], serpin E2 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor) Factor 1), member 2], serpin F2 [serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], serpin G1 [serpin peptidase inhibitor, clade G (C1 inhibitor) Factor), member 1], serpin H1 [serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)], SET [SET nuclear oncogene], SETDB2 [SET domain, branching 2], SETX [senataxin], SFPQ [splicing factor proline / glutamine rich (polypyrimidine tract binding protein related)], SFRP1 [secreted frizzled related protein 1], SFRP2 [secreted frizzled related protein 2], SFRP5 [secreted frizzled-related protein 5], SFTPA1 [surfactant protein A1], SFTPB [surfactant protein B], SFTPC [surfact Protein C], SFTPD [surfactant protein D], SGCA [sarcoglycan, alpha (50 kDa dystrophin-related glycoprotein)], SGCB [sarcoglycan, beta (43 kDa dystrophin-related glycoprotein)], SGK1 [serum / glucocorticoid control Kinase 1], SGSH [N-sulfoglucosamine sulfohydrolase], SGTA [containing small glutamine-rich tetratricopeptide repeat (TPR), alpha], SH2B1 [SH2B adapter protein 1], SH2B3 [SH2B adapter protein 3], SH2D1A [SH2 Domain containing 1A], SH2D4B [SH2 domain containing 4B], SH3KBP1 [SH3-domain kinase binding protein 1], SHBG [sex hormone] Binding globulin], SHC1 [SHC (Src homology 2 domain-containing) transforming protein 1], SHH [Sonic hedgehog homologue (Drosophila)], SHMT2 [serine hydroxymethyltransferase 2 (mitochondrion)], SI [sucrase-iso Maltase (alpha-glucosidase)], SIGIRR [single immunoglobulin and toll-interleukin 1 receptor (TIR) domain], SIP1 [motor neuron protein interacting protein survival 1], SIPA1 [signal-induced proliferation-related 1] SIRPA [signal control protein alpha], SIRPB2 [signal control protein beta 2], SIRT1 [sirtuin (silent mating type information control 2 homolog) 1 (budding yeast)], KIV2L [super killer virucidal activity 2-like (budding yeast)], SKP2 [S-phase kinase-related protein 2 (p45)], SLAMF1 [signaling lymphocyte activation molecule family member 1], SLAMF6 [SLAM Family member 6], SLC11A1 [solute carrier family 11 (proton-bonded divalent metal ion transporter), member 1], SLC11A2 [solute carrier family 11 (proton-bonded divalent metal ion transporter), member 2], SLC12A1 [solute] Carrier family 12 (sodium / potassium / chloride transporter), member 1], SLC12A2 [solute carrier family 12 (sodium / potassium / chloride transporter), member 2], SLC14A1 [solute carrier family 14 ( Element transporter), member 1 (kid blood group)], SLC15A1 [solute carrier family 15 (oligopeptide transporter), member 1], SLC16A1 [solute carrier family 16, member 1 (monocarboxylic acid transporter 1)], SLC17A5 [solute carrier family
-17 (anion / sugar transporter), member 5], SLC17A6 [solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6], SLC17A7 [solute carrier family 17 (sodium-dependent inorganic phosphate) Cotransporter), member 7], SLC19A1 [solute carrier family 19 (folate transporter), member 1], SLC1A1 [solute carrier family 1 (neurotype / epithelial high affinity glutamate transporter, Xag system), member 1] SLC1A2 [solute carrier family 1 (glial cell high affinity glutamate transporter), member 2], SLC1A4 [solute carrier family 1 (glutamic acid / neutral amino acid transporter), member 4], SLC22A12 [solute carrier family 22 (organic) Anion / urate transporter), member 12], SL 22A2 [solute carrier family 22 (organic cation transporter), member 2], SLC22A23 [solute carrier family 22, member 23], SLC22A3 [solute carrier family 22 (extraneuron monoamine transporter), member 3], SLC22A4 [solute] Carrier family 22 (organic cation / ergothioneine transporter), member 4], SLC22A5 [solute carrier family 22 (organic cation / carnitine transporter), member 5], SLC22A6 [solute carrier family 22 (organic anion transporter) , Member 6], SLC24A2 [solute carrier family 24 (sodium / potassium / calcium exchanger), member 2], SLC25A1 [solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1], SLC25 20 [solute carrier family 25 (carnitine / acylcarnitine translocase), member 20], SLC25A3 [solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3], SLC25A32 [solute carrier family 25, member 32] SLC25A33 [solute carrier family 25, member 33], SLC25A4 [solute carrier family 25 (mitochondrial carrier, adenine nucleotide transporter), member 4], SLC26A4 [solute carrier family 26, member 4], SLC27A4 [solute carrier family 27 ( Fatty acid transporter), member 4], SLC28A1 [solute carrier family 28 (sodium-linked nucleoside transporter), member 1], SLC2A1 [solute carrier family 2 (promoting gluco- Member 1], SLC2A13 [solute carrier family 2 (facilitated glucose transporter), member 13], SLC2A3 [solute carrier family 2 (facilitating glucose transporter), member 3], SLC2A4 [solute carrier family 2 ( Accelerated glucose transporter), member 4], SLC30A1 [solute carrier family 30 (zinc transporter), member 1], SLC30A8 [solute carrier family 30 (zinc transporter), member 8], SLC31A1 [solute carrier family 31 (copper) Transporter), member 1], SLC35A1 [solute carrier family 35 (CMP-sialic acid transporter), member A1], SLC35A2 [solute carrier family 35 (UDP-galactose transporter), member A2], SLC35C1 [solute carrier family 35, Men -C1], SLC35F2 [solute carrier family 35, member F2], SLC39A3 [solute carrier family 39 (zinc transporter), member 3], SLC3A2 [solute carrier family 3 (active factors for dibasic and neutral amino acid transport) , Member 2], SLC46A1 [solute carrier family 46 (folate transporter), member 1], SLC5A5 [solute carrier family 5 (sodium iodide cotransporter), member 5], SLC6A11 [solute carrier family 6 (neurotransmitter) Transporter, GABA), member 11], SLC6A14 [solute carrier family 6 (amino acid transporter), member 14], SLC6A19 [solute carrier family 6 (neutral amino acid transporter), member 19], SLC6A3 [solute carrier family 6 (Neurotransmitter transporter, -Pamine), member 3], SLC6A4 [solute carrier family 6 (neurotransmitter transporter, serotonin), member 4], SLC6A8 [solute carrier family 6 (neurotransmitter transporter, creatine), member 8], SLC7A1 [solute] Carrier family 7 (cationic amino acid transporter, y + system), member 1], SLC7A2 [solute carrier family 7 (cationic amino acid transporter, y + system), member 2], SLC7A4 [solute carrier family 7 (cation) Amino acid transporter, y + system), member 4], SLC7A5 [solute carrier family 7 (cationic amino acid transporter, y + system), member 5], SLC8A1 [solute carrier family 8 (sodium / calcium exchanger), member 1], SLC9A1 [solute carrier family 9 (sodium / Hydrogen exchanger), member 1], SLC9A3R1 [solute carrier family 9 (sodium / hydrogen exchanger), member 3 regulator 1], SLCO1A2 [solute carrier organic anion transporter family, member 1A2], SLCO1B1 [solute carrier organic Anion transporter family, member 1B1], SLCO1B3 [solute carrier organic anion transporter family, member 1B3], SLPI [secretory leukocyte peptidase inhibitor], SMAD1 [SMAD family member 1], SMAD2 [SMAD family member 2] , SMAD3 [SMAD family member 3], SMAD4 [SMAD family member 4], SMAD7 [SMAD family member 7], SMARAC4 [SWI / SNF related, matrix-linked, active -Dependent regulator chromatin, subfamily a, member 4], SMACAL1 [SWI / SNF-related, matrix-bound, actin-dependent regulator chromatin, subfamily a-like 1], SMARCB1 [SWI / SNF-related, matrix-bound , Actin-dependent regulator chromatin, subfamily b, member 1], SMC1A [chromosomal structural maintenance 1A], SMC3 [chromosomal structural maintenance 3], SMG1 [SMG1 homologue, phosphatidylinositol 3-kinase related kinase ( Caenolabditis elegance)], SMN1 [Motor neuron 1 survival, telomere], SMPD1 [sphingomyelin phosphodiesterase 1, acid lysosome], SMPD2 [sphingomyelin phosphodieste] Case 2, Neutral membrane (neutral sphingomyelinase)], SMTN [Smooterin], SNAI2 [Snail homolog 2 (Drosophila)], SNAP25 [synaptosome-related protein, 25 kDa], SNCA [synuclein, alpha (amyloid precursor) Non-A4 component)], SNCG [synuclein, gamma (breast cancer specific protein 1)], SNURF [SNRPN upstream reading frame], SNW1 [SNW domain-containing 1], SNX9 [selected nexin 9], SOAT1 [sterol O- Acyltransferase 1], SOCS1 [inhibition of cytokine signaling 1], SOCS2 [inhibition of cytokine signaling 2], SOCS3 [inhibition of cytokine signaling 3], SOD1 [superoxide dismuta ZE1, soluble], SOD2 [superoxide dismutase 2, mitochondria], SORBS3 [sorbin and SH3 domain-containing 3], SORD [sorbitol dehydrogenase], SOX2 [SRY (sex determining region Y) box 2], SP1 [Sp1 transcription factor ], SP110 [SP110 nuclear protein], SP3 [Sp3 transcription factor], SPA17 [sperm autoantigen protein 17], SPARC [secreted protein, acidic, cysteine-rich (ostonectin)], SPHK1 [sphingosine kinase 1], SPI1 [ Spleen focus forming virus (SFFV) provirus-integrated oncogene spi1], SPINK1 [serine peptidase inhibitor, casal type 1], SPINK13 [serine peptidase inhibitor, casal 1 3 (estimated)], SPINK5 [serine peptidase inhibitor, casal type 5], SPN [sialophorin], SPON1 [spondin1, extracellular matrix protein], SPP1 [secreted phosphate protein 1], SPRED1 [sprouty (sprouty) related , EVH1 domain containing 1], SPRR2A [small proline rich protein 2A], SPRR2B [small proline rich protein 2B], SPTB [spectin, beta, erythrocytes], SRC [v-src sarcoma (Schmidt-Rupin A-2) virus carcinogenesis Gene homolog (tri)], SRD5A1 [steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5alpha-steroid delta4-dehydrogenase alpha 1)], SREBF1 [sterol Regulatory element binding transcription factor 1], SREBF2 [sterol regulatory element binding transcription factor 2], SRF [serum response factor (c-fos serum response element binding transcription factor)], SRGN [serglycine], SRP9 [signal recognition particle 9 kDa] , SRPX [sushi-repeat containing protein, X-linked], SRR [serine racemase], SRY [sex determining region Y], SSB [Sjogren's syndrome antigen B (self-antigen La)], SST [somatostatin], SSTR2 [somatostatin receptor 2], SSTR4 [somatostatin receptor 4], ST8SIA4 [ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4], STAR [steroid-producing acute regulatory protein], STAT1 [signal transduction] Transcriptional activator 1, 91 kDa], STAT2 [signaling transcriptional activator 2, 113 kDa], STAT3 [signaling transcriptional activator 3 (acute-phase reaction factor)], STAT4 [signaling transcriptional activation Factor 4], STAT5A [signaling transcriptional activator 5A], STAT5B [signaling transcriptional activator 5B], STAT6 [signaling transcriptional activator 6, interleukin-4 inducible], STELLAR [reproductive] And embryonic stem cell enhancing protein TELLA], STIM1 [stromal interaction molecule 1], STIP1 [stress-inducible-phosphoprotein 1], STK11 [serine / threonine kinase 11], STMN2 [stathmin-like 2], STRAP [serine / Threonine kinase receptor related protein ], STRC [stereocillin], STS [steroid sulfatase (microsome), isozyme S], STX6 [syntaxin 6], STX8 [syntaxin 8], SULT1A1 [sulfotransferase family, cytosol, 1A, phenol priority, member 1], SULT1A3 [sulfotransferase family, cytosol, 1A, phenol preference, member 3], SUMF1 [sulfatase modifier 1], SUMO1 [regulatory factor 3 of miftwo (mif two) homolog 1 (budding yeast)], SUMO3 [SMT3 (regulatory factor 3 of mif two) homolog 3 (budding yeast)], SUOX [sulfite oxidase], SUV39H1 [inhibitor 1 of heterologous color 3-9 homologue (Drosophila) SWAP70 [SWAP switching B cell complex 70 kDa subunit], SYCP3 [synaptonema complex protein 3], SYK [spleen tyrosine kinase], SYNM [cinemine, intermediate filament protein], SYNPO [synaptopodin], SYNPOpodin 2 [synaptopodin 2], SYP [synaptophysin], SYT3 [synaptotagmin III], SYTL1 [synaptotagmin-like 1], T [T, short-tailed malform homolog (mouse)], TAC1 [tachykinin, precursor 1], TAC4 [tachykinin 4 (hemokinin)] TACR1 [tachykinin receptor 1], TACR2 [tachykinin receptor 2], TACR3 [tachykinin receptor 3], TAGLN [transgelin], TAL1 [T cell acute lymphocyte leukemia 1], TAOK3 [ AO kinase 3], TAP1 [transporter 1, ATP binding cassette, subfamily B (MDR / TAP)], TAP2 [transporter 2, ATP binding cassette, subfamily B (MDR / TAP)], TARDBP [TAR DNA binding Protein], TARP [TCR
Gamma alternative reading frame protein], TAT [tyrosine aminotransferase], TBK1 [TANK binding kinase 1], TBP [TATA box binding protein], TBX1 [T box 1], TBX2 [T box 2], TBX21 [T box 21] , TBX3 [T box 3], TBX5 [T box 5], TBXA2R [thromboxane A2 receptor], TBXAS1 [thromboxane A synthase 1 (platelet)], TCEA1 [transcription elongation factor A (SII), 1], TCEAL1 [Transcription elongation factor A (SII) -like 1], TCF4 [transcription factor 4], TCF7L2 [transcription factor 7-like 2 (T cell specific, HMG box)], TCL1A [T cell leukemia / lymphoma 1A], TCL1B [T Cell leukemia / lymphoma 1B], TCN [Transcobalamin I (vitamin B12 binding protein, R binder family)], TCN2 [transcobalamin II, macrocytic anemia], TDP1 [tyrosyl-DNA phosphodiesterase 1], TEC [tec protein tyrosine kinase], TECTA [ectrin alpha ], TEK [TEK tyrosine kinase, endothelium], TERF1 [telomere repeat binding factor (NIMA-interaction) 1], TERF2 [telomere repeat binding factor 2], TERT [telomerase reverse transcriptase], TES [testis-derived transcription (3 LIM domain)], TF [transferrin], TFAM [transcription factor A, mitochondria], TFAP2A [transcription factor AP-2 alpha (activation enhancer binding protein 2 alpha)], TFF2 [Shajikoshi cause 2], TFF3 [Shadikoku factor 3 (intestine)], TFPI [tissue factor pathway inhibitor (lipoprotein-related coagulation inhibitor)], TFPT [TCF3 (E2A) fusion partner (in childhood leukemia)], TFR2 [transferrin receptor 2], TFRC [transferrin receptor (p90, CD71)], TG [thyroglobulin], TGFA [transforming growth factor, alpha], TGFB1 [transforming growth factor, beta 1], TGFB2 [transforming growth factor, beta 2 ], TGFB3 [transforming growth factor, beta 3], TGFBR1 [transforming growth factor, beta receptor 1], TGFBR2 [transforming growth factor, beta receptor II (70/80 kDa)], TG F1 [TGFB-inducible factor homeobox 1], TGM1 [transglutaminase 1 (K polypeptide epithelial type I, protein-glutamine-gamma-glutamyltransferase)], TGM2 [transglutaminase 2 (C polypeptide, protein-glutamine-gamma) -Glutamyltransferase)], TGM3 [transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)], TH [tyrosine hydroxylase], THAP1 [THAP domain-containing, apoptosis-related protein 1], THBD [thrombomodulin] , THBS1 [thrombospondin 1], THBS3 [thrombospondin 3], THPO [thrombopoietin], THY1 [Thy-1 cell table Face antigen], TIA1 [TIA1 cytotoxic granule-related RNA binding protein], TIE1 [tyrosine kinase 1 having immunoglobulin-like and EGF-like domains], TIMD4 [containing T-cell immunoglobulin and mucin domain 4], TIMELESS [timeless homology] Body (Drosophila)], TIMP1 [TIMP metallopeptidase inhibitor 1], TIMP2 [TIMP metallopeptidase inhibitor 2], TIMP3 [TIMP metallopeptidase inhibitor 3], TIRAP [Tall-interleukin 1 receptor (TIR) domain containing Adapter protein], TJP1 [tight junction protein 1 (closed zone 1)], TK1 [thymidine kinase 1, soluble], TK2 [thymidine kinase 2, mitochondria], TKT [transketola] Z], TLE4 [transducin-like enhancer split 4 (E (sp1) homologue, Drosophila)], TLR1 [Toll-like receptor 1], TLR10 [Toll-like receptor 10], TLR2 [Toll-like receptor 2 ], TLR3 [Toll-like receptor 3], TLR4 [Toll-like receptor 4], TLR5 [Toll-like receptor 5], TLR6 [Toll-like receptor 6], TLR7 [Toll-like receptor 7], TLR8 [Toll -Like receptor 8], TLR9 [toll-like receptor 9], TLX1 [T-cell leukemia homeobox 1], TM7SF4 [transmembrane 7 superfamily member 4], TMED3 [transmembrane emp24 protein transport domain containing 3], TMEFF2 [ Transmembrane protein 2 with EGF-like and two follistatin-like domains], TMEM1 2E [transmembrane protein 132E], TMEM18 [transmembrane protein 18], TMEM19 [transmembrane protein 19], TMEM216 [transmembrane protein 216], TMEM27 [transmembrane protein 27], TMEM67 [transmembrane protein 67], TMPO [ Thymopoietin], TMPRSS15 [transmembrane protease, serine 15], TMSB4X [thymosin beta 4, X-linked], TNC [tenascin C], TNF [tumor necrosis factor (TNF superfamily, member 2)], TNFAIP1 [tumor necrosis factor, alpha Inducible protein 1 (endothelium)], TNFAIP3 [tumor necrosis factor, alpha-inducible protein 3], TNFAIP6 [tumor necrosis factor, alpha-inducible protein 6], TNFRSF10A [tumor necrosis factor receptor super -Family, member 10a], TNFRSF10B [tumor necrosis factor receptor superfamily, member 10b], TNFRSF10C [tumor necrosis factor receptor superfamily, member 10c, decoy without intracellular domain], TNFRSF10D [tumor necrosis factor receptor Superfamily, member 10d, decoy with truncated cell death domain], TNFRSF11A [tumor necrosis factor receptor superfamily, member 11a, NFKB activator], TNFRSF11B [tumor necrosis factor receptor superfamily, member 11b], TNFRSF13B [Tumor necrosis factor receptor superfamily, member 13B], TNFRSF13C [Tumor necrosis factor receptor superfamily, member 13C], TNFR F14 [tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)], TNFRSF17 [tumor necrosis factor receptor superfamily, member 17], TNFRSF18 [tumor necrosis factor receptor superfamily, member 18], TNFRSF1A [ Tumor necrosis factor receptor superfamily, member 1A], TNFRSF1B [tumor necrosis factor receptor superfamily, member 1B], TNFRSF21 [tumor necrosis factor receptor superfamily, member 21], TNFRSF25 [tumor necrosis factor receptor superfamily, Member 25], TNFRSF4 [tumor necrosis factor receptor superfamily, member 4], TNFRSF6B [tumor necrosis factor receptor superfamily, member 6 , Decoy], TNFRSF8 [tumor necrosis factor receptor superfamily, member 8], TNFRSF9 [tumor necrosis factor receptor superfamily, member 9], TNFSF10 [tumor necrosis factor (ligand) superfamily, member 10], TNFSF11 [tumor Necrosis factor (ligand) superfamily, member 11], TNFSF12 [tumor necrosis factor (ligand) superfamily, member 12], TNFSF13 [tumor necrosis factor (ligand) superfamily, member 13], TNFSF13B [tumor necrosis factor (ligand) Superfamily, member 13b], TNFSF14 [tumor necrosis factor (ligand) superfamily, member 14], TNFSF15 [tumor necrosis factor (ligand) superfamily , Member 15], TNFSF18 [tumor necrosis factor (ligand) superfamily, member 18], TNFSF4 [tumor necrosis factor (ligand) superfamily, member 4], TNFSF8 [tumor necrosis factor (ligand) superfamily, member 8], TNFSF9 [tumor necrosis factor (ligand) superfamily, member 9], TNKS [tankylase, TRF1-interacting ankyrin-related ADP-ribose polymerase], TNNC1 [troponin C1 type (slow muscle type)], TNNI2 [troponin I2 type (skeleton) , Fast)], TNNI3 [troponin type I3 (heart)], TNNT3 [troponin type T3 (skeleton, fast)], TNPO1 [transportin 1], TNS1 [tensin 1], TNXB [tenascin XB], TOM1L2 [ yb1-like target 2 (chicken)], TOP1 [topoisomerase (DNA) I], TOP1MT [topoisomerase (DNA) I, mitochondria], TOP2A [topoisomerase (DNA) II alpha 170 kDa], TOP2B [topoisomerase (DNA) II beta 180 kDa ], TOP3A [topoisomerase (DNA) III alpha], TOPBP1 [topoisomerase (DNA) II binding protein 1], TP53 [tumor protein p53], TP53BP1 [tumor protein p53 binding protein 1], TP53RK [TP53 regulatory kinase], TP63 [ Tumor protein p63], TP73 [tumor protein p73], TPD52 [tumor protein D52], TPH1 [tryptophan hydroxylase 1], PI1 [triose phosphate isomerase 1], TPM1 [tropomyosin 1 (alpha)], TPM2 [tropomyosin 2 (beta)], TPM [thiopurine S-methyltransferase], TPO [thyroid peroxidase], TPP1 [tripeptidyl peptidase I] , TPP2 [tripeptidyl peptidase II], TPPP [tubulin polymerization promoting protein], TPPP3 [tubulin polymerization promoting protein family member 3], TPSAB1 [tryptase alpha / beta1], TPSB2 [tryptase beta2 (gene / pseudogene) ], TPSD1 [tryptase delta 1], TPSG1 [tryptase gamma 1], TPT1 [tumor protein, translationally regulated 1], TRADD [TNFRSF1A-related cells Cyst death mediating domain], TRAF1 [TNF receptor-related factor 1], TRAF2 [TNF receptor-related factor 2], TRAF3IP2 [TRAF3 interacting protein 2], TRAF6 [TNF receptor-related factor 6], TRAIP [TRAF interaction Protein], TRAPPC10 [transport protein particle complex 10], TRDN [triazine], TREX1 [3 prime repair exonuclease 1], TRH [thyroid stimulating hormone-releasing hormone], TRIB1 [tribles homolog 1 (Drosophila)] , TRIM21 [containing a trisegment motif 21], TRIM22 [containing a trisegment motif 22], TRIM26 [containing a trisegment motif 26], TRIM28 [containing a trisegment motif 28], TRIM29 [containing a trisegment motif 29], RIM68 [trisegmental motif containing 68], TRPA1 [transient receptor potential cation channel, subfamily A, member 1], TRPC1 [transient receptor potential cation channel, subfamily C, member 1], TRPC3 [Transient receptor potential cation channel, subfamily C, member 3], TRPC6 [transient receptor potential cation channel, subfamily C, member 6], TRPM1 [transient receptor potential cation channel , Subfamily M, member 1], TRPM8 [transient receptor potential cation channel, subfamily M, member 8], TRPS1 [hair nose and phalanx syndrome I], TRPV1 [transient receptor potential cation. Channel, subfamily V, member 1], TRPV4 [transient receptor potential cation channel Subfamily V, member 4], TRPV5 [transient receptor potential cation channel, subfamily V, member 5], TRPV6 [transient receptor potential cation channel, subfamily V, member 6], TRRAP [ Transforming / transcription domain related proteins
], TSC1 [tuberous sclerosis 1], TSC2 [tuberous sclerosis 2], TSC22D3 [TSC22 domain family, member 3], TSG101 [tumor susceptibility gene 101], TSHR [thyroid stimulating hormone receptor], TSLP [thymus] Interstitial lymphocyte formation factor], TSPAN7 [tetraspanin 7], TSPO [transporter protein (18 kDa)], TSSK2 [testis-specific serine kinase 2], TSTA3 [tissue-specific transplantation antigen P35B], TTF2 [transcription termination factor , RNA polymerase II], TTN [titin], TTPA [tocopherol (alpha) transfer protein], TTR [transthyretin], TUBA1B [tubulin, alpha1b], TUBA4A [tubulin, alpha4a], TUBB [tubulin] The ], TUBB1 [tubulin, beta 1], TUBG1 [tubulin, gamma 1], TWIST1 [twisted homolog 1 (Drosophila)], TWSG1 [twisted gastrulation homolog 1 (Drosophila)], TXK [TXK Tyrosine kinase], TXN [thioredoxin], TXN2 [thioredoxin 2], TXNDC5 [thioredoxin domain-containing 5 (endoplasmic reticulum)], TXNDC9 [thioredoxin domain-containing 9], TXNIP [thioredoxin interacting protein], TXNRD1 [thioredoxin reductase 1], TXNRD2 [thioredoxin reductase 2], TYK2 [tyrosine kinase 2], TYMP [thymidine phosphorylase], TYMS [thymidylate synthetase], TYR [tyrosinase (oculocutaneous albinism IA) ], TYRO3 [TYRO3 protein tyrosine kinase], TYROBP [TYRO protein tyrosine kinase binding protein], TYRP1 [tyrosinase-related protein 1], UBB [ubiquitin B], UBC [ubiquitin C], UBE2C [ubiquitin-binding enzyme E2C], UBE2N [ Ubiquitin-conjugating enzyme E2N (UBC13 homologue, yeast)], UBE2U [ubiquitin-conjugating enzyme E2U (presumed)], UBE3A [ubiquitin protein ligase E3A], UBE4A [ubiquitination factor E4A (UFD2 homologue, yeast)], UCHL1 [ubiquitin Carboxyl-terminal esterase L1 (ubiquitin thiol esterase)], UCN [urocortin], UCN2 [urocortin 2], UCP1 [uncoupled protein 1 (mitochondrial) A, proton carrier)], UCP2 [uncoupled protein 2 (mitochondrion, proton carrier)], UCP3 [uncoupled protein 3 (mitochondrion, proton carrier)], UFD1L [ubiquitin fusion degradation 1-like (yeast)], UGCG [UDP -Glucose ceramide glucosyltransferase], UGP2 [UDP-glucose pyrophosphorylase 2], UGT1A1 [UDP glucuronosyltransferase 1 family, polypeptide A1], UGT1A6 [UDP glucuronosyltransferase 1 family, polypeptide A6], UGT1A7 [UDP Glucuronosyltransferase 1 family, polypeptide A7], UGT8 [UDP glycosyltransferase 8], UIMC1 [ubiquitin interaction motif included ], ULBP1 [UL16 binding protein 1], ULK2 [unc-51-like kinase 2 (Caenolabditis elegans)], UMOD [uromodulin], UMPS [uridine monophosphate synthetase], UNC13D [unc-13 homolog D (Caenolabditis elegance)], UNC93B1 [unc-93 homolog B1 (Caenolabditis elegance)], UNG [uracil-DNA glycosylase], UQCRFS1 [ubiquinol-cytochrome c reductase, Riske iron- Sulfur polypeptide 1], UROD [uroporphyrinogen decarboxylase], USF1 [upstream transcription factor 1], USF2 [upstream transcription factor 2, c-fos interaction], USP18 [ubiquitin-specific peptidase 18 , USP34 [ubiquitin-specific peptidase 34], UTRN [utrophin], UTS2 [urotensin 2], VAMP8 [vesicle-associated membrane protein 8 (endobrevin)], VAPA [VAMP (vesicle-associated membrane protein) -related protein A, 33 kDa] , VASP [vasodilator-stimulated phosphoprotein], VAV1 [vav 1 guanine nucleotide exchanger], VAV3 [vav 3 guanine nucleotide exchanger], VCAM1 [vascular cell adhesion molecule 1], VCAN [Versican], VCL [Vinculin] , VDAC1 [voltage-dependent anion channel 1], VDR [vitamin D (1 [25-dihydroxyvitamin D3) receptor], VEGFA [vascular endothelial growth factor A], VEGFC [vascular endothelial growth factor C], VHL [phone] Hippel-Rin Tumor control], VIL1 [villin 1], VIM [vimentin], VIP [vasoactive intestinal peptide], VIPR1 [vasoactive intestinal peptide receptor 1], VIPR2 [vasoactive intestinal peptide receptor 2], VLDLR [Very low density lipoprotein receptor], VMAC [vimentin type intermediate filament-related coiled coil protein], VPREB1 [pre-B lymphocyte 1], VPS39 [vacuum protein localization 39 homologue (budding yeast)], VTN [vitronectin ], VWF [von Willebrand factor], WARS [tryptophanyl-tRNA synthetase], WAS [Wiscot-Aldrich syndrome (asthma-thrombocytopenia)], WASF1 [WAS protein family, member 1], WASF2 [WAS protein family, member 2], WASL [Wiscot-Aldrich syndrome-like], WDFY3 [containing WD repeat and FYVE domain 3], WDR36 [WD repeat domain 36], WEE1 [WEE1 homologue (fission yeast)], WIF1 [WNT inhibitory factor 1 ], WIPF1 [WAS / WASL interacting protein family, member 1], WNK1 [WNK lysine-deficient protein kinase 1], WNT5A [wingless MMTV integration site family, member 5A], WRN [Werner syndrome, RecQ helicase-like], WT1 [Wilms tumor 1], XBP1 [X box binding protein 1], XCL1 [chemokine (C motif) ligand 1], XDH [xanthine dehydrogenase], XIAP [X-linked inhibitor of apoptosis], XPA [Xeroderma pigmentosum, A complementation group], XPC [Xeroderma pigmentosum, C complementation group], XPO5 [Exportin 5], XRCC1 [X-ray repair supplement defect repair in Chinese hamster cells], XRCC2 [Chinese X-ray repair supplement deficiency repair 2 in hamster cells], XRCC3 [X-ray repair supplement deficiency repair 3 in Chinese hamster cells], XRCC4 [X-ray repair supplement deficiency repair 4 in Chinese hamster cells], XRCC5 [X-rays in Chinese hamster cells] Repair supplement deficiency repair 5 (double-strand break religation)], XRCC6 [X-ray repair supplement deficiency repair 6 in Chinese hamster cells], YAP1 [Yes-related protein 1], YARS [tyrosyl-tRNA synthetase], YBX1 [Y box Binding protein 1], Y S1 [v-yes-1 Yamaguchi sarcoma virus oncogene homolog 1], YPEL1 [ippe-like 1 (Drosophila)], YPEL2 [yippee-like 2 (Drosophila)], YWHAB [tyrosine 3-monooxygenase / Tryptophan 5-monooxygenase activating protein, beta polypeptide], YWHAQ [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activating protein, theta polypeptide], YWHAZ [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase Activated protein, zeta polypeptide], YY1 [YY1 transcription factor], ZAP70 [zeta-chain (TCR) -related protein kinase 70 kDa], ZBED1 [zinc finger, ED type 1], ZC3H12A [Zinc finger CCCH type containing 12A], ZC3H12D [Zinc finger CCCH type containing 12D], ZFR [Zinc finger RNA binding protein], ZNF148 [Zinc finger protein 148], ZNF267 [Zinc finger protein 267] , ZNF287 [Zinc finger protein 287], ZNF300 [Zinc finger protein 300], ZNF365 [Zinc finger protein 365], ZNF521 [Zinc finger protein 521], ZNF74 [Zinc finger protein 74], and ZPBP2 [Zona pellucida binding protein 2] Is mentioned.

  In certain embodiments, using animals produced by the methods of the present invention, using measurements commonly used in immunodeficiency research, mutations that affect the onset and / or progression of animals and immunodeficiencies. Study the impact.

  Genetically modified animals produced by the methods of the invention, such as knockout and transgenic animals, can be altered alone or in combination, including changes to any one or more of Rag1, Rag2, FoxN1, and DNAPK. It should be understood that other genes may be included. Thus, for example, animals comprising single, double, or triple gene knockouts are contemplated. Any of these can be used in a variety of ways in which alteration of one or more immunodeficiency genes can be useful. For example, the genetically modified animals described herein can identify progenitor cells, including lymphoid progenitors and pluripotent stem cells, identify new cytokines that play a role in hematopoietic cell growth and differentiation, known cytokines It can be used for the study of hematopoietic cells, such as analysis of the effects of drugs and analysis of the effect of drugs on hematopoietic cells. Such animals also include influenza, West Nile virus, herpes virus, picornavirus, neurotrophic coronavirus, varicella-zoster (chicken pox), respiratory corporal virus, cowpox, hepatitis B, rabies, and dengue virus, As well as lymphophilic viruses, including human immunodeficiency virus (HIV), human T lymphophilic virus (HTLV-1), and Epstein-Barr virus (EBV), and also rat-specific infections such as, for example, rat-adapted influenza virus However, it can also be used in studies on the pathogenesis of diseases caused by viral infections such as, but not limited to, those that mimic the effects of human-specific viruses on their hosts (eg, H. Lebrec and GR Burleson ( 1994) Toxicology.Jul 1; 91 (2): 179-88).

  In other embodiments, genetically modified animals produced by the methods of the invention may also be useful in the study of defense mechanisms against microorganisms that cause disease in immunocompromised patients, where the microorganism is a cytomegalovirus, It can be Pneumocystis carini, or Candida species. For example, genetically modified animals such as knockout rats may be subjects for preclinical evaluation of specific “gene therapy”. For example, the gene is capable of self-renewal in hematopoietic progenitor cells, preferably in a pluripotent stem cell that has self-renewal ability from a patient with inherited genetic defect, or from a rat model with inherited genetic defect Can be introduced into pluripotent stem cells that can be reintroduced into genetically modified rats for the purpose of determining the therapeutic utility of the modified cells. In addition, genetically modified animals study the biological mechanisms underlying immunodeficiency diseases and conditions caused by or associated with mutations in immunodeficiency genes such as Rag1, Rag2, FoxN1, or DNAPK. It can also be useful to

  In addition, genetically modified animals created by the methods of the invention can be used to develop diagnostic assays for immunodeficiency disorders, including but not limited to leukemias, which are not treated here, or Any animal that has been previously treated with a therapeutic agent is assessed for the presence of one or more biomarkers compared to an untreated control animal. Such genetically modified animals include Rag1, Rag2, FoxN1, or DNAPK, but use of genetically modified animals in which one or more immunodeficiency genes are knocked out is not limited to such immunodeficiency disorders such as leukemia With another therapeutic agent that can be used in methods of screening candidate therapies or therapeutic compounds to treat, and then can be untreated or a drug, microorganism, transplanted cell, or other agent Any animal that has been previously treated is treated with a candidate therapy or candidate therapeutic agent, a biological sample is obtained from the animal, and the biological sample is a sample from an unaffected wild-type control sample, Alternatively, it is evaluated relative to a sample from a genetically modified animal that has not been subjected to a candidate treatment or therapeutic agent.

  In yet further embodiments, the method for mimicking an autoimmune disease may involve adoptive transfer of B cells that respond to antigens against the autoimmune disease, or T cells activated against the autoimmune disease. A suitable non-human mammal having an antigen target for an autoimmune disease can be immunized as follows.

  Immune cells can be prepared from immunized animals and then described herein, such as Rag1, Rag2, FoxN1, or DNAPK knockout rats, or rats with any combination of these gene knockouts Can be transplanted into genetically modified animals. The development of the autoimmune phenotype in the recipient knockout animal is then compared to a non-transplanted knockout animal or a non-pathological immune cell lacking self-reactivity, as described above, compared to a transplanted knockout animal. Or compared to wild-type animals transplanted with immune cells.

In some embodiments, a method for creating a combined immunodeficiency syndrome model provides a genetically modified animal such as a rat in which Rag1, Rag2, FoxN1, or DNAPK is knocked out as described herein. The knockout animal may further be depleted of natural killer (NK) cells by any one of a plurality of possible methods. Non-limiting examples of methods for NK deficiency in knockout animals include i) Lyst gene disruption, or ii) FoxN1 mutant animals, NSAIDs (non-steroidal anti-inflammatory drugs), statins, allosteric LFA-1 inhibitors Treatment with a compound that inhibits NK cell activity, including but not limited to, vinblastine, paclitaxel, docetaxel, cladribine, chlorambucil, bortezomib, or MG-132.

N. Trinucleotide repeat disorder

  Trinucleotide repeat extension disorders fall into two categories determined by the type of repeat. The most common repeat is triplet CAG, which encodes the amino acid glutamine (Q) when present in the coding region of a gene. Therefore, these disorders are referred to as polyglutamine (polyQ) disorders and include Huntington's disease (HD), bulbar spinal muscular atrophy (SBMA), spinocerebellar ataxia (SCA1, 2, 3, 6). , 7, and 17), and dentate nucleus red nucleus pallidal Louisa atrophy (DRPLA). Other trinucleotide repeat elongation disorders are not accompanied by CAG triplets or CAG triplets are not in the coding region of the gene and are referred to as non-polyglutamine disorders. Non-polyglutamine disorders include fragile X syndrome (FRAXA), fragile XE mental retardation (FRAXE), Friedreich ataxia (FRDA), myotonic dystrophy (DM), and spinocerebellar ataxia (SCA types 8 and 12) ).

  In one embodiment, the methods of the invention can be used to create genetically modified animals or cells in which at least one chromosomal sequence associated with a trinucleotide repeat disorder has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with a trinucleotide repeat disorder may be edited. A trinucleotide repeat disorder associated protein or regulatory sequence can typically be selected based on an experimental association of the protein or sequence with a trinucleotide repeat elongation disorder. Trinucleotide repeat extension proteins can include proteins associated with susceptibility to developing a trinucleotide repeat extension disorder, the presence of a trinucleotide repeat extension disorder, the severity of a trinucleotide repeat extension disorder, or any combination thereof. For example, the production rate or circulating concentration of a protein associated with a trinucleotide repeat stretch disorder can be increased or suppressed in a population having a trinucleotide repeat stretch disorder compared to a population lacking a trinucleotide repeat stretch disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  Non-limiting examples of proteins associated with trinucleotide repeat elongation disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), DMPK (myotonic dystrophy-protein kinase), FXN (frataxin), ATXN2 (ataxin 2), ATN1 (atrophin 1), FEN1 (flap structure-specific endonuclease 1), TNRC6A (trinucleotide repeat-containing 6A), PABPN1 (poly (A) binding protein, nucleus 1), JPH3 (junctophilin 3), MED15 (mediator complex subunit 15), ATXN1 (Ataxin 1), ATXN3 (Ataxin 3), TBP (TATA box binding protein), CACNA1A (Calcium channel, voltage-dependent) Sex, P / Q type, alpha 1A subunit), ATXN8OS (ATXN8 reverse strand (non-protein coding)), PPP2R2B (protein phosphatase 2, regulatory subunit B, beta), ATXN7 (Ataxin 7), TNRC6B (Trinucleotide repeat) 6B), TNRC6C (trinucleotide repeat-containing 6C), CELF3 (CUGBP, Elav-like family member 3), MAB21L1 (mab-21-like 1 (Caenolabditis elegans)), MSH2 (mutS homolog 2, colon cancer) , Non-polyp type 1 (E. coli)), TMEM185A (transmembrane protein 185A), SIX5 (SIX homeobox 5), CNPY3 (canopy 3 homologue (zebrafish)), FRAXE (fragile part) Folate type, rare, fra (X) (q28) E), GNB2 (guanine nucleotide-binding protein (G protein), beta polypeptide 2), RPL14 (ribosomal protein L14), ATXN8 (Ataxin 8), INSR (Insulin receptor) Body), TTR (transthyretin), EP400 (E1A binding protein p400), GIGYF2 (GRB10 interacting GYF protein 2), OGG1 (8-oxoguanine DNA glycosylase), STC1 (stanniocalcin 1), CNDP1 (carnosine dipeptidase 1) (Metallopeptidase M20 family)), C10orf2 (chromosome 10 open reading frame 2), MAML3 mastermind-like 3 (Drosophila), DKC1 (congenital keratosis 1, dissimilar) Kerin), PAXIP1 (PAX interaction (having transcription activation domain) protein 1), CASK (calcium / calmodulin-dependent serine protein kinase (MAGUK family)), MAPT (microtubule-associated protein tau), SP1 (Sp1 transcription factor) ), POLG (polymerase (DNA-directed), gamma), AFF2 (AF4 / FMR2 family, member 2), THBS1 (thrombospondin 1), TP53 (tumor protein p53), ESR1 (estrogen receptor 1), CGGBP1 ( CGG triplet repeat binding protein 1), ABT1 (activator 1 of basal transcription), KLK3 (kallikrein related peptidase 3), PRNP (prion protein), JUN (jun oncogene), KCNN3 (potassium) Interstitial / small conductance calcium activation channel, subfamily N, member 3), BAX (BCL2-related X protein), FRAXA (fragile site, folate type, rare, fra (X) (q27.3) A (macro testis) , Mental retardation)), KBBTBD10 (containing kerchile repeat and BTB (POZ) domain 10), MBNL1 (muscle blind-like (Drosophila)), RAD51 (RAD51 homologue (RecA homologue, E. coli) (budding yeast)), NCOA3 ( Nuclear receptor coactivator 3), ERDA1 (extended repeat domain, CAG / CTG 1), TSC1 (tuberous sclerosis 1), COMP (cartilage oligomeric matrix protein), GCLC (glutamate-cysteine ligase, catalytic subunit) , RRAD (Ra associated with diabetes s-related), MSH3 (mutS homolog 3 (E. coli)), DRD2 (dopamine receptor D2), CD44 (CD44 molecule (Indian blood group)), CTCF (CCCTC binding factor (zinc finger protein)), CCND1 (cyclin D1) ), CLSPN (claspin homologue (Xenopus laevis)), MEF2A (myocyte enhancer factor 2A), PTPRU (protein tyrosine phosphatase, receptor type, U), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), TRIM22 ( Trisegment motif-containing 22), WT1 (Wilms tumor 1), AHR (aryl hydrocarbon receptor), GPX1 (glutathione peroxidase 1), TPMT (thiopurine S-methyltransferase), NDP (Norie disease (pseudoglioma)) ARX (Aristales-related homeobox), MUS81 (MUS81 endonuclease homologue (budding yeast)), TYR (tyrosinase (oculocutaneous albinism IA)), EGR1 (early growth response 1), UNG (uracil-DNA glycosylase), NUMB L (numb homologue (Drosophila) -like), FABP2 (fatty acid binding protein 2, intestine), EN2 (engrailed homeobox 2), CRYGC (crystallin, gamma C), SRP14 (signal) Recognition particle 14 kDa (homologous Alu RNA binding protein)), CRYGB (crystallin, gamma B), PDCD1 (programmed cell death 1), HOXA1 (homeobox A1), ATXN2L (Ataxin2-like), PMS2 (PMS2 reduced) Increase after separation 2 (budding yeast)), GLA (galactosidase, alpha), CBL (Cas-Br-M (mouse) allotrophic retrovirus transforming sequence), FTH1 (ferritin, heavy polypeptide 1), IL12RB2 (Interleukin 12 receptor, beta 2), OTX2 (orthodentic homeobox 2), HOXA5 (homeobox A5), POLG2 (polymerase (DNA-directed), gamma2, accessory subunit), DLX2 (distal deficiency) Homeobox 2), SIRPA (signal control protein alpha), OTX1 (orthodentic homeobox 1), AHRR (aryl-hydrocarbon receptor inhibitor), MANF (mesencephalic astrocyte-derived neurotrophic factor), TMEM158 (Transmembrane Protein 158 (genes / pseudogenes)), and ENSG00000078687 the like.

  Exemplary proteins associated with trinucleotide repeat elongation disorders include HTT (huntingtin), AR (androgen receptor), FXN (frataxin), Atxn3 (attaxin), Atxn1 (attaxin), Atxn2 (attaxin), Atxn7 (attaxin) ), Atxn10 (Ataxin), DMPK (Myotonic Dystrophy-Protein Kinase), Atn1 (Atrophin 1), CBP (Creb Binding Protein), VLDLR (Very Low Density Lipoprotein Receptor), and any of them A combination is included.

In certain embodiments, animals produced by the methods of the invention are used to affect the onset and / or progression of animals and trinucleotide repeat disorders using measurements commonly used in the study of trinucleotide repeat disorders. Study the effects of mutations.

O. Neurotransmission disorder

  Non-limiting examples of neurotransmission disorders include amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA) including SCA2, Alzheimer; autism, mental retardation, Rett syndrome, fragile X syndrome , Depression, schizophrenia, bipolar disorder, learning, memory, or behavioral disorder, anxiety, brain injury, seizure disorder, Huntington's disease (chorea), mania, neuroleptic malignant syndrome, pain, parkinsonism, parkinson Disease, late-onset dyskinesia, myasthenia gravis, paroxysmal ataxia, hyperkalemia periodic palsy, hypokalemic periodic palsy, Lambert Eaton syndrome, congenital paramyotonia, Rasmussen encephalitis, startle disease (excessive startle) Illness, stiff infant syndrome), and the effects of botulism, mushroom poisoning, organophosphates, snake venoms such as from Acer snakes And the like. In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with neurotransmission disorders has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In each of the above embodiments, one or more chromosomal sequences associated with neurotransmission disorders may be edited. A neurotransmission disorder associated protein or regulatory sequence can typically be selected based on an experimental association of a protein with a neurotransmission disorder. Nerve transmission disorder related proteins include proteins associated with susceptibility to developing neurotransmission disorders, the presence of neurotransmission disorders, the severity of neurotransmission disorders, or any combination thereof. For example, the production rate or circulating concentration of a neurotransmission disorder-related protein can be increased or suppressed in a population having a neurotransmission disorder compared to a population lacking a neurotransmission disorder. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

Non-limiting examples of proteins related to neurotransmission disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neural type)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, Alpha-2C-, receptor), TACR1 (tachykinin receptor 1), HTR2C (5-hydroxytryptamine (serotonin) receptor 2C), SLC1A2 (solute carrier family 1 (glial cell high affinity glutamate transporter), member 2 ), GRM5 (glutamate receptor, metabotropic 5), GRM2 (glutamate receptor, metabotropic 2), GABRG3 (gamma-aminobutyric acid (GABA) A receptor, gamma 3), CACNA1B (calcium channel, voltage dependent) Sex, N type, alpha 1B subunit), NO 2 (Nitric oxide synthase 2, inducible), SLC6A5 (solute carrier family 6 (neurotransmitter transporter, glycine), member 5), GABRG1 (gamma-aminobutyric acid (GABA) A receptor, gamma 1), NOS3 (Nitric oxide synthase 3 (endothelial cells)), GRM3 (glutamate receptor, metabotropic 3), HTR6 (5-hydroxytryptamine (serotonin) receptor 6), SLC1A3 (solute carrier family 1 (glial cell high affinity) Glutamate transporter), member 3), GRM7 (glutamate receptor, metabotropic 7), HRH1 (histamine receptor H1), SLC1A1 (solute carrier family 1 (neurotype / epithelial high affinity glutamate transporter, Xag system) , Member 1), GRM4 (glutamate receptor, metabotropic 4), GLUD2 Glutamate dehydrogenase 2), ADRA2B (adrenergic, alpha-2B-, receptor), SLC1A6 (solute carrier family 1 (high affinity aspartate / glutamate transporter), member 6), GRM6 (glutamate receptor, metabotropic) 6), SLC1A7 (solute carrier family 1 (glutamate transporter), member 7), SLC6A11 (solute carrier family 6 (neurotransmitter transporter, GABA), member 11), CACNA1A (calcium channel, voltage-dependent, P / Q-type, alpha 1A subunit), CACNA1G (calcium channel, voltage-dependent, T-type, alpha 1G subunit), GRM1 (glutamate receptor, metabotropic 1), CACNA1H (calcium channel, voltage-dependent, T-type) , Alpha 1 H subunit), GRM8 (glutamate receptor, metabotropic 8), CHRNA3 (cholinergic receptor, nicotinic, alpha3), P2RY2 (purinergic receptor P2Y, G-protein binding, 2), TRPV6 ( Transient receptor potential cation channel, subfamily V, member 6), CACNA1E (calcium channel, voltage-dependent, R-type, alpha1E subunit), ACCN1 (amylolide-sensitive cation channel 1, neurotype), CACNA1I (Calcium channel, voltage-dependent, T-type, alpha1I subunit), GABARAP (GABA (A) receptor related protein), P2RY1 (purinergic receptor P2Y, G-protein binding, 1), P2RY6 (pyrimidine agonist) Sex receptor P2Y, G-protein binding, 6 , RPH3A (labylphilin 3A homologue (mouse)), HDC (histidine decarboxylase), P2RY14 (purinergic receptor P2Y, G-protein binding, 14), P2RY4 (pyrimidinergic receptor P2Y, G-protein binding, 4), P2RY10 (purinergic receptor P2Y, G-protein binding, 10), SLC28A3 (solute carrier family 28 (sodium-linked nucleoside transporter), member 3), NOSTRIN (nitric oxide synthase transporter), P2RY13 ( Purinergic receptor P2Y, G-protein binding, 13), P2RY8 (purinergic receptor P2Y, G-protein binding, 8), P2RY11 (purinergic receptor P2Y, G-protein binding, 11), SLC6A3 (Solute carrier family 6 Neurotransmitter transporter, dopamine), member 3), HTR3A (5-hydroxytryptamine (serotonin) receptor 3A), DRD2 (dopamine receptor D2), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A), TH (Tyrosine hydroxylase), CNR1 (cannabinoid receptor 1 (brain)), VIP (vasoactive intestinal peptide), NPY (neuropeptide Y), GAL (galanine prepropeptide), TAC1 (tachykinin, precursor 1), SYP (Synaptophysin), SLC6A4 (solute carrier family 6 (neurotransmitter transporter, serotonin), member 4), DBH (dopamine beta-hydroxylase (dopamine beta-monooxygenase)), DRD3 (dopamine receptor D3), NR3C1 ( Nuclear receiver Container subfamily 3, group C, member 1 (glucocorticoid receptor)), HTR1B (5-hydroxytryptamine (serotonin) receptor 1B), GABBR1 (gamma-aminobutyric acid (GABA) B receptor, 1), CALCA (Calcitonin-related polypeptide alpha), CRH (adrenocorticotropic hormone releasing hormone), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), TACR2 (tachykinin receptor 2), COMT (catechol-O-methyltransferase), GRIN2B (glutamate receptor, ionic, N-methyl D-aspartic acid 2B), GRIN2A (glutamate receptor, ionic, N-methyl D-aspartic acid 2A), PRL (prolactin), ACHE (acetylcholine esterler) (Yt blood group)), ADRB2 (adrenergic, beta-2-, receptor, surface), ACE (angiotensin I converting enzyme (peptidyl-dipeptidase A) 1), SNAP25 (synaptosome-related protein, 25 kDa), GABRA5 ( Gamma-aminobutyric acid (GABA) A receptor, alpha 5), MECP2 (methyl CpG binding protein 2 (Rett syndrome)), BCHE (butyrylcholinesterase), ADRB1 (adrenergic, beta-1-, receptor), GABRA1 (Gamma-aminobutyric acid (GABA) A receptor, alpha 1), GCH1 (GTP cyclohydrolase 1), DDC (dopa decarboxylase (aromatic L-amino acid decarboxylase)), MAOB (monoamine oxidase B), DRD5 (dopa) Receptor D5), GABRE (gamma-aminobutyric acid (GABA) A receptor, epsilon), SLC6A2 (solute carrier family 6 (neurotransmitter transporter, noradrenaline), member 2), GABRR2 (gamma-aminobutyric acid (GABA) ) Receptor, rho2), SV2A (synaptic vesicle glycoprotein 2A), GABRR1 (gamma-aminobutyric acid (GABA) receptor, RHO (rho) 1), GHRH (growth hormone releasing hormone), CCK (cholecystokinin) , PDYN (prodynorphin), SLC6A9 (solute carrier family 6 (neurotransmitter transporter, glycine), member 9), KCND1 (potassium voltage-gated channel, Shal-related subfamily, member 1), SRR ( Serine racemase), DYT10 (di Stonia 10), MAPT (microtubule-related protein tau), APP (amyloid beta (A4) precursor protein), CTSB (cathepsin B), ADA (adenosine deaminase), AKT1 (v-akt mouse thymoma virus oncogene homologue) 1), GRIN1 (glutamate receptor, counterionic, N-methyl D-aspartate 1), BDNF (brain-derived neurotrophic factor), HMOX1 (heme oxygenase (decycling) 1), OPRM1 (opioid receptor, Mu1), GRIN2C (glutamate receptor, ionic, N-methyl D-aspartate 2C), GRIA1 (glutamate receptor, ionic, AMPA1), GABRA6 (gamma-aminobutyric acid (GABA) A receptor, Alpha 6), FOS (FBJ mouse bone Tumor gene homologue), GABRG2 (gamma-aminobutyric acid (GABA) A receptor, gamma 2), GABRB3 (gamma-aminobutyric acid (GABA) A receptor, beta 3), OPRK1 (opioid receptor, kappa 1 ), GABRB2 (gamma-aminobutyric acid (GABA) A receptor, beta 2), GABRD (gamma-aminobutyric acid (GABA) A receptor, delta), ALDH5A1 (aldehyde dehydrogenase 5 family, member A1), GAD1 (glutamic acid de) Carboxylase 1 (brain, 67 kDa)), NSF (N-ethylmaleimide sensitive factor), GRIN2D (glutamate receptor, anionic, N-methyl D-aspartate 2D), ADORA1 (adenosine A1 receptor), GABRA2 (gamma) -Aminobutyric acid (G BA) A receptor, alpha 2), GLRA1 (glycine receptor, alpha 1), CHRM3 (cholinergic receptor, muscarinic 3), CHAT (choline acetyltransferase), KNG1 (kininogen 1), HMOX2 (heme oxygenase ( Recycling) 2), DRD4 (dopamine receptor D4), MAOA (monoamine oxidase A), CHRM2 (cholinergic receptor, muscarinic 2), ADORA2A (adenosine A2a receptor), STXBP1 (syntaxin binding protein 1), GABRA3 (Gamma-aminobutyric acid (GABA) A receptor, alpha 3), TPH1 (tryptophan hydroxylase 1), HCRTR1 (hypocretin (orexin) receptor 1), HCRTR2 (hypocretin (orexin) receptor 2) ), CHRM1 (cholinergic receptor, muscarinic 1), FOLH1 (folate hydrolase (prostate specific membrane antigen) 1), AANAT (arylalkylamine N-acetyltransferase), INS (insulin), NR3C2 (nuclear receptor sub) Family 3, group C, member 2), FAAH (fatty acid amide hydrolase), GALR2 (galanin receptor 2), ADCYAP1 (adenylate cyclase activating polypeptide 1 (pituitary)), PPP1R1B (protein phosphatase 1, regulation) (Inhibitor) Subunit 1B), HOMER1 (Homer homolog 1 (Drosophila)), ADCY10 (Adenylate cyclase 10 (soluble)), PSEN2 (Presenilin 2 (Alzheimer's disease 4)), UBE3A (ubiquitin tamper) Ligase E3A), SOD1 (superoxide dismutase 1, soluble), LYN (v-yes-1 Yamaguchi sarcoma virus-related oncogene homolog), TSC2 (tuberous sclerosis 2), PRKCA (protein kinase C, alpha), PPARG (peroxisome proliferator activated receptor gamma), ESR1 (estrogen receptor 1), NTRK1 (neurotrophic tyrosine kinase, receptor type 1), EGFR (epidermal growth factor receptor (erythroblastic leukemia virus) (V-erb-b) oncogene homologue, bird)), S100B (S100 calcium binding protein B), NTRK3 (neurotrophic tyrosine kinase, receptor, type 3), PLCG2 (phospholipase C, gamma 2 (phosphatidylinositol) Specific)), NTRK2 (neurotrophic chi Synkinase, receptor, type 2), DNMT1 (DNA (cytosine-5-)-methyltransferase 1), EGF (epidermal growth factor (beta-urogastrone)), GRIA3 (glutamate receptor, ionic, AMPA3), NCAM1 (neuronal cell adhesion molecule 1), CDKN1A (cyclin-dependent kinase inhibitor 1A (p21, Cip1)), BCL2L1 (BCL2-like 1), TP53 (tumor protein p53), CASP9 (caspase 9, apoptosis-related cysteine peptidase), CCKBR (cholecystokinin B receptor), PARK2 (Parkinson's disease (autosomal recessive, juvenile) 2, parkin), ADRA1B (adrenergic, alpha-1B-, receptor), CASP3 (caspase 3, apoptosis-related cysteine pep Thidase), PRNP (prion protein), CRHR1 (corticotropin releasing hormone receptor 1), L1CAM (L1 cell adhesion molecule), NGFR (nerve growth factor receptor (TNFR superfamily, member 16)), CREB1 (cAMP) Responsive element connection
Combined protein 1), PLCG1 (phospholipase C, gamma 1), CAV1 (caveolin 1, caveolae protein, 22 kDa), ABCC8 (ATP binding cassette, subfamily C (CFTR / MRP), member 8), ACTN2 (actinin, alpha 2) ), GRIA2 (glutamate receptor, anionic, AMPA2), HPRT1 (hypoxanthine phosphoribosyltransferase 1), SYN1 (synapsin I), CSNK2A1 (kazen kinase 2, alpha1 polypeptide), GRIK1 (glutamate receptor, counterion) Sex, kainic acid 1), ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), AVPR2 (arginine vasopressin receptor 2), HTR4 (5-hydroxytris) Tamine (serotonin) receptor 4), C3 (complement component 3), AGT (angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), AGTR1 (angiotensin II receptor, type 1), CDK5 ( Cyclin-dependent kinase 5), LRP1 (low density lipoprotein receptor-related protein 1), ARRB2 (arrestin, beta 2), PLD2 (phospholipase D2), OPRD1 (opioid receptor, delta 1), GNB3 (guanine nucleotide binding protein) (G protein), beta polypeptide 3), PIK3CG (phosphoinositide-3-kinase, catalyst, gamma polypeptide), APAF1 (apoptotic peptidase activator 1), SSTR2 (somatostatin receptor 2), IL2 (in -Leukin 2), ADORA3 (adenosine A3 receptor), ADRA1A (adrenergic, alpha-1A-, receptor), HTR7 (5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase binding)), ADRBK2 (adrenergic) , Beta, receptor kinase 2), ALOX5 (arachidonic acid 5-lipoxygenase), NPR1 (natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic peptide receptor A)), AVPR1A (arginine vasopressin receptor 1A) ), CHRNB1 (cholinergic receptor, nicotinic, beta1 (muscle)), SET (SET nuclear oncogene), PAH (phenylalanine hydroxylase), POMC (proopiomelanocortin), LEPR (leptin receptor) ), SDC2 (syndecan 2), VIPR1 (vasoactive intestinal peptide receptor 1), DBI (diazepam binding inhibitor (GABA receptor modulator, acyl-coenzyme A binding protein)), NPY1R (neuropeptide Y receptor Y1) ), NPR2 (natriuretic peptide receptor B / guanylate cyclase B (atrial natriuretic peptide receptor B)), CNR2 (cannabinoid receptor 2 (macrophage)), LEP (leptin), CCKAR (cholecystokinin A receptor) Body), GLRB (glycine receptor, beta), KCNQ2 (potassium voltage-gated channel, KQT-like subfamily, member 2), CHRNA2 (cholinergic receptor, nicotinic, alpha 2 (neural type)), BDKRB2 (bradykinin) Receptor B2), CHRNA1 Cholinergic receptor, nicotinic, alpha 1 (muscle)), CHRND (cholinergic receptor, nicotinic, delta), CHRNA7 (cholinergic receptor, nicotinic, alpha 7), PLD1 (phospholipase D1, phosphatidylcholine specific) ), NRXN1 (neulexin 1), NRP1 (neuropilin 1), DLG3 (disc, large homolog 3 (Drosophila)), GNAQ (guanine nucleotide binding protein (G protein), q polypeptide), DRD1 (dopamine receptor) D1), PRKG1 (protein kinase, cGMP-dependent, type I), CNTNAP2 (contactin-related protein-like 2), EDN3 (endothelin 3), ABAT (4-aminobutyric acid aminotransferase), TDO2 (tryptophan 2,3- Oxygenase), neuro D1 (neurogenic differentiation 1), CHRNE (cholinergic receptor, nicotinic, epsilon), CHRNB2 (cholinergic receptor, nicotinic, beta 2 (neurotype)), CHRNB3 (cholinergic receptor) Nicotinic, beta 3), HTR1D (5-hydroxytryptamine (serotonin) receptor 1D), ADRA1D (adrenergic, alpha-1D-, receptor), HTR2B (5-hydroxytryptamine (serotonin) receptor 2B), GRIK3 (glutamate receptor, anionic, kainate 3), NPY2R (neuropeptide Y receptor Y2), GRIK5 (glutamate receptor, anionic, kainate 5), GRIA4 (glutamate receptor, anionic, AMPA4), EDN1 (endothelin 1), PRLR (Prolactin receptor), GABRB1 (gamma-aminobutyric acid (GABA) A receptor, beta 1), GARS (glycyl-tRNA synthetase), GRIK2 (glutamate receptor, ionic, kainate 2), ALOX12 (arachidonic acid) 12-lipoxygenase), GAD2 (glutamate decarboxylase 2 (islet and brain, 65 kDa)), LHCGR (luteinizing hormone / coryogonadotropin receptor), SHMT1 (serine hydroxymethyltransferase 1 (soluble)), PDXK (pyridoxal (pyridoxine, Vitamin B6) kinase), LIF (leukemia inhibitory factor (cholinergic differentiation factor)), PLCD1 (phospholipase C, delta 1), NTF3 (neurotrophin 3), NFE2L2 (nuclear factor (red blood cells) 2) like 2), PLCB4 (phospholipase C, beta 4), GNRHR (gonadotropin releasing hormone receptor), NLGN1 (neurolidine 1), PPP2R4 (protein phosphatase 2A activator, regulatory subunit 4), SSTR3 (somatostatin receptor) Body 3), CRHR2 (adrenocorticotropic hormone releasing hormone receptor 2), NGF (nerve growth factor (beta polypeptide)), NRCAM (neural cell adhesion molecule), NRXN3 (neulexin 3), GNRH1 (gonadotropin releasing hormone) 1 (Luteinizing Release Hormone)), TRHR (Thyroid Stimulating Hormone Releasing Hormone Receptor), ARRB1 (Arrestin, Beta 1), INPP1 (Inositol Polyphosphate-1-phosphatase), PTN (Pleiotrophin), PSM 10 (proteasome (prosome, macropine) 26S subunit, non-ATPase, 10), DLG1 (disk, large homolog 1 (Drosophila)), PSMB8 (proteasome (prosome, macropine) subunit, beta type, 8 (large Multifunctional peptidase 7)), CYCS (cytochrome c, somatic), ADORA2B (adenosine A2b receptor), ADRB3 (adrenergic, beta-3-, receptor), CHGA (chromogranin A (parathyroid secreted protein 1) ), ADM (adrenomedullin), GABRP (gamma-aminobutyric acid (GABA) A receptor, pie), GLRA2 (glycine receptor, alpha 2), PRKG2 (protein kinase, cGMP-dependent, type II), GLS (glutaminase) , TA CR3 (tachykinin receptor 3), ALDH7A1 (aldehyde dehydrogenase 7 family, member A1), GABBR2 (gamma-aminobutyric acid (GABA) B receptor, 2), GDNF (glial cell-derived neurotrophic factor), CNTFR (hair-like) Somatotrophic factor receptor), CNTN2 (contactin 2 (axon)), TOR1A (tocin family 1, member A (tocin A)), CNTN1 (contactin 1), CAMK1 (calcium / calmodulin-dependent protein kinase I) , NPPB (natriuretic peptide precursor B), OXTR (oxytocin receptor), OSM (oncostatin M), VIPR2 (vasoactive intestinal peptide receptor 2), CHRNB4 (cholinergic receptor, nicotinic, beta 4) , CHRNA5 (choline Receptor, nicotinic, alpha5), AVP (arginine vasopressin), RELN (Reelin), GRLF1 (glucocorticoid receptor DNA binding factor 1), NPR3 (natriuretic peptide receptor C / guanylate cyclase C (atrial) Natriuretic peptide receptor C)), GRIK4 (glutamate receptor, counterionic, kainic acid 4), KISS1 (KiSS-1 transfer inhibition), HTR5A (5-hydroxytryptamine (serotonin) receptor 5A), ADCYAP1R1 (A Denylate cyclase activating polypeptide 1 (pituitary) receptor type I), GABRA4 (gamma-aminobutyric acid (GABA) A receptor, alpha 4), GLRA3 (glycine receptor, alpha 3), INHBA (inhibin, Beta A), DLG2 (D , Large homolog 2 (Drosophila)), PPYR1 (pancreatic polypeptide receptor 1), SSTR4 (somatostatin receptor 4), NPPA (natriuretic peptide precursor A), SNAP23 (synaptosome-related protein, 23 kDa), AKAP9 ( A kinase (PRKA) anchor protein (yotiao) 9), NRXN2 (neulexin 2), FHL2 (four half LIM domain 2), TJP1 (tight junction protein 1 (closed zone 1)), NRG1 (neuregulin) 1), CAMK4 (calcium / calmodulin-dependent protein kinase IV), CAV3 (caveolin 3), VAMP2 (vesicle-associated membrane protein 2 (synaptobrevin 2)), GALR1 (galanin receptor 1), GHRHR (growth hormone-releasing protein) Rumon receptor), HTR1E (5-hydroxytryptamine (serotonin) receptor 1E), PENK (proenkephalin), HTT (huntingtin), HOXA1 (homeobox A1), NPY5R (neuropeptide Y receptor Y5), UNC119 ( unc-119 homologue (Caenolabditis elegans)), TAT (tyrosine aminotransferase), CNTF (ciliary neurotrophic factor), SHMT2 (serine hydroxymethyltransferase 2 (mitochondria)), ENTPD1 (ectonucleoside 3) Phosphate diphosphohydrolase 1), GRIP1 (glutamate receptor interacting protein 1), GRP (gastrin releasing peptide), NCAM2 (nerve cell adhesion molecule 2), SSTR1 (somatostatin receptor 1), LTB (clathrin, light chain (Lcb)), DAO (D-amino acid oxidase), QDPR (quinoid dihydropteridine reductase), PYY (peptide YY), PNMT (phenylethanolamine N-methyltransferase), NTSR1 (neurotensin receptor) Body 1 (high affinity)), NTS (neurotensin), HCRT (hypocretin (orexin) neuropeptide precursor), SNAP29 (synaptosome related protein, 29 kDa), SNAP91 (synaptosome related protein, 91 kDa homolog (mouse)), MADD (MAP-kinase activated cell death domain), IDO1 (indoleamine 2,3-dioxygenase 1), TPH2 (tryptophan hydroxylase 2), TAC3 (tachykinin 3), RIN3A (glutamate receptor, anionic, N-methyl-D-aspartate 3A), REN (renin), GALR3 (galanine receptor 3), MAGI2 (membrane-associated guanylate kinase, WW and PDZ domain containing 2), KCNJ9 (potassium inward rectifier channel, subfamily J, member 9), BDKRB1 (bradykinin receptor B1), CHRNA6 (cholinergic receptor, nicotinic, alpha6), CHRM5 (cholinergic receptor, muscarinic 5) CHRNG (cholinergic receptor, nicotinic, gamma), SLC6A1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1), ENTPD2 (ectonucleoside triphosphate diphosphohydrolase 2), CALCB (calcitonin) Related polypeptide beta) , SHBG (sex hormone binding globulin), serpin A6 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6), NRG2 (neuregulin 2), PNOC (prepronociceptin), NAPA (N -Ethyloma
Reimide-sensitive factor binding protein, alpha), PICK1 (protein interaction with PRKCA 1), PLCD4 (phospholipase C, delta 4), GCDH (glutaryl-coenzyme A dehydrogenase), NLGN2 (neurolidine 2), NBEA (new lobby) Chin), ATP10A (ATPase, class V, 10A type), RAPGEF4 (Rap guanine nucleotide exchanger (GEF) 4), UCN (urocortin), PCSK6 (proprotein convertase subtilisin / kexin type 6), HTR1F (5 -Hydroxytryptamine (serotonin) receptor 1F), SGCB (sarcoglycan, beta (43 kDa dystrophin-related glycoprotein)), GABRQ (gamma-aminobutyric acid (GABA) receptor, theta), HRL (ghrelin / obstatin prepropeptide), NCALD (neurocalcin delta), neuro D2 (neurogenic differentiation 2), DPEP1 (dipeptidase 1 (kidney)), SLC1A4 (solute carrier family 1 (glutamic acid / neutral amino acid) Transporter), member 4), DNM3 (dynamin 3), SLC6A12 (solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12), SLC6A6 (solute carrier family 6 (neurotransmitter transporter, taurine) ), Member 6), YME1L1 (YME1-like 1 (budding yeast)), VSNL1 (vicinin-like 1), SLC17A7 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7), HOMER2 (homer homology) Body 2 (Drosophila)), YT7 (synaptotagmin VII), TFIP11 (tufterin interacting protein 11), GMFB (glial maturation factor, beta), PREB (prolactin regulatory element binding), NTSR2 (neurotensin receptor 2), NTF4 (neurotrophin 4), PPP1R9B (Protein phosphatase 1, regulatory (inhibitor) subunit 9B), DISC1 (schizophrenia vulnerability 1), NRG3 (neuregulin 3), OXT (oxytocin, prepropeptide), TRH (thyroid stimulating hormone releasing hormone), NISCH (Niscalin), CRHBP (corticotropin-releasing hormone binding protein), SLC6A13 (solute carrier family 6 (neurotransmitter transporter, GABA), member 13), NPPC (natriuretic peptide) Precursor C), CNTN3 (contactin 3 (plasmacytoma-related)), KAT5 (K (lysine) acetyltransferase 5), CNTN6 (contactin 6), KIAA0101 (KIAA0101), PANX1 (p annexin 1), CTSL1 (cathepsin L1) ), EARS2 (glutamyl-tRNA synthetase 2, mitochondria (presumed)), CRIPT (cysteine-rich PDZ binding protein), CORT (cortisatin), DLGAP4 (disc, large (Drosophila) homolog-related protein 4), ASTN2 (ASTROTAC 2), HTR3B (5-hydroxytryptamine (serotonin) receptor 3B), PMCH (pro-melanin-concentrating hormone), TSPO (transporter protein (18 kDa)), GDF2 (adult) Differentiation factor 2), CNTNAP1 (contactin-related protein 1), GNRH2 (gonadotropin-releasing hormone 2), AUTS2 (autism susceptibility candidate 2), SV2C (synaptic vesicle glycoprotein 2C), CARTPT (CART prepropeptide), NSUN4 ( NOP2 / Sun domain family, member 4), CNTN5 (contactin 5), NEUROD4 (neurogenic differentiation 4), NEUROG1 (neurogenin 1), SLTM (SAFB-like, transcriptional modulator), GNRHR2 (gonadotropin releasing hormone (type 2)) Receptor 2), ASTN1 (astrotactin 1), SLC22A18 (solute carrier family 22, member 18), SLC17A6 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), men -6), GABRR3 (gamma-aminobutyric acid (GABA) receptor, RHO (rho) 3), DAOA (D-amino acid oxidase activator), ENSG000003384, nd NOS2P1 (nitric oxide synthase 2 pseudogene 1) .

  Exemplary neurotransmission-related proteins include 5-HTT (5-hydroxytryptamine transporter), SLC6A4 (solute carrier family 6, member 4), COMT (catechol-O-methyltransferase), DRD1A (dopamine receptor D1A), SLC6A3 (solute carrier family 6, member 3), DAO1 (D-amino acid oxidase), DTNBP1 (dystrobrevin binding protein 1), and any combination thereof are included.

In certain embodiments, using animals produced by the methods of the present invention, using measurements commonly used in the study of neurotransmission disorders, mutations that affect the onset and / or progression of animals and neurotransmission disorders. Study the impact.

ii. Pharmacological model

  The methods of the invention can be used to create animals or cells that can be used as pharmacological models. Such a pharmacological model may be a model for pharmacokinetics or a model for pharmacokinetics. For example, in one embodiment, the methods of the invention can be used to create animals or cells that contain chromosomal edits in one or more nucleic acid sequences associated with metabolism of a pharmaceutically active compound. Such animals or cells can be used to study the effect of nucleic acid sequences on pharmaceutical compounds.

  Alternatively, the methods of the invention can be used to create animals or cells that contain chromosomal editing in disease-related sequences. Such animals or cells can be used to assess the effects of therapeutic agents on the development or progression of the disease. For example, the effect of a therapeutic agent can be measured in a “humanized” animal so that the information obtained therefrom can be used to predict the effect of the agent in humans. In general, the method comprises contacting a genetically modified animal comprising at least one edited chromosomal sequence encoding a protein associated with a disease with a therapeutic agent, and determining the result of a selected parameter as a wild-type animal. Comparison with the results obtained from contacting the same agent. Non-limiting examples of suitable diseases include those listed in Section II (a) i.

  Also provided are methods for assessing the effect of a drug in an isolated cell comprising at least one edited chromosomal sequence encoding a protein associated with a disease, as well as such cells (or genetic modifications disclosed herein) There is also provided a method for assessing the effect of a drug using a lysate of a cell derived from a cultured animal). For example, the role of a particular protein associated with a disease in the metabolism of a particular drug can be determined using such methods. Similarly, substrate specificity and pharmacokinetic parameters can be readily determined using such methods. Those skilled in the art are familiar with suitable tests and / or procedures.

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with toxicology has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above. Any chromosomal sequence or protein involved in absorption, distribution, metabolism, and excretion (ADME), and toxicology may be utilized for the purposes of the present invention. ADME and toxicology-related proteins are typically selected based on experimental association of proteins with ADME and toxicology-related disorders. For example, production rates or circulating concentrations of ADME and toxicology-related proteins can be increased or suppressed in populations with ADME and toxicology disorders compared to populations lacking ADME and toxicology disorders. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  Illustrative non-limiting examples of chromosomal sequences or proteins involved in ADME and toxicology include: Oct1, Oct2, Hfe2, Ppar (alpha) MDR1a (ABC transporter ABCB1a), MDR1b (ABCB1b), BCRP (ABCC1), MRP1 (ABCG2), MRP2 (ABCC2, cMOAT), and combinations thereof may be selected.

  A further aspect of the present disclosure includes a method for assessing the effect of a drug. Suitable agents include, without limitation, pharmaceutically active ingredients, drugs, food additives, pesticides, herbicides, poisons, industrial chemicals, household chemicals, and other environmental chemicals. For example, the effect of a drug can be measured in a “humanized” genetically modified animal so that the information obtained therefrom can be used to predict the effect of the drug in humans. In general, the method comprises a genetically modified animal comprising at least one inactivated chromosomal sequence involved in ADME and toxicology, and at least one chromosome encoding an orthologous human protein involved in ADME and toxicology. Contacting the sequence incorporated therein with the drug and comparing the results of the selected parameters with the results obtained from contacting the wild-type animal with the same drug. The selected parameters are: (a) the rate of elimination of the drug or its metabolite, (b) the circulating level of the drug or its metabolite, (c) the bioavailability of the drug or its metabolite, (d) the drug Or (e) the rate of clearance of the drug or its metabolite, (f) the toxicity of the drug or its metabolite, (g) the effectiveness of the drug or its metabolite, (h) the drug or Including but not limited to the pharmacokinetics of the metabolite and (i) extrahepatic contributions to the metabolic rate and clearance of the drug or its metabolite.

  Also provided are methods for assessing the effect of a drug in an isolated cell comprising at least one edited chromosomal sequence involved in ADME and toxicology, as well as such cells (or genetically modified as disclosed herein). There is also provided a method for assessing the effect of a drug using a lysate of cells derived from a living animal. For example, the role of specific proteins involved in ADME and toxicology in the metabolism of specific drugs can be determined using such methods. Similarly, substrate specificity and pharmacokinetic parameters can be readily determined using such methods. Those skilled in the art are familiar with suitable tests and / or procedures.

  Among the proteins of interest involved in drug ADME and toxicology are ABC transporters, also known as efflux transport proteins. Thus, for example, the genetically modified animals described herein containing an edited chromosomal sequence encoding an ABC transporter can be used to screen for biologically active agents, including drugs, as well as those Can be useful for investigating the distribution, efficacy, metabolism, and / or toxicity. These screening methods are particularly useful for assessing drug kinetics with improved predictability in the genetically modified animals described herein, eg, in genetically modified rats as a human model. Useful. Accordingly, the present disclosure also features a method for assessing an ADME profile of a drug in a genetically modified animal as part of a drug screening or evaluation process. Candidate therapeutics, ie, candidate drugs, can be administered to genetically modified animals that include target gene knockout and / or expressed transgenes achieved through the use of ZFNs. A knockout or knockin gene is associated with at least one aspect of drug ADME profile or toxicology, and / or metabolism, and may be derived from a mouse, rat, or human genome.

  For example, a method for screening a test compound target is a membrane in which any one or more of ABC transporters such as Mdr1a, Mdr1b, PXR, BCRP, MRP1, or MRP2 is knocked out and is therefore mediated by a knockout protein. Genetically modified animals that inhibit or eliminate through transport can be utilized. Such animals may be exposed to test compounds suspected of inhibiting the transporter activity of the knockout protein. Inhibition of transport by a compound in a genetically modified animal can be determined using any of a number of routine laboratory tests and techniques, and inhibition of transport can be determined in the wild treated with the same test compound. It may be compared to that observed in a type animal. The difference in the effect of the test compound in the two animals can be an indication of the target of the test compound. Furthermore, inhibition of one or more ABC transporter proteins such as Mdr1a, Mdr1b, PXR, BCRP, MRP1, or MRP2 may improve certain ADME characteristics of candidate therapeutics. For example, absorption or efficacy of a candidate therapeutic compound can be improved by knocking out the expression of one or more ABC transporter proteins such as Mdr1a, Mdr1b, PXR, BCRP, MRP1, or MRP2 in a particular tissue. Thus, the genetically modified animals and cells described herein, eg, genetically modified animals and cells that contain genetic modifications of one or more ABC transporter proteins, to identify the target of a test compound It will be appreciated that, or to identify methods in which the ADME characteristics and toxicology of a candidate compound can be improved, it can be advantageously used in many methods for evaluating the ADME and toxicology characteristics of a candidate therapeutic compound.

  The overwhelming need to accurately predict how drugs and environmental chemicals will affect a large population can be easily understood. The genetically modified animals, embryos, cells, and cell lines described herein can be used to analyze the manner in which various compounds interact with biological systems. Genetically modified cells and cell lines are used to improve the predictive capabilities of cell-based assay systems, such as assays used to assess new molecular components and possible drug-drug interactions, for example. Thus, much of the known complexity in biological systems can be adjusted. More specifically, it is recognized that biological systems typically include multiple components that are responsive to exposure to new, potentially harmful compounds.

  The “ADMET system” is described as containing five components. The first component is a biological system that, when perturbed, signals to activate the drug metabolism system and can include stress responses and DNA repair pathways. Once the drug metabolism system is activated, the “foreign sensor” puts extraneous molecules that need to be removed under monitoring. The detection of foreign molecules by a foreign sensor then activates a series of gene inductions that upregulate the enzymes involved in metabolizing the foreign molecules into a form for easier removal. The third ADMET component enzyme comprises a phase I enzyme comprising at least three classes of oxidases, of which the best known class is the cytochrome P450 class. Cytochrome 450 enzymes typically add reactive hydroxyl moieties to potential toxins to inactivate them, making the toxins more polar (soluble). The fourth component of the ADMET system includes at least seven classes of enzymes that further alter the product of phase I enzymatic modification. Typically, these enzymes are conjugated enzymes that add a hydrophilic moiety to make already oxidized xenobiotics more water-soluble ADMET and are easily collected and excreted through urine and bile. . The last component is a transport system with transporter proteins, such as an ABC transporter, that functions as a molecular pump that facilitates the movement of xenobiotics from one tissue to another. Transporter proteins are involved in moving drugs into, out of or through cells.

  Each component of the ADMET system has a unique set of substrate structure specificities that must be considered by any assay. For each essential member of each of the five component classes, there is a group of genetic polymorphisms in the population that can dramatically affect activity on specific xenobiotic chemical structures, further increasing predictability. Make it a bigger challenge. The growing field of pharmacogenomics addresses the challenges created by such genetic variation. In addition, it is also known that sex differences in the manner in which different components of the xenobiotic system react play a role in changes in drug metabolism.

  Thus, the genetically modified animals, cells, and particularly cell lines described herein serve as the basis for cell-based assays with improved predictive capabilities with respect to drug clinical outcomes or chemical toxicological issues. Will be useful. A panel of cell lines is explicitly contemplated for such purposes. For example, cell-based assays can be created that are representative of target tissues where drug compound metabolism or toxicity is likely to occur. At present, standard assays are usually performed on transformed cell lines derived from the target tissue and have several harmonized functional properties. Genetically modified and differentiated pluripotent cells can be used to replace immortalized cell components in order to create better cell-based assays that better represent the natural state. That is, genetically modified cell lines can be used in more highly predictive cell-based assays suitable for high-throughput, high-content compound screening.

  Thus, this disclosure contemplates ZFN-mediated genetic modification of genes associated with portions of the xenobiotic metabolism machinery. Such modifications include reporter tag knockout, knockin, introduction of specific mutations known to affect activity, or combinations thereof. For example, using genetically modified cells and cell lines, transporter panels that reflect tissue-specific, sex-specific, and / or population, cell-based foreign sensors that functionally reflect tissue-specific and population Assay panels can be created as well as induction assays that measure genetic activation of different drug metabolism components and overt toxicological responses such as genotoxicity, cardiotoxicity, and apoptosis.

In accordance with the present disclosure, tissue-specific strains that have been modified to isolate specific transporter activity and predict population responses to individual chemical components can be established. For example, using ZFNs, important and common polymorphisms in enterocyte cell lines, as well as representative cell lines of the liver, blood-brain-barrier (brain microvascular endothelial cells), kidney, and any Transporter gene knockouts in intestinal cell lines can be created, such as for introduction into relevant tissue-specific cell lines. A panel of cell lines shows knockouts of individual transporter proteins (eg, MDR-1, MRP1, 2, 3, 4, 6, BCRP), combinations of knockouts to isolate the effects of individual transporters (eg, , BCRP and MRP2, MDR-1 and MRP2, MRP-3 and MRP1), and intestinal cells (Caco2 or BBe1) with transporter-deficient strains (ie, all 7 transporters have been knocked out). The panel of enterocytes may include OATP-2B1, PEPT-1, and OCT-N2 knockouts. A panel of enterocytes can be created that includes common polymorphisms in the major transporter genes that affect drug transport and are of interest to pharmaceutical researchers.

  Three foreign sensors (PXR, AhR, and CAR) in humans are known to have overlapping specificity in response to xenobiotics. Knowing how much foreign substance sensors are activated by any particular chemical compound is also an important consideration for understanding drug reactions and drug-drug interactions. Creating a panel of cells that report induction by a foreign sensor can delineate the specificity. In a foreign body sensor, further modifying the cells to address functionally important polymorphisms will allow population prediction. ZFNs can be used to create knockout cell lines similar to the transporter knockout cell lines described above, and reporter cell lines that express different fluorescent proteins upon induction of different foreign sensors. For example, a cell line can be created that expresses green FP when PXR is induced, red FP when CAR activity is induced, and blue FP when AhR is induced. All strains can be constructed in the relevant tissue type cell lines, ie intestine, liver, kidney, brain, and heart. It represents a tissue most involved in drug toxicity and metabolism, and can create a panel of cells in which each foreign sensor (CAR, PXR, AhR) is knocked out. In addition, when each of the three foreign matter sensors is activated, a cell line that produces a fluorescent protein can also be produced.

Also contemplated are induction assays for ADME biotransformation and toxicological response genes. Currently, the activities of each of the many phase I and phase II enzymes can be performed in a simple biochemical assay, while the available assays are not limited to any particular exogenous xenobiotic. Enzyme induction cannot be measured in a high-throughput manner. Described herein, ZFN is used to provide a basis for assays that can measure up / down regulation of key phase I and phase II enzymes along with genes involved in toxicological reactions. Genetically modified cell lines can be created. For example, ZFN can be used to create strains with a reporter gene (eg, encoding a fluorescent protein or luciferase) that is inserted proximal to the promoter of the gene being measured. These gene targets may be any of the essential phase I, phase II, transporters, genotoxic agents, or components of the apoptosis / necrosis pathway. It can also create a panel of tissue-specific cells that report on the activation of genes encoding either phase I or phase II enzymes, transporters, or toxic response pathways (eg genotoxicity or apoptosis). it can.


iii. Developmental model

  The methods of the invention can be used to create animals or cells that can be used as development models. Such models can be used to study embryogenesis, organ development, organ system development, and the like. For example, in one embodiment, the methods of the invention can be used to create an animal or cell that includes chromosomal editing in one or more nucleic acid sequences associated with the development of an organ or organ system. Non-limiting examples of organs include brain, eye, nose, ear, throat, mouth (including teeth, tongue, lips, gums), spinal cord, bone, heart, blood vessel, lung, liver, pancreas, gallbladder, spleen, Examples include the esophagus, stomach, small intestine, large intestine, appendix, rectum, bladder, reproductive organs, immune system organs (including thyroid, lymph nodes, lymph vessels), and endocrine organs. Non-limiting examples of organ systems include the nervous system, circulatory system, digestive system, respiratory system, skeletal system, lymphatic system, reproductive system, muscular system, integumental system, excretory system, and endocrine system.

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with neurodevelopment has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above. The chromosomal sequence associated with neural development can be a protein coding sequence or a regulatory sequence. In certain embodiments, the neurodevelopmental sequence may be associated with a neurodevelopmental disorder, a biochemical pathway associated with a neurodevelopmental disorder, or associated with a disorder such as phenylketonuria that is closely associated with a neurodevelopmental disorder Can do.

Non-limiting examples of neurodevelopment related sequences include A2BP1 [Ataxin 2 binding protein 1], AADAT [amino adipate aminotransferase], AANAT [arylalkylamine N-acetyltransferase], ABAT [4-aminobutyric acid aminotransferase]. , ABCA1 [ATP binding cassette, subfamily A (ABC1), member 1], ABCA13 [ATP binding cassette, subfamily A (ABC1), member 13], ABCA2 [ATP binding cassette, subfamily A (ABC1), member 2 ], ABCB1 [ATP binding cassette, subfamily B (MDR / TAP), member 1], ABCB11 [ATP binding cassette, subfamily B (MDR / TAP), member 11], ABCB [ATP binding cassette, subfamily B (MDR / TAP), member 4], ABCB6 [ATP binding cassette, subfamily B (MDR / TAP), member 6], ABCB7 [ATP binding cassette, subfamily B (MDR / TAP) ), Member 7], ABCC1 [ATP binding cassette, subfamily C (CFTR / MRP), member 1], ABCC2 [ATP binding cassette, subfamily C (CFTR / MRP), member 2], ABCC3 [ATP binding cassette, Subfamily C (CFTR / MRP), member 3], ABCC4 [ATP binding cassette, subfamily C (CFTR / MRP), member 4], ABCD1 [ATP binding cassette, subfamily D (ALD), member 1], ABCD3 [ATP Cassette, subfamily D (ALD), member 3], ABCG1 [ATP binding cassette, subfamily G (WHITE), member 1], ABCG2 [ATP binding cassette, subfamily G (WHITE), member 2], ABCG4 [ ATP binding cassette, subfamily G (WHITE), member 4], ABHD11 [abhydrolase domain containing 11], ABI1 [abl-interacting factor 1], ABL1 [c-abl oncogene 1, receptor tyrosine kinase], ABL2 [V-abl Abelson murine leukemia virus oncogene homolog 2 (arg, Abelson-related gene)], ABLIM1 [actin-binding LIM protein 1], ABLIM2 [actin-binding LIM protein family, member 2], ABLIM3 [Actin-binding LIM protein family, member 3], ABO [ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase)], ACAA1 [acetyl- Coenzyme A acyltransferase 1], ACACA [acetyl-coenzyme A carboxylase alpha], ACACB [acetyl-coenzyme A carboxylase beta], ACADL [acyl-coenzyme A dehydrogenase, long chain], ACADM [acyl-coenzyme A Dehydrogenase, C-4 to C-12 linear], ACADS [acyl-coenzyme A dehydrogenase, C-2 to C-3 short chain], ACADSB [acyl-coenzyme A dehydrogenase, short / branched chain], CAN [Aggrecan], ACAT2 [acetyl-coenzyme A acetyltransferase 2], ACCN1 [amylolide-sensitive cation channel 1, neural type], ACE [angiotensin I converting enzyme (peptidyl-dipeptidase A) 1], ACE2 [angiotensin I Converting enzyme (peptidyl-dipeptidase A) 2], ACHE [acetylcholinesterase (Yt blood group)], ACLY [ATP citrate lyase], ACO1 [aconitase 1, soluble], ACTA1 [actin, alpha 1, skeletal muscle], ACTB [actin, beta], ACTC1 [actin, alpha, myocardium 1], ACTG1 [actin, gamma1], ACTL6A [actin-like 6A], ACTL6B [actin-like 6B], ACTN1 [actinin, alpha1 ACTR1A [ARP1 actin-related protein 1 homolog A, centlactin alpha (yeast)], ACTR2 [ARP2 actin-related protein 2 homolog (yeast)], ACTR3 [ARP3 actin-related protein 3 homolog (yeast)], ACTR3B [ ARP3 actin-related protein 3 homolog B (yeast)], ACVR1 [activin A receptor, type I], ACVR2A [activin A receptor, type IIA], ADA [adenosine deaminase], ADAM10 [ADAM metallopeptidase domain 10], ADAM11 [ADAM metallopeptidase domain 11], ADAM12 [ADAM metallopeptidase domain 12], ADAM15 [ADAM metallopeptidase domain 15], ADAM17 [ADAM metallopeptidase Domain 17], ADAM18 [ADAM metallopeptidase domain 18], ADAM19 [ADAM metallopeptidase domain 19 (meltlin beta)], ADAM2 [ADAM metallopeptidase domain 2], ADAM20 [ADAM metallopeptidase domain 20], ADAM21 [ADAM metallopeptidase Domain 21], ADAM22 [ADAM metallopeptidase domain 22], ADAM23 [ADAM metallopeptidase domain 23], ADAM28 [ADAM metallopeptidase domain 28], ADAM29 [ADAM metallopeptidase domain 29], ADAM30 [ADAM metallopeptidase domain 30], ADAM8 [ADAM metallopeptidase domain 8], ADAM9 [ADAM Ropeptidase domain 9 (meltrin gamma)], ADAMTS1 [ADAM metallopeptidase having thrombospondin type 1 motif, 1], ADAMTS13 [ADAM metallopeptidase having thrombospondin type 1 motif, 13], ADAMTS4 [thrombospondin ADAM metallopeptidase with type 1 motif, 4], ADAMTS5 [ADAM metallopeptidase with thrombospondin type 1 motif, 5], ADAP2 [ArfGAP 2 with double PH domain], ADAR [adenosine deaminase, RNA specific] ADARB1 [adenosine deaminase, RNA specific, B1 (RED1 homolog rat)], ADCY1 [adenylate cyclase 1 (brain)], ADCY10 [adenylate] Clease 10 (soluble)], ADCYAP1 [adenylate cyclase activating polypeptide 1 (pituitary)], ADD1 [adducin 1 (alpha)], ADD2 [adducin 2 (beta)], ADH1A [alcohol dehydrogenase 1A (class I), alpha polypeptide], ADIPOQ [containing adiponectin, C1Q and collagen domain], ADK [adenosine kinase], ADM [adrenomedullin], ADNP [activity-dependent neuroprotective homeobox], ADORA1 [adenosine A1 receptor], ADORA2A [Adenosine A2a receptor], ADORA2B [Adenosine A2b receptor], ADORA3 [Adenosine A3 receptor], ADRA1B [Adrenergic, alpha-1B-, receptor], ADRA2A [A Lenargic, alpha-2A-, receptor], ADRA2B [adrenergic, alpha-2B-, receptor], ADRA2C [adrenergic, alpha-2C-, receptor], ADRB1 [adrenergic, beta-1-, Receptor], ADRB2 [adrenergic, beta-2-, receptor, surface], ADRB3 [adrenergic, beta-3-, receptor], ADRBK2 [adrenergic, beta, receptor kinase 2], ADSL [adenylo succinate Acid lyase], AFF2 [AF4 / FMR2 family, member 2], AFM [afamin], AFP [alpha-fetal protein], AGAP1 [ArfGAP with GTPase domain, ankyrin repeat and PH domain 1], AGER [final glycation product specific Receptor], AGFG 1 [ArfGAP 1 with FG repeat], AGPS [alkylglycerone phosphate synthase], AGRN [Agrin], AGRP [Agouti related protein homologue (mouse)], AGT [Angiotensinogen (serpin peptidase inhibitor, Clade A, Member 8)], AGTR1 [angiotensin II receptor, type 1], AGTR2 [angiotensin II receptor, type 2], AHCY [adenosylhomocysteinase], AHI1 [Abelson helper integration site 1], AHR [aryl] Hydrocarbon receptor], AHSG [alpha-2-HS-glycoprotein], AICDA [activation-inducing cytidine deaminase], AIFM1 [apoptosis-inducing factor, mitochondria-related, 1], AIRE [autoimmune regulator], AKAP 12 [A kinase (PRKA) anchor protein 12], AKAP9 [A kinase (PRKA) anchor protein (Yotiao) 9], AKR1A1 [Aldo-ketoreductase family 1, member A1 (aldehyde reductase)], AKR1B1 [Aldo -Ketoreductase family 1, member B1 (aldose reductase)], AKR1C3 [Aldo-ketoreductase family 1, member C3 (3-alphahydroxysteroid dehydrogenase, type II)], AKT1 [v-akt mouse thymoma virus oncogene homology Body 1], AKT2 [v-akt mouse thymoma virus oncogene homolog 2], AKT3 [v-akt mouse thymoma virus oncogene homolog 3 (protein kinase B, cancer) )], ALAD [aminolevulinic acid, delta-, dehydratase], ALB [albumin], ALB [albumin], ALCAM [activated leukocyte cell adhesion molecule], ALDH1A1 [aldehyde dehydrogenase 1 family, member A1], ALDH3A1 [aldehyde dehydrogenase 3 Family, member A1], ALDH5A1 [aldehyde dehydrogenase 5 family, member A1], ALDH7A1 [aldehyde dehydrogenase 7 family, member A1], ALDH9A1 [aldehyde dehydrogenase 9 family, member A1], ALDOA [aldolase A, fructose-diphosphate] , ALDOB [Aldolase B, fructose-diphosphate], ALDOC [Aldolase C, fructose-diphosphate] ALK [anaplastic lymphoma receptor tyrosine kinase], ALOX12 [arachidonic acid 12-lipoxygenase], ALOX5 [arachidonic acid 5-lipoxygenase], ALOX5AP [arachidonic acid 5-lipoxygenase activating protein], ALPI [alkaline phosphatase, intestine], ALPL [alkaline phosphatase, liver / bone / kidney], ALPP [alkaline phosphatase, placenta (Reagan isozyme)], ALS2 [amyotrophic lateral sclerosis 2 (juvenile)], AMACR [alpha-methylacyl-CoA racemase], AMBP [alpha-1-microglobulin / bikunin precursor], AMPH [Amphiphycin], ANG [Angiogenin, Ribonuclease, RNase A family, 5], ANGPT1 [Angiopo Chin 1], ANGPT2 [Angiopoietin 2], ANGPTL3 [Angiopoietin-like 3], ANK1 [Ankyrin 1, erythrocytic], ANK3 [Ankyrin 3, Lambie diaphragm (Ankyrin G)], ANKRD1 [Ankyrin repeat domain 1 (cardiac muscle)] , ANP32E [acid (leucine rich) nuclear phosphoprotein 32 family, member E], ANPEP [alanyl (membrane) aminopeptidase], ANXA1 [annexin A1], ANXA2 [annexin A2], ANXA5 [annexin A5], AP1S1 [adapter Related protein complex 1, Sigma 1 subunit], AP1S2 [Adapter-related protein complex 1, Sigma 2 subunit], AP2A1 [Adapter-related protein complex 2, alpha 1 subunit] AP2B1 [Adapter-related protein complex 2, beta 1 subunit], APAF1 [apoptotic peptidase activator 1], APBA1 [amyloid beta (A4) precursor protein binding, family A, member 1], APBA2 [amyloid vector]
(A4) precursor protein binding, family A, member 2], APBB1 [amyloid beta (A4) precursor protein binding, family B, member 1 (Fe65)], APBB2 [amyloid beta (A4) precursor protein binding , Family B, member 2], APC [adenomatous colon polyposis], APCS [amyloid P component, serum], APEX1 [APEX nuclease (multifunctional DNA repair enzyme) 1], APH1B [anterior pharyngeal defect 1 homolog B] (Caenolabditis elegance)], APLP1 [amyloid beta (A4) precursor-like protein 1], APOA1 [apolipoprotein AI], APOA5 [apolipoprotein AV], APOB [apolipoprotein B (Ag ( x) containing antigen)], APOC2 [ Polypoprotein C-II], APOD [apolipoprotein D], APOE [apolipoprotein E], APOM [apolipoprotein M], APP [amyloid beta (A4) precursor protein], APPL1 [adapter protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1], APRT [adenine phosphoribosyltransferase], APTX [aplataxin], AQP1 [aquaporin 1 (colton blood group)], AQP2 [aquaporin 2 (collecting tube)], AQP3 [aquaporin 3 ( Gil blood group)], AQP4 [aquaporin 4], AR [androgen receptor], ARC [activity-regulated cytoskeleton-related protein], AREG [amphiregulin], ARFGEF2 [ADP-riboseating factor Guanine nucleotide-exchanger 2 (brefeldin A inhibitory)], ARG1 [arginase, liver], ARHGAP1 [Rho GTPase activating protein 1], ARHGAP32 [Rho GTPase activating protein 32], ARHGAP4 [Rho GTPase activating protein 4] ARHGAP5 [Rho GTPase activating protein 5], ARHGDIA [Rho GDP dissociation inhibitor (GDI) alpha], ARHGEF1 [Rho guanine nucleotide exchanger (GEF) 1], ARHGEF10 [Rho guanine nucleotide exchanger (GEF) 10], ARHGEF11 [Rho guanine nucleotide exchanger (GEF) 11], ARHGEF12 [Rho guanine nucleotide exchanger (GEF) 12], ARHGEF 5 [Rho guanine nucleotide exchanger (GEF) 15], ARHGEF16 [Rho guanine nucleotide exchanger (GEF) 16], ARHGEF2 [Rho / Rac guanine nucleotide exchanger (GEF) 2], ARHGEF3 [Rho guanine nucleotide exchanger (GEF) 3), ARHGEF4 [Rho guanine nucleotide exchanger (GEF) 4], ARHGEF5 [Rho guanine nucleotide exchanger (GEF) 5], ARHGEF6 [Rac / Cdc42 guanine nucleotide exchanger (GEF) 6], ARHGEF7 [Rho guanine nucleotide] Exchanger (GEF) 7], ARHGEF9 [Cdc42 guanine nucleotide exchanger (GEF) 9], ARID1A [AT-rich interaction domain 1A (SWI-like)], ARID1 [AT-rich interaction domain 1B (SWI1-like)], ARL13B [ADP-riboseating factor-like 13B], ARPC1A [actin-related protein 2/3 complex, subunit 1A, 41 kDa], ARPC1B [actin-related protein 2/3 Complex, subunit 1B, 41 kDa], ARPC2 [actin-related protein 2/3 complex, subunit 2, 34 kDa], ARPC3 [actin-related protein 2/3 complex, subunit 3, 21 kDa], ARPC4 [actin-related Protein 2/3 complex, subunit 4, 20 kDa], ARPC5 [actin-related protein 2/3 complex, subunit 5, 16 kDa], ARPC5L [actin-related protein 2/3 complex, subunit 5-like], ARPP19 [CAMP Regulatory phosphoprotein, 19 kDa], ARR3 [arrestin 3, retina (X-arrestin)], ARRB2 [arrestin, beta 2], ARSA [arylsulfatase A], ARTN [artemin], ARX [Aristales-related homeobox] ASCL1 [Acaete-scoot complex homolog 1 (Drosophila)], ASMT [acetyl serotonin O-methyltransferase], ASPA [Aspartacylase (canavan disease)], ASPG [asparaginase homolog (budding yeast)], ASPH [ Aspartate beta-hydroxylase], ASPM [asp (abnormal spindle) homologue, microcephaly-related (Drosophila)], ASRGL1 [asparaginase-like 1], ASS1 [argininosuccinate synthase 1], AST 1 [astrotactin 1], ATAD5 [ATPase family, AAA domain containing 5], ATF2 [activated transcription factor 2], ATF4 [activated transcription factor 4 (tax responsive enhancer element B67)], ATF6 [activated transcription Factor 6], ATM [vasodilatory ataxia mutation], ATOH1 [atonal homolog 1 (Drosophila)], ATOX1 [ATX1 antioxidant protein 1 homolog (yeast)], ATP10A [ATPase, class V, 10A Type], ATP2A2 [ATPase, Ca ++ transport, myocardium, slow muscle 2], ATP2B2 [ATPase, Ca ++ transport, plasma membrane 2], ATP2B4 [ATPase, Ca ++ transport, plasma membrane 4], ATP5O [ATP synthase, H + transport, mitochondria F1 complex, O sub-uni ATP6AP1 [ATPase, H + transport, lysosomal accessory protein 1], ATP6V0C [ATPase, H + transport, lysosome 16 kDa, V0 subunit c], ATP7A [ATPase, Cu ++ transport, alpha polypeptide], ATP8A1 [ATPase, aminophospholipid Transporter (APLT), class I, type 8A, member 1], ATR [vasodilatory ataxia and Rad3-related], ATRN [attractin], ATRX [alpha thalassemia / mental retardation syndrome X-linked (RAD54 homologue, budding yeast) ATXN1 [Ataxin 1], ATXN2 [Ataxin 2], ATXN3 [Ataxin 3], AURKA [Aurora Kinase A], AUTS2 [Autism Susceptibility Candidate 2], AVP [Arginine Vasopressi ], AVPR1A [arginine vasopressin receptor 1A], AXIN2 [Axin 2], AXL [AXL receptor tyrosine kinase], AZU1 [azulocidin 1], B2M [beta-2-microglobulin], B3GNT2 [UDP-GlcNAc: Beta Gal Beta-1 [3-N-acetylglucosaminyltransferase 2], B9D1 [B9 protein domain 1], BACE1 [beta site APP cleaving enzyme 1], BACE2 [beta site APP cleaving enzyme 2], BACH1 [BTB and CNC homology Sex 1, basic leucine zipper transcription factor 1], BAD [BCL2-related agonist of cell death], BAGE2 [B malignant melanoma antigen family, member 2], BIAAP2 [BAI1-related protein 2], BIAAP2L1 [BAI 1-related protein 2-like 1], BAK1 [BCL2-antagonist / killer 1], BARD1 [BRCA1-related RING domain 1], BARHL1 [BarH-like homeobox 1], BARHL2 [BarH-like homeobox 2], BASP1 [brain-rich, Membrane-bound signal protein 1], BAX [BCL2-related X protein], BAZ1A [bromodomain adjacent to the zinc finger domain, 1A], BAZ1B [bromodomain adjacent to the zinc finger domain, 1B], BBS9 [Bardy-Biddle syndrome 9 ], BCAR1 [breast cancer anti-estrogen resistance 1], BCHE [butyrylcholinesterase], BCL10 [B cell CLL / lymphoma 10], BCL2 [B cell CLL / lymphoma 2], BCL2A1 [BCL2 related protein A1], BCL2L1 [BCL2-like 1], BCL2L11 [BCL2-like 11 (proapoptotic factor)], BCL3 [B-cell CLL / lymphoma 3], BCL6 [B-cell CLL / lymphoma 6], BCL7A [B-cell CLL / lymphoma 7A ], BCL7B [B cell CLL / lymphoma 7B], BCL7C [B cell CLL / lymphoma 7C], BCR [breakpoint cluster region], BDKRB1 [bradykinin receptor B1], BDNF [brain-derived neurotrophic factor], BECN1 [ Beclin 1, autophagy-related], BEST1 [bestrophin 1], BEX1 [brain-expressing, X-linked 1], BEX2 [brain-expressing X-linked 2], BGLAP [bone gamma-carboxyglutamic acid (gla) protein], BGN [Biglycan], BID [BH3 mutual work Domain cell death agonist], BIN1 [crosslinking integration factor 1], BIRC2 [containing baculovirus IAP repeat 2], BIRC3 [containing baculovirus IAP repeat 3], BIRC5 [containing baculovirus IAP repeat 5], BIRC7 [baculovirus IAP repeat] Containing 7], BLK [B lymphoid tyrosine kinase], BLVRB [Biliverdine reductase B (flavin reductase (NADPH))], BMI1 [BMI1 polycombing finger oncogene], BMP1 [bone morphogenetic protein 1], BMP10 [bone morphogenetic protein 10], BMP15 [bone morphogenetic protein 15], BMP2 [bone morphogenetic protein 2], BMP3 [bone morphogenetic protein 3], BMP4 [bone morphogenetic protein 4], BMP5 [bone morphogenetic protein] 5], BMP6 [bone morphogenetic protein 6], BMP7 [bone morphogenetic protein 7], BMP8A [bone morphogenetic protein 8a], BMP8B [bone morphogenetic protein 8b], BMPR1A [bone morphogenetic protein receptor, type IA], BMPR1B [bone] Morphogenetic protein receptor, type IB], BMPR2 [bone morphogenetic protein receptor, type II (serine / threonine kinase)], BOC [Boc homologue (mouse)], BOK [BCL2-related ovarian killer], BPI [bactericidal / Permeability enhancing protein], BRAF [v-raf murine sarcoma virus oncogene homolog B1], BRCA1 [breast cancer 1, early onset], BRCA2 [breast cancer 2, early onset], BRWD1 [containing bromodomain and WD repeat domain 1], BSND [Barter syndrome, infants, with sensorineural hearing loss (Burchin) , BST2 [bone marrow stromal cell antigen 2], BTBD10 [BTB (POZ) domain containing 10], BTC [betacellulin], BTD [biotinidase], BTG3 [BTG family, member 3], BTK [Breton agammaglobulinemia] Tyrosine kinase], BTN1A1 [butyrophilin, subfamily 1, member A1], BUB1B [one homologue beta (yeast) whose germination is not inhibited by benzimidazole], C15orf2 [chromosome 15 open reading frame 2], C16orf75 [chromosome 16 open reading Frame 75], C17orf42 [chromosome 17 open reading frame 42], C1orf187 [chromosome 1 open reading frame 187], C1R [complement component 1, r substructure] Component], C1S [complement component 1, s subcomponent], C21orf2 [chromosome 21 open reading frame 2], C21orf33 [chromosome 21 open reading frame 33], C21orf45 [chromosome 21 open reading frame 45], C21orf62 [chromosome 21 open reading frame 62], C21orf74 [chromosome 21 open reading frame 74], C3 [complement component 3], C3orf58 [chromosome 3 open reading frame 58], C4A [complement component 4A (Rogers blood group)], C4B [complement component 4B (Chido blood group)], C5AR1 [complement component 5a receptor 1], C6orf106 [chromosome 6 open reading frame 106], C6orf 25 [chromosome 6 open reading frame 25], CA1 [carbonic anhydrase I], CA2 [carbonic anhydrase II], CA3 [carbonic anhydrase III, muscle specific], CA6 [carbonic anhydrase VI], CA9 [carbonic anhydrase] Enzyme IX], CABIN1 [calcineurin ligation]
Combined protein 1], CABLES1 [Cdk5 and AbI enzyme substrate 1], CACNA1B [calcium channel, voltage-dependent, N-type, alpha1B subunit], CACNA1C [calcium channel, voltage-dependent, L-type, alpha1C subunit] CACNA1G [calcium channel, voltage-dependent, T-type, alpha1G subunit], CACNA1H [calcium channel, voltage-dependent, T-type, alpha1H subunit], CACNA2D1 [calcium channel, voltage-dependent, alpha2 / delta Subunit 1], CADM1 [cell adhesion molecule 1], CADPS2 [Ca ++-dependent secretion activator 2], CALB2 [calbindin 2], CALCA [calcitonin-related polypeptide alpha], CALCR [calcitonin Tone], CALM3 [calmodulin 3 (phosphorylase kinase, delta)], CALR [calreticulin], CAMK1 [calcium / calmodulin-dependent protein kinase I], CAMK2A [calcium / calmodulin-dependent protein kinase II alpha], CAMK2B [calcium / Calmodulin-dependent protein kinase II beta], CAMK2G [calcium / calmodulin-dependent protein kinase II gamma], CAMK4 [calcium / calmodulin-dependent protein kinase IV], CAMKK2 [calcium / calmodulin-dependent protein kinase kinase 2, beta], CAMP [Cathelicidin antibacterial peptide], CANT1 [calcium activated nucleotidase 1], CANX [ca Nexin], CAPN1 [calpain 1, (mu / I) large subunit], CAPN2 [calpain 2, (m / II) large subunit], CAPN5 [calpain 5], CAPZA1 [capping protein (actin filament) muscle Z-ray , Alpha 1], CARD16 [caspase mobilization domain family, member 16], C-arm 1 [co-activator-related arginine methyltransferase 1], CARTPT [CART prepropeptide], CASK [calcium / calmodulin-dependent serine protein kinase (MAGUK) Family)], CASP1 [caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)], CASP10 [caspase 10, apoptosis-related system Stain peptidase], CASP2 [caspase 2, apoptosis-related cysteine peptidase], CASP3 [caspase 3, apoptosis-related cysteine peptidase], CASP6 [caspase 6, apoptosis-related cysteine peptidase], CASP7 [caspase 7, apoptosis-related cysteine peptidase], CASP8 [ Caspase 8, apoptosis-related cysteine peptidase], CASP8AP2 [caspase 8-binding protein 2], CASP9 [caspase 9, apoptosis-related cysteine peptidase], CASR [calcium sensing receptor], CAST [calpastatin], CAT [catalase], CAV1 [ Caveolin 1, caveola protein, 22 kDa], CAV2 [caveolin 2], CAV3 [caveo 3], CBL [Cas-Br-M (mouse) allotrophic retrovirus conversion sequence], CBLB [Cas-Br-M (mouse) allotrophic retrovirus conversion sequence b], CBR1 [carbonyl reductase 1], CBR3 [carbonyl reductase 3], CBS [cystathionine-beta-synthase], CBX1 [chromobox homolog 1 (HP1 beta homolog Drosophila)], CBX5 [chromobox homolog 5 (HP1 alpha homolog, Drosophila)], CC2D2A [Coiled coil and C2 domain containing 2A], CCBE1 [collagen and calcium binding EGF domain 1], CCBL1 [cysteine conjugate-beta lyase, cytoplasm], CCDC50 [coiled coil domain containing 50], CCK [Cholesis] Kinin], CCKAR [cholecystokinin A receptor], CCL1 [chemokine (CC motif) ligand 1], CCL11 [chemokine (CC motif) ligand 11], CCL13 [chemokine (CC motif) ligand 13 ], CCL17 [chemokine (CC motif) ligand 17], CCL19 [chemokine (CC motif) ligand 19], CCL2 [chemokine (CC motif) ligand 2], CCL20 [chemokine (CC motif) Ligand 20], CCL21 [chemokine (CC motif) ligand 21], CCL22 [chemokine (CC motif) ligand 22], CCL26 [chemokine (CC motif) ligand 26], CCL27 [chemokine (CC) Motif) Ligand 27], CCL3 [Chemokine (CC motif) ligand 3], CCL4 [chemokine (CC motif) ligand 4], CCL5 [chemokine (CC motif) ligand 5], CCL7 [chemokine (CC motif) ligand 7] CCL8 [chemokine (CC motif) ligand 8], CCNA1 [cyclin A1], CCNA2 [cyclin A2], CCNB1 [cyclin B1], CCND1 [cyclin D1], CCND2 [cyclin D2], CCND3 [cyclin D3], CCNG1 [cyclin G1], CCNH [cyclin H], CCNT1 [cyclin T1], CCR1 [chemokine (CC motif) receptor 1], CCR3 [chemokine (CC motif) receptor 3], CCR4 [chemokine ( CC motif) receptor 4] CCR5 [chemokine (CC motif) receptor 5], CCR6 [chemokine (CC motif) receptor 6], CCR7 [chemokine (CC motif) receptor 7], CCT5 [chaperonin-containing TCP1, subunit 5 (epsilon)], CD14 [CD14 molecule], CD19 [CD19 molecule], CD1A [CD1a molecule], CD1B [CD1b molecule], CD1D [CD1d molecule], CD2 [CD2 molecule], CD209 [CD209 molecule], CD22 [ CD22 molecule], CD244 [CD244 molecule, natural killer cell receptor 2B4], CD247 [CD247 molecule], CD27 [CD27 molecule], CD274 [CD274 molecule], CD28 [CD28 molecule], CD2AP [CD2-related protein], CD33 [ CD33 molecule], D34 [CD34 molecule], CD36 [CD36 molecule (thrombospondin receptor)], CD3E [CD3e molecule, epsilon (CD3-TCR complex)], CD3G [CD3g molecule, gamma (CD3-TCR complex)], CD4 [CD4 molecule], CD40 [CD40 molecule, TNF receptor superfamily member 5], CD40LG [CD40 ligand], CD44 [CD44 molecule (Indian blood group)], CD46 [CD46 molecule, complement regulatory protein], CD47 [ CD47 molecule], CD5 [CD5 molecule], CD55 [CD55 molecule, decay-accelerating factor for complement (chromar blood group)], CD58 [CD58 molecule], CD59 [CD59 molecule, complement regulatory protein], CD63 [CD63 molecule ], CD69 [CD69 molecule], CD7 [C D7 molecule], CD72 [CD72 molecule], CD74 [CD74 molecule, major histocompatibility complex, class II invariant chain], CD79A [CD79a molecule, immunoglobulin related alpha], CD79B [CD79b molecule, immunoglobulin related beta], CD80 [CD80 molecule], CD81 [CD81 molecule], CD86 [CD86 molecule], CD8A [CD8a molecule], CD9 [CD9 molecule], CD99 [CD99 molecule], CDA [cytidine deaminase], CDC25A [cell division cycle 25 homologue] A (fission yeast)], CDC25C [cell division cycle 25 homolog C (fission yeast)], CDC37 [cell division 37 homolog (budding yeast)], CDC42 [cell division cycle 42 (GTP-binding protein, 25 kDa)] , CDC5L [CDC5 cell division cycle-like ( Fission yeast)], CDH1 [cadherin 1, type 1, E-cadherin (epithelium)], CDH10 [cadherin 10, type 2 (T2-cadherin)], CDH12 [cadherin 12, type 2 (N-cadherin 2)], CDH15 [cadherin 15, type 1, M-cadherin (myotubule)], CDH2 [cadherin 2, type 1, N-cadherin (neural type)], CDH4 [cadherin 4, type 1, R-cadherin (retina)], CDH5 [cadherin 5, type 2 (vascular endothelium)], CDH9 [cadherin 9, type 2 (T1-cadherin)], CDIPT [CDP-diacylglycerol-inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)], CDK1 [cyclin -Dependent kinase 1], CDK14 [cyclin-dependent kinase 4], CDK2 [cyclin dependent kinase 2], CDK4 [cyclin dependent kinase 4], CDK5 [cyclin dependent kinase 5], CDK5R1 [cyclin dependent kinase 5, regulatory subunit 1 (p35)], CDK5RAP2 [ CDK5 regulatory subunit binding protein 2], CDK6 [cyclin dependent kinase 6], CDK7 [cyclin dependent kinase 7], CDK9 [cyclin dependent kinase 9], CDKL5 [cyclin dependent kinase like 5], CDKN1A [cyclin -Dependent kinase inhibitor 1A (p21, Cip1)], CDKN1B [cyclin-dependent kinase inhibitor 1B (p27, Kip1)], CDKN1C [cyclin-dependent kinase inhibitor 1C (p57, Kip2)], CDKN2A Cyclin-dependent kinase inhibitor 2A (malignant melanoma, p16, inhibits CDK4)], CDKN2B [cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], CDKN2C [cyclin-dependent kinase inhibitor 2C (p18, CDK4 is inhibited)], CDKN2D [cyclin dependent kinase inhibitor 2D (p19, inhibits CDK4)], CDNF [brain dopamine neurotrophic factor], CDO1 [cysteine dioxygenase, type I], CDR2 [cerebellar degeneration-related protein 2, 62 kDa], CDT1 [chromatin licensing and DNA replication factor 1], CDX1 [tail type homeobox 1], CDX2 [tail type homeobox 2], CEACAM1 [oncofetal antigen-related cell adhesion molecule 1 (bile glycoprotein) ], CEACAM3 [Carcinoembryonic antigen-related cell adhesion molecule 3], CEACAM5 [carcinoembryonic antigen-related cell adhesion molecule 5], CEACAM7 [carcinoembryonic antigen-related cell adhesion molecule 7], CEBPB [CCAAT / enhancer binding protein (C / EBP) , Beta], CEBPD [CCAAT / enhancer binding protein (C / EBP), delta], CECR2 [Cateye syndrome chromosomal region, candidate 2], CEL [carboxyl ester lipase (bile salt-stimulated lipase)], CENPC1 [centromere protein C1], CENPJ [centromere protein J], CEP290 [centrosome protein 290 kDa], CER1 [cerberus 1, cysteine knot superfamily, homologue (Xenopus laevis)], CETP [cholesteryl ester transport tamper Quality, plasma], CFC1 [crypt, FRL-1, cryptic family 1], CFH [complement factor H], CFHR1 [complement factor H related 1], CFHR3 [complement factor H related 3 ], CFHR4 [complement factor H-related 4], CFI [complement factor I], CFL1 [cofilin 1 (non-muscle)], CFL2 [cofilin 2 (muscle)], CFLAR [CASP8 and FADD-like apoptosis regulator] , CFTR [cystic fibrosis transmembrane conductance regulator (ATP binding cassette subfamily C, member 7)], CGA [glycoprotein hormone, alpha polypeptide], CGB [chorionic gonadotropin, beta polypeptide], CGB5 [chorionic Gonadotropin, beta polypeptide 5], CGGBP1 [CGG trip Ttoripito binding protein 1], CHAF1A [chromatin aggregation factor 1, subunit A (p150)], CHAF1B [chromatin aggregation factor 1, subunit B (p60)], CHAT [choline acetyltransferase], CHEK1 [CHK1 checkpoint
Homologue (fission yeast)], CHEK2 [CHK2 checkpoint homologue (fission yeast)], CHGA [chromogranin A (parathyroid secreted protein 1)], CHKA [choline kinase alpha], CHL1 [L1CAM has homology. Cell adhesion molecule (similar homologue of L1)], CHN1 [chimerin (chimerin) 1], CHP [calcium binding protein P22], CHP2 [calcineurin B homologous protein 2], CHRD [codein], CHRM1 [cholinergic receptor, Muscarinic 1], CHRM2 [cholinergic receptor, muscarinic 2], CHRM3 [cholinergic receptor, muscarinic 3], CHRM5 [cholinergic receptor, muscarinic 5], CHRNA3 [cholinergic receptor, nicotinic] , Alpha 3], CHRNA4 [choline Receptor, nicotinic, alpha4], CHRNA7 [cholinergic receptor, nicotinic, alpha7], CHRNB2 [cholinergic receptor, nicotinic, beta2 (neurotype)], CHST1 [carbohydrate (keratin sulfate Gal- 6) Sulfotransferase 1], CHST10 [Carbohydrate Sulfotransferase 10], CHST3 [Carbohydrate (chondroitin 6) Sulfotransferase 3], CHUK [Conserved Helix-Loop-Helix Ubiquitous Kinase], CHURC1 [Churtil Domain Containing 1], CIB1 [Calcium And integrin binding 1 (calmyrin)], CIITA [class II, major histocompatibility complex, transactivator], CIRBP [cold-inducible RNA binding protein], CISD1 [CDGSH iron sulfate] Domain 1], CISH [cytokine-inducible SH2-containing protein], CIT [citron (rho interaction, serine / threonine kinase 21)], CLASP2 [cytoplasmic linker-binding protein 2], CLCF1 [cardiotrophin-like cytokine factor 1] CLCN2 [chloride channel 2], CLDN1 [claudin 1], CLDN14 [claudin 14], CLDN16 [claudin 16], CLDN3 [claudin 3], CLDN4 [claudin 4], CLDN5 [claudin 5] CLDN8 [Claudin 8], CLEC12A [C-type lectin domain family 12, member A], CLEC16A [C-type lectin domain family 16, member A], CLEC5A [C-type lectin domain family 5 , Member A], CLEC7A [C-type lectin domain family 7, member A], CLIP2 [CAP-GLY domain-containing linker protein 2], CLSTN1 [calcintenin 1], CLTC [clathrin, heavy chain (Hc)], CLU [ Clusterin], CMIP [c-Maf derived protein], CNBP [CCHC type zinc finger, nucleic acid binding protein], CNGA3 [cyclic nucleotide-gated channel alpha 3], CNGB3 [cyclic nucleotide-gated channel beta 3], CNN1 [calponin 1 , Basic, smooth muscle], CNN2 [calponin 2], CNN3 [calponin 3, acidic], CNOT8 [CCR4-NOT transcription complex, subunit 8], CNP [2 ′ [3′-cyclic nucleotide 3 ′ phosphodiesterase] , CNR [Cannabinoid receptor 1 (brain)], CNR2 [cannabinoid receptor 2 (macrophages)], CNTF [ciliary neurotrophic factor], CNTFR [ciliary neurotrophic factor receptor], CNTFR [ciliary neurotrophic] Factor receptor], CNTFR [ciliary neurotrophic factor receptor], CNTLN [centrain, centrosome protein], CNTN1 [contactin 1], CNTN2 [contactin 2 (axon)], CNTN4 [contactin 4], CNTNAP1 [Contactin-binding protein 1], CNTNAP2 [Contactin-binding protein-like 2], COBL [Cordon-Blue homologue (mouse)], COG2 [Component 2 of oligomer Golgi complex], COL18A1 [Collagen, XVIII type alpha 1], COL1A1 [Collagen, Type I Al 1], COL1A2 [collagen, type I alpha 2], COL2A1 [collagen, type II alpha 1], COL3A1 [collagen, type III alpha 1], COL4A3 [collagen, type IV, alpha 3 (Goodpasture antigen)], COL4A3BP [collagen, type IV, alpha 3 (goodpasture antigen) binding protein], COL5A1 [collagen, type V, alpha 1], COL5A2 [collagen, type V, alpha 2], COL6A1 [collagen, type VI alpha 1], COL6A2 [collagen, type VI alpha 2], COL6A3 [collagen, type VI alpha 3], COMT [catechol-O-methyltransferase], COPG2 [coatmer protein complex, subunit gamma 2], COPS4 [COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis thaliana)], CORO1A [colonin, actin-binding protein, 1A], COX5A [cytochrome c oxidase subunit Va], COX7B [cytochrome c oxidase subunit VIIb], CP [ Ceruloplasmin (ferrooxidase)], CPA1 [carboxypeptidase A1 (pancreas)], CPA2 [carboxypeptidase A2 (pancreas)], CPA5 [carboxypeptidase A5], CPB2 [carboxypeptidase B2 (plasma)], CPOX [coproporphyrin Nogen oxidase], CPS1 [carbamoyl-phosphate synthetase 1, mitochondria], CPT1A [carnitine palmitoyltransferase 1A (liver)], CR1 [complement structure] Component (3b / 4b) receptor 1 (Knops blood group)], CR2 [complement component (3d / Epstein Barr virus) receptor 2], CRABP1 [cell retinoic acid binding protein 1], CRABP2 [cell Retinoic acid binding protein 2], CRAT [carnitine O-acetyltransferase], CRB1 [crumbs homolog 1 (Drosophila)], CREB1 [cAMP responsive element binding protein 1], CREBBP [CREB binding protein], CRELD1 [ Cysteine rich 1 with EGF-like domain], CRH [corticotropin releasing hormone], CRIP1 [cysteine rich protein 1 (intestine)], CRK [v-crk sarcoma virus CT10 oncogene homologue (bird)], RKL [v-crk sarcoma virus CT10 oncogene homologue (bird) -like], CRLF1 [cytokine receptor-like factor 1], CRLF2 [cytokine receptor-like factor 2], CRLF3 [cytokine receptor-like factor 3], CRMP1 [ Collapsin response mediator protein 1], CRP [C-reactive protein, pentraxin-related], CRTC1 [CREB-regulated transcription coactivator 1], CRX [Cone rod homeobox], CRYAA [Crystallin, alpha A], CRYAB [ Crystallin, alpha B], CS [citrate synthase], CSAD [cysteine sulfinic acid decarboxylase], CSF1 [colony stimulating factor 1 (macrophage)], CSF1R [colony stimulating factor 1 receptor], CSF2 [colony stimulating factor 2 ( Granule Sphere-macrophage)], CSF2RA [colony stimulating factor 2 receptor, alpha, low affinity (granulocyte-macrophage)], CSF3 [colony stimulating factor 3 (granulocyte)], CSF3R [colony stimulating factor 3 receptor (granule) Sphere)], CSH2 [chorionic somatomammotropic hormone 2], CSK [c-src tyrosine kinase], CSMD1 [CUB and sushi multiple domain 1], CSMD3 [CUB and sushi multiple domain 3], CSNK1D [casein kinase 1, Delta], CSNK1E [casein kinase 1, epsilon], CSNK2A1 [casein kinase 2, alpha 1 polypeptide], CSPG4 [chondroitin sulfate proteoglycan 4], CSPG5 [chondroitin sulfate proteoglycan 5 (neuroglycan C)], C T3 [cystatin C], CST7 [cystatin F (leucocystatin)], CSTB [cystatin B (stephin B)], CTAG1B [cancer / testis antigen 1B], CTBP1 [C-terminal binding protein 1], CTCF [CCCTC binding factor ( Zinc finger protein)], CTDSP1 [CTD (carboxy terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1], CTF1 [cardiotrophin 1], CTGF [connective tissue growth factor], CTLA4 [cytotoxic T Lymphocyte-related protein 4], CTNNA1 [catenin (cadherin-related protein), alpha1, 102 kDa], CTNNAL1 [catenin (cadherin-related protein), alpha-like 1], CTNNB1 [catenin (cadherin-related protein) , Beta 1, 88 kDa], CTNND1 [catenin (cadherin-related protein), delta 1], CTNND2 [catenin (cadherin-related protein), delta 2 (neuroplastic placofilin-related arm-repeat protein)], CTNS [cystinosis, kidney Syndrome], CTRL [chymotrypsin-like], CTSB [cathepsin B], CTSC [cathepsin C], CTSD [cathepsin D], CTSG [cathepsin G], CTSH [cathepsin H], CTSL1 [cathepsin L1], CTSS [cathepsin S] ], CTTN [cortactin], CTTNBP2 [cortactin binding protein 2], CUL4B [calin 4B], CUL5 [calin 5], CUX2 [cut-like homeobox 2], CX3CL1 [chemokine (C-X3-C motif) Gand 1], CX3CR1 [chemokine (C-X3-C motif) receptor 1], CXADR [coxsackievirus and adenovirus receptor], CXCL1 [chemokine (C-X-C motif) ligand 1 (malignant melanoma growth stimulating activity) , Alpha)], CXCL10 [chemokine (C—X—C motif) ligand 10], CXCL12 [chemokine (C—C—C motif) ligand 12 (stromal cell-derived factor 1)], CXCL16 [chemokine (C—X -C motif) ligand 16], CXCL2 [chemokine (C-X-C motif) ligand 2], CXCL5 [chemokine (C-X-C motif) ligand 5], CXCR1 [chemokine (C-X-C motif) reception Body 1], CXCR2 [chemokine (C—X—C motif) receptor 2], C CR3 [chemokine (C—X—C motif) receptor 3], CXCR4 [chemokine (C—C—C motif) receptor 4], CXCR5 [chemokine (C—C—C motif) receptor 5], CYB5A [ Cytochrome b5A type (microsome)], CYBA [cytochrome b-245, alpha polypeptide], CYBB [cytochrome b-245, beta polypeptide], CYCS [cytochrome c, somatic cell type], CYFIP1 [cytoplasmic FMR1 interacting protein 1 ], CYLD [Cylindromatosis (Turban tumor syndrome)], CYP11A1 [cytochrome P450, family 11, subfamily A, polypeptide 1], CYP11B1 [cytochrome P450, family 11, subfamily B, polypeptide 1], CYP11B2 [ Cytochrome P45 , Family 11, subfamily B, polypeptide 2], CYP17A1 [cytochrome P450, family 17, subfamily A, polypeptide 1], CYP19A1 [cytochrome P450, family 19, subfamily A, polypeptide 1], CYP1A1 [cytochrome P450, family 1, subfamily A, polypeptide 1], CYP1A2 [cytochrome P450, family 1, subfamily A, polypeptide 2], CYP1B1 [cytochrome P450, family 1, subfamily B, polypeptide 1], CYP21A2 [ Cytochrome P450, family 21, subfamily A, polypeptide 2], CYP2A6 [cytochrome P450, family 2, subfamily A, polypeptide 6], CYP2B6 [Cytochrome P450, family 2, subfamily B, polypeptide 6], CYP2C9 [cytochrome P450, family 2, subfamily C, polypeptide 9], CYP2D6 [cytochrome P450, family 2, subfamily D, polypeptide 6]
CYP2E1 [cytochrome P450, family 2, subfamily E, polypeptide 1], CYP3A4 [cytochrome P450, family 3, subfamily A, polypeptide 4], CYP7A1 [cytochrome P450, family 7, subfamily A, polypeptide 1 ], CYR61 [cysteine-rich, angiogenesis-inducing factor, 61], CYSLTR1 [cysteinyl leukotriene receptor 1], CYSLTR2 [cysteinyl leukotriene receptor 2], DAB1 [disabled homolog 1 (Drosophila) )], DAGLA [diacylglycerol lipase, alpha], DAGLB [diacylglycerol lipase, beta], DAO [D-amino acid oxidase], DAOA [D-amino acid oxy] Activating factor], DAPK1 [cell death-related protein kinase 1], DAPK3 [cell death-related protein kinase 3], DAXX [cell death-domain binding protein], DBH [dopamine beta-hydroxylase (dopamine beta-monooxygenase) ], DBI [diazepam binding inhibitor (GABA receptor modulator, acyl-coenzyme A binding protein)], DBN1 [drebrin 1], DCAF6 [DDB1 and CUL4-related factor 6], DCC [deleted in colorectal cancer] , DCDC2 [double cortin domain-containing 2], DCK [deoxycytidine kinase], DCLK1 [doublecortin-like kinase 1], DCN [decolin], DCTN1 [dynactin 1 (p150, glued homologue, shojo) Flies)], DCTN2 [dynactin2 (p50)], DCTN4 [dynactin4 (p62)], DCUN1D1 [DCN1, defect 1 in cullin neddylation, domain-containing 1 (budding yeast)], DCX [double cortin] DDB1 [damage-specific DNA binding protein 1, 127 kDa], DDC [dopa decarboxylase (aromatic L-amino acid decarboxylase)], DDIT3 [DNA damage-induced transcription 3], DDIT4 [DNA damage-induced transcription 4], DDIT4L [DNA damage-inducible transcription 4-like], DDR1 [discoidin domain receptor tyrosine kinase 1], DDX10 [DEAD (Asp-Glu-Ala-Asp) box polypeptide 10], DDX17 [DEAD ( sp-Glu-Ala-Asp) box polypeptide 17], DEFB4A [defensin, beta 4A], DEK [DEK oncogene], DES [desmin], DEXI [Dex homologue (mouse)], DFFA [DNA fragmentation factor , 45 kDa, alpha polypeptide], DFNB31 [deafness, autosomal recessive 31], DGCR6 [diGeorge syndrome essential region gene 6], DGUOK [deoxyguanosine kinase], DHCR7 [7-dehydrocholesterol reductase], DHFR [dihydrofolate reductase ], DIAPH1 [diaphanous homolog 1 (Drosophila)], DICER1 [Dicer 1, ribonuclease type III], DIO1 [deiodinase, indothyronine, type I], DIO2 [deyo] Enzyme, indothyronine, type II], DIP2A [DIP2 disco-interacting protein 2 homolog A (Drosophila)], DIRAS3 [DIRAS family, GTP-binding RAS-like 3], DISC1 [disrupted in schizophrenia 1] DISC2 [disruption in schizophrenia 2 (non-protein code)], DKC1 [congenital keratosis 1, dyskerin], DLG1 [discs, large homolog 1 (Drosophila)], DLG2 [discus (Discs), large homolog 2 (Drosophila)], DLG3 [discs, large homolog 3 (Drosophila)], DLG4 [discs, large homolog 4 (Drosophila)], DLGAP1 [disc Discs, large (show Drosophila) homologue-related protein 1], DLGAP2 [discs, large (Drosophila) homologue-related protein 2], DLK1 [Delta-like 1 homologue (Drosophila)], DLL1 [Delta-like 1 (Drosophila)], DLX1 [distal-less homeobox 1], DLX2 [distal-less homeobox 2], DLX3 [distal-less homeobox 3], DLX4 [ Distal-less homeobox 4], DLX5 [distal-less homeobox 5], DLX6 [distal-less homeobox 6], DMBT1 [malignant brain tumor Deletion 1], DMC1 [mck1 homology] DMC1 amount inhibitory factor, meiosis-specific homologous recombination (yeast)], DMD [dystrophin], DMPK [myotonic dystrophy-protein kinase], DNAI2 [dynein, axon, intermediate strand 2], DNAJC28 [DnaJ ( Hsp40) homologue, subfamily C, member 28], DNAJC30 [DnaJ (Hsp40) homologue, subfamily C, member 30], DNASE1 [deoxyribonuclease I], DNER [delta / notch-like EGF repeat containing], DNLZ [ DNL type zinc finger], DNM1 [dynamin 1], DNM3 [dynamin 3], DNMT1 [DNA (cytosine-5-)-methyltransferase 1], DNMT3A [DNA (cytosine-5-)-methyltransferase 3 alpha], DNMT3B [DNA (cytosine-5-)-methyltransferase 3 beta], DNTT [deoxynucleotidyl transferase, terminal], DOC2A [double C2-like domain, alpha], DOCK1 [cytoplasmic contributor 1], DOCK3 [cytoplasm Donation factor 3], DOCK4 [Dedication factor 4 for cytokinesis], DOCK7 [Dedication factor 7 for cytokinesis], DOK7 [Docking protein 7], DONSON [downstream of SON], DOPEY1 [dopey] family members 1], DOPEY2 [dopey family member 2], DPF1 [D4, zinc and double PHD finger family 1], DPF3 [D4, zinc and double PHD finger, family 3], DPH1 [DPH1 Allogeneic (budding yeast)], DPP10 [dipeptidyl-peptidase 10], DPP4 [dipeptidyl-peptidase 4], DPRXP4 [divergent pairing-related homeobox pseudogene 4], DPT [dermatopontin], DPYD [dihydropyrimidine dehydrogenase] DPYSL2 [dihydropyrimidinase-like 2], DPYSL3 [dihydropyrimidinase-like 3], DPYSL4 [dihydropyrimidinase-like 4], DPYSL5 [dihydropyrimidinase-like 5], DRD1 [dopamine receptor D1], DRD2 [Dopamine receptor D2], DRD3 [Dopamine receptor D3], DRD4 [Dopamine receptor D4], DRD5 [Dopamine receptor D5], DRG1 [Developmentally regulated GTP-binding protein 1], DRGX Dorsal root ganglion homeobox], DSC2 [desmocollin 2], DSCAM [Down syndrome cell adhesion molecule], DSCAML1 [Down syndrome cell adhesion molecule-like 1], DSCR3 [Down syndrome essential region gene 3], DSCR4 [Down syndrome essential region] Gene 4], DSCR6 [Down syndrome essential region gene 6], DSERG1 [Down syndrome encephalopathy-related protein 1], DSG1 [desmoglein 1], DSG2 [desmoglein 2], DSP [desmoplakin], DST [dystonin], DSTN [ Destrin (actin depolymerizing factor)], DTNBP1 [dystrobrevin binding protein 1], Dallard [Dullard homologue (Xenopus laevis)], DUSP1 [bispecific phosphatase 1], DUSP13 [bispecific Sphatase 13], DUSP6 [bispecific phosphatase 6], DUT [deoxyuridine triphosphatase], DVL1 [dishvelled], dsh homolog 1 (Drosophila)], DYRK1A [bispecific tyrosine- (Y)- Phosphorylation-regulated kinase 1A], DYRK3 [bispecific tyrosine- (Y) -phosphorylation-regulated kinase 3], DYSF [dysferlin, limb muscular dystrophy 2B (autosomal recessive)], DYX1C1 [dyslexia-sensitive 1 candidate 1 ], E2F1 [E2F transcription factor 1], ear 2 [glutamyl-tRNA synthetase 2, mitochondria (presumed)], EBF4 [early B cell factor 4], ECE1 [endothelin converting enzyme 1], ECHS1 [enoyl coenzyme A hydratase, Short chain, , Mitochondria], EDN1 [endothelin 1], EDN2 [endothelin 2], EDN3 [endothelin 3], EDNRA [endothelin receptor A type], EDNRB [endothelin receptor B type], EEF1A1 [eukaryotic translation elongation factor 1 alpha 1], EEF2 [eukaryotic translation elongation factor 2], EEF2K [eukaryotic cell elongation factor-2 kinase], EFHA1 [EF-hand domain family, member A1], EFNA1 [Ephrin-A1], EFNA2 [Ephrin-A2 ], EFNA3 [Ephrin-A3], EFNA4 [Ephrin-A4], EFNA5 [Ephrin-A5], EFNB2 [Ephrin-B2], EFNB3 [Ephrin-B3], EFS [Embryonic Fyn Related Substrate], EGF [Epithelial Growth] Factor (beta-urogastron)], EG R [epidermal growth factor receptor (erythroblastic leukemia virus (v-erb-b) oncogene homologue, bird)], EGLN1 [egl9 homologue 1 (Caenolabditis elegans)], EGR1 [early growth Response 1], EGR2 [Early growth response 2], EGR3 [Early growth response 3], EHADAH [enoyl-coenzyme A, hydratase / 3-hydroxyacyl coenzyme A dehydrogenase], EHMT2 [true chromatin histone-lysine N- Methyltransferase 2], EID1 [EP300 interaction inhibitor 1 of differentiation], EIF1AY [eukaryotic translation initiation factor 1A, Y-linked], EIF2AK2 [eukaryotic translation initiation factor 2-alpha kinase 2], EIF2AK3 [eukaryotic Cell translation initiation factor 2-alpha kinase 3], EIF2B2 [eukaryotic translation initiation factor Child 2B, subunit 2 beta, 39 kDa], EIF2B5 [eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82 kDa], EIF2S1 [eukaryotic translation initiation factor 2, subunit 1 alpha, 35 kDa], EIF2S2 [true Nuclear cell translation initiation factor 2, subunit 2 beta, 38 kDa], EIF3M [eukaryotic cell translation initiation factor 3, subunit M], EIF4E [eukaryotic cell translation initiation factor 4E], EIF4EBP1 [eukaryotic cell translation initiation factor 4E Binding protein 1], EIF4G1 [eukaryotic translation initiation factor 4 gamma, 1], EIF4H [eukaryotic translation initiation factor 4H], E row [elastase, neutrophil expression], ELAVL1 [ELAV (embryonic lethality) , Abnormal vision, Drosophila) -like 1 (Hu antigen R)], ELAVL3 [ELAV ( Sexually lethal, abnormal vision, Drosophila) -like 3 (Hu antigen C)], ELAVL4 [ELAV (embryonic lethal, abnormal vision, Drosophila) -like 4 (Hu antigen D)], ELF5 [E74-like factor 5 (ets domain) Transcription factor)], ELK1 [ELK1, member of ETS oncogene family], ELMO1 [phagocytosis and cell motility 1], ELN [elastin], ELP4 [elongation protein 4 homologue (budding yeast)], EMP2 [epithelial membrane protein 2], EMP3 [epithelial protein 3], EMX1 [blank air gate homeo box 1], EMX2 [blank air gate homeo box 2], EN1 [engraved homeo box 1], EN2 [englailed homeo box 2], ENAH [enabled (en bled) homolog (Drosophila)], ENDOG [endonuclease G], ENG [endoglin], ENO1 [enolase 1, (alpha)], ENO2 [enolase 2 (gamma, neurotype)], ENPEP [glutamylaminopeptidase ( Aminopeptida
Ase A)], ENPP1 [Ectonucleotide pyrophosphatase / phosphodiesterase 1], ENPP2 [Ectonucleotide pyrophosphatase / phosphodiesterase 2], ENSA [endosulfin alfa], ENSG00001444396 [], ENSG000000183653 [], ENSG00002155557 [], ENTPD1 [Ecto Nucleoside triphosphate diphosphohydrolase 1], EP300 [E1A binding protein p300], EPCAM [epithelial cell adhesion molecule], EPHA1 [EPH receptor A1], EPHA10 [EPH receptor A10], EPHA2 [EPH receptor A2], EPHA3 [EPH receptor A3], EPHA4 [EPH receptor A4], EPHA5 [EPH receptor A5], EPHA6 [EPH Tone A6], EPHA7 [EPH receptor A7], EPHA8 [EPH receptor A8], EPHB1 [EPH receptor B1], EPHB2 [EPH receptor B2], EPHB3 [EPH receptor B3], EPHB4 [EPH receptor B4 ], EPHB6 [EPH receptor B6], EPHX2 [epoxide hydrolase 2, cytoplasm], EPM2A [epilepsy, progressive myoclonus type 2A, rafora disease (laforin)], EPO [erythropoietin], EPOR [erythropoietin receptor], EPRS [ Glutamyl-prolyl-tRNA synthetase], EPS15 [epidermal growth factor receptor pathway substrate 15], ERBB2 [v-erb-b2 erythroblastic leukemia virus oncogene homolog 2, neuro / glioblastoma oncogene homolog ( Tri)], ERBB3 [v-erb b2 erythroblastic leukemia virus oncogene homolog 3 (bird)], ERBB4 [v-erb-a erythroblastic leukemia virus oncogene homolog 4 (bird)], ERC2 [ELKS / RAB6 interaction / CAST family Member 2], ERCC2 [Resection repair cross-complementing rodent repair deficiency, complementation group 2], ERCC3 [Resection repair cross-complementing rodent repair deficiency, complementation group 3 (Xeroderma pigmentosum B group complementation)], ERCC5 [ Resection repair cross-complementing rodent repair defect, complementation group 5], ERCC6 [Resection repair cross-complementing rodent repair defect, complementation group 6], ERCC8 [Resection repair cross-complementing rodent repair defect, complementation group 8], EREG [Epiregulin], ERG [v-ets erythroblastosis virus E26 oncogene homolog (bird)], ERVWE1 [endogenous retrovirus family W, env (C7), Member 1], ESD [Esterase D / Formylglutathione hydrolase], ESR1 [Estrogen receptor 1], ESR2 [Estrogen receptor 2 (ERbeta)], ESRRA [Estrogen-related receptor alpha], ESRRB [Estrogen Related Receptor Beta], ETS1 [v-ets erythroblastosis virus E26 oncogene homolog 1 (bird)], ETS2 [v-ets erythroblastosis virus E26 oncogene homolog 2 (bird)], ETV1 [ ets mutant 1], ETV4 [ets mutant 4], ETV5 [ets mutant 5], ETV6 [ets mutant 6], EVL [Enah / Vasp-like], EXOC4 [Exorcist complex component 4], EXOC8 [ Exorcist complex component 8], EXT1 [exostose (multiple) 1], E T2 [exostostoma (multiple) 2], EZH2 [Zest homologue enhancer 2 (Drosophila)], EZR [Ezrin], F12 [coagulation factor XII (Hageman factor)], F2 [coagulation factor II (Thrombin)], F2R [coagulation factor II (thrombin) receptor], F2RL1 [coagulation factor II (thrombin) receptor-like 1], F3 [coagulation factor III (thromboplastin, tissue factor)], F7 [coagulation Factor VII (serum prothrombin conversion promoting factor)], F8 [coagulation factor VIII, procoagulant component], F9 [coagulation factor IX], FAAH [fatty acid amide hydrolase], FABP3 [fatty acid binding protein 3, muscle and heart (Breast-derived growth inhibitory factor)], FABP4 [fatty acid binding protein 4, adipocyte , FABP5 [fatty acid binding protein 5 (psoriasis related)], FABP7 [fatty acid binding protein 7, brain], FADD [cell death domain-mediated Fas (TNFRSF6) related], FADS2 [fatty acid desaturase 2], FAM120C [sequence similarity] Family 120C], FAM165B [Family 165 with sequence similarity, Member B], FAM3C [Family 3 with sequence similarity, Member C], FAM53A [Family 53 with sequence similarity, Member A], FARP2 [FERM, RhoGEF and pleckstrin domain protein 2], FARSA [phenylalanyl-tRNA synthetase, alpha subunit], FAS [Fas (TNF receptor superfamily, member 6)], FASLG [F as ligand (TNF superfamily, member 6)], FASN [fatty acid synthase], FASTK [Fas-activated serine / threonine kinase], FBLN1 [fibrin 1], FBN1 [fibrillin 1], FBP1 [fructose-1 [6-bis Phosphatase 1], FBXO45 [F box protein 45], FBXW5 [F box and WD repeat domain containing 5], FBXW7 [F box and WD repeat domain containing 7], FCER2 [Fc fragment of IgE, low affinity II, against it Receptor (CD23)], FCGR1A [Fc fragment of IgG, high affinity Ia, receptor (CD64)], FCGR2A [Fc fragment of IgG, low affinity IIa, receptor (CD32)], FCGR2B [Fc of IgG Fragment, low affinity Ib, receptor (CD32)], FCGR3A [Fc fragment of IgG, low affinity IIIa, receptor (CD16a)], FCRL3 [Fc receptor-like 3], FDFT1 [farnesyl-diphosphate farnesyltransferase 1], FDX1 [Ferredoxin 1], FDXR [ferredoxin reductase], FECH [ferrochelatase (prototoporphyria)], FEM1A [fem-1 homologue a (Caenolabditis elegans)], FER [fer (fps / fes related) tyrosine kinase ], FES [feline sarcoma oncogene], FEZ1 [bundle sequence and extension protein zeta 1 (zygin I)], FEZ2 [bundle sequence and extension protein zeta 2 (zygin II)], FEZF1 [ FEZ family Lead finger 1], FEZF2 [FEZ family zinc finger 2], FGF1 [fibroblast growth factor 1 (acidic)], FGF19 [fibroblast growth factor 19], FGF2 [fibroblast growth factor 2 (basic)] FGF20 [fibroblast growth factor 20], FGF3 [fibroblast growth factor 3 (mouse mammary tumor virus integration site (v-int-2) oncogene homolog)], FGF4 [fibroblast growth factor 4], FGF5 [fibroblast growth factor 5], FGF7 [fibroblast growth factor 7 (keratinocyte growth factor)], FGF8 [fibroblast growth factor 8 (androgen inducible)], FGF9 [fibroblast growth factor 9 (glia) Activating factor)], FGFBP1 [fibroblast growth factor binding protein 1], FGFR1 [fibroblast growth factor receptor 1], F GFR2 [fibroblast growth factor receptor 2], FGFR3 [fibroblast growth factor receptor 3], FGFR4 [fibroblast growth factor receptor 4], FHIT [fragile histidine triple gene], FHL1 [four and a half LIM domain 1], FHL2 [four half LIM domain 2], FIBP [fibroblast growth factor (acidic) intracellular binding protein], FIGF [c-fos inducible growth factor (vascular endothelial growth factor D)], FIG. NL1 [figetin-like 1], FKBP15 [FK506 binding protein 15, 133 kDa], FKBP1B [FK506 binding protein 1B, 12.6 kDa], FKBP5 [FK506 binding protein 5], FKBP6 [FK506 binding protein 6, 36 kDa], FKBP8 [FKBP8] Binding protein 8, 38 kDa], FKTN [ Kuching], FLCN [follicular hormone], FLG [filaggrin], FLI1 [friend leukemia virus integration 1], FLNA [filamin A, alpha], FLNB [filamin B, beta], FLNC [filamin C, gamma], FLT1 [fms Related tyrosine kinase 1 (vascular endothelial growth factor / vascular permeability factor receptor)], FLT3 [fms related tyrosine kinase 3], FMN1 [formin 1], FMNL2 [formin-like 2], FMR1 [fragile X mental retardation 1], FN1 [fibronectin 1], FOLH1 [folate hydrolase (prostate specific membrane antigen) 1], FOLR1 [folate receptor 1 (adult)], FOS [FBJ mouse osteosarcoma virus oncogene homologue], FOSB [FBJ mouse osteosarcoma Virus oncogene homolog B], FOXC2 [Four Head box C2 (MFH-1, Mesenkoku fork head 1)], FOXG1 [fork head box G1], FOXL2 [fork head box L2], FOXM1 [fork head box M1], FOXO1 [fork head box O1], FOXO3 [Fork head box O3], FOXP2 [fork head box P2], FOXP3 [fork head box P3], FPR1 [formyl peptide receptor 1], FPR2 [formyl peptide receptor 2], FRMD7 [FERM domain containing 7], FRS2 [Fibroblast growth factor receptor substrate 2], FRS3 [Fibroblast growth factor receptor substrate 3], FRYL [FRY-like], FSCN1 [Facin homologue 1, actin bundling protein (American urchin)], FSHB [Follicle stimulating hormone, beta polypeptide], FSHR [follicle stimulating hormone receptor], FST [follistatin], FSTL1 [follistatin-like 1], FSTL3 [follistatin-like 3 (secreted glycoprotein)], FTCD [formiminotransferase cyclodeaminase ], FTH1 [ferritin, heavy polypeptide 1], FTL [ferritin, light polypeptide], FTMT [ferritin mitochondria], FTSJ1 [FtsJ homolog 1 (E. coli)], FUCA1 [fucosidase, alpha-L-1, tissue] , Furin [furin (paired basic amino acid cleaving enzyme)], FUT1 [fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)], FUT4 [fucosyltransferase] (Alpha (1 [3) fucosyltransferase, myeloid specific)], FXN [frataxin], FXR1 [fragile X mental retardation, autosomal homolog 1], FXR2 [fragile X mental retardation, autosomal homolog 2], FXYD1 [FXYD domain-containing ion transport regulator 1], FYB [FYN-binding protein (FYB-120 / 130)], FYN [FYN oncogene related to SRC, FGR, YES], FZD1 [frizzled homolog 1 ( Drosophila)], FZD10 [frizzled homologue 10 (Drosophila)], FZD2 [frizzled homologue 2 (Drosophila)], FZD3 [frizzled) homologue 3 (Drosophila D, Drosophila D) Frizzled homologue 4 (Drosophila)], FZD5 [frizzled homologue 5 (Drosophila)], FZD6 [frizzled) homologue 6 (Drosophila), FZD7 [frizled (frzle) Drosophila)], FZD8 [frizzled homologue 8 (Drosophila)], FZD9 [frizzled homologue 9 (Drosophila)], FZR1 [fizzy / cell division cycle 20 related 1 (Drosophila) G6PD [glucose-6-phosphate dehydrogenase], GAA [glucosidase, alpha, acid], GAB1 [GRB2-related binding protein 1], GABARAP [GABA (A) receptor Body-related protein], GABBR1 [gamma-aminobutyric acid (GABA) B receptor, 1], GABBR2 [gamma-aminobutyric acid (GABA) B receptor, 2], GABPA [GA binding protein transcription factor, alpha subunit 60 kDa] GABRA1 [gamma-amino
Butyric acid (GABA) A receptor, alpha 1], GABRA2 [gamma-aminobutyric acid (GABA) A receptor, alpha 2], GABRA3 [gamma-aminobutyric acid (GABA) A receptor, alpha 3], GABRA4 [gamma- Aminobutyric acid (GABA) A receptor, alpha 4], GABRA5 [gamma-aminobutyric acid (GABA) A receptor, alpha 5], GABRA6 [gamma-aminobutyric acid (GABA) A receptor, alpha 6], GABRB1 [gamma] Aminobutyric acid (GABA) A receptor, beta 1], GABRB2 [gamma-aminobutyric acid (GABA) A receptor, beta 2], GABRB3 [gamma-aminobutyric acid (GABA) A receptor, beta 3], GABRD [ Gamma-aminobutyric acid (GABA) A receptor, delta], GABRE [gamma-amino Acid (GABA) A receptor, epsilon], GABRG1 [gamma-aminobutyric acid (GABA) A receptor, gamma 1], GABRG2 [gamma-aminobutyric acid (GABA) A receptor, gamma 2], GABRG3 [gamma-amino Butyrate (GABA) A receptor, gamma 3], GABRP [gamma-aminobutyric acid (GABA) A receptor, pie], GAD1 [glutamate decarboxylase 1 (brain, 67 kDa)], GAD2 [glutamate decarboxylase 2 (islet and Brain, 65 kDa)], GAL [galanin prepropeptide], GALE [UDP-galactose-4-epimerase], GALK1 [galactokinase 1], GALT [galactose-1-phosphate uridylyltransferase], GAP43 [growth binding protein 43], GA DH [glyceraldehyde-3-phosphate dehydrogenase], GARS [glycyl-tRNA synthetase], GART [phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase], GAS1 [growth arrest specific 1 ], GAS6 [growth arrest specific 6], GAST [gastrin], GATA1 [GATA binding protein 1 (globin transcription factor 1)], GATA2 [GATA binding protein 2], GATA3 [GATA binding protein 3], GATA4 [GATA binding Protein 4], GATA6 [GATA-binding protein 6], GBA [glucosidase, beta, acid], GBE1 [glucan (1 [4-alpha-), branching enzyme 1], GBX2 [ Gastrulation brain homeobox 2], GC [group-specific component (vitamin D binding protein)], GCG [glucagon], GCH1 [GTP cyclohydrolase 1], GCNT1 [glucosaminyl (N-acetyl) transferase 1, core 2], GDAP1 [ganglioside-induced differentiation-related protein 1], GDF1 [growth differentiation factor 1], GDF11 [growth differentiation factor 11], GDF15 [growth differentiation factor 15], GDF7 [growth differentiation factor 7], GDI1 [GDP dissociation Inhibitory factor 1], GDI2 [GDP dissociation inhibitory factor 2], GDNF [glial cell-derived neurotrophic factor], GDPD5 [glycerophosphodiester phosphodiesterase domain-containing 5], GEM [GTP binding protein overexpressed in skeletal muscle], GFAP [Glial fibrillary acid Protein], GFER [growth factor, augmenter of liver regeneration], GFI1B [growth factor independent 1B transcriptional repressor], GFRA1 [GDNF family receptor alpha 1], GFRA2 [GDNF family receptor alpha 2], GFRA3 [ GDNF family receptor alpha 3], GFRA4 [GDNF family receptor alpha 4], GGCX [gamma-glutamyl carboxylase], GGNBP2 [gametogenetin binding protein 2], GGT1 [gamma-glutamyltransferase 1], GGT2 [gamma- Glutamyltransferase 2], GH1 [growth hormone 1], GHR [growth hormone receptor], GHRH [growth hormone releasing hormone], GHRHR [growth hormone releasing hormone] Mon receptor], GHRL [ghrelin / obstatin prepropeptide], GHSR [growth hormone secretagogue receptor], GIPR [gastric inhibitory polypeptide receptor], GIT1 [G protein-coupled receptor kinase interaction ArfGAP 1] , GJA1 [gap junction protein, alpha 1, 43 kDa], GJA4 [gap junction protein, alpha 4, 37 kDa], GJA5 [gap junction protein, alpha 5, 40 kDa], GJB1 [gap junction protein, beta 1, 32 kDa], GJB2 [Gap junction protein, beta 2, 26 kDa], GJB6 [Gap junction protein, beta 6, 30 kDa], GLA [galactosidase, alpha], GLB1 [galactosidase, beta 1], GLDC [Glici Dehydrogenase (decarboxylation)], GLI1 [GLI family zinc finger 1], GLI2 [GLI family zinc finger 2], GLI3 [GLI family zinc finger 3], GLIS1 [GLIS family zinc finger 1], GLIS2 [GLIS family zinc finger 2], GLO1 [glyoxalase I], GLRA2 [glycine receptor, alpha 2], GLRB [glycine receptor, beta], GLS [glutaminase], GLUD1 [glutamate dehydrogenase 1], GLUD2 [glutamate dehydrogenase 2], GLUL [Glutamate-ammonia ligase (glutamine synthetase)], GLYAT [glycine-N-acyltransferase], GMFB [glial maturation factor, beta ], GMNN [geminin, DNA replication inhibitor], GMPS [guanine monophosphate synthetase], GNA11 [guanine nucleotide binding protein (G protein), alpha 11 (Gq class)], GNA12 [guanine nucleotide binding protein (G protein) Alpha12], GNA13 [guanine nucleotide binding protein (G protein), alpha13], GNA14 [guanine nucleotide binding protein (G protein), alpha14], GNA15 [guanine nucleotide binding protein (G protein), alpha15 (Gq class) )], GNAI1 [guanine nucleotide-binding protein (G protein), alpha inhibitory polypeptide 1], GNAI2 [guanine nucleotide-binding protein (G protein) ), Alpha inhibitory polypeptide 2], GNAI3 [guanine nucleotide binding protein (G protein), alpha inhibitory polypeptide 3], GNAL [guanine nucleotide binding protein (G protein), alpha activating polypeptide, olfaction Type], GNAO1 [guanine nucleotide binding protein (G protein), alpha-activating active polypeptide O], GNAQ [guanine nucleotide binding protein (G protein), q polypeptide], GNAS [GNAS complex locus], GNAT1 [ Guanine nucleotide-binding protein (G protein), alpha-transmitting active polypeptide 1], GNAT2 [Guanine nucleotide-binding protein (G protein), alpha-transmitting active polypeptide 2], GNAZ Guanine nucleotide binding protein (G protein), alpha z polypeptide], GNB1 [guanine nucleotide binding protein (G protein), beta polypeptide 1], GNB1L [guanine nucleotide binding protein (G protein), beta polypeptide 1-like], GNB2 [guanine nucleotide binding protein (G protein), beta polypeptide 2], GNB2L1 [guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1], GNB3 [guanine nucleotide binding protein (G protein), beta polypeptide 3], GNB4 [guanine nucleotide binding protein (G protein), beta polypeptide 4], GNB5 [guanine nucleotide binding protein (G protein) , Beta 5], GNG10 [guanine nucleotide binding protein (G protein), gamma 10], GNG11 [guanine nucleotide binding protein (G protein), gamma 11], GNG12 [guanine nucleotide binding protein (G protein), gamma 12], GNG13 [guanine nucleotide binding protein (G protein), gamma 13], GNG2 [guanine nucleotide binding protein (G protein), gamma 2], GNG3 [guanine nucleotide binding protein (G protein), gamma 3], GNG4 [guanine nucleotide binding Protein (G protein), gamma 4], GNG5 [guanine nucleotide binding protein (G protein), gamma 5], GNG7 [guanine nucleotide binding protein G protein), gamma 7], GNLY [granulinin], GNRH1 [gonadotropin releasing hormone 1 (luteinogenic releasing hormone)], GNRHR [gonadotropin releasing hormone receptor], GOLGA2 [Golgin A2], GOLGA4 [Golgin A4], GOT2 [glutamate-oxaloacetate transaminase 2, mitochondria (aspartate aminotransferase 2)], GP1BA [glycoprotein Ib (platelet), alpha polypeptide], GP5 [glycoprotein V (platelet)], GP6 [glycoprotein VI (platelet)], GP9 [glycoprotein IX (platelet)], GPC1 [glypican 1], GPC3 [glypican 3], GPD1 [glycerol-3-phosphate dehydrogenase 1 (soluble)], GPN [gef Phosphorus], GPI [glucose phosphate isomerase], GPM6A [glycoprotein M6A], GPM6B [glycoprotein M6B], GPR161 [G protein-coupled receptor 161], GPR182 [G protein-coupled receptor 182], GPR56 [G protein-coupled] Receptor 56], GPRC6A [G protein-coupled receptor, family C, group 6, member A], GPRIN1 [G protein-regulated inducer 1 of neurite outgrowth 1], GPT [glutamate-pyruvate transaminase (alanine aminotransferase) ], GPT2 [glutamate pyruvate transaminase (alanine aminotransferase) 2], GPX1 [glutathione peroxidase 1], GPX3 [glutathione peroxidase 3 (plasma)], GPX 4 [glutathione peroxidase 4 (phospholipid hydroperoxidase)], GRAP [GRB2-related adapter protein], GRB10 [growth factor receptor binding protein 10], GRB2 [growth factor receptor binding protein 2], GRB7 [growth factor receptor binding] Protein 7], GREM1 [Gremlin 1, Cysteine Knot Superfamily, Homologue (Xenopus laevis)], GRIA1 [Glutamate Receptor, Anionic, AMPA1], GRIA2 [Glutamate Receptor, Anionic, AMPA2], GRIA3 [ Glutamate receptor, ionic, AMPA3], GRID2 [glutamate receptor, ionic, delta2], GRID2IP [glutamate receptor, ionic, delta2 (grid2) interacting protein , GRIK1 [glutamate receptor, ionic, kainate 1], GRIK2 [glutamate receptor, ionic, kainate 2], GRIN1 [glutamate receptor, ionic, N-methyl D-aspartic acid 1], GRIN2A [glutamate receptor, counterionic, N-methyl D-aspartate 2A], GRIP1 [glutamate receptor interacting protein 1], GRLF1 [glucocorticoid receptor DNA binding factor 1], GRM1 [glutamate Receptor, metabotropic 1], GRM2 [glutamate receptor, metabotropic 2], GRM5 [glutamate receptor, metabotropic 5], GRM7 [glutamate receptor, metabotropic 7], GRM8 [glutamate receptor] , Metabotropic 8], GRN [granulin], GRP [gastrin releasing pep De], GRPR [gastrin releasing peptide receptor], GSK3B [glycogen synthase kinase 3 beta], GSN [gelsolin], GSR [glutathione reductase], GSS [glutathione synthetase], GSTA1 [glutathione S- transferase
Zealpha 1], GSTM1 [glutathione S-transferase mu 1], GSTP1 [glutathione S-transferase pie 1], GSTT1 [glutathione S-transferase theta 1], GSTZ1 [glutathione transferase zeta 1], GTF2B [basic transcription factor IIB] , GTF2E2 [basic transcription factor IIE, polypeptide 2, beta 34 kDa], GTF2H1 [basic transcription factor IIH, polypeptide 1, 62 kDa], GTF2H2 [basic transcription factor IIH, polypeptide 2, 44 kDa], GTF2H3 [basic Transcription factor IIH, polypeptide 3, 34 kDa], GTF2H4 [basic transcription factor IIH, polypeptide 4, 52 kDa], GTF2I [basic transcription factor IIi], GTF2IRD1 GTF2I repeat domain containing 1], GTF2IRD2 [GTF2I repeat domain containing 2], GUCA2A [guanylate cyclase activator 2A (guanylin)], GUCY1A3 [guanylate cyclase 1, soluble, alpha3], GUSB [glucuronidase, beta], GYPA [Glycophorin A (MNS blood group)], GYPC [Glycophorin C (Gelvic blood group)], GZF1 [GDNF-inducible zinc finger protein 1], GZMA [Granzyme A (Granzyme 1, cytotoxic T lymphocyte-related serine) Esterase 3)], GZMB [Granzyme B (Granzyme 2, cytotoxic T lymphocyte-related serine esterase 1)], H19 [H19, maternal imprinted expression transcription (non-protein code)], H1F0 [H Histone family, member 0], H2AFX [H2A histone family, member X], H2AFY [H2A histone family, member Y], H6PD [hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)], HADHA [hydroxyacyl-complement Enzyme A dehydrogenase / 3-ketoacyl-coenzyme A thiolase / enoyl-coenzyme A hydratase (trifunctional protein), alpha subunit], HAMP [hepcidin antibacterial peptide], hand 1 [cardiac and neural crest derivative expression 1] , Hand 2 [cardiac and neural crest derivative expression 2], HAP1 [huntingtin-related protein 1], HAPLN1 [hyaluronan and proteoglycan link protein 1], HARS [histidyl-tRNA synte Hase1], HAS1 [hyaluronan synthase 1], HAS2 [hyaluronan synthase 2], HAS3 [hyaluronan synthase 3], HAX1 [HCLS1-binding protein X-1], HBA2 [hemoglobin, alpha 2], HBB [hemoglobin, beta], HBEGF [heparin-binding EGF-like growth factor], HBG1 [hemoglobin, gamma A], HBG2 [hemoglobin, gamma G], HCCS [holocytochrome c synthase (cytochrome c heme-lyase)], HCK [hematopoietic cell kinase], HCLS1 [Hematopoietic cell-specific phosphorus substrate 1], HCN4 [hyperpolarization activated cyclic nucleotide-gated potassium channel 4], HCRT [hypocretin (orexin) neuropeptide precursor], HCRTR1 [hypocretin (orexin) receptor 1 ], HCRTR2 [hypocretin (orexin) receptor 2], HDAC1 [histone deacetylase 1], HDAC2 [histone deacetylase 2], HDAC4 [histone deacetylase 4], HDAC9 [histone deacetylase 9], HDC [Histidine decarboxylase], HDLBP [high density lipoprotein binding protein], HEPACAM [hepatocyte cell adhesion molecule], HES1 [split hair-like and enhancer 1, (Drosophila)], HES3 [split hair-like and enhancer 3 ( Drosophila)], HES5 [Split Hair and Enhancer 5 (Drosophila)], HES6 [Split Hair and Enhancer 6 (Drosophila)], HEXA [Hexosaminidase A (Alpha Repeptide)], HFE [hemopigmentation], HFE2 [hemopigmentation type 2 (juvenile)], HGF [hepatocyte growth factor (hepapoietin A, scatter factor)], HGS [hepatocyte growth factor-regulated tyrosine kinase substrate ], HHEX [hematopoietic expression homeobox], HHIP [hedgehog interacting protein], HIF1A [hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)], HINT1 [histidine triplet] Nucleotide binding protein 1], HIPK2 [homeodomain interacting protein kinase 2], HIRA [HIR histone cell cycle control defect homolog A (budding yeast)], HIRIP3 [HIRA interacting protein 3], HIST1H2AB [histone cluster 1, H2ab ], HIST1 2AC [Histone cluster 1, H2ac], HIST1H2AD [Histone cluster 1, H2ad], HIST1H2AE [Histone cluster 1, H2ae], HIST1H2AG [Histone cluster 1, H2ag], HIST1H2AI [Histone cluster 1, H2ai], HIST1H2A , H2aj], HIST1H2AK [histone cluster 1, H2ak], HIST1H2AL [histone cluster 1, H2al], HIST1H2AM [histone cluster 1, H2am], HIST1H3E [histone cluster 1, H3e], HIST2H2AA2H3A2H3A2 [Histone cluster 2, H2aa4], HIST2H2AC [hist Cluster 2, H2ac], HKR1 [GLI-Kruppel family member HKR1], HLA-A [major histocompatibility complex, class I, A], HLA-B [major histocompatibility complex, class I, B ], HLA-C [major histocompatibility complex, class I, C], HLA-DMA [major histocompatibility complex, class II, DM alpha], HLA-DOB [major histocompatibility complex, class II] , DO beta], HLA-DQA1 [major histocompatibility complex, class II, DQ alpha 1], HLA-DQB1 [major histocompatibility complex, class II, DQ beta 1], HLA-DRA [major histocompatibility Sex complex, class II, DRalpha], HLA-DRB1 [major histocompatibility complex, class II, DRbeta1], HLA-DRB4 [major tissue suitability Sex complex, class II, DR beta 4], HLA-DRB5 [major histocompatibility complex, class II, DR beta 5], HLA-E [major histocompatibility complex, class I, E], HLA- F [major histocompatibility complex, class I, F], HLA-G [major histocompatibility complex, class I, G], HLCS [holocarboxylase synthetase (biotin- (propionyl-coenzyme A-carboxylase (ATP -Hydrolysis)) Ligase)]], HMBS [Hydroxymethylbilan synthase], HMGA1 [High mobility group A T hook 1], HMGA2 [High mobility group A T hook 2], HMGB1 [High mobility group box 1] , HMGCR [3-hydroxy-3-methylglutaryl-coenzyme A reductase], HMGN1 [high mobility group nucleosome-binding domain In 1], HMOX1 [heme oxygenase (decycling) 1], HMOX2 [heme oxygenase (decycling) 2], HNF1A [HNF1 homeobox A], HNF4A [hepatocyte nuclear factor 4, alpha], HNMT [histamine N-methyl Transferase], HNRNPA2B1 [heterologous nuclear ribonucleoprotein A2 / B1], HNRNPK [heterologous nuclear ribonucleoprotein K], HNRNPL [heterologous nuclear ribonucleoprotein L], HNRNPU [heterologous nuclear ribonucleoprotein U (scaffolding adhesion factor A)] , HNRDL [Heterologous ribonucleoprotein D-like], HOMER1 [Homer homolog 1 (Drosophila)], HOXA1 [Homeobox A1], HOXA10 [Homeobox A10], HOXA2 [Home] Obox A2], HOXA5 [homeobox A5], HOXA9 [homeobox A9], HOXB1 [homeobox B1], HOXB4 [homeobox B4], HOXB9 [homeobox B9], HOXD11 [homeobox D11], HOXD12 [homeobox 12] Box D12], HOXD13 [Homeobox D13], HP [Haptoglobin], HPD [4-Hydroxyphenylpyruvate dioxygenase], HPRT1 [Hypoxanthine phosphoribosyltransferase 1], HPS4 [Hermansky-Padlac syndrome 4], HPX [ Hemopexin], HRAS [v-Ha-ras Harvey rat sarcoma virus oncogene homologue], HRG [histidine-rich glycoprotein], HRH1 [histamine receptor H1] HRH2 [histamine receptor H2], HRH3 [histamine receptor H3], HSD11B1 [hydroxysteroid (11-beta) dehydrogenase 1], HSD11B2 [hydroxysteroid (11-beta) dehydrogenase 2], HSD17B10 [hydroxysteroid (17-beta) ) Dehydrogenase 10], HSD3B2 [hydroxy-delta-5-steroid dehydrogenase, 3beta- and steroid delta-isomerase 2], HSF1 [heat shock transcription factor 1], HSP90AA1 [heat shock protein 90 kDa alpha (cytosol), class A Member 1], HSP90B1 [heat shock protein 90 kDa beta (Grp94), member 1], HSPA1A [heat shock 70 kD protein A], HSPA4 [heat shock 70 kD protein 4], HSPA5 [heat shock 70 kD protein 5 (glucose-regulated protein, 78 kDa)], HSPA8 [heat shock 70 kD protein 8], HSPA9 [heat shock 70 kD protein 9 (mortarin)], HSPB1 [heat shock 27 kD protein 1], HSPD1 [heat shock 60 kD protein 1 (chaperonin)], HSPE1 [heat shock 10 kD protein 1 (chaperonin 10)], HSPG2 [heparan sulfate proteoglycan 2], HTN1 [histatin 1], HTR1A [ 5-hydroxytryptamine (serotonin) receptor 1A], HTR1B [5-hydroxytryptamine (serotonin) receptor 1B], HTR1D [5-hydroxytryptamine (se Rotonin) receptor 1D], HTR1E [5-hydroxytryptamine (serotonin) receptor 1E], HTR1F [5-hydroxytryptamine (serotonin) receptor 1F], HTR2A [5-hydroxytryptamine (serotonin) receptor 2A], HTR2B [5-hydroxytryptamine (serotonin) receptor 2B], HTR2C [5-hydroxytryptamine (serotonin) receptor 2C], HTR3A [5-hydroxytryptamine (serotonin) receptor 3A], HTR3B [5-hydroxytryptamine (serotonin) Receptor 3B], HTR5A [5-hydroxytryptamine (serotonin) receptor 5A], HTR6 [5-hydroxytryptamine (serotonin) receptor 6], HTR7 [5-hydroxytryptamine (serotonin) receptor Body 7 (adenylate cyclase binding)], HTT [huntingtin], HYAL1 [hyaluronoglucosaminidase 1], HYOU1 [hypoxic upregulation 1], IAPP [islet amyloid polypeptide], IBSP [integrin binding sialoprotein], ICAM1 [cell adhesion molecule 1], ICAM2 [cell adhesion molecule 2], ICAM3 [cell adhesion molecule 3], ICAM5 [cell adhesion molecule 5, telecephalin], ICOS [inducible T cell costimulatory factor] ID1 [Inhibitor 1 of DNA binding, dominant inhibitory helix-loop-helix protein], ID2 [Inhibitor of DNA binding 2, dominant inhibitory helix-loop-helix protein], ID3 [Inhibitor 3 of DNA binding, dominant inhibition Helix-loop-helix protein], ID4 Inhibitor 4 of DNA binding, dominant inhibition helix-loop-helix protein], IDE [insulin-degrading enzyme], IDI1 [isopentenyl-diphosphate delta isomerase 1], IDO1 [indoleamine 2 [3-dioxygenase 1], IDS [iduronic acid 2
-Sulfatase], IDUA [iduronidase, alpha-L-], IER3 [early reaction 3], IFI27 [interferon, alpha inducible protein 27], IFNA1 [interferon, alpha1], IFNA2 [interferon, alpha2], IFNAR1 [Interferon (alpha, beta and omega) receptor 1], IFNAR2 [interferon (alpha, beta and omega) receptor 2], IFNB1 [interferon, beta 1, fibroblast], IFNG [interferon, gamma], IFNGR1 [ Interferon gamma receptor 1], IFNGR2 [interferon gamma receptor 2 (interferon gamma transmission factor 1)], IGF1 [insulin-like growth factor 1 (somatomedin C)], GF1R [insulin-like growth factor 1 receptor], IGF2 [insulin-like growth factor 2 (somatomedin A)], IGF2R [insulin-like growth factor 2 receptor], IGFBP1 [insulin-like growth factor binding protein 1], IGFBP2 [insulin-like] Growth factor binding protein 2, 36 kDa], IGFBP3 [insulin-like growth factor binding protein 3], IGFBP4 [insulin-like growth factor binding protein 4], IGFBP5 [insulin-like growth factor binding protein 5], IGFBP6 [insulin-like growth factor binding protein] 6], IGFBP7 [insulin-like growth factor binding protein 7], IGHA1 [immunoglobulin heavy constant alpha 1], IGHE [immunoglobulin heavy constant epsilon], IGHG1 [immunoglobulin heavy constant gamma 1 (G m marker)], IGHJ1 [immunoglobulin heavy chain 1], IGHM [immunoglobulin heavy constant mu], IGHMBP2 [immunoglobulin mu binding protein 2], IGKC [immunoglobulin kappa constant], IKBKAP [kappa light polypeptide in B cells Inhibitor of gene enhancer, kinase complex-related protein], IKBKB [inhibitor of kappa light polypeptide gene enhancer in B cells, kinase beta], IKZF1 [IKAROS family zinc finger 1 (Icarus)], IL10 [interleukin 10] IL10RA [interleukin 10 receptor, alpha], IL10RB [interleukin 10 receptor, beta], IL11 [interleukin 11], IL11RA [interleukin 11 Receptor, alpha], IL12A [interleukin 12A (natural killer cell stimulating factor 1, cytotoxic lymphocyte maturation factor 1, p35)], IL12B [interleukin 12B (natural killer cell stimulating factor 2, cytotoxicity) Lymphocyte maturation factor 2, p40)], IL12RB1 [interleukin 12 receptor, beta 1], IL13 [interleukin 13], IL15 [interleukin 15], IL15RA [interleukin 15 receptor, alpha], IL16 [Interleukin 16 (lymphocyte chemoattractant)], IL17A [interleukin 17A], IL18 [interleukin 18 (interferon-gamma inducing factor)], IL18BP [interleukin 18 binding protein], IL1A [interleukin IL-1, alpha], IL1B [interleukin 1, beta], IL1F7 [interleukin 1 family, member 7 (zeta)], IL1R1 [interleukin 1 receptor, type I], IL1R2 [interleukin 1 receptor, II Type], IL1RAPL1 [interleukin 1 receptor accessory protein-like 1], IL1RL1 [interleukin 1 receptor-like 1], IL1RN [interleukin 1 receptor antagonist], IL2 [interleukin 2], IL21 [interleukin 21] IL22 [interleukin 22], IL23A [interleukin 23, alpha subunit p19], IL23R [interleukin 23 receptor], IL29 [interleukin 29 (interferon, lambda 1)], IL2 A [interleukin 2 receptor, alpha], IL2RB [interleukin 2 receptor, beta], IL3 [interleukin 3 (colony stimulating factor, multiple)], IL3RA [interleukin 3 receptor, alpha (low affinity) )], IL4 [interleukin 4], IL4R [interleukin 4 receptor], IL5 [interleukin 5 (colony stimulating factor, eosinophils)], IL6 [interleukin 6 (interferon, beta 2)], IL6R [ Interleukin 6 receptor], IL6ST [interleukin 6 signaling factor (gp130, oncostatin M receptor)], IL7 [interleukin 7], IL7R [interleukin 7 receptor], IL8 [interleukin 8], IL9 [Interleukin 9], ILK [Integration Phosphorus chain kinase], IMMP2L [IMP2 internal mitochondrial membrane peptidase-like (budding yeast)], IMMT [inner membrane protein, mitochondria (mitophylline)], IMPA1 [inositol (myo) -1 (or 4) -monophosphatase 1], IMPDH2 [IMP (inosine monophosphate) dehydrogenase 2], INADL [InaD-like (Drosophila)], INCENP [internal centromere protein antigen 135/155 kDa], ING1 [growth family inhibitor, member 1], ING3 [growth family inhibition] Factor, member 3], INHA [inhibin, alpha], INHBA [inhibin, beta A], INPP1 [inositol polyphosphate-1-phosphatase], INPP5D [inositol polyline] -5-phosphatase, 145 kDa], INPP5E [inositol polyphosphate-5-phosphatase, 72 kDa], INPP5J [inositol polyphosphate-5-phosphatase J], INPPL1 [inositol polyphosphate phosphatase-like 1], INS [insulin], INSIG2 [ Insulin-inducible gene 2], INS-IGF2 [INS-IGF2 read-through transcription], INSL3 [insulin-like 3 (Leydig cells)], INSR [insulin receptor], INVS [inversin], IQCB1 [IQ motif-containing B1 ] IQGAP1 [IQ motif-containing GTPase activating protein 1], IRAK1 [interleukin-1 receptor-related kinase 1], IRAK4 [interleukin-1 receptor-related kinase 4], I EB2 [iron responsive element binding protein 2], IRF1 [interferon regulatory factor 1], IRF4 [interferon regulatory factor 4], IRF8 [interferon regulatory factor 8], IRS1 [insulin receptor substrate 1], IRS2 [insulin Receptor substrate 2], IRS4 [insulin receptor substrate 4], IRX3 [Iroquois homeobox 3], ISG15 [ISG15 ubiquitin-like modifier], ISL1 [ISL LIM homeobox 1], ISL2 [ISL LIM homeobox 2], ISLR2 [leucine rich repeat 2 containing immunoglobulin superfamily], ITGA2 [integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], ITGA2B [integrin, alpha 2b (IIb / IIa complex platelet glycoprotein IIb, antigen CD41)], ITGA3 [integrin, alpha3 (antigen CD49C, alpha3 subunit of VLA-3 receptor)], ITGA4 [integrin, alpha4 (antigen CD49D, VLA-4) Alpha4 subunit of the receptor)], ITGA5 [integrin, alpha5 (fibronectin receptor, alpha polypeptide)], ITGA6 [integrin, alpha6], ITGA9 [integrin, alpha9], ITGAL [integrin, alphaL ( Antigen CD11A (p180), lymphocyte function-related antigen 1, alpha polypeptide)], ITGAM [integrin, alpha M (complement component 3 receptor 3 subunit)], ITGAV [integrin, alpha V (vitro) Cutin receptor, alpha polypeptide, antigen CD51)], ITGAX [integrin, alpha X (complement component 3 receptor 4 subunit)], ITGB1 [integrin, beta1 (fibronectin receptor, beta polypeptide, antigen CD29) Includes MDF2, MSK12)], ITGB2 [integrin, beta 2 (complement component 3 receptors 3 and 4 subunits)], ITGB3 [integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)], ITGB4 [Integrin, beta 4], ITGB6 [integrin, beta 6], ITGB7 [integrin, beta 7], ITIH4 [inter-alpha (globulin) inhibitor H4 (plasma kallikrein sensitive glycoprotein)], ITM2B [integrated membrane protein 2B], ITPR1 [inositol 1 [4 [5-triphosphate receptor, type 1], ITPR2 [inositol 1 [4 [5-triphosphate receptor, type 2], ITPR3 [inositol 1 [4 [5- Triphosphate receptor, type 3], ITSN1 [intersectin 1 (SH3 domain protein)], ITSN2 [intersectin 2], IVL [involucrin], JAG1 [jagged 1 (Alagille syndrome)], JAK1 [Janus Kinase 1], JAK2 [Janus Kinase 2], JAK3 [Janus Kinase 3], JAM2 [Junction Adhesion Molecule 2], JARID2 [Tenji, AT Rich Interaction Domain 2], JMJD1C [Tenji Domain Containing 1C], JMY [Junction-mediated and regulatory protein, p53 cofactor], JRKL [Jerky homology Like (mouse)], JUN [jun oncogene], JUNB [jun B proto-oncogene], JUND [jun D proto-oncogene], JUP [junction placoglobin], KAL1 [Kalman syndrome 1 sequence], KALRN [ Caliline, RhoGEF kinase], KARS [lysyl-tRNA synthetase], KAT2B [K (lysine) acetyltransferase 2B], KATNA1 [katanin p60 (containing ATPase) subunit A1], KATNB1 [containing katanin p80 (including WD repeat) subunits B1], KCNA4 [potassium voltage-gated channel, shaker-related subfamily, member 4], KCND1 [potassium voltage-gated channel, Shal-related subfamily, member 1], KCND2 [k Um potential-gated channel, Shal-related subfamily, member 2], KCNE1 [potassium-potential-gated channel, Isk-related family, member 1], KCNE2 [potassium-potential-gated channel, Isk-related family, member 2], KCNH2 [potassium voltage-gated channel, subfamily H (eag related), member 2], KCNH4 [potassium voltage-gated channel, subfamily H (eag related), member 4], KCNJ15 [potassium inward rectifier channel, sub Family J, member 15], KCNJ3 [potassium inward rectifier channel, subfamily J, member 3], KCNJ4 [potassium inward rectifier channel, subfamily J, member 4], KCNJ5 [potassium inward rectifier channel , Subfamily J, member 5], KCNJ6 [potassium inward rectifier channel, subfamily J, member 6], KCNMA1 [potassium large conductance calcium activation channel, subfamily M, alpha member 1], KCNN1 [potassium intermediate / Small conductance calcium activation channel, subfamily N, member 1], KCNN2 [potassium intermediate / small conductance calcium activation channel, subfamily N, member 2], KCNN3 [potassium intermediate / small conductance calcium activation channel, Subfamily N, member 3], KCNQ1 [potassium voltage-gated channel, KQT-like subfamily, member 1], KCNQ2 [potassium voltage-gated channel, KQT-like subfamily, member -2], KDM5C [lysine (K) -specific demethylase 5C], KDR [kinase insertion domain receptor (type III receptor tyrosine kinase)], KIAA0101 [KIAA0101], KIAA0319 [KIAA0319], KIAA1715 [KIAA1
715], KIDINS220 [kinase D interaction substrate, 220 kDa], KIF15 [kinesin family member 15], KIF16B [kinesin family member 16B], KIF1A [kinesin family member 1A], KIF2A [kinesin heavy chain member 2A], KIF2B [kinesin Family member 2B], KIF3A [kinesin family member 3A], KIF5C [kinesin family member 5C], KIF7 [kinesin family member 7], KIR2DL1 [killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1], KIR2DL3 [killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3], KIR2DS2 [killer cell immunoglobulin-like receptor, two domains, Cytoplasmic tail, 2], KIR3DL1 [killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1], KIR3DL2 [killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2], KIRREL3 [ IRRE-like relative 3 (Drosophila)], KISS1 [KiSS-1 metastasis suppressor], KISS1R [KISS1 receptor], KIT [v-kit Hardy-Zuckerman 4 feline sarcoma virus oncogene homologue], KITLG [KIT ligand] , KL [Kroto], KLF7 [Kruppel-like factor 7 (ubiquitous)], KLK1 [kallikrein 1], KLK10 [kallikrein-related peptidase 10], KLK11 [kallikrein-related peptidase 11], KLK2 [kallikrein-related peptidase 2], KLK3 [ Ricklein-related peptidase 3], KLK5 [kallikrein-related peptidase 5], KLRD1 [killer cell lectin-like receptor subfamily D, member 1], KLRK1 [killer cell lectin-like receptor subfamily K, member 1], KMO [kynurenine 3 -Monooxygenase (kynurenine 3-hydroxylase)], KNG1 [kininogen 1], KPNA2 [cariopherin alpha 2 (RAG cohort 1, importin alpha 1)], KPNB1 [cariopherin (importin) beta 1], KPTN [captin] (Actin binding protein)], KRAS [v-Ki-ras2 kristen rat sarcoma virus oncogene homologue], KRIT1 [KRIT1, containing ankyrin repeat], KRT1 [keratin 1], KRT1 0 [keratin 10], KRT14 [keratin 14], KRT18 [keratin 18], KRT19 [keratin 19], KRT3 [keratin 3], KRT5 [keratin 5], KRT7 [keratin 7], KRT8 [keratin 8], KRTAP19- 3 [keratin binding protein 19-3], KRTAP2-1 [keratin binding protein 2-1], L1CAM [L1 cell adhesion molecule], LACTB [lactamase, beta], LALBA [lactalbumin, alpha-], LAMA1 [laminin, Alpha1], LAMB1 [laminin, beta1], LAMB2 [laminin, beta2 (laminin S)], LAMB4 [laminin, beta4], LAMP1 [lysosome-related membrane protein 1], LAMP2 [lysosome-related membrane protein 2], LAP3 [ Isin aminopeptidase 3], LAPTM4A [lysosomal protein transmembrane 4 alpha], large [like glycosyltransferase], LARS [leucyl-tRNA synthetase], LASP1 [LIM and SH3 protein 1], LAT2 [linker for T cell family activation , Member 2], LBP [lipopolysaccharide binding protein], LBR [lamin B receptor], LCA10 [lung cancer-related protein 10], LCA5 [leber congenital cataract 5], LCAT [lecithin-cholesterol acyltransferase], LCK [lymphoid] Sphere-specific protein tyrosine kinase], LCN1 [lipocalin 1 (tear prealbumin)], LCN2 [lipocalin 2], LCP1 [lymphocyte cytosolic protein 1 (L-plastin)], L P2 [Lymphocyte cytosolic protein 2 (76 kDa SH2 domain-containing leukocyte protein)], LCT [Lactase], LDB1 [LIM domain binding 1], LDB2 [LIM domain binding 2], LDHA [Lactate dehydrogenase A], LDLR [Low Density lipoprotein receptor], LDLRAP1 [low density lipoprotein receptor adapter protein 1], LEF1 [lymphoid enhancer binding factor 1], LEO1 [Leo1, Paf1 / RNA polymerase II complex component, homologue (budding yeast) ], LEP [leptin], LEPR [leptin receptor], LGALS13 [lectin, galactoside bond, soluble, 13], LGALS3 [lectin, galactoside bond, soluble, 3], LGMN [legumain], LGR4 [leucine G repeat-containing G protein-coupled receptor 4], LGTN [ligatin], LHCGR [Luteinizing hormone / chorionic gonadotropin receptor], LHFPL3 [lipoma HMGIC fusion partner 3], LHX1 [LIM homeobox 1], LHX2 [LIM homeobox 2], LHX3 [LIM homeobox 3], LHX4 [LIM homeobox 4], LHX9 [LIM homeobox 9], LIF [leukemia inhibitory factor (cholinergic differentiation factor)], LIFR [leukemia inhibitory Factor receptor alpha], LIG1 [ligase I, DNA, ATP dependent], LIG3 [ligase III, DNA, ATP dependent], LIG4 [ligase IV, DNA, ATP dependent], LILRA3 [leukocyte immunoglobulin-like receptor] Subfamily A (TM domain Member 3], LILRB1 [leukocyte immunoglobulin-like receptor, subfamily B (having TM and ITIM domains), member 1], LIMK1 [LIM domain kinase 1], LIMK2 [LIM domain kinase 2 ], LIN7A [Lin-7 homolog A (Caenolabditis elegance)], LIN7B [Lin-7 homolog B (Caenolabditis elegance)], LIN7C [Lin-7 homolog C (Caenolabdi) Tis elegance)], LINGO1 [containing leucine-rich repeat and Ig domain 1], LIPC [lipase, hepatic], LIPE [lipase, hormone-sensitive], LLGL1 [lethal giant larval homolog 1 (Drosophila)], LMAN1 [ Lectin, mannose binding, 1], LM A [lamin A / C], LMO2 [LIM domain only 2 (Lombotin-like 1)], LMX1A [LIM homeobox transcription factor 1, alpha], LMX1B [LIM homeobox transcription factor 1, beta], LNPEP [leucyl / cis] Tinylaminopeptidase], LOC400590 [hypothesis LOC400590], LOC646021 [similar to hCG1774990], LOC646030 [similar to hCG1991475], LOC646627 [phospholipase inhibitor], LOR [loriculin], LOX [lysyl oxidase], LOXL1 [lysyl oxidase-like] ], LPA [Lipoprotein, Lp (a)], LPL [Lipoprotein lipase], LPO [Lactoperoxidase], LPP [LIM domain in Lipoma Preferential translocation partner], LPPR1 [lipid phosphate phosphatase-related protein type 1], LPPR3 [lipid phosphate phosphatase-related protein type 3], LPPR4 [lipid phosphate phosphatase-related protein type 4], LPXN [leupaxin], LRP1 [ Low density lipoprotein receptor related protein 1], LRP6 [low density lipoprotein receptor related protein 6], LRP8 [low density lipoprotein receptor related protein 8, apolipoprotein e receptor], LRPAP1 [low density lipoprotein receptor Body-related protein binding protein 1], LRPPRC [containing leucine-rich PPR-motif], LRRC37B [containing leucine-rich repeat 37B], LRRC4C [containing leucine-rich repeat 4C], LRRTM1 [leucine Rich repeat transmembrane nerve type 1], LSAMP [limbic system related membrane protein], LSM2 [LSM2 homologue, U6 micronuclear RNA binding (budding yeast)], LSS [lanosterol synthase (2 [3-oxidized squalene-lanosterol cyclase] )], LTA [lymphotoxin alpha (TNF superfamily, member 1)], LTA4H [leukotriene A4 hydrolase], LTBP1 [latent transforming growth factor beta binding protein 1], LTBP4 [latent transforming growth factor beta binding protein 4] ], LTBR [lymphotoxin beta receptor (TNFR superfamily, member 3)], LTC4S [leukotriene C4 synthase], LTF [lactotransferrin], LY96 [lymphocyte antigen 96], LYN [v-yes-1 mountain] Sarcoma virus-related oncogene homologue], LYVE1 [lymphatic endothelial hyaluronan receptor 1], M6PR [mannose-6-phosphate receptor (cation-dependent)], MAB21L1 [mab-21-like 1 (Caenolabditis) Elegance)], MAB21L2 [mab-21-like 2 (Caenolabditis elegans)], MAF [v-maf myometrial fibrosarcoma oncogene homologue (bird)], MAG [myelin-binding glycoprotein], MAGEA1 [Malignant melanoma antigen family A, 1 (induced expression of antigen MZ2-E)], MAGEL2 [MAGE-like 2], MAL [mal, T cell differentiation protein], MAML2 [mastermind-like 2 (Drosophila)], MAN2A1 [Mannosidase, alpha, class 2A, member 1], MANBA [ Mannosidase, beta A, lysosome], MANF [middle brain astrocyte-derived neurotrophic factor], MAOA [monoamine oxidase A], MAOB [monoamine oxidase B], MAP1B [microtubule-related protein 1B], MAP2 [microtubule-related protein 2], MAP2K1 [mitogen activated protein kinase kinase 1], MAP2K2 [mitogen activated protein kinase kinase 2], MAP2K3 [mitogen activated protein kinase kinase 3], MAP2K4 [mitogen activated protein kinase kinase 4], MAP3K1 [mitogen] Activated protein kinase kinase kinase 1], MAP3K12 [mitogen activated protein kinase kinase kinase 12], MAP3K13 [my GEN3 activated protein kinase kinase kinase 13], MAP3K14 [mitogen activated protein kinase kinase kinase 14], MAP3K4 [mitogen activated protein kinase kinase kinase 4], MAP3K7 [mitogen activated protein kinase kinase kinase 7], MAPK1 [mitogenic activity Protein kinase 1], MAPK10 [mitogen activated protein kinase 10], MAPK14 [mitogen activated protein kinase 14], MAPK3 [mitogen activated protein kinase 3], MAPK8 [mitogen activated protein kinase 8], MAPK8IP2 [mitogenic activity Protein kinase 8 interacting protein 2], MAPK8IP3 [mitogenic activity Protein kinase 8 interacting protein 3], MAPK9 [mitogen activated protein kinase 9], MAPKAPK2 [mitogen activated protein kinase activated protein kinase 2], MAPKSP1 [MAPK scaffold protein 1], MAPRE3 [microtubule-related protein, RP / EB family, member 3], MAPT [microtubule-related protein tau], MARCKS [myristoylated alanine-rich protein kinase C substrate], MARK1 [MAP / microtubule affinity control kinase 1], MARK2 [MAP / microtubule affinity Regulatory kinase 2], MAT2A [methionine adenosyltransferase II, alpha], MATR3 [matrine 3], MAX [MYC-related factor X], MAZ [MYC-related zinc fingertan Protein (purine binding transcription factor)], MB [myoglobin], MBD1 [methyl-CpG binding domain protein 1], MBD2 [methyl-CpG binding domain protein 2], MBD3 [methyl-CpG binding domain protein 3], MBD4 [ Methyl-CpG binding domain
In protein 4], MBL2 [mannose-binding lectin (protein C) 2, soluble (opsonin defect)], MBP [myelin basic protein], MBTPS1 [membrane-bound transcription factor peptidase, site 1], MC1R [melanocortin 1 receptor ( Alpha melanocyte stimulating hormone receptor)], MC3R [melanocortin 3 receptor], MC4R [melanocortin 4 receptor], MCCC2 [methylcrotonoyl-coenzyme A carboxylase 2 (beta)], MCF2L [MCF. 2 cell line-derived conversion sequences], MCHR1 [melanin-concentrating hormone receptor 1], MCL1 [myeloid cell leukemia sequence 1 (BCL2-related)], MCM7 [minichromosome maintenance complex component 7], MCPH1 [microcephalin 1], MDC1 [mediator 1 of DNA damage checkpoint], MDFIC [MyoD family inhibitor factor domain-containing], MDGA1 [MAM domain-containing glycosylphosphatidylinositol anchor 1], MDK [midkine (neurite growth promoting factor 2)], MDM2 [Mdm2 p53 binding protein homologue (mouse)], ME2 [malic enzyme 2, NAD (+)-dependent, mitochondria], MECP2 [methyl CpG binding protein 2 (Rett syndrome)], MED1 [mediator complex subunit 1], MED12 [mediator complex subunit 12], MED24 [mediator complex subunit 24], MEF2A [myocyte enhancer factor 2A], MEF2C [myosite enhancer factor 2C], MEIS1 [mace homeobox 1], MEN1 [Multiple endocrine tumor I], MERTK [c-mer proto-oncogene tyrosine kinase], MES P2 [dorsal mesoderm 2 homologue (mouse)], MEST [mesoderm-specific transcription homologue (mouse)], MET [met proto-oncogene (hepatocyte growth factor receptor)], METAP2 [methionylaminopeptidase 2], METRN [meteoline, glial cell differentiation regulator], MFSD6 [main facilitator superfamily domain-containing 6], MGAT2 [Manno (Alpha-1 [6-)-glycoprotein beta-1 [2-N-acetylglucosaminyltransferase], MGMT [O-6-methylguanine-DNA methyltransferase], MGP [matrix Gl protein], MGST1 [ Microsomal glutathione S-transferase 1], MICA [MHC class I polypeptide-related sequence A], MICAL1 [containing microtubule-related monoxygenase, calponin and LIM domain 1], MICB [MHC class I polypeptide-related sequence B], MIF [macrophages Migration inhibitory factor (glycosylation inhibitor)], MITF [microphthalmia-related transcription factor], MKI67 [identified by antigen monoclonal antibody Ki-67], MKKS [Macksig-Kaufmann syndrome], MK K1 [MAP kinase interaction serine / threonine kinase 1], MKRN3 [Macolin ring finger protein 3], MKS1 [Meckel syndrome, type 1], MLH1 [mutL homologue 1, colon cancer, non-polyposis type 2 (E. coli)], MLL [myeloid / lymphoid or mixed lineage leukemia (Trisolax homologue, Drosophila)], MLLT4 [Myeloid / lymphoid or mixed lineage leukemia (Trisolax homologue, Drosophila), translocated to it 4], MLPH [melanophylline], MLX [MAX-like protein X], MLXIPL [MLX interacting protein-like], MME [membrane metallo-endopeptidase], MMP1 [matrix metallopeptidase 1 (interstitial collagenase)], MMP10 [matrix metallo Pep Tidase 10 (stromelysin 2)], MMP12 [matrix metallopeptidase 12 (macrophage elastase)], MMP13 [matrix metallopeptidase 13 (collagenase 3)], MMP14 [matrix metallopeptidase 14 (membrane insertion type)], MMP2 [matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV collagenase)], MMP24 [matrix metallopeptidase 24 (membrane insertion type)], MMP26 [matrix metallopeptidase 26], MMP3 [matrix metallopeptidase 3 (stromelysin 1, progelatinase)], MMP7 [matrix metallopeptidase 7 (matrilysine, uterus)], MMP8 [matrix metallopeptidase 8 (neutrophil collagenase)], MMP9 [matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)], MN1 [meningiomas (disrupted at equilibrium translocation) 1], MNAT1 [mena a trois) homologue 1, cyclin H assembly factor (Xenopus laevis)], MNX1 [motor neuron and pancreatic homeobox 1], MOG [myelin oligodendrocyte glycoprotein], MPL [myeloproliferative leukemia virus oncogene], MPO [Myeloperoxidase], MPP1 [membrane protein, palmitoylated 1, 55 kDa], MPZL1 [myelin protein zero-like 1], MR1 [major histocompatibility complex, class I-related], MRAP [melanocortin 2 receptor accessory -Protein], MRAS [muscle RAS oncogene homologue], MRC1 [mannose receptor, type C1], MRGPRX1 [MAS-related GPR, member X1], MS4A1 [transmembrane 4-domain, subfamily A, member 1], MSH2 [mutS homolog 2, colon cancer, non-polyposis type 1 (E. coli)], MSH3 [mutS homolog 3 (E. coli)], MSI1 [Musashi homolog 1 (Drosophila)], MSN [moesin], MSR1 [macrophage scavenger] Receptor 1], MSTN [myostatin], MSX1 [msh homeobox 1], MSX2 [msh homeobox 2], MT2A [metallothionein 2A], MT3 [metallothionein3], MT-ATP6 [mitochondrial-encoded ATP synthase 6 ], T-CO1 [cytochrome c oxidase I encoded by mitochondria], MT-CO2 [cytochrome c oxidase II encoded by mitochondria], MT-CO3 [cytochrome c oxidase III encoded by mitochondria], MTF1 [metal regulatory properties Transcription factor 1], MTHFD1 [methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase], MTHFD1L [methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1-like], MTHFR [5 [ 10-methylenetetrahydrofolate reductase (NADPH)], MTL5 [metallothionein-like 5, testis-specific (tesmin)], MTMR14 [myo Tubulin-related protein 14], MT-ND6 [NADH dehydrogenase 6 encoded by mitochondria], MTNR1A [melatonin receptor 1A], MTNR1B [melatonin receptor 1B], MTOR [mechanical target of rapamycin (serine / threonine kinase)] MTR [5-methyltetrahydrofolate-homocysteine methyltransferase], MTRR [5-methyltetrahydrofolate-homocysteine methyltransferase reductase], MTTP [microsomal triglyceride transport protein], MUC1 [mucin 1, cell surface binding], MUC16 [ Mucin 16, cell surface binding], MUC19 [mucin 19, oligomer], MUC2 [mucin 2, oligomer mucus / gel formation], MUC3A [mucin 3A, fine Cell surface binding], MUC5AC [mucin 5AC, oligomer mucus / gel formation], MUSK [muscle, skeleton, receptor tyrosine kinase], MUT [methylmalonyl coenzyme A mutase], MVK [mevalonate kinase], MVP [major vault Protein], MX1 [myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], MXD1 [MAX dimerization protein 1], MXI1 [MAX interaction factor 1], MYB [v-myb bone marrow Blastosis virus oncogene homologue (bird)], MYC [v-myc myelocytosis virus oncogene homologue (bird)], MYCBP2 [MYC binding protein 2], MYCN [v-myc myelocytosis virus] Related oncogenes, neuroblastoma derived (bird)], MYD88 [ Myeloid differentiation primary response gene (88)], MYF5 [myogenic factor 5], MYH10 [myosin, heavy chain 10, non-muscle], MYH14 [myosin, heavy chain 14, non-muscle], MYH7 [myosin, heavy chain 7, myocardium, beta], MYL1 [myosin, light chain 1, alkali, skeleton, speed], MYL10 [myosin, light chain 10, controllability], MYL12A [myosin, light chain 12A, controllability, non-sarcomere], MYL12B [myosin, light chain 12B, regulatory], MYL2 [myosin, light chain 2, regulatory, heart, slow], MYL3 [myosin, light chain 3, alkali, ventricular, skeleton, slow], MYL4 [myosin, Light chain 4, alkali, atrium, embryonic], MYL5 [myosin, light chain 5, regulatory], MYL6 [myosin, light chain 6, alkali, smooth muscle and non-muscle], MYL6B [myosin, light chain 6] , Alkali, smooth and non-muscle], MYL7 [myosin, light chain 7, regulatory], MYL9 [myosin, light chain 9, regulatory], MYLK [myosin light chain kinase], MYLPF [myosin light chain, phosphorylated Sex, fast skeletal muscle], MYO1D [myosin ID], MYO5A [myosin VA (heavy chain 12, myoxin)], MYOC [myosylin, trabecular meshwork-induced glucocorticoid reaction], MYOD1 [myogenic differentiation 1], MYOG [myogenin (myogenic factor 4)], MYOM2 [myomesin (M-protein) 2, 165 kDa], MYST3 [MYST histone acetyltransferase (monocytic leukemia) 3], NACA [nascent polypeptide-related complex alpha Subunit], NAGLU [N-acetylglucosaminidase, alpha-], NAIP [NLR family, apoptosis inhibitory protein], NAMPT [nicotinamide phosphoribosyltransferase], NANOG [Nanog homeobox], NANS [N-acetylneuraminic acid synthase], NAP1L2 [nucleosome assembly protein 1-like 2], NAPA [N-ethylmaleimide sensitive factor adhesion protein, alpha], NAPG [N-ethylmaleimide sensitive factor adhesion protein, gamma], NAT2 [N-acetyltransferase 2 (arylamine N-acetyltransferase)], NAV1 [neuron navigator 1 ], NAV3 [neuron navigator 3], NBEA [neurobin], NCALD [neurocalcin delta], NCAM1 [nerve cell adhesion molecule 1], CAM2 [neuronal cell adhesion molecule 2], NCF1 [neutrophil cytosolic factor 1], NCF2 [neutrophil cytosolic factor 2], NCK1 [NCK adapter protein 1], NCK2 [NCK adapter protein 2], NCKAP1 [NCK Related protein 1], NCL [nucleolin], NCOA2 [nuclear receptor coactivator 2], NCOA3 [nuclear receptor coactivator 3], NCOR1 [nuclear receptor coactivator 1], NCOR2 [nuclear receptor] Co-suppressor 2], NDE1 [nudE nuclear distribution gene E homologue 1 (pseudo-kobium fungus)], NDEL1 [nudE nuclear distribution gene E homologue (pseudo-koji fungus) -like 1], NDN [nexin homologue] (Mouse)], NDNL2 [Nexin-like 2], NDP [Norie disease (pseudoglioma)], NDUFA1 [NADH dehydrogenase] (Ubiquinone) 1 alpha partial complex, 1, 7.5 kDa], NDUFAB1 [NADH dehydrogenase (ubiquinone) 1, alpha / beta partial complex, 1, 8 kDa], NDUFS3 [NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30 kDa (NADH-co enzyme Q reductase)], NDUFV3 [NADH dehydrogenase (ubiquinone) flavoprotein 3, 10 kDa], NEDD4 [neural precursor cell expression, developmental downregulation 4], NEDD4L [neural precursor cell expression, development Downward control 4
Like], NEFH [neurofilament, heavy polypeptide], NEFL [neurofilament, light polypeptide], NEFM [neurofilament, medium polypeptide], NENF [neuron-derived neurotrophic factor], NEO1 [neogenin homolog 1 ( Chicken)], NES [nestin], NET1 [neuroepithelial cell conversion 1], NEU1 [sialidase 1 (lysosomal sialidase)], NEU3 [sialidase 3 (membrane sialidase)], nerve D1 [neurogenic differentiation 1], nerve D4 [Neurogenic differentiation 4], neuron G1 [neurogenin 1], neuron G2 [neurogenin 2], NF1 [neurofibromin 1], NF2 [neurofibromin 2 (Merlin)], NFASC [neurofasin homologue (chicken)] ], NFAT5 [activated T cell nuclear factor 5, Zhang Responsiveness], NFATC1 [nuclear factor of activated T cells, cytoplasm, calcineurin dependent 1], NFATC2 [nuclear factor of activated T cells, cytoplasm, calcineurin dependent 2], NFATC3 [nuclear factor of activated T cells, Cytoplasm, calcineurin-dependent 3], NFATC4 [nuclear factor of activated T cells, cytoplasm, calcineurin-dependent 4], NFE2L2 [nuclear factor (erythroid derived 2) -like 2], NFIC [nuclear factor I / C (CCAAT binding) Transcription factor)], NFIL3 [nuclear factor, interleukin 3 controllability], NFKB1 [nuclear factor 1 of kappa light polypeptide gene enhancer in B cells], NFKB2 [nuclear factor 2 of kappa light polypeptide gene enhancer in B cells ( p49 / p100)], NFKBIA [kappa light polypep in B cells NFKBIB [kappa light polypeptide gene enhancer nuclear factor inhibitor in beta cells, beta], NFKBIL1 [kappa light polypeptide gene enhancer nuclear factor inhibitor-like 1 in B cells ], NFYA [nuclear transcription factor Y, alpha], NFYB [nuclear transcription factor Y, beta], NGEF [neurotype guanine nucleotide exchanger], NGF [nerve growth factor (beta polypeptide)], NGFR [nerve growth factor receptor] Body (TNFR superfamily, member 16)], NGFRAP1 [nerve growth factor receptor (TNFRSF16) binding protein 1], NHLRC1 [containing NHL repeat 1], NINJ1 [ninjurin 1], NINJ2 [ninjurin 2], NIP7 [nuclear import] 7 phases Allogeneic (budding yeast)], NIPA1 [not imprinted in Prader-Willi / Angelman syndrome 1], NIPA2 [not imprinted in Prader-Willie / Angelman syndrome 2], NIVAL1 [NIPA-like domain-containing 1], NIPL4 [ NIPA-like domain-containing 4], nip snap 1 [nip snap homolog 1 (Caenolabditis elegans)], NISCH [niscalin], NIT2 [nitrilase family, member 2], NKX2-1 [NK2 homeobox 1], NKX2-2 [NK2 homeobox 2], NLGN1 [neurorigin 1], NLGN2 [neurorigin 2], NLGN3 [neuroligin 3], NLGN4X [neurorigin 4, X chain], NLGN4Y [neurorigi] 4, Y-linked], NLRP3 [NLR family, pilin domain-containing 3], NMB [neuromedin B], NME1 [non-metastatic cell 1, protein expressed in it (NM23A)], NME2 [non-metastatic cell 2, in which Expressed protein (NM23B)], NME4 [non-metastatic cell 4, protein expressed in it], NNAT [neuronatine], NOD1 [nucleotide binding oligomerization domain containing 1], NOD2 [nucleotide binding oligomerization domain containing 2] ], NOG [Noggin], NOL6 [Nucleoprotein family 6 (RNA related)], NOS1 [Nitric oxide synthase 1 (neural type)], NOS2 [Nitric oxide synthase 2, inducible], NOS3 [Monoxide] Nitrogen synthase 3 (endothelial cells)], NOST IN [nitric oxide synthase transporter], Notch 1 [Notch homologue 1, translocation-related (Drosophila)], Notch2 [Notch homologue 2 (Drosophila)], Notch3 [Notch homologue 3 (Drosophila)], NOV [nephroblastoma overexpression gene], NOVA1 [neuro-oncological ventral antigen 1], NOVA2 [neuro-oncological ventral antigen 2], NOX4 [NADPH oxidase 4], NPAS4 [neurological PAS domain protein 4], NPFF [neuropeptide FF-amide peptide precursor], NPHP1 [nephrosis 1 (juvenile)], NPHP4 [nephrosis 4], NPHS1 [nephropathy 1, congenital, Finnish type (nephrin)], NPM1 [Nucleophosmin (nuclear phosphoprotein B23, Numatrin)], NPPA [Natriuretic peptide precursor A], NPPB [natriuretic peptide precursor B], NPPC [natriuretic peptide precursor C], NPR1 [natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic peptide receptor A)], NPR3 [sodium Diuretic peptide receptor C / guanylate cyclase C (atrial natriuretic peptide receptor C)], NPRL2 [nitrogen permease regulator-like 2 (budding yeast)], NPTX1 [neural pentraxin I], NPTX2 [neural pentraxin II] NPY [neuropeptide Y], NPY1R [neuropeptide Y receptor Y1], NPY2R [neuropeptide Y receptor Y2], NPY5R [neuropeptide Y receptor Y5], NQO1 [NAD (P) H dehydrogenase, quinone 1] , NQO2 [NAD (P) Dehydrogenase, quinone 2], NR0B1 [nuclear receptor subfamily 0, group B, member 1], NR0B2 [nuclear receptor subfamily 0, group B, member 2], NR1H3 [nuclear receptor subfamily 1, group H, Member 3], NR1H4 [nuclear receptor subfamily 1, group H, member 4], NR1I2 [nuclear receptor subfamily 1, group I, member 2], NR1I3 [nuclear receptor subfamily 1, group I, member 3 NR2C1 [nuclear receptor subfamily 2, group C, member 1], NR2C2 [nuclear receptor subfamily 2, group C, member 2], NR2E1 [nuclear receptor subfamily 2, group A, member 1], NR2F1 [nuclear receptor subfamily 2, group F, member 1], NR2F2 [nuclear receptor subfamily 2, group F, member 2] NR3C1 [nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)], NR3C2 [nuclear receptor subfamily 3, group C, member 2], NR4A2 [nuclear receptor subfamily 4, A Group, member 2], NR4A3 [nuclear receptor subfamily 4, group A, member 3], NR5A1 [nuclear receptor subfamily 5, group A, member 1], NR6A1 [nuclear receptor subfamily 6, group A, Member 1], NRAS [neuroblastoma RAS virus (v-ras) oncogene homologue], NRCAM [neural cell adhesion molecule], NRD1 [nadilysin (N-arginine dibasic convertase)], NRF1 [nuclear respiration] Factor 1], NRG1 [neuregulin 1], NRIP1 [nuclear receptor interacting protein 1], NRN1 [Neurich Neurotin 1], NRP1 [neuropilin 1], NRP2 [neuropilin 2], NRSN1 [neurensin 1], NRTN [neurturin], NRXN1 [neulexin 1], NRXN3 [neulexin 3], NSD1 [nuclear receptor binding SET domain protein 1], NSF [N-ethylmaleimide sensitive factor], NSUN5 [NOP2 / Sun domain family, member 5], NT5E [5′-nucleotidase, ecto (CD73)] , NTF3 [neurotrophin 3], NTF4 [neurotrophin 4], NTHL1 [nth endonuclease III-like 1 (E. coli)], NTN1 [netrin1], NTN3 [netrin3], NTN4 [netrin4], NTNG1 [ Ne Thrin G1], NTRK1 [neurotrophic tyrosine kinase, receptor, type 1], NTRK2 [neurotrophic tyrosine kinase, receptor, type 2], NTRK3 [neurotrophic tyrosine kinase, receptor, type 3], NTS [Nerve tensin], NTSR1 [nerve tensin receptor 1 (high affinity)], NUCB2 [nucleobindin 2], NUDC [nuclear distribution gene C homologue (pseudogonococcus koji fungus)], NUDT6 [nudix] (Nucleoside diphosphate binding part X) type motif 6], NUDT7 [nudix (nucleoside diphosphate binding part X) type motif 7], NUMB [num homologue (Drosophila)], NUP98 [nucleo Porin 98 kDa], NUPR1 [nucleoprotein, transcriptional regulator, 1] NXF1 [nuclear RNA export factor 1], NXNL1 [nucleoredoxin-like 1], OAT [ornithine aminotransferase], OCA2 [oculodermatoderma II], OCLN [Occludin], OCM [oncomodulin], ODC1 [ornithine Carboxylase 1], OFD1 [mouth-face-finger syndrome 1], OGDH [oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)], OLA1 [Obg-like ATPase 1], OLIG1 [oligodendrocyte transcription factor 1], OLIG2 [Oligodendrocyte lineage transcription factor 2], OLR1 [oxidized low density lipoprotein (lectin-like) receptor 1], OMG [Oligodendrocyte myelin glycoprotein], OPHN1 [Oligofrenin 1], OPN1SW [Opsin 1 ( Body pigment), shortwave sensitivity], OPRD1 [opioid receptor, delta 1], OPRK1 [opioid receptor, kappa 1], OPRL1 [opiate receptor-like 1], OPRM1 [opioid receptor, mu1], OPTN [opti Neurin], OSBP [oxysterol binding protein], OSBPL10 [oxysterol binding protein like 10], OSBPL6 [oxysterol binding protein like 6], OSM [oncostatin M], OTC [ornithine carbamoyltransferase], OTX2 [orthodenticle Homeobox 2], OXA1L [oxidase (cytochrome c) assembly 1-like], OXT [oxytocin, prepropeptide], OXTR [oxytocin receptor], P2RX7 [purinergic receptor P2X, Riga Open aperture ion channel, 7], P2RY1 [purinergic receptor P2Y, G-protein binding, 1], P2RY12 [purinergic receptor P2Y, G-protein binding, 12], P2RY2 [purinergic receptor P2Y, G-protein binding, 2], P4HB [prolyl 4-hydroxylase, beta polypeptide], PABPC1 [poly (A) binding protein, cytoplasm 1], PADI4 [peptidylarginine deiminase, type IV], PAEP [luteal] Hormone-related endometrial proteins], PAFAH1B1 [platelet activating factor acetylhydrolase 1b, regulatory subunit 1 (45 kDa)], PAFAH1B2 [platelet activating factor acetylhydrolase 1b, catalytic subunit 2 (30 kDa)], PAG1 [Sphingo Phosphorylated protein 1 associated with glycolipid microdomains], PAH [phenylalanine hydroxylase], PAK1 [p21 protein (Cdc42 / Rac) activated kinase 1], PAK2 [p21 protein (Cdc42 / Rac) activated kinase 2], PAK3 [p21 protein (Cdc42 / Rac) activation kinase 3], PAK4 [p21 protein (Cdc42 / Rac) activation kinase 4], PAK6 [p21 protein (Cdc42 / Rac) activation kinase 6], PAK7 [p21 protein ( Cdc42 / Rac) activated kinase 7], PAPPA [pregnancy-related plasma protein A, paparicin 1], PAPPA2 [paparicin 2], PARD6A [par-6 split defect 6 homolog alpha (Caenolabditis et al. Cancer)], PARG [poly (ADP-ribose) glycohydrolase], PARK2 [Parkinson's disease (autosomal recessive, juvenile) 2, Parkin], PARK7 [Parkinson's disease (autosomal recessive, premature onset) 7], PARN [Poly (A) -specific ribonuclease
Denylation nuclease)], PARP1 [poly (ADP-ribose) polymerase 1], PAWR [PRKC, apoptosis, WT1, regulator], PAX2 [pairing box 2], PAX3 [pairing box 3], PAX5 [pairing box 5], PAX6 [pairing box 6], PAX7 [pairing box 7], PBX1 [pre-B cell leukemia homeobox 1], PC [pyruvate carboxylase], PCDH10 [protocadherin 10], PCDH19 [protocadherin 19] PCDHA12 [protocadherin alpha 12], PCK2 [phosphoenolpyruvate carboxykinase 2 (mitochondrion)], PCLO [piccolo (presynaptic cell matrix protein)], PCM1 [centrocentric substance 1], PC T1 [protein-L-isoaspartate (D-aspartate) O-methyltransferase], PCNA [proliferating cell nuclear antigen], PCNT [pericentrin], PCP4 [Purkinje cell protein 4], PCSK7 [proprotein convertase subtilisin / Kexin type 7], PDCD1 [programmed cell death 1], PDE11A [phosphodiesterase 11A], PDE3B [phosphodiesterase 3B, cGMP inhibitory], PDE4A [phosphodiesterase 4A, cAMP specific (phosphodiesterase E2 dance homologue, Drosophila) ], PDE4B [phosphodiesterase 4B, cAMP specific (phosphodiesterase E4 dance homologue, Drosophila)], PDE4D [e Hodiesterase 4D, cAMP specific (phosphodiesterase E3 dance homologue, Drosophila)], PDE5A [phosphodiesterase 5A, cGMP specific], PDE8A [phosphodiesterase 8A], PDGFA [platelet derived growth factor alpha polypeptide], PDGFB [ Platelet-derived growth factor beta polypeptide (simian sarcoma virus (v-sis) oncogene homolog)], PDGFC [platelet-derived growth factor C], PDGFD [platelet-derived growth factor D], PDGFRA [platelet-derived growth factor receptor, Alpha polypeptide], PDGFRB [platelet-derived growth factor receptor, beta polypeptide], PDHA1 [pyruvate dehydrogenase (lipoamide) alpha1], PDIA2 [protein disulfide Isomerase family A, member 2], PDIA3 [protein disulfide isomerase family A, member 3], PDLIM1 [PDZ and LIM domain 1], PDLIM7 [PDZ and LIM domain 7 (enigma)], PDP1 [pyruvate dehydrogenase phosphatase catalytic subunit 1], PDPN [podoplanin], PDXK [pyridoxal (pyridoxine, vitamin B6) kinase], PDXP [pyridoxal (pyridoxine, vitamin B6) phosphatase], PDYN prodynorphin], PDZK1 [PDZ domain-containing 1], PEBP1 [phosphatidylethanol Amine binding protein 1], PECAM1 [platelet / endothelial cell adhesion molecule], PENK [proenkephalin], PER1 [ Riod homolog 1 (Drosophila)], PER2 [Period homolog 2 (Drosophila)], PEX13 [Peroxisome biosynthesis factor 13], PEX2 [Peroxisome biosynthesis factor 2], PEX5 [Peroxisome biosynthesis factor 5], PEX7 [Peroxisome Biosynthetic factor 7], PF4 [platelet factor 4], PFAS [phosphoribosylformylglycine amidine synthase], PFKL [phosphofructokinase, liver], PFKM [phosphofructokinase, muscle], PFN1 [profillin 1], PFN2 [Profilin 2], PFN3 [Profilin 3], PFN4 [Profilin family, Member 4], PGAM2 [Phosphoglycerate mutase 2 (muscle)], PGD [Phosphogluconate dehydrogenase], PGF Placental growth factor], PGK1 [phosphoglycerate kinase 1], PGM1 [phosphoglucomutase 1], PGR [progesterone receptor], PHB [prohibitin], PHEX [phosphate-regulated endopeptidase homolog, X-linked], PHF10 [ PHD finger protein 10], PHF8 [PHD finger protein 8], PHGDH [phosphoglycerate dehydrogenase], PHKA2 [phosphorylase kinase, alpha 2 (liver)], PHLDA2 [pleckstrin homology-like domain, family A, member 2], PHOX2B [Pairing-like homeobox 2b], PHYH [phytanoyl-CoA 2-hydroxylase], PHYHIP [phytanoyl-CoA 2-hydroxylase interacting protein], PIAS1 [active STAT protein inhibitors, 1], PICALM [phosphatidylinositol-binding clathrin assembly protein], PIGF [phosphatidylinositol glycan anchor biosynthesis, class F], PIGP [phosphatidylinositol glycan anchor biosynthesis, class P], PIK3C2A [phosphoinositide -3-kinase, class 2, alpha polypeptide], PIK3C2B [phosphoinositide-3-kinase, class 2, beta polypeptide], PIK3C2G [phosphoinositide-3-kinase, class 2, gamma polypeptide], PIK3C3 [phosphoinositide-3 -Kinase, class 3], PIK3CA [phosphoinositide-3-kinase, catalyst, alpha polypeptide], PIK3CB [phosphoinositide-3 Kinase, catalyst, beta polypeptide], PIK3CD [phosphoinositide-3-kinase, catalyst, delta polypeptide], PIK3CG [phosphoinositide-3-kinase, catalyst, gamma polypeptide], PIK3R1 [phosphoinositide-3-kinase, regulatory sub Unit 1 (alpha)], PIK3R2 [phosphoinositide-3-kinase, regulatory subunit 2 (beta)], PIK3R3 [phosphoinositide-3-kinase, regulatory subunit 3 (gamma)], PIK3R4 [phosphoinositide-3-kinase , Regulatory subunit 4], PIK3R5 [phosphoinositide-3-kinase, regulatory subunit 5], PINK1 [PTEN-inducible putative kinase 1], PITX1 [pairing-like homeodomain 1], PITX2 [pair Formation-like homeodomain 2], PITX3 [pair-like homeodomain 3], PKD1 [polycystic kidney disease 1 (autosomal dominant)], PKD2 [polycystic kidney disease 2 (autosomal dominant)], PKHD1 [multiple Cystic kidney and liver disease 1 (autosomal recessive)], PKLR [pyruvate kinase, liver and RBC], PKN2 [protein kinase N2], PKNOX1 [PBX / knot (knotted) 1 homeobox 1], PL -5283 [PL-5283 protein], PLA2G10 [phospholipase A2, group X], PLA2G2A [phospholipase A2, group IIA (platelet, symphrin liquid)], PLA2G4A [phospholipase A2, group IVA (cytosol, calcium dependent)], PLA2G6 [phospholipase A2, V Group (cytosol, calcium-independent)], PLA2G7 [phospholipase A2, group VII (platelet activating factor acetylhydrolase, plasma)], PLAC4 [placenta-specific 4], PLAG1 [polymorphic adenoma gene 1], PLAGL1 [Polymorphic adenoma gene-like 1], PLAT [plasminogen activator, tissue], PLAU [plasminogen activator, urokinase], PLAUR [plasminogen activator, urokinase receptor], PLCB1 [phospholipase C, beta 1 ( Phosphoinositide specific)], PLCB2 [phospholipase C, beta 2], PLCB3 [phospholipase C, beta 3 (phosphatidylinositol specific)], PLCB4 [phospholipase C, beta 4], PLCG1 [phospholipase C, gamma 1], PL G2 [phospholipase C, gamma 2 (phosphatidylinositol specific)], PLCL1 [phospholipase C-like 1], PLD1 [phospholipase D1, phosphatidylcholine specific], PLD2 [phospholipase D2], PLEK [pleckstrin], PLEKHH1 [pleckstrin homology] Sex domain containing, family H (having MyTH4 domain) member 1], PLG [plasminogen], PLIN1 [perilipin 1], PLK1 [Polo-like kinase 1 (Drosophila)], PLOD1 [procollagen-lysine 1,2-oxoglutarate 5-dioxygenase 1], PLP1 [proteolipid protein 1], PLTP [phospholipid transport protein], PLXNA1 [Plexin A1], PLXNA2 [Plexin A2], PL XNA3 [Plexin A3], PLXNA4 [Plexin A4], PLXNB1 [Plexin B1], PLXNB2 [Plexin B2], PLXNB3 [Plexin B3], PLXNC1 [Plexin C1], PLXND1 [Plexin D1], PML [Promyelocytic leukemia] , PMP2 [peripheral myelin protein 2], PMP22 [peripheral myelin protein 22], PMS2 [PMS2 post-meiosis increase 2 (budding yeast)], PMVK [phosphomevalonate kinase], PNOC [prepronociceptin], PNP [purine nucleoside phosphorylase ], PNPLA6 [patatin-like phospholipase domain-containing 6], PNPO [pyridoxamine 5′-phosphate oxidase], POFUT2 [protein O-fucosyltransferase 2], P OLB [polymerase (DNA-directed), beta], POLR1C [polymerase (RNA) I polypeptide C, 30 kDa], POLR2A [polymerase (RNA) II (DNA-directed) polypeptide A, 220 kDa], POLR3K [polymerase (RNA ) III (DNA-directed) polypeptide K, 12.3 kDa], POM121C [POM121 membrane glycoprotein C], POMC [proopiomelanocortin], POMGNT1 [protein O-linked mannose beta 1 [2-N-acetylglucosaminyltransferase] ], POMT1 [protein-O-mannosyltransferase 1], PON1 [paraoxonase 1], PON2 [paraoxonase 2], POR [P450 (cytochrome) oxidoreductase], OSTN [periostin, osteoblast specific factor], POU1F1 [POU class 1 homeobox 1], POU2F1 [POU class 2 homeobox 1], POU3F4 [POU class 3 homeobox 4], POU4F1 [POU class 4 homeobox 1] ], POU4F2 [POU class 4 homeobox 2], POU4F3 [POU class4 homeobox 3], POU5F1 [POU class5 homeobox 1], PPA1 [pyrophosphatase (inorganic) 1], PPARA [peroxisome growth factor activation] Receptor alpha], PPARD [peroxisome proliferator activated receptor delta], PPARG [peroxisome proliferator activated receptor gamma], PPARGC1A [peroxisome proliferator activated receptor gamma, Sex factor 1 alpha], PPAT [phosphoribosyl pyrophosphate amide transferase], PPBP [proplatelet basic protein (chemokine (C—X—C motif) ligand 7)], PPFIA1 [protein tyrosine phosphatase, receptor type, f poly Peptide (PTPRF), interacting protein (ripin), alpha 1], PPFIA2 [protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (lipin), alpha 2], PPFIA3 [protein tyrosine phosphatase, receptor Body type, f polypeptide (PTPRF), interacting protein (Riplin), alpha 3], PPFIBP1 [PTPRF interacting protein, binding protein 1 (Repurin beta 1)], PPIC [ Peptidylprolyl isomerase C (cyclophilin C)], PPIG [peptidylprolyl isomerase G (cyclophilin G)], PPP1R15A [protein phosphatase 1, regulatory (inhibitor) subunit 15A], PPP1R1B [protein phos
Fatase 1, regulatory (inhibitor) subunit 1B], PPP1R9A [protein phosphatase 1, regulatory (inhibitor) subunit 9A], PPP1R9B [protein phosphatase 1, regulatory (inhibitor) subunit 9B], PPP2CA [ Protein phosphatase 2, catalytic subunit, alpha isozyme], PPP2R4 [protein phosphatase 2A activator, regulatory subunit 4], PPP3CA [protein phosphatase 3, catalytic subunit, alpha isozyme], PPP3CB [protein phosphatase 3, catalytic subunit Unit, beta isozyme], PPP3CC [protein phosphatase 3, catalytic subunit, gamma isozyme], PPP3R1 [protein phosphatase 3 Regulatory subunit B, alpha], PPP3R2 [protein phosphatase 3, regulatory subunit B, beta], PPP4C [protein phosphatase 4, catalytic subunit], PPY [pancreatic polypeptide], PQBP1 [polyglutamine binding protein 1] , PRAM1 [PML-RARA regulatory adapter molecule 1], PRAME [Preferentially expressed antigen in malignant melanoma], PRDM1 [PR domain containing 1, ZNF domain included], PRDM15 [PR domain containing 15], PRDM2 [PR domain containing 2, having a ZNF domain], PRDX1 [peroxiredoxin 1], PRDX2 [peroxiredoxin 2], PRDX3 [peroxiredoxin 3], PRDX4 [peroxiredoxin 4], PRDX6 [per Xyledoxin 6], PRF1 [Perforin 1 (pore forming protein)], PRKAA1 [protein kinase, AMP activation, alpha 1 catalytic subunit], PRKAA2 [protein kinase, AMP activation, alpha 2 catalytic subunit], PRKAB1 [ Protein kinase, AMP activation, beta 1 non-catalytic subunit], PRKACA [protein kinase, cAMP-dependent, catalyst, alpha], PRKACB [protein kinase, cAMP-dependent, catalyst, beta], PRKACG [protein kinase, cAMP-dependent Sex, catalyst, gamma], PRKAG1 [protein kinase, AMP activation, gamma 1 non-catalytic subunit], PRKAG2 [protein kinase, AMP activation, gamma 2 non-catalytic subunit], PRK AR1A [protein kinase, cAMP-dependent, regulatory, type I alpha (tissue-specific loss factor 1)], PRKAR1B [protein kinase, cAMP-dependent, regulatory, type I beta], PRKAR2A [protein kinase, cAMP-dependent , Regulatory, type II alpha], PRKAR2B [protein kinase, cAMP dependent, regulatory, type II beta], PRKCA [protein kinase C, alpha], PRKCB [protein kinase C, beta], PRKCD [protein kinase C, Delta], PRKCE [protein kinase C, epsilon], PRKCG [protein kinase C, gamma], PRKCH [protein kinase C, eta], PRKCI [protein kinase C, iota], PRKCQ [protein kinase] , Theta], PRKCZ [protein kinase C, zeta], PRKD1 [protein kinase D1], PRKDC [protein kinase, DNA activation, catalytic polypeptide], PRKG1 [protein kinase, cGMP-dependent, type I], PRL [prolactin ], PRLR [prolactin receptor], PRMT1 [protein arginine methyltransferase 1], PRNP [prion protein], PROC [protein C (inactivator of coagulation factor Va and factor VIIIa)], PROCR [protein C receptor , Endothelium (EPCR)], PRODH [proline dehydrogenase (oxidase) 1], PROK1 [prokineticin 1], PROK2 [prokineticin 2], PROM1 [prominin 1], PROS1 [protein (Alpha)], PRPF40A [PRP40 pre-mRNA processing factor 40 homolog A (budding yeast)], PRPF40B [PRP40 pre-mRNA processing factor 40 homolog B (budding yeast)], PRPH [peripherin], PRPH2 [peripherin 2 (retina) Denaturation, slow)], PRPS1 [phosphoribosyl pyrophosphate synthetase 1], PRRG4 [proline rich Gla (G-carboxyglutamate) 4 (transmembrane)], PRSS8 [protease, serine, 8], PRTN3 [proteinase 3], PRX [Periaxin], PSAP [Prosaposin], PSEN1 [Presenilin 1], PSEN2 [Presenilin 2 (Alzheimer's disease 4)], PSG1 [Pregnancy-specific beta-1-glycoprotein 1], PSIP1 [PC4 and SF RS1 interacting protein 1], PSMA5 [proteasome (prosome, macropine) subunit, alpha type, 5], PSMA6 [proteasome (prosome, macropine) subunit, alpha type, 6], PSMB8 [proteasome (prosome, macro) Pine) subunit, beta type, 8 (large multifunctional peptidase 7)], PSMB9 [proteasome (prosome, macropine) subunit, beta type, 9 (large multifunctional peptidase 2)], PSMC1 [proteasome (prosome , Macropine) 26S subunit, ATPase, 1], PSMC4 [proteasome (prosome, macropine) 26S subunit, ATPase, 4], PSMD9 [proteasome (prosome, macropa 26S subunit, non-ATPase, 9], PSME1 [proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)], PSME2 [proteasome (prosome, macropain) activator subunit 2 (PA28) Beta)], PSMG1 [proteasome (prosome, macropain) assembly chaperone 1], PSPH [phosphoserine phosphatase], PSPN [percefin], PSTPIP1 [proline-serine-threonine phosphatase interacting protein 1], PTAFR [platelet activating factor Receptor], PTCH1 [patched homolog 1 (Drosophila)], PTCH2 [patched homolog 2 (Drosophila)], PTEN [phosph Tase and tensin homologues], PTF1A [pancreatic specific transcription factor, 1a], PTGER1 [prostaglandin E receptor 1 (subtype EP1), 42 kDa], PTGER2 [prostaglandin E receptor 2 (subtype EP2) 53 kDa], PTGER3 [prostaglandin E receptor 3 (subtype EP3)], PTGER4 [prostaglandin E receptor 4 (subtype EP4)], PTGES [prostaglandin E synthase], PTGES2 [prostaglandin E synthase 2], PTGIR [prostaglandin I2 (prostacyclin) receptor (IP)], PTGS1 [prostaglandin-endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)], PTGS2 [prostaglandin − Endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)], PTH [parathyroid hormone], PTH1R [parathyroid hormone 1 receptor], PTHHLH [parathyroid hormone-like hormone], PTK2 [PTK2 protein tyrosine kinase 2] ], PTK2B [PTK2B protein tyrosine kinase 2 beta], PTK7 [PTK7 protein tyrosine kinase 7], PTN [pleiotrophin], PTPN1 [protein tyrosine phosphatase, non-receptor type 1], PTPN11 [protein tyrosine phosphatase, non-receptor type 11] ], PTPN13 [protein tyrosine phosphatase, non-receptor type 13 (APO-1 / CD95 (Fas) related phosphatase)], PTPN18 [protein Tyrosine phosphatase, non-receptor type 18 (brain-derived)], PTPN2 [protein tyrosine phosphatase, non-receptor type 2], PTPN22 [protein tyrosine phosphatase, non-receptor type 22 (lymphoid)], PTPN6 [protein tyrosine phosphatase, non-receptive Body type 6], PTPN7 [protein tyrosine phosphatase, non-receptor type 7], PTPRA [protein tyrosine phosphatase, receptor type A], PTPRB [protein tyrosine phosphatase, receptor type, B], PTPRC [protein tyrosine phosphatase, receptor type, C] , PTPRD [protein tyrosine phosphatase, receptor type, D], PTPRE [protein tyrosine phosphatase, receptor type, E], PTPRF [protein tyrosine phosphat , Receptor type, F], PTPRJ [protein tyrosine phosphatase, receptor type, J], PTPRK [protein tyrosine phosphatase, receptor type, K], PTPRM [protein tyrosine phosphatase, receptor type, M], PTPRO [protein tyrosine phosphatase , Receptor type, O], PTPRS [protein tyrosine phosphatase, receptor type, S], PTPRT [protein tyrosine phosphatase, receptor type, T], PTPRU [protein tyrosine phosphatase, receptor type, U], PTPRZ1 [protein tyrosine phosphatase, receptor Body type, Z polypeptide 1], PTS [6-pyruvoyl tetrahydropterin synthase], PTTG1 [pituitary tumor-conversion 1], PVR [poliovirus receptor], PVRL 1 [Poliovirus receptor-related 1 (herpesvirus entry mediator C)], PWP2 [PWP2 cyclic tryptophan protein homologue (yeast)], PXN [paxillin], PYCARD [containing PYD and CARD domains], PYGB [phosphorylase, glycogen , Brain], PYGM [phosphorylase, glycogen, muscle], PYY [peptide YY], QDPR [quinoid dihydropteridine reductase], QKI [quaking homologue, KH domain RNA binding (mouse)], RAB11A [RAB11A, member RAS oncogene family], RAB11FIP5 [RAB11 family interacting protein 5 (class I)], RAB39B [RAB39B, member RAS oncogene family Milly], RAB3A [RAB3A, member RAS oncogene family], RAB4A [RAB4A, member RAS oncogene family], RAB5A [RAB5A, member RAS oncogene family], RAB8A [RAB8A, member RAS oncogene family], RAB9A [RAB9A , Member RAS oncogene family], RABEP1 [labaptin, RAB GTPase-binding effector protein 1], RABGEF1 [RAB guanine nucleotide exchanger (GEF) 1], RAC1 [ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding) Protein Rac1)], RAC2 [ras-related C3 Clostridium botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)], AC3 [ras-related C3 botulinum toxin substrate 3 (rho family, small GTP-binding protein Rac3)], RAD51 [RAD51 homologue (RecA homologue, Escherichia coli) (budding yeast)], RAF1 [v-raf-1 murine leukemia virus Oncogene homolog 1], RAG1 [recombinant activating gene 1], RAG2 [recombinant activating gene 2], RAGE [kidney tumor antigen], RALA [v-ral simian leukemia virus oncogene homolog A (ras related) )], RALBP1 [ralA binding protein 1], RALGAPA2 [Ral GTPase activating protein, alpha subunit 2 (catalyst)], RALGAPB [Ral GTPase activating protein, beta subunit (non-catalyst)], RALGDS [ral guanine nucleotide dissociation Discount factor], RAN [RAN, member RAS oncogene family], RAP1A [RAP1A, RAS oncogene family members of], RAP1B [RAP1B, member of RAS oncogene family], RAP1GAP [RAP1 GTPase activation
Protein], RAPGEF3 [Rap guanine nucleotide exchanger (GEF) 3], RAPEF4 [Rap guanine nucleotide exchanger (GEF) 4], RAPH1 [Ras association (RalGDS / AF-6) and pleckstrin homology domain 1], RAPSN [Synaptic receptor-related protein], RARA [retinoic acid receptor, alpha], RARB [retinoic acid receptor, beta], RARG [retinoic acid receptor, gamma], RARS [arginyl-tRNA synthetase], RASA1 [RAS p21 protein activator (GTPase activator protein) 1], RASA2 [RAS p21 protein activator 2], RASGRF1 [Ras protein-specific guanine nucleotide releasing factor 1], RASGRP1 [ AS guanyl releasing protein 1 (calcium and DAG regulation)], RASSF1 [Ras association (RalGDS / AF-6) domain family member 1], RASSF5 [Ras association (RalGDS / AF-6) domain family member 5], RB1 [ Retinoblastoma 1], RBBP4 [retinoblastoma binding protein 4], RBM11 [RNA binding motif protein 11], RBM4 [RNA binding motif protein 4], RBM45 [RNA binding motif protein 45], RBP4 [retinol binding protein 4, plasma], RBPJ [recombinant signal binding protein for immunoglobulin kappa J region], RCAN1 [regulator 1 of calcineurin], RCAN2 [regulator 2 of calcineurin], RCAN3 [RCAN family member 3], RCOR1 [REST co-inhibitor 1], RDX [radixin], REEP3 [receptor accessory protein 3], REG1A [regenerated island-derived 1 alpha], RELA [v-rel reticuloendotheliosis virus carcinogenesis Gene homolog A (bird)], RELN [Reelin], REN [renin], REPIN1 [replication initiation factor 1], REST [RE1-silencing transcription factor], RET [ret proto-oncogene], RETN [resistin] RFC1 [Replication factor C (Activation factor 1) 1, 145 kDa], RFC2 [Replication factor C (Activation factor 1) 2, 40 kDa], RFX1 [Regulatory factor X, 1 (affects HLA class II expression)] , RGMA [RGM domain family, member A], RGMB [RGM domain file Lee, member B], RGS3 [regulator of G-protein signaling 3], RHD [Rh blood group, D antigen], RHEB [Ras homologue abundant in the brain], RHO [rhodopsin], RHOA [ras homologue gene Family, member A], RHOB [ras homolog gene family, member B], RHOC [ras homolog gene family, member C], RHOD [ras homolog gene family, member D], RHOG [ras homolog gene family, Member G (rho G)], RHOH [ras homolog gene family, member H], RICTOR [MTOR's RPTOR-independent companion, complex 2], RIMS3 [regulatory synaptic membrane exocytosis 3], RIPK1 [receptor (TNFRSF) Mutual work Serine-threonine kinase 1], RIPK2 [receptor interaction serine-threonine kinase 2], RNASE1 [ribonuclease, RNase A family, 1 (pancreas)], RNASE3 [ribonuclease, RNase A family, 3 (eosinophil cationic) Protein)], RNASEL [ribonuclease L (2 ′ [5′-oligoadenylate synthetase dependence)], RND1 [Rho family GTPase 1], RND2 [Rho family GTPase 2], RND3 [Rho family GTPase 3], RNF123 [ Ring finger protein 123], RNF128 [Ring finger protein 128], RNF13 [Ring finger protein 13], RNF135 [Ring finger protein 135] RNF2 [ring finger protein 2], RNF6 [ring finger protein (C3H2C3 type) 6], RNH1 [ribonuclease / angiogenin inhibitor 1], RNPC3 [containing RNA binding region (RNP1, RRM) 3], ROBO1 [roundabout (Roundabout), axonal guidance receptor, homologue 1 (Drosophila)], ROBO2 [roundabout, axonal guidance receptor, homologue 2 (Drosophila)], ROBO3 [roundabout, axon Inducible receptor, homolog 3 (Drosophila)], ROBO4 [roundabout homolog 4, magic roundabout (Drosophila)], RO K1 [Rho-related, coiled-coil-containing protein kinase 1], ROCK2 [Rho-related, coiled-coil-containing protein kinase 2], RPGR [retinal pigment degeneration GTPa cell regulator], RPGRIP1 [retinal pigment degeneration GTPa cell regulator interacting protein 1], RPGRIP1L [ RPGRIP1-like], RPL10 [ribosomal protein L10], RPL24 [ribosomal protein L24], RPL5 [ribosomal protein L5], RPL7A [ribosomal protein L7a], RPLP0 [ribosomal protein, large, P0], RPS17 [ribosomal protein 17], RPS17P3 [Ribosomal protein 17 pseudogene 3], RPS19 [ribosomal protein 19], RPS27A [ribosomal protein 2] 7a], RPS6 [ribosomal protein 6], RPS6KA1 [ribosomal protein 6 kinase, 90 kDa, polypeptide 1], RPS6KA3 [ribosomal protein 6 kinase, 90 kDa, polypeptide 3], RPS6KA6 [ribosomal protein 6 kinase, 90 kDa, polypeptide 6 ] RPS6KB1 [ribosomal protein 6 kinase, 70 kDa, polypeptide 1], RRAS [related RAS virus (r-ras) oncogene homologue], RRAS2 [related RAS virus (r-ras) oncogene homologue 2], RRBP1 [Ribosome-binding protein 1 homologue 180 kDa (dog)], RRM1 [ribonucleotide reductase M1], RRM2 [ribonucleotide reductase M2], RRM2B [ribonucleic acid Otide reductase M2 B (TP53 inducible)], RTN4 [reticulon 4], RTN4R [reticulon 4 receptor], RUFY3 [RUN and FYVE domain containing 3], RUNX1 [runt-related transcription factor 1], RUNX1T1 [runt-related transcription factor 1, translocated to it (1 (cyclin D-related)], RUNX2 [runt-related transcription factor 2], RUNX3 [runt-related transcription factor 3], RUVBL2 [RuvB-like 2 (E. coli)], RXRA [retinoid X receptor , Alpha], RYK [RYK receptor-like tyrosine kinase], RYR2 [ryanodine receptor 2 (heart)], RYR3 [ryanodine receptor 3], S100A1 [S100 calcium-binding protein A1], S100A10 [S100 calcium-binding protein A10] S100A12 [S100 calcium binding protein A12], S100A2 [S100 calcium binding protein A2], S100A4 [S100 calcium binding protein A4], S100A6 [S100 calcium binding protein A6], S100A7 [S100 calcium binding protein A7], S100A8 [S100 calcium binding Protein A8], S100A9 [S100 Calcium Binding Protein A9], S100B [S100 Calcium Binding Protein B], SAA4 [Serum Amyloid A4, Constitutive], SACS [Charlesvoir-Sagne's Spastic Ataxia], SAFB [Scaffolding Adhesion factor B], SAG [S-antigen, retina and pineal gland (arrestin)], SAMHD1 [SAM domain and HD domain 1], ATB2 [SATB homeobox 2], SBDS [Schwahmann-Bodian-Diamond syndrome], SCARB1 [scavenger receptor class B, member 1], SCD [stearoyl-CoA desaturase (delta-9-desaturase)], SCD5 [stearoyl- CoA desaturase 5], SCG2 [secretogranin II], SCG5 [secretogranin V (7B2 protein)], SCGB1A1 [secretglobin, family 1A, member 1 (uteroglobin)], SCN11A [sodium channel, voltage-gated, XI Type alpha subunit], SCN1A [sodium channel, voltage-gated, type I alpha subunit], SCN2A [sodium channel, voltage-gated type, type II alpha subunit SCN3A [sodium channel, voltage-gated, type III alpha subunit], SCN5A [sodium channel, voltage-gated, type V, alpha subunit], SCN7A [sodium channel, voltage-gated, type VII, alpha], SCNN1B [sodium channel, non-potential open type 1, beta], SCNN1G [sodium channel, non-potential open type 1, gamma], SCP2 [sterol carrier protein 2], SCT [secretin], SCTR [secretin receptor], SCUBE1 [ Signal peptide, CUB domain, EGF-like 1], SDC2 [syndecan 2], SDC3 [syndecan 3], SDCBP [syndecan binding protein (syntenin)], SDHB [succinate dehydrogenase complex, subunit B, iron sulfur ( p)], SDHD [succinate dehydrogenase complex, subunit D, integral membrane protein], SDS [serine dehydratase], SEC14L2 [SEC14-like 2 (budding yeast)], SELE [selectin E], SELL [selectin L], SELP [selectin P (granular membrane protein 140 kDa, antigen CD62)], SELPLG [selectin P ligand], SEMA3A [sema domain, immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3A], SEMA3B [sema domain, Immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3B], SEMA3C [sema domain, immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3C], SEMA3D [semad In, immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3D], SEMA3E [sema domain, immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3E], SEMA3F [sema domain, Immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3F], SEMA3G [sema domain, immunoglobulin domain (Ig), short basic domain, secretion, (semaphorin) 3G], SEMA4A [sema domain, immunoglobulin Domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A], SEMA4B [sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B], SEMA 4C [sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C], SEMA4D [sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (Semaphorin) 4D], SEMA4F [sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F], SEMA4G [sema domain, immunoglobulin domain (Ig), transmembrane domain (TM ) And short cytoplasmic domain, (semaphorin) 4G], SEMA5A [sema domain, 7th thrombospondin repeat (type 1 and type 1 like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A], SEMA5B [ Madomain, 7th thrombospondin repeat (type 1 and type 1 like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B], SEMA6A [sema domain, transmembrane domain (TM), and cytoplasmic domain, (Semaphorin) 6A]
, SEMA6B [sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B], SEMA6C [sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C], SEMA6D [sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D], SEMA7A [semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)], SEPP1 [selenoprotein P, plasma, 1], SEPT2 [septin 2], SEPT4 [Septin 4], SEPT5 [Septin 5], SEPT6 [Septin 6], SEPT7 [Septin 7], SEPT9 [Septin 9], Serpin A1 [Serpin peptidase inhibitor, Clade A (alpha-1 anti-proteinase, anti-t Psine), member 1], serpin A3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3], serpin A7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, anti Trypsin), member 7], serpin B1 [serpin peptidase inhibitor, clade B (ovalbumin), member 1], serpin B2 [serpin peptidase inhibitor, clade B (ovalbumin), member 2], serpin B6 [serpin peptidase Inhibitor, clade B (ovalbumin), member 6], serpin C1 [serpin peptidase inhibitor, clade C (antithrombin), member 1], serpin E1 [serpin peptidase inhibitor, clade E (ne) Syn, plasminogen activator inhibitor type 1), member 1], serpin E2 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], serpin F1 [serpin peptidase inhibitor] , Clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1], serpin H1 [serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)], serpin I1 [Serpin peptidase inhibitor, clade I (nerve serpin), member 1], SET [SET nuclear oncogene], SETX [senataxin], SEZ6L2 [seizure-related 6 homologue (mouse) -like 2], SFPQ [splicing factor proline / Glutamine (Polypyrimidine tract binding protein binding)], SFRP1 [secreted frizzled-related protein 1], SFRP4 [secreted frizzled-related protein 4], SFRS15 [splicing factor, arginine / serine rich 15], SFTPA1 [ Surfactant protein A1], SFTPB [Surfactant protein B], SFTPC [Surfactant protein C], SGCB [sarcoglycan, beta (43 kDa dystrophin-related glycoprotein)], SGCE [sarcoglycan, epsilon], SGK1 [serum / glucocorticoid control Sex kinase 1], SH2B1 [SH2B adapter protein 1], SH2B3 [SH2B adapter protein 3], SH2D1A [S 2 domain containing 1A], SH3BGR [SH3 domain binding glutamate rich protein], SH3BGRL [SH3 domain binding glutamate rich protein-like], SH3BP1 [SH3-domain binding protein 1], SH3GL1P2 [SH3-domain GRB2-like 1 pseudogene 2], SH3GL3 [SH3-domain GRB2-like 3], SH3KBP1 [SH3-domain kinase binding protein 1], SH3PXD2A [SH3 and PX domain 2A], SHANK1 [SH3 and multiple ankyrin repeat domain 1], SHANGK2 [SH3 and multiple ankyrin repeats Domain 2], SHANK3 [SH3 and multiple ankyrin repeat domain 3], SHBG [sex hormone binding globulin], SHC1 [SH (Contains Src homology 2 domain) conversion protein 1], SHC3 [SHC (contains Src homology 2 domain) conversion protein 3], SHH [Sonic hedgehog homolog (Drosophila)], SHOC2 [clear homolog soc-2 Suppressor (Caenolabditis elegans)], SI [Sucrase-isomaltase (alpha-glucosidase)], SIAH1 [Seven in Absentia homolog 1 (Drosophila)], SIAH2 [Absence Seven] in absentia) homolog 2 (Drosophila)], sigma R1 [sigma non-opioid intracellular receptor 1], SILV [silver homolog (mouse)], SIM1 [single-minded phase] Body 1 (Drosophila)], SIM2 [single-minded homolog 2 (Drosophila)], SIP1 [Motor neuron protein interacting protein survival 1], SIRPA [Signal regulatory protein alpha], SIRT1 [Sirtuin] (Silent mating type information control 2 homolog) 1 (budding yeast)], SIRT4 [Sirtuin (silent mating type information control 2 homolog)], SIRT6 [sirtuin (silent mating type information control 2 homolog) 6 (budding yeast)], SIX5 [SIX homeobox 5], SKI [v-ski sarcoma virus oncogene homologue (bird)], SKP2 [S-fase kinase-related protein 2 (p45)], SLAMF6 [SLAM family Member 6], SLC10A1 [solute carrier family 10 (sodium / bile acid cotransporter family), member 1], SLC11A2 [solute carrier family 11 (proton-bonded divalent metal ion transporter), member 2], SLC12A1 [solute carrier family 12 (sodium) / Potassium / chloride transporter), member 1], SLC12A2 [solute carrier family 12 (sodium / potassium / chloride transporter), member 2], SLC12A3 [solute carrier family 12 (sodium / chloride transporter), member 3], SLC12A5 [solute carrier family 12 (potassium / chloride transporter), member 5], SLC12A6 [solute carrier family 12 (potassium / chloride transporter), member 6], SLC13A1 [solute carrier family 13 (sodium / Sulfuric acid Transporter), member 1], SLC15A1 [solute carrier family 15 (oligopeptide transporter), member 1], SLC16A2 [solute carrier family 16, member 2 (monocarboxylic acid transporter 8)], SLC17A5 [solute carrier family 17 (Anion / sugar transporter), member 5], SLC17A7 [solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7], SLC18A2 [solute carrier family 18 (vesicle monoamine), member 2] SLC18A3 [solute carrier family 18 (vesicle acetylcholine), member 3], SLC19A1 [solute carrier family 19 (folate transporter), member 1], SLC19A2 [solute carrier family 19 (thiamine transporter), member 2], SLC1A1 [Solute carrier phase Lee 1 (neurotype / epithelial high affinity glutamate transporter, system Xag), member 1], SLC1A2 [solute carrier family 1 (glial cell high affinity glutamate transporter), member 2], SLC1A3 [solute carrier family 1 ( Glial cell high affinity glutamate transporter), member 3], SLC22A2 [solute carrier family 22 (organic cation transporter), member 2], SLC25A12 [solute carrier family 25 (mitochondrial carrier, aral), member 12], SLC25A13 [Solute carrier family 25, member 13 (citrin)], SLC25A20 [solute carrier family 25 (carnitine / acylcarnitine translocase), member 20], SLC25A3 [solute carrier family 25 (mitochondrial carrier, phosphate carrier) ), Member 3], SLC26A3 [solute carrier family 26, member 3], SLC27A1 [solute carrier family 27 (fatty acid transporter), member 1], SLC29A1 [solute carrier family 29 (nucleoside transporter), member 1], SLC2A1 [Solute carrier family 2 (promoted glucose transporter), member 1], SLC2A13 [solute carrier family 2 (promoted glucose transporter), member 13], SLC2A2 [solute carrier family 2 (promoted glucose transporter) ), Member 2], SLC2A3 [solute carrier family 2 (promoted glucose transporter), member 3], SLC2A4 [solute carrier family 2 (promoted glucose transporter), member 4], SLC30A3 [solute carrier family 30 (zinc Carrier 3), SLC30A4 [solute carrier family 30 (zinc transporter), member 4], SLC30A8 [solute carrier family 30 (zinc transporter), member 8], SLC31A1 [solute carrier family 31 (zinc transporter) ), Member 1], SLC32A1 [solute carrier family 32 (GABA vesicle transporter), member 1], SLC34A1 [solute carrier family 34 (sodium phosphate), member 1], SLC38A3 [solute carrier family 38, member 3] SLC39A2 [solute carrier family 39 (zinc transporter), member 2], SLC39A3 [solute carrier family 39 (zinc transporter), member 3], SLC40A1 [solute carrier family 40 (iron-regulated transporter), member 1] , SLC4A11 [solute carrier Millie 4, sodium borate transporter, member 11], SLC5A3 [solute carrier family 5 (sodium / myo-inositol cotransporter), member 3], SLC5A8 [solute carrier family 5 (iodide transporter), member 8] SLC6A1 [solute carrier family 6 (neurotransmitter transporter, GABA), member 1], SLC6A14 [solute carrier family 6 (amino acid transporter), member 14], SLC6A2 [solute carrier family 6 (neurotransmitter transporter, Noradrenaline), member 2], SLC6A3 [solute carrier family 6 (neurotransmitter transporter, dopamine), member 3], SLC6A4 [solute carrier family 6 (neurotransmitter transporter, serotonin), member 4], SLC6A8 [solute] Carrier family 6 (neurotransmission Mass transporter, creatine), member 8], SLC7A14 [solute carrier family 7 (cationic amino acid transporter, y + system), member 14], SLC7A5 [solute carrier family 7 (cationic amino acid transporter, y + system) , Member 5], SLC9A2 [solute carrier family 9 (sodium / hydrogen exchanger), member 2], SLC9A3 [solute carrier family 9 (sodium / hydrogen exchanger), member 3], SLC9A3R1 [solute carrier family 9 (sodium / hydrogen exchanger) Hydrogen exchanger), member 3 regulator 1], SLC9A3R2 [solute carrier family 9 (sodium / hydrogen exchanger), member 3 regulator 2], SLC9A6 [solute carrier family 9 (sodium / hydrogen exchanger), member 6], SLIT1 [Slit homolog 1 Drosophila)], SLIT2 [Slit homolog 2 (Drosophila)], SLIT3 [Slit homolog 3 (Drosophila)], SLITRK1 [SLIT and NTRK-like family, member 1], SLN [Sarcolipin], SLPI [secreted leukocyte peptidase inhibitor ], SMAD1 [SMAD family member 1], SMAD2 [SMAD family member 2], SMAD3 [SMAD family member 3], SMAD4 [SMAD family member 4], SMAD6 [SMAD family member 6], SMAD7 [SMAD family member 7], SMARCA1 [SWI / SNF-related, matrix binding, chromatin actin-dependent regulator, subfamily a, member 1], SMARCA2 [SW / SNF related, matrix binding, chromatin actin dependent regulator, subfamily a, member 2], SMARCA4 [SWI / SNF related, matrix binding, chromatin actin dependent regulator, subfamily a, member 4], SMA
RCA5 [SWI / SNF-related, matrix binding, chromatin actin-dependent regulator, subfamily a, member 5], SMARCB1 [SWI / SNF-related, matrix binding, actin-dependent regulator of chromatin, subfamily b, member 1], SMARCC1 [SWI / SNF association, matrix binding, actin-dependent regulator of chromatin, subfamily c, member 1], SMARKC2 [SWI / SNF association, matrix binding, actin-dependent regulator of chromatin, subfamily c, member 2], SMARCD1 [SWI / SNF association, matrix binding, actin-dependent regulator of chromatin, subfamily d, member 1], SMARKD3 [SWI / SNF association, Matri Binding, chromatin actin-dependent regulator, subfamily d, member 3], SMARCE1 [SWI / SNF-related, matrix binding, chromatin actin-dependent regulator, subfamily e, member 1], SMG1 [SMG1 homologue, phosphatidyl Inositol 3-kinase related kinase (Caenolabditis elegans)], SMN1 [Motor neuron survival 1, telomere], SMO [smoothened homologue (Drosophila)], SMPD1 [Sphingomyelin phosphodiesterase 1, acid Lysosome], SMS [spermine synthase], SNAI2 [Snail homolog 2 (Drosophila)], SNAP25 [synaptosome-related protein, 25 kDa], SNC [Synuclein, alpha (non-A4 component of amyloid precursor)], SNCAIP [synuclein, alpha interacting protein], SNCB [synuclein, beta], SNCG [synuclein, gamma (breast cancer-specific protein 1)], SNRPA [small] Nuclear ribonucleoprotein polypeptide A], SNRPN [micronuclear ribonucleoprotein polypeptide N], SNTG2 [syntrophin, gamma 2], SNURF [SNRPN upstream reading frame], SOAT1 [sterol O-acyltransferase 1], SOCS1 [cytokine Signal transduction inhibitor 1], SOCS3 [cytokine signal transduction inhibitor 3], SOD1 [superoxide dismutase 1, soluble], SOD2 [superoxide dismuter] ZE 2, mitochondria], SORBS3 [containing sorbine and SH3 domains 3], SORL1 [containing sortilin-related receptors, L (DLR class) A repeats], SORT1 [sortilin 1], SOS1 [seven-less son homolog 1 (Drosophila) )], SOS2 [Seven-less son homolog 2 (Drosophila)], SOSTDC1 [containing sclerostin domain 1], SOX1 [SRY (sex determining region Y) box 1], SOX10 [SRY (sex determining region Y) box 10] , SOX18 [SRY (sex determination region Y) box 18], SOX2 [SRY (sex determination region Y) box 2], SOX3 [SRY (sex determination region Y) box 3], SOX9 [SRY (sex determination region Y) box 9], SP1 [Sp1 transcription factor], SP3 [Sp3 transcription Child], SPANXB1 [SPANX family, member B1], SPANXC [SPANX family, member C], SPARC [secreted protein, acidic, cysteine-rich (ostonectin)], SPARC1 [SPARC-like 1 (Evan)], SPAST [Spastin] SPHK1 [sphingosine kinase 1], SPINK1 [serine peptidase inhibitor, casal type 1], SPINT2 [serine peptidase inhibitor, Kunitz type 2], SPN [sialophorin], SPNS2 [spin star homolog 2 (Drosophila)], SPON2 [spondin 2, extracellular matrix protein], SPP1 [secreted phosphorylated protein 1], SPRED2 [sprout related, EVH1 domain containing 2], SPRY2 [sp Uti homolog 2 (Drosophila)], SPTA1 [spectrin, alpha, erythrocytic 1 (elliptocytosis 2)], SPTAN1 [spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)], SPTB [spectrin, Beta, erythrocytic], SPTBN1 [spectrin, beta, nonerythrocytic 1], SRC [v-src sarcoma (Schmidt-Rupin A-2) virus oncogene homologue (bird)], SRCRB4D [scavenger receptor cysteine rich Domain containing, group B (4 domains)], SRD5A1 [steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5alpha-steroid delta4-dehydrogenase alpha1)], SREBF1 [sterol regulatory element binding Transcription factor 1], SRE BF2 [sterol regulatory element binding transcription factor 2], SRF [serum response factor (c-fos serum response element binding transcription factor)], SRGAP1 [SLIT-ROBO Rho GTPase activating protein 1], SRGAP2 [SLIT-ROBO Rho GTPase Activating protein 2], SRGAP3 [SLIT-ROBO Rho GTPase activating protein 3], SRPX [sushi-repeat containing protein, X-linked], SRY [sex determining region Y], SSB [Sjogren's syndrome antigen B (autoantigen La) ], SSH1 [Slingshot homolog 1 (Drosophila)], SSRP1 [structure-specific recognition protein 1], SST [somatostatin], SSTR1 [somatostatin receptor 1], SSTR2 [somatostatin receptor 2], SSTR3 Somatostatin receptor 3], SSTR4 [somatostatin receptor 4], SSTR5 [somatostatin receptor 5], ST13 [inhibition of tumorigenicity 13 (colon cancer) (Hsp70 interacting protein)], ST14 [inhibition of tumorigenicity 14 (Colon cancer)], ST6GAL1 [ST6 beta-galactoamide alpha-2 [6-sialyltransferase 1], ST7 [tumor-forming suppression 7], STAG2 [stromal antigen 2], STAG3 [stromal antigen 3], STAT [steroid production acute regulatory protein], STAT1 [signaling factor and transcriptional activator 1, 91 kDa], STAT2 [signaling factor and transcriptional activator 2, 113 kDa], STAT3 [signaling factor and transcriptional factor Activating factor 3 (Acute-phase reaction factor)] STAT4 [signaling factor and transcriptional activator 4], STAT5A [signaling factor and transcriptional activator 5A], STAT5B [signaling factor and transcriptional activator 5B], STAT6 [signaling factor and transcriptional factor Activator 6, interleukin-4 inducible], STATH [statin], STC1 [stanniocalcin 1], STIL [SCL / TAL1 interfering locus], STIM1 [stromal interaction molecule 1], STK11 [serine / threonine kinase] 11], STK24 [serine / threonine kinase 24 (STE20 homologue, yeast)], STK36 [serine / threonine kinase 36, fusion homologue (Drosophila)], STK38 [serine / threonine kinase 38], STK38L [serine / threonine] Kinase 38-like], STK39 [serine threonine kinase 39 (STE20 / SPS1 homologue, yeast)], STMN1 [stathmin 1], STMN2 [stathmine-like 2], STMN3 [stathmin-like 3], STMN4 [stathmine-like 4], STOML1 [Stomatin (EPB72) -like 1], STS [steroid sulfatase (microsome), isozyme S], STUB1 [STIP1 homology and U box-containing protein 1], STX1A [syntaxin 1A (brain)], STX3 [syntaxin 3], STYX [Serine / threonine / tyrosine interacting protein], SUFU [inhibitor of fusion homologue (Drosophila)], SULT2A1 [sulfotransferase family, cytosol, 2A, dehydroepiandro Teron (DHEA) preference, member 1], SUMO1 [SMT3 (suppressor 3 of miftwo) homolog 1 (budding yeast)], SUMO3 [suppressor 3 of miftwo (miftwo)) homology Body 3 (budding yeast)], SUN1 [containing Sad1 and UNC84 domain 1], SUN2 [containing Sad1 and UNC84 domain 2], SUPT16H [Ty inhibitory factor 16 homologue (budding yeast)], SUZ12P [zest Suppressor 12 homolog pseudogene], SV2A [synaptic vesicle glycoprotein 2A], SYK [spleen tyrosine kinase], SYN1 [synapsin I], SYN2 [synapsin II], SYN3 [synapsin III], SYNGAP1 [synaptic Ras GTPase activity Protein 1 homolog ( )], SYNJ1 [synaptojanin 1], SYNPO2 [synaptopodin 2], SYP [synaptophysin], SYT1 [synaptotagmin I], TAC1 [tachykinin, precursor 1], TAC3 [tachykinin 3], TACR1 [tachykinin receptor 1] , TAF1 [TAF1 RNA polymerase II, TATA box binding protein (TBP) -related factor, 250 kDa], TAF6 [TAF6 RNA polymerase II, TATA box-binding protein (TBP) -related factor, 80 kDa], TAGAP [T cell activation RhoGTPase activation Protein], TAGLN [transgelin], TAGLN3 [transgelin 3], TAOK2 [TAO kinase 2], TAP1 [transporter 1, ATP-binding cassette, subfamily B (M R / TAP)], TAP2 [transporter 2, ATP binding cassette, subfamily B (MDR / TAP)], TAPBP [TAP binding protein (tapasin)], TARDBP [TAR DNA binding protein], TARP [TCR gamma alternative reading Frame protein], TAS2R1 [taste receptor, type 2, member 1], TAT [tyrosine aminotransferase], TBC1D4 [TBC1 domain family, member 4], TBCB [tubulin folding cofactor B], TBCD [tubulin folding complement] Factor D], TBCE [tubulin folding cofactor E], TBL1Y [transducin (beta) -like 1, Y-linked], TBL2 [transducin (beta) -like 2], TBP [TATA box binding protein], T PL2 [TATA box binding protein-like 2], TBR1 [T box, brain, 1], TBX1 [T box 1], TBX21 [T box 21], TBXA2R [thromboxane A2 receptor], TBXAS1 [thromboxane A synthase 1 (Platelet)], TCEB3 [transcription elongation factor B (SIII), polypeptide 3 (110 kDa, elongin A)], TCF12 [transcription factor 12], TCF19 [transcription factor 19], TCF4 [transcription factor 4], TCF7 [transcription Factor 7 (T cell specific, HMG box)], TCF7L2 [Transcription factor 7-like 2 (T cell specific, HMG box)], TCHH [trichohyalin], TCN1 [transcobalamin I (vitamin B12 binding protein, R binding) Family)], TCN2 [transcobalamin II Macrocytic anemia], TCP1 [t-complex 1], TDO2 [tryptophan 2 [3-dioxygenase], TDRD3 [tudle domain containing 3], TEAD2 [TEA domain family member 2], TEAD4 [TEA domain family member 4], TEK [TEK tyrosine kinase, endothelium], TERF1 [Telomeric repeat binding factor (NIMA interaction) 1], TERF2 [Telomeric repeat binding factor 2], TERT [telomerase reverse transcriptase], TET2 [tet oncogene Family member 2], TF [transferrin], TFAM [transcription factor A, mitochondria], TFAP2A [transcription factor AP-2 alpha (activation enhancer binding protein 2 alpha)], TFCP2 [transcription factor CP2], TFF1 [Tre Foil factor 1], TFF2 [trefoil factor 2], TFF3 [trefoil factor 3 (intestine)], TFPI [tissue factor pathway inhibitor (lipoprotein-related coagulation inhibitor)], TFPI2 [tissue factor pathway inhibitor 2], TFRC [Transferrin receptor
(P90, CD71)], TG [thyroglobulin], TGFA [converting growth factor, alpha], TGFB1 [converting growth factor, beta 1], TGFB1I1 [converting growth factor beta1-induced transcription 1], TGFB2 [converting growth factor, Beta 2], TGFB3 [converting growth factor, beta 3], TGFBR1 [converting growth factor, beta receptor 1], TGFBR2 [converting growth factor, beta receptor II (70/80 kDa)], TGFBR3 [converting growth factor, beta Receptor III], TGIF1 [TGFB-inducible factor homeobox 1], TGM2 [transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)], TH [tyrosine hydroxylase], THAP1 [THAP domain-containing, Apoptosis Protein 1], THBD [thrombomodulin], THBS1 [thrombospondin 1], THBS2 [thrombospondin 2], THBS4 [thrombospondin 4], THEM4 [thioesterase superfamily member 4], THPO [thrombopoietin], THRA [ Thyroid hormone receptor, alpha (erythroblastic leukemia virus (v-erb-a) oncogene homolog, bird)], THY1 [Thy-1 cell surface antigen], TIAM1 [T cell lymphoma invasion and metastasis 1], TIMP2 [T cell lymphoma invasion and metastasis 2], TIMP1 [TIMP metallopeptidase inhibitor 1], TIMP2 [TIMP metallopeptidase inhibitor 2], TIMP3 [TIMP metallopeptidase inhibitor 3], TINF2 [TERF1 ( RF1) interacting nuclear factor 2], TJP1 [tight junction protein 1 (closed zone 1)], TJP2 [tight junction protein 2 (closed zone 2)], TK1 [thymidine kinase 1, soluble], TKT [transketolase] TLE1 [transducin-like enhancer 1 of split (E (sp1) homologue, Drosophila)], TLR1 [Toll-like receptor 1], TLR2 [Toll-like receptor 2], TLR3 [Toll-like receptor 3], TLR4 [Toll-like receptor 4], TLR5 [Toll-like receptor 5], TLR7 [Toll-like receptor 7], TLR8 [Toll-like receptor 8], TLR9 [Toll-like receptor 9], TLRX3 [T-cell leukemia Homeobox 3], TMEFF1 [transmembrane protein 1 with EGF-like and two follistatin-like domains], TMEM1 00 [transmembrane protein 100], TMEM216 [transmembrane protein 216], TMEM50B [transmembrane protein 50B], TMEM67 [transmembrane protein 67], TMEM70 [transmembrane protein 70], TMEM87A [transmembrane protein 87A], TMOD2 [ Tropomodulin 2 (neural type)], TMOD4 [tropomodulin 4 (muscle)], TMPRSS11A [transmembrane protease, serine 11A], TMPRSS15 [transmembrane protease, serine 15], TMPRSS2 [transmembrane protease, serine 2], TNC [tenascin C], TNF [tumor necrosis factor (TNF superfamily, member 2)], TNFAIP3 [tumor necrosis factor, alpha-inducible protein 3], TNFRSF10A [tumor necrosis factor receptor Sue -Family, member 10a], TNFRSF10B [tumor necrosis factor receptor superfamily, member 10b], TNFRSF10C [tumor necrosis factor receptor superfamily, member 10c, decoy without intracellular domain], TNFRSF10D [tumor necrosis factor receptor Superfamily, member 10d, decoy with truncated cell death domain], TNFRSF11B [tumor necrosis factor receptor superfamily, member 11b], TNFRSF18 [tumor necrosis factor receptor superfamily, member 18], TNFRSF19 [tumor necrosis factor Receptor superfamily, member 19], TNFRSF1A [tumor necrosis factor receptor superfamily, member 1A], TNFRSF1B [tumor necrosis factor receptor -Per family, member 1B], TNFRSF25 [tumor necrosis factor receptor superfamily, member 25], TNFRSF8 [tumor necrosis factor receptor superfamily, member 8], TNFSF10 [tumor necrosis factor (ligand) superfamily, member 10] , TNFSF11 [tumor necrosis factor (ligand) superfamily, member 11], TNFSF13 [tumor necrosis factor (ligand) superfamily, member 13], TNFSF13B [tumor necrosis factor (ligand) superfamily, member 13b], TNFSF4 [tumor necrosis Factor (ligand) superfamily, member 4], TNK2 [tyrosine kinase, non-receptor, 2], TNNI3 [troponin type I3 (heart)], TNNT1 [troponin type T1 (Skeleton, slow)], TNNT2 [troponin T2 type (heart)], TNR [tenascin R (restrictin, janusin)], TNS1 [tensin 1], TNS3 [tensin 3], TNXB [tenascin XB], TOLLIP [Toll interacting protein], TOP1 [topoisomerase (DNA) I], TOP2A [topoisomerase (DNA) II alpha 170 kDa], TOP2B [topoisomerase (DNA) II beta 180 kDa], TOR1A [Torsin family 1, member A (Torcin A) ], TP53 [tumor protein p53], TP53BP1 [tumor protein p53 binding protein 1], TP63 [tumor protein p63], TP73 [tumor protein p73], TPH1 [tryptophan hydro Sylase 1], TPH2 [tryptophan hydroxylase 2], TPI1 [triosephosphate isomerase 1], TPO [thyroid peroxidase], TPT1 [tumor protein, translational regulation 1], TPTE [transmembrane phosphatase with tensin homology], TRADD [ TNFRS1A-related cell death domain mediated], TRAF2 [TNF receptor-related factor 2], TRAF3 [TNF receptor-related factor 3], TRAF6 [TNF receptor-related factor 6], TRAP1 [TNF receptor-related protein 1], TREM1 [ Inducible receptor 1 expressed on myeloid cells], TRH [Thyrotropin-releasing hormone], TRIM21 [containing a trisomic motif 21], TRIM22 [containing a trisomic motif 22], TRIM26 [containing a trisomic motif 26], TRI 27 [Tripartite motif-containing 27], TRIM50 [Tripartite motif-containing 50], TRIO [Trifunctional domain (PTPRF interaction)], TRPA1 [Transient receptor potential cation channel, Subfamily A, Member 1] , TRPC1 [transient receptor potential cation channel, subfamily C, member 1], TRPC5 [transient receptor potential cation channel, subfamily C, member 5], TRPC6 [transient receptor potential cation Ion channel, subfamily C, member 6], TRPM1 [transient receptor potential cation channel, subfamily M, member 1], TRPV1 [transient receptor potential cation channel, subfamily V, member 1] , TRPV2 [transient receptor potential cation channel, subfamily V, member 2], TRRAP [transformation / transcription domain related protein], TSC1 [tuberous sclerosis 1], TSC2 [tuberous sclerosis 2], TSC22D3 [TSC22 domain family, member 3], TSG101 [tumor susceptibility gene 101], TSHR [ Thyroid-stimulating hormone receptor], TSN [translin], TSPAN12 [tetraspanin 12], TSPAN7 [tetraspanin 7], TSPO [translocator protein (18 kDa)], TTC3 [tetratricopeptide repeat domain 3], TTF1 [transcription termination factor , RNA polymerase I], TTF2 [transcription termination factor, RNA polymerase II], TTN [titin], TTPA [tocopherol (alpha) transport protein], TTR [transthyretin], TUB [Taby phase] Body (mouse)], TUBA1A [tubulin, alpha 1a], TUBA1B [tubulin, alpha 1b], TUBA1C [tubulin, alpha 1c], TUBA3C [tubulin, alpha 3c], TUBA3D [tubulin, alpha 3d] , TUBA4A [tubulin, alpha 4a], TUBA8 [tubulin, alpha8], TUBB [tubulin, beta], TUBB1 [tubulin, beta1], TUBB2A [tubulin, beta2A], TUBB2B [tubulin, Beta 2B], TUBB2C [tubulin, beta 2C], TUBB3 [tubulin, beta 3], TUBB4 [tubulin, beta 4], TUBB4Q [tubulin, beta polypeptide 4, member Q], TUB 6 [tubulin, beta 6], TUBGCP5 [tubulin, gamma complex binding protein 5], TUFM [Tu translation elongation factor, mitochondria], TUSC3 [tumor suppressor candidate 3], TWIST1 [twist homolog 1 (Drosophila)], TXN [thioredoxin], TXNIP [thioredoxin interacting protein], TXNRD1 [thioredoxin reductase 1], TXNRD2 [thioredoxin reductase 2], TYK2 [tyrosine kinase 2], TYMP [thymidine phosphorylase], TYMS [thymidylate] Synthetase], TYR [tyrosinase (oculocutaneous albinism IA)], TYRO3 [TYRO3 protein tyrosine kinase], TYROBP [TYRO protein tyrosine kinase binding protein] ], TYRP1 [tyrosinase-related protein 1], U2AF1 [U2 micronuclear RNA cofactor 1], UBA1 [ubiquitin-like modifier activating enzyme 1], UBA52 [ubiquitin A-52 residue ribosomal protein fusion product 1], UBB [ Ubiquitin B], UBC [ubiquitin C], UBE2A [ubiquitin conjugating enzyme E2A (RAD6 homologue)], UBE2C [ubiquitin conjugating enzyme E2C], UBE2D2 [ubiquitin conjugating enzyme E2D2 (UBC4 / 5 homologue, yeast)], UBE2H [Ubiquitin conjugating enzyme E2H (UBC8 homologue, yeast)], UBE2I [ubiquitin conjugating enzyme E2I (UBC9 homologue, yeast)], UBE3A [ubiquitin protein ligase E3A], UBL5 [ubiquitin-like 5], UCHL1 [ubiquitin carboxyl terminal e Sterase L1 (ubiquitinthiol esterase)], UCN [urocortin], UCP1 [uncoupled protein 1 (mitochondria, proton carrier)], UCP2 [uncoupled protein 2 (mitochondrion, proton carrier)], UCP3 [uncoupled] Protein 3 (mitochondrion, proton carrier)], UGT1A1 [UDP glucuronosyltransferase 1 family, polypeptide A1], UGT1A3 [UDP glucuronosyltransferase 1 family, polypeptide A3], ULK1 [unc-51-like kinase 1 (cae Nolabditis elegance)], UNC5A [unc-5 homolog A (Caenolabditis elegance)], UNC5B [unc-5 homolog B (Caenolabditis) Legans)], UNC5C [unc-5 homolog C (Caenolabditis elegans)], UNC5D [unc-5 homolog D (Caenolabditis elegans)], UNG [uracil-DNA glycosylase], UPF3B [ Regulator homologue B of UPF3 nonsense transcription (yeast)], UPK3B [uroplakin 3B], UPP2 [uridine phosphorylase 2], UQCRC1 [ubiquinol-cytochrome c reductase core protein I], USF1 [upstream transcription factor 1], USF2 [upstream transcription Factor 2, c-fos interaction], USH2A [Usher syndrome 2A (autosomal recessive, mild)], USP1 [ubiquitin specific peptidase 1], USP15 [ubiquitin specific peptidase 15], USP25 [ubiquitin specific peptide Daze 25], USP29 [ubiquitin-specific peptidase 29], USP33 [ubiquitin-specific peptidase 33], USP4 [ubiquitin-specific peptidase 4 (proto - oncogenes)], USP5 [ubiquitin-specific peptidase 5 (isopeptidase T)]
USP9X [ubiquitin-specific peptidase 9, X-linked], USP9Y [ubiquitin-specific peptidase 9, Y-linked], UTRN [utrophin], UXT [ubiquitously expressed transcription], VAMP7 [vesicle-associated membrane protein 7 ], VASP [vasodilator-stimulated phosphorylated protein], VAV1 [vav 1 guanine nucleotide exchanger], VAV2 [vav 2 guanine nucleotide exchanger], VAX1 [front ventral homeobox 1], VCAM1 [vascular cell adhesion molecule] 1], VCL [vinculin], VDAC1 [voltage-dependent anion channel 1], VDAC2 [voltage-dependent anion channel 2], VDR [vitamin D (1 [25-dihydroxyvitamin D3) receptor], VEGFA [blood vessel] Endothelial growth factor A], VEGFB [vascular endothelial growth factor ], VEGFC [vascular endothelial growth factor C], VGF [VGF nerve growth factor inducible], VHL [von Hippel-Lindau tumor suppressor], VIM [vimentin], VIP [vasoactive intestinal peptide], VIPR1 [vasoactive Enteric peptide receptor 1], VIPR2 [vasoactive intestinal peptide receptor 2], VKORC1 [vitamin K epoxide reductase complex, subunit 1], VLDLR [very low density lipoprotein receptor], VPS29 [vacuum protein Localized 29 homologue (budding yeast)], VSIG4 [containing V-set and immunoglobulin domain 4], VSX1 [visual system homeobox 1], VTN [vitronectin], VWC2 [containing von Willebrand factor C domain 2] , VWF [von Willebrand factor], WAS [Wisco -Aldrich syndrome (eczema-thrombocytopenia)], WASF1 [WAS protein family, member 1], WASF2 [WAS protein family, member 2], WASL [Wiscott-Aldrich syndrome-like], WBSCR16 [Williams-Buren syndrome Chromosome region 16], WBSCR17 [Williams-Buren syndrome chromosome region 17], WBSCR22 [WilliamsBuren syndrome chromosome region 22], WBSCR27 [WilliamsBuren syndrome chromosome region 27], WBSCR28 [Williams-Buren syndrome chromosome region 28], WDR4 [WD Repeat domain 4], WEE1 [WEE1 homologue (fission yeast)], WHAMM [WAS protein homologue related to actin, Golgi membrane and Tubule], WIPF1 [WAS / WASL interacting protein family, member 1], WIPF3 [WAS / WASL interacting protein family, member 3], WNK3 [WNK lysine-deficient protein kinase 3], WNT1 [wingless MMTV integration site family , Member 1], WNT10A [wingless MMTV integration site family, member 10A], WNT10B [wingless MMTV integration site family, member 10B], WNT11 [wingless MMTV integration site family, member 11], WNT16 [wing] Les type MMTV integration site family, member 16], WNT2 [Wingles type MMTV integration site family member 2], WNT2B [Wingless type MMT Integration site family, member 2B], WNT3 [Wingles type MMTV integration site family, member 3], WNT3A [Wingles type MMTV integration site family, member 3A], WNT4 [Wingles type MMTV integration site family, member 4], WNT5A [Wingles type MMTV integration site family, member 5A], WNT5B [Wingles type MMTV integration site family, member 5B], WNT6 [Wingles type MMTV integration site family, member 6], WNT7A [Wingles type MMTV integration site family Family, member 7A], WNT7B [Wingless MMTV integration site family, member 7B], WNT8A [Wingless MMTV integration site family, member 8A], WNT8B [Wingles MMTV integration site family, member 8B], WNT9A [Wingles MMTV integration site family, member 9A], WNT9B [Wingles MMTV integration site family, member 9B], WRB [tryptophan rich base Sex protein], WRN [Werner syndrome, RecQ helicase-like], WT1 [Wilms tumor 1], XBP1 [X box binding protein 1], XCL1 [chemokine (C motif) ligand 1], XDH [xanthine dehydrogenase], XIAP [apoptosis] X-linked inhibitor], XIRP2 [2 containing xin actin-binding repeats], XPC [pigmentia pigmentosum, C complementation group], XRCC1 [X-ray repair complement defect repair in Chinese hamster cells] ] XRCC5 [X-ray repair complement defect repair 5 in Chinese hamster cells (double-strand break religation)], XRCC6 [X-ray repair complement defect repair 6 in Chinese hamster cells], XRN1 [5′-3 ′ exoribonuclease 1 ] YBX1 [Y box binding protein 1], YWHAB [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activating protein, beta polypeptide], YWHAE [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activating protein, Epsilon polypeptide], YWHAG [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activating protein, gamma polypeptide], YWHAQ [tyrosine 3-monooxygenase / bird] Ptophan 5-monooxygenase activating protein, theta polypeptide], YWHAZ [tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activating protein, zeta polypeptide], ZAP70 [zeta-chain (TCR) binding protein kinase 70 kDa], ZBTB16 [containing zinc finger and BTB domain 16], ZBTB33 [containing zinc finger and BTB domain 33], ZC3H12A [containing zinc finger CCCH type 12A], ZEB1 [Zinc finger E box binding homeobox 1], ZEB2 [Zinc finger E box Binding homeobox 2], ZFP161 [Zinc finger protein 161 homologue (mouse)], ZFP36 [Zinc finger protein 36, C3H type, Homologous (mouse)], ZFP42 [zinc finger protein 42 homologue (mouse)], ZFP57 [zinc finger protein 57 homologue (mouse)], ZFPM1 [zinc finger protein, 1 complex type], ZFPM2 [zinc finger protein, 2 Complex type], ZFY [Zinc finger protein, Y-linked], ZFYVE9 [Zinc finger, FYVE domain containing 9], ZIC1 [Zic family member 1 (mismatched pairing homolog, Drosophila)], ZIC2 [Zic family member 2 (mismatch) Pairing homologue, Drosophila)], ZIC3 [Zic family member 3 (mismatched pairing homologue, Drosophila)], ZMPSTE24 [Zinc metallopeptidase (STE24 homologue, budding yeast)], ZNF148 Zinc finger protein 148], ZNF184 [Zinc finger protein 184], ZNF225 [Zinc finger protein 225], ZNF256 [Zinc finger protein 256], ZNF333 [Zinc finger protein 333], ZNF385B [Zinc finger protein 385B], ZNF44 [Zinc finger] Protein 44], ZNF521 [Zinc finger protein 521], ZNF673 [Zinc finger family member 673], ZNF79 [Zinc finger protein 79], ZNF84 [Zinc finger protein 84], ZW10 [ZW10, centromeric binding, homologue (Drosophila) )], And ZYX [Zyxin].

  Preferred neurodevelopmental genes include BMP4 (bone morphogenetic protein 4), CHRD (codeh), NOG (noggin), WNT2 (wingless MMTV integration site family member 2), WNT2B (wingless MMTV integration site family, member 2B) ), WNT3A (Wingles type MMTV integration site family, member 3A), WNT4 (Wingles type MMTV integration site family, member 4), WNT5A (Wingles type MMTV integration site family, member 5A), WNT6 (Wingles type MMTV) Integration site family, member 6), WNT7B (Wingless MMTV integration site family, member 7B), WNT8B (Wingless MMTV integration site family, member 8B), W T9A (Wingless type MMTV integration site family, member 9A), WNT9B (Wingles type MMTV integration site family, member 9B), WNT10A (Wingless type MMTV integration site family, member 10A), WNT10B (Wingles type MMTV integration site family) Family, member 10B), WNT16 (Wingles type MMTV integration site family, member 16), OTX2 (orthodentic homeobox 2), GBX2 (gastroenteric brain homeobox 2), FGF8 (fibroblast growth factor 8) (Androgen inducible)), RELN (Reelin), DAB1 (disabled homolog 1 (Drosophila)), POU4F1 (POU class 4 homeobox 1), and N MB (Nam (numb) homolog (Drosophila) may include.

In certain embodiments, animals produced by the methods of the present invention can be used to study the effects of mutations on animals and neurodevelopment using measurements commonly used in neurodevelopmental studies.

iv. Cell function model

  The methods of the invention can be used to create animals or cells that can be used as cell function models. Can produce animals or cells. Such a model can be used to study the effect of the edited chromosomal sequence on the cell function of interest. For example, cell function models can be used to study the effect of edited chromosomal sequences on intracellular or extracellular signaling. Alternatively, cell function models can be used to study the effect of edited chromosomal nucleic acid sequences on sensory perception.

In one embodiment, the methods of the invention can be used to create animals or cells that contain chromosomal edits in one or more chromosomal sequences associated with signal transduction biochemical pathways. Non-limiting examples of suitable pathways and associated nucleic acid sequences are listed in Table C.

Alternatively, the methods of the invention can be used to create animals or cells that contain chromosomal edits in one or more nucleic acid sequences associated with cell function. As a non-limiting example, chromosomal editing can be made in sequences related to cognition, nociception, taste, and AB transporters, each detailed below.

A. Cognition

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with cognition has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  In the foregoing embodiments, the chromosomal sequence associated with cognition may encode a cognition-related protein or may be a regulatory sequence. Cognitive-related proteins are a diverse set of proteins that can be associated with susceptibility to developing cognitive impairment, the presence of cognitive impairment, the severity of cognitive impairment, or any combination thereof. Non-limiting examples of cognitive impairment include Alzheimer's disease, mental retardation, Rett syndrome, fragile X syndrome, major depressive disorder, unipolar disorder, mania, discomfort, bipolar disorder, dysthymia, and mood circulation Mood disorders, schizophrenia, schizophrenic emotional disorder, schizophrenia-like disorder, delusional disorder, short-term mental disorder, substance-induced mental disorder, and shared mental disorder, borderline personality disorder and dissociation Personality disorders such as gender identity disorder, anxiety disorders such as generalized anxiety disorder and obsessive-compulsive disorder, childhood disorders, HIV-related dementia such as dementia (HAD) and multiple cerebral infarction dementia, autistic disorder Adaptation disorder, delirium, Tourette's disorder, attention deficit disorder, and post-traumatic stress disorder.

Cognition-related proteins or regulatory sequences can typically be selected based on experimental association of cognition-related sequences with cognitive disorders. For example, the production rate or circulating concentration of cognitive-related proteins can be increased or suppressed in a population with cognitive impairment compared to a population lacking cognitive impairment. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

Non-limiting examples of cognition-related proteins include A2M (alpha-2-macroglobulin), AATF (antiapoptotic transcription factor), ACPP (acid phosphatase prostate), ACTA2 (actin alpha2 smooth muscle aorta), ADAM22 (ADAM) Metallopeptidase domain), ADORA3 (adenosine A3 receptor), ADRA1D (alpha-1D adrenergic receptor for alpha-1D adrenoceptor), AHSG (alpha-2-HS-glycoprotein), AIF1 (allograft inflammatory Factor 1), ALAS2 (delta-aminolevulinate synthase 2), AMBP (alpha-1-microglobulin / bikunin precursor), ANK3 (anclin 3), ANXA3 (annexin A3), APCS (amyloid P component blood) ), APOA1 (apolipoprotein A1), APOA12 (apolipoprotein A2), APOB (apolipoprotein B), APOC1 (apolipoprotein C1), APOE (apolipoprotein E), APOH (apolipoprotein H), APP (amyloid precursor protein) ), ARC (activity-regulated cytoskeleton-related protein), ARF6 (ADP-ribose factor 6), ARHGAP5 (Rho GTPase activation protein 5), ASCL1 (Acaete-scote homolog 1), B2M (beta-2 microglobulin) , B4GALNT1 (beta-1,4-N-acetyl-galactosaminyltransferase 1), BAX (Bcl-2 related X protein), BCAT (branched chain amino acid transaminase 1 cytosol), B KDHA (branched chain keto acid dehydrogenase E1 alpha), BCKDK (branched chain alpha-keto acid dehydrogenase kinase), BCL2 (B cell lymphoma 2), BCL2L1 (BCL2-like 1), BDNF (brain derived neurotrophic factor), BHLHE40 ( Class E basic helix-loop-helix protein 40), BHLHE41 (class E basic helix-loop-helix protein 41), BMP2 (bone morphogenetic protein 2A), BMP3 (bone morphogenetic protein 3), BMP5 (bone morphogenetic protein 5) ), BRD1 (bromodomain-containing 1), BTC (betacellulin), BTNL8 (butyrophilin-like protein 8), CALB1 (calbindin 1), CALM1 (calmodulin 1), CAMK1 (calcium / calmodulin) -Dependent protein kinase type I), CAMK4 (calcium / calmodulin-dependent protein kinase type IV), CAMKIIB (calcium / calmodulin-dependent protein kinase type IIB), CAMKIIG (calcium / calmodulin-dependent protein kinase type IIG), CASP11 ( Caspase-10), CASP8 (caspase-8 apoptosis-related cysteine peptidase), CBLN1 (cerebellin 1 precursor), CCL2 (chemokine (CC motif) ligand 2), CCL22 (chemokine (CC motif) ligand 22), CCL3 (Chemokine (CC motif) ligand 3), CCL8 (chemokine (CC motif) ligand 8), CCNG1 (cyclin-G1), CCNT2 (cyclin T2) ), CCR4 (C-C chemokine receptor type 4 (CD194)), CD58 (CD58), CD59 (protectin), CD5L (CD5 antigen-like), CD93 (CD93), CDKN2AIP (CDKN2A interacting protein), CDKN2B (cyclin) -Dependent kinase inhibitor 2B), CDX1 (homeobox protein CDX-1), CEA (carcinoembryonic antigen), CEBPA (CCAAT / enhancer binding protein alpha), CEBPB (CCAAT / enhancer binding protein C / EBP beta), CEBPB (CCAAT / enhancer binding protein beta), CEBPD (CCAAT / enhancer binding protein delta), CEBPG (CCAAT / enhancer binding protein gamma), CENPB (centrome Protein B), CGA (glycoprotein hormone alpha chain), CGGBP1 (CGG triplet repeat-binding protein 1), CHGA (chromogranin A), CHGB (secretneurin), CHN2 (beta-chimerin), CHRD (chodin), CHRM1 (choline) Sex receptor muscarinic 1), CITED2 (Cbp / p300 interaction transactivator 2), CLEC4E (C-type lectin domain family 4 member E), CMTM2 (CKLF-like MARVEL transmembrane domain-containing protein 2), CNTN1 (contactin) 1), CNTNAP1 (contactin-related protein-like 1), CR1 (erythrocyte complement receptor 1), CREM (cAMP responsive element modulator), CRH (corticotropin releasing hormone), C HR1 (adrenocorticotropic hormone releasing hormone receptor 1), CRKRS (cell division cycle 2 related protein kinase 7), CSDA (DNA binding protein A), CSF3 (granulocyte colony stimulating factor 3), CSF3R (granulocyte colony stimulating factor) 3 receptor), CSP (chemically sensitive protein), CSPG4 (chondroitin sulfate proteoglycan 4), CTCF (CCCTC binding factor zinc finger protein), CTGF (connective tissue growth factor), CXCL12 (chemokine CX-C motif ligand 12) , DAD1 (protection factor 1 against T cell cell death), DAXX (cell death binding protein 6), DBN1 (drebrin 1), DBP (D site of albumin promoter-albumin D box binding protein), DDR1 (discoidin domain) Receptor family member 1), DDX14 (DEAD / DEAH box helicase), DEFA3 (defensin alpha 3 neutrophil specific), DVL3 (disheveled dsh homolog 3), EDN1 (endothelin 1), EDNRA (endothelin) Receptor A), EGF (epidermal growth factor), EGFR (epidermal growth factor receptor), EGR1 (early growth response protein 1), EGR2 (early growth response protein 2), EGR3 (early growth response protein 3), EIF2AK2 (Eukaryotic cell translation initiation factor 2-alpha kinase 2), ELANE (elastase neutrophil expression), ELK1 (ELK1 member ETS oncogene family), ELK3 (ELK3 ETS-domain protein (SRF accessory protein) Protein 2)), EML2 (stab microtubule binding protein-like 2), EPHA4 (EPH receptor A4), ERBB2 (V-erb-b2 erythroblastic leukemia virus oncogene homolog 2), ERBB3 (receptor) Tyrosine-protein kinase erbB-3), ESR2 (estrogen receptor 2), ESR2 (estrogen receptor 2), ETS1 (V-ets erythroblastosis virus E26 oncogene homolog 1), ETV6 (Ets variant 6) FASLG (Fas ligand TNF superfamily member 6), FCAR (Fc fragment of IgA receptor), FCER1G (high affinity I receptor for IgE Fc fragment gamma polypeptide), FCGR2A (IgG Fc fragment low affinity IIa) Receptor-CD32), FCGR3B (Fc fragment low affinity of IgG III Receptor-CD16b), FCGRT (Fc fragment receptor transporter alpha of IgG), FGA (basic fibrinogen), FGF1 (acidic fibroblast growth factor 1), FGF14 (fibroblast growth factor 14), FGF16 (fibers) Blast growth factor 16), FGF18 (fibroblast growth factor 18), FGF2 (basic fibroblast growth factor 2), FIBP (acidic fibroblast growth factor intracellular binding protein), FIGF (C-fos inducible) Growth factor), FMR1 (fragile X mental retardation 1), FOSB (FBJ mouse osteosarcoma oncogene homolog B), FOXO1 (forkhead box O1), FSHB (follicle stimulating hormone beta polypeptide), FTH1 (ferritin heavy poly) Peptide 1), FTL (ferritin light polypeptide), G1P3 (inter Elon alpha inducible protein 6), G6S (N-acetylglucosamine-6-sulfatase), GABRA2 (gamma-aminobutyric acid A receptor alpha2), GABRA3 (gamma-aminobutyric acid A receptor alpha3), GABRA4 (gamma) -Aminobutyric acid A receptor alpha 4), GABRB1 (gamma-aminobutyric acid A receptor beta 1), GABRG1 (gamma-aminobutyric acid A receptor gamma 1), GADD45A (growth arrest and DNA damage inducing alpha), GCLC ( Glutamate-cysteine ligase catalytic subunit), GDF15 (growth differentiation factor 15), GDF9 (growth differentiation factor 9), GFRA1 (GDNF family receptor alpha 1), GIT1 (G protein-coupled receptor kinase interaction factor 1), GNA13 (Guanine Nucleotide binding protein / G protein alpha 13), GNAQ (guanine nucleotide binding protein / G protein q polypeptide), GPR12 (G protein coupled receptor 12), GPR18 (G protein coupled receptor 18), GPR22 (G protein coupled receptor) Body 22), GPR26 (G protein coupled receptor 26), GPR27 (G protein coupled receptor 27), GPR77 (G protein coupled receptor 77), GPR85 (G protein coupled receptor 85), GRB2 (growth factor receptor) Binding protein 2), GRLF1 (glucocorticoid receptor DNA binding factor 1), GST (glutathione S-transferase), GTF2B (basic transcription factor IIB), GZMB (granzyme B), hand 1 (heart and neural crest derivatives) 1), HAVCR1 (Hepatitis A virus cell receptor 1), HES1 (Split 1 hair and enhancer), HES5 (Split 5 hair and enhancer), HLA-DQA1 (Major histocompatibility complex class II DQ) Alpha), HOXA2 (homeobox A2), HOXA4 (homeobox A4), HP (haptoglobin), HPGDS (prostaglandin-D synthase), HSPA8 (heat shock 70 kD protein 8), HTR1A (5-hydroxytryptamine receptor 1A) ), HTR2A (5-hydroxytryptamine receptor 2A), HTR3A (5-hydroxytryptamine receptor 3A), ICAM1 (intracellular adhesion molecule 1 (CD54)), IFIT2 (interfero having a tetratricopeptide repeat) Inducible protein 2), IFNAR2 (interferon alpha / beta / omega receptor 2), IGF1 (insulin-like growth factor 1), IGF2 (insulin-like growth factor 2), IGFBP2 (insulin-like growth factor binding protein 2, 36 kDa), IGFBP7 (insulin-like growth factor binding protein 7), IL10 (interleukin 10), IL10RA (interleukin 10 receptor alpha), IL11 (interleukin 11), IL11RA (interleukin 11 receptor alpha), IL11RB (interleukin 11) Receptor beta), IL13 (interleukin 13), IL15 (interleukin 15), IL17A (interleukin 17A), IL17RB (interleukin 17 receptor B), IL18 ( Interleukin 18), IL18RAP (interleukin 18 receptor accessory protein), IL1R2 (interleukin 1 receptor type II), IL1RN (interleukin 1 receptor antagonist), IL2RA (interleukin 2 receptor alpha), IL4R (interleukin 18) Leukin 4 receptor), IL6 (interleukin 6), IL6R (interleukin 6 receptor), IL7 (interleukin 7), IL8 (interleukin 8), IL8RA (interleukin 8 receptor alpha), IL8RB (interleukin) 8 receptor beta), ILK (integrin chain kinase), INPP4A (inositol polyphosphate-4-phosphatase type I, 107 kDa), INPP4B (inositol polyphosphate-4-phosphater) ZE type beta), INS (insulin), IRF2 (interferon regulatory factor 2), IRF3 (interferon regulatory factor 3), IRF9 (interferon regulatory factor 9), IRS1 (insulin receptor substrate 1), ITGA4 (integrin) Alpha 4)
ITGA6 (integrin alpha-6), ITGAE (integrin alpha E), ITGAV (integrin alpha-V), JAG1 (Jagged 1), JAK1 (Janus kinase 1), JDP2 (Jun dimerized protein 2) , JUN (Jun oncogene), JUNB (Jun B proto-oncogene), KCNJ15 (potassium inward rectifier channel subfamily J member 15), KIF5B (kinesin family member 5B), KLRC4 (killer cell lectin-like receptor sub) Family C member 4), KRT8 (keratin 8), LAMP2 (lysosome-associated membrane protein 2), LEP (leptin), LHB (luteinizing hormone beta polypeptide), LRRN3 (leucine-rich repeat neurotype 3), MAL (Mal T cell differentiation protein), MAN1A1 (mannosidase alpha class 1A member 1), MAOB (monoamine oxidase B), MAP3K1 (mitogen activated protein kinase kinase kinase 1), MAPK1 (mitogen activated protein kinase 1), MAPK3 ( Mitogen-activated protein kinase 3), MAPRE2 (microtubule-related protein RP / EB family member 2), MARCKS (myristoylated alanine-rich protein kinase C substrate), MAS1 (MAS1 oncogene), MASL1 (MAS1 oncogene-like), MBP (Myelin basic protein), MCL1 (myeloid cell leukemia sequence 1), MDMX (MDM2-like p53 binding protein), MECP2 (methyl CpG binding) Protein 2), MFGE8 (milk fat globule-EGF factor 8 protein), MIF (macrophage migration inhibitory factor), MMP2 (matrix metallopeptidase 2), MOBP (myelin-related oligodendrocyte basic protein), MUC16 (cancer antigen 125) , MX2 (myxovirus (influenza virus) resistance 2), MYBBP1A (MYB binding protein 1a), NBN (nibrin), NCAM1 (neuronal cell adhesion molecule 1), NCF4 (neutrophil cytosolic factor 4 40 kDa), NCOA1 (nuclear) Receptor coactivator 1), NCOA2 (nuclear receptor coactivator 2), NEDD9 (neural precursor cell expression developmental downregulation 9), NEUR (neuraminidase), NFATC1 (nuclear factor of activated T cells) Cytoplasmic calcineurin dependence 1), NFE2L2 (nuclear factor erythroid-derived 2-like 2), NFIC (nuclear factor I / C), NFKBIA (nuclear factor inhibitor alpha of kappa light polypeptide gene enhancer in B cells), NGFR (nerve growth factor receptor), NIACR2 (Niacin receptor 2), NLGN3 (neuroligin 3), NPFFR2 (neuropeptide FF receptor 2), NPY (neuropeptide Y), NR3C2 (nuclear receptor subfamily 3 group C member 2), NRAS (neuroblastoma) RAS virus (v-ras) oncogene homolog), NRCAM (neuron cell adhesion molecule), NRG1 (neuregulin 1), NRTN (neurturin), NRXN1 (neulexin 1), NSFAF (neutral sphingomyelinase activation-related) Factor), NTF3 (neurotrophin 3) , NTF5 (neurotrophin 4/5), ODC1 (ornithine decarboxylase 1), or 10A1 (olfactory receptor 10A1), or 1A1 (olfactory receptor family 1 subfamily A member 1), or 1N1 (olfactory receptor family) 1 subfamily N member 1), or 3A2 (olfactory receptor family 3 subfamily A member 2), or 7A17 (olfactory receptor family 7 subfamily A member 17), or M1 (orosomucoid 1), OXTR (oxytocin receptor) ), P2RY13 (purinergic receptor P2Y G-protein binding 13), P2Y12 (purinergic receptor P2Y G-protein binding 12), P70S6K (P70S6 kinase), PAK1 (P21 / Cdc42 / Rac1 activation kinase) ZE1), PAR1 (Prada-Willi / Angelman region-1), PBEF1 (Pre-B cell colony promoting factor 1), PCAF (P300 / CBP-related factor), PDE4A (cAMP specific 3 ′, 5′-circular) Phosphodiesterase 4A), PDE4B (phosphodiesterase 4B cAMP specific), PDE4B (phosphodiesterase 4B cAMP specific), PDE4D (phosphodiesterase 4D cAMP specific), PDGFA (platelet derived growth factor alpha polypeptide), PDGFB (platelet derived growth factor beta poly) Peptide), PDGFC (platelet-derived growth factor C), PDGFRB (beta-type platelet-derived growth factor receptor), PDPN (podoplanin), PENK (enkephalin), PER1 (period homolog 1), PLA2 Phospholipase A2), PLAU (plasminogen activator urokinase), PLXNC1 (plexin C1), PMVK (phosphomevalonate kinase), PNOC (prepronociceptin), POLH (polymerase (DNA-directed) eta), POMC (proopiomelanocortin (adreno) Nocorticotropin / beta-lipotropin / alpha-melanocyte stimulating hormone / beta-melanocyte stimulating hormone / beta-endorphin)), POU2AF1 (POU domain class 2 related factor 1), PRKAA1 (5′-AMP activated protein kinase catalytic subunit alpha -1), PRL (prolactin), PSCDBP (cytohesin 1-interacting protein), PSPN (percefin), PTAFR (platelet activation factor) Receptor), PTGS2 (prostaglandin-endoperoxide synthase 2), PTN (pleiotrophin), PTPN11 (protein tyrosine phosphatase non-receptor type 1), PYY (peptide YY), RAB11B (RAB11B member RAS oncogene family) ), RAB6A (RAB6A member RAS oncogene family), RAD17 (RAD17 homolog), RAF1 (RAF proto-oncogene serine / threonine-protein kinase), RANBP2 (RAN binding protein 2), RAP1A (RAP1A member RAS oncogene) Family), RB1 (retinoblastoma 1), RBL2 (retinoblastoma-like 2 (p130)), RCVRN (recovelin), REM2 (RAS / RAD / GEM-like GTP connection) 2), RFRP (RFamide-related peptide), RPS6KA3 (ribosomal protein 6 kinase 90 kDa polypeptide 3), RTN4 (reticulon 4), RUNX1 (Runt-related transcription factor 1), S100A4 (S100 calcium-binding protein A4), S1PR1 (sphingosine -1-phosphate receptor 1), SCG2 (secretogranin II), SCYE1 (small-inducible cytokine subfamily E member 1), SERENBP1 (selenium-binding protein 1), SGK (serum / glucocorticoid-regulated kinase) SKD1 (K + transport growth defect inhibitor 1), SLC14A1 (solute carrier family 14 (urea transporter) member 1 (kid blood group)), SLC25A37 (solute carrier family 25 member 37), SMAD2 ( SMAD family member 2), SMAD5 (SMAD family member 5), SNAP23 (synaptosome-related protein 23 kDa), SNCB (synuclein beta), SNF1LK (SNF1-like kinase), SORT1 (sortilin 1), SSB (Sjogren's syndrome antigen B), STAT1 (Signaling factor and transcriptional activator 1, 91 kDa), STAT5A (signaling factor and transcriptional activator 5A), STAT5B (signaling factor and transcriptional activator 5B), STX16 (syntaxin 16), TAC1 (Takikinin precursor 1), TBX1 (T box 1), TEF (Thyroid Embryonic Factor), TF (Transferrin), TGFA (Converted Growth Factor alpha), TGFB1 (Converted Growth Factor beta 1), GFB2 (conversion growth factor beta 2), TGFB3 (conversion growth factor beta 3), TGFBR1 (conversion growth factor beta receptor I), TGM2 (transglutaminase 2), THPO (thrombopoietin), TIMP1 (TIMP metallopeptidase inhibitor 1) , TIMP3 (TIMP metallopeptidase inhibitor 3), TMEM129 (transmembrane protein 129), TNFRC6 (TNFR / NGFR cysteine-rich region), TNFRSF10A (tumor necrosis factor receptor superfamily member 10a), TNFRSF10C (tumor necrosis factor receptor super Family member 10c decoy without intracellular domain), TNFRSF1A (tumor necrosis factor receptor superfamily member 1A), TOB2 (ERBB22 2 transfer factor) , TOP1 (topoisomerase (DNA) I), TOPOII (topoisomerase 2), TRAK2 (transport protein kinesin binding 2), TRH (thyrotropin releasing hormone), TSH (thyroid-stimulating hormone alpha), TUBA1A (tubulin alpha 1a), TXK (TXK tyrosine kinase), TYK2 (tyrosine kinase 2), UCP1 (uncoupled protein 1), UCP2 (uncoupled protein 2), ULIP (Unc-33-like phosphate protein), UTRN (utrophin), VEGF ( Vascular endothelial growth factor), VGF (VGF nerve growth factor inducible), VIP (vasoactive intestinal peptide), VNN1 (vanin 1), VTN (vitronectin), WNT2 (wingless MMTV integration site family group) Bar 2), XRCC6 (X-ray repair cross-complementing 6), ZEB2 (zinc finger E-box binding homeobox 2), and ZNF461 can (zinc finger protein 461), and.

  Exemplary cognitive-related proteins include ANK3 (ankrine 3), APP (amyloid precursor protein), B2M (beta-2 microglobulin), BRD1 (bromodomain containing 1), FMR1 (fragile X mental retardation 1), MECP2 ( Methyl CpG binding protein 2), NGFR (nerve growth factor receptor), NLGN3 (neuroligin 3), NRXN1 (neulexin 1) and any combination thereof are included.

In certain embodiments, animals created by the methods of the invention can be used to study the effects of mutations on animals as well as cognition.

B. Nociception and taste

  Sensory-related chromosomal sequences can include, but are not limited to, nociceptive-related genes, pain-related genes, and taste-related genes. In one embodiment, the methods of the invention can be used to create an animal or cell in which at least one chromosomal sequence associated with a sensory process has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

Sensory-related chromosomal sequences may be associated with nociception, or processes that accept and respond to nociceptive stimuli. Non-limiting examples of nociceptive associated chromosomal sequences include CALCA (calcitonin related polypeptide alpha), FOS (FBJ mouse osteosarcoma virus oncogene homolog), NPY (neuropeptide Y), TACR1 (tachykinin receptor 1), OPRM1 (opioid receptor mu1), OPRD1 (opioid receptor delta1), OPRK1 (opioid receptor kappa1), TH (tyrosine hydroxylase), DRD2 (dopamine receptor D2), PTGS2 (prostaglandin-endoperoxide) Synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), TNF (tumor necrosis factor (TNF superfamily member 2)), PDYN (prodynorphin), KNG1 (kininogen 1), CCK (cholecyst) Nin), NOS1 (nitric oxide synthase 1 (neural type)), IL1B (interleukin 1 beta), SST (somatostatin), HTR3A (5-hydroxytryptamine (serotonin) receptor 3A), MAPK1 (mitogen-activated protein kinase) 1), GAL (Galanin prepropeptide), DYT10 (Dystonia 10), TRPV1 (Transient receptor potential cation channel subfamily V member 1), IL6 (Interleukin 6 (interferon beta 2)), HTR2A (5- Hydroxytryptamine (serotonin) receptor 2A), CNR1 (cannabinoid receptor 1 (brain)), NOS2 (nitrogen monoxide synthase 2 inducible), PNOC (prepronociceptin), NTS (neurotensin), PTGS1 (prosta) Randin-endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)), ACHE (acetylcholinesterase (Yt blood group)), NGF (nerve growth factor (beta polypeptide)), CCKBR (cholecystokinin B receptor) ), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), NPFF (neuropeptide FF-amide peptide precursor), CCL2 (chemokine (CC motif) ligand 2), CAT (catalase), BDNF (brain-derived) Neurotrophic factor), ADORA1 (adenosine A1 receptor), NPR1 (natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic peptide receptor A)), GRP (gastrin releasing peptide), MME (membrane metathesis) Rho-endopeptidase), ABCB1 (ATP binding cassette subfamily B (MDR / TAP) member 1), PENK (proenkephalin), TAC1 (tachykinin precursor 1), INS (insulin), NTRK1 (neurotrophic tyrosine kinase receptor) Body type 1), SCN9A (sodium channel voltage-gated IX alpha subunit), BCHE (butyrylcholinesterase), GALR2 (galanine receptor 2), ADCYAP1 (adenylate cyclase-activating polypeptide 1 (pituitary)) , HRH2 (histamine receptor H2), OXT (oxytocin prepropeptide), POMC (proopiomelanocortin), ADORA2A (adenosine A2a receptor), CPOX (coproporphyrinogen oxidase), NTS 2 (neurotensin receptor 2), SLC1A2 (solute carrier family 1 (glia cell high affinity glutamate transporter) member 2), OPRL1 (opiate receptor-like 1), GALR1 (galanine receptor 1), DDC (dopade) Carboxylase (aromatic L-amino acid decarboxylase)), P2RX2 (purinergic receptor P2X ligand-gated ion channel 2), HMOX1 (heme oxygenase (decycling) 1), CNR2 (cannabinoid receptor 2 (macrophage)), HTR1B (5-hydroxytryptamine (serotonin) receptor 1B), HRH1 (histamine receptor H1), ADRA2A (adrenergic alpha-2A-receptor), GALR3 (galanine receptor 3), KCND1 (potassium voltage-gated channel system) (Shal-related subfamily member 1), PRL (prolactin), IFNG (interferon gamma), GABBR1 (gamma-aminobutyric acid (GABA) B receptor 1), IL10 (interleukin 10), VWF (von Willebrand factor) ), GPT (glutamate-pyruvate transaminase (alanine aminotransferase)), CSF3 (colony stimulating factor 3 (granulocyte)), IL2 (interleukin 2), IFNA1 (interferon alpha 1), PROK1 (prokineticin 1), HMGCR ( 3-hydroxy-3-methylglutaryl-coenzyme A reductase), JUN (jun oncogene), NPPA (natriuretic peptide precursor A), ADCY10 (adenylate cyclase 10 (soluble)) ), IL4 (interleukin 4), MAPK14 (mitogen-activated protein kinase 14), ADA (adenosine deaminase), TGFB1 (conversion growth factor beta 1), MAPK8 (mitogen-activated protein kinase 8), EDNRB (endothelin receptor B) Type), AKR1B1 (aldo-ketoreductase family 1 member B1 (aldose reductase)), NOS3 (nitrogen monoxide synthase 3 (endothelial cells)), GABRE (gamma-aminobutyric acid (GABA) A receptor epsilon), KCNJ5 (potassium) Inwardly rectifying channel subfamily J member 5), EPHX2 (epoxide hydrolase 2 cytoplasm), EDNRA (endothelin receptor type A), NTSR1 (neurotensin receptor 1 (high affinity)), IL1 (Interleukin 13), EDN3 (endothelin 3), CRH (corticotropin releasing hormone), PPARA (peroxisome proliferator activated receptor alpha), CCKAR (cholecystokinin A receptor), FAAH (fatty acid amide hydrolase) ), EDN1 (endothelin 1), CABIN1 (calcineurin binding protein 1), NTRK3 (neurotrophic tyrosine kinase receptor type 3), NTF3 (neurotrophin 3), PL-5283 (PL-5283 protein), APC (adenoma) Sex colon polyposis), DBH (dopamine beta-hydroxylase (dopamine beta-monooxygenase)), SYP (synaptophysin), SLC8A1 (solute carrier family 8 (sodium / calcium exchanger)) 1), CHRNA4 (cholinergic receptor nicotinic alpha 4), TRPA1 (transient receptor potential cation channel subfamily A member 1), CYBB (cytochrome b-245beta polypeptide), RAC1 (ras related C3 botulinum) Bacterial toxin substrate 1 (rho family small GTP binding protein Rac1)), IDS (iduronic acid 2-sulfatase), LTF (lactotransferrin), TRPM8 (transient receptor potential cation channel subfamily M member 8), MRGPRX3 ( MAS-related GPR member X3), CCR5 (chemokine (CC motif) receptor 5), CCL5 (chemokine (CC motif) ligand 5), MBL2 (mannose-binding lectin (protein C) 2 soluble (opsonin defect)) , P2R X3 (purinergic receptor P2X ligand-gated ion channel 3), MRGPRX2 (MAS-related GPR member X2), FAM134B (family 134 member B with sequence similarity), IL8 (interleukin 8), NTRK2 (neurotrophic) Tyrosine kinase receptor type 2), GJA1 (gap junction protein alpha 1 43 kDa), CACNA1H (calcium channel voltage-dependent T type alpha 1H subunit), HDC (histidine decarboxylase), IFT88 (intraflagellar transport 88 homologue (Chlamydomonas) )), POU4F3 (POU class 4 homeobox 3), ATOH1 (atonal homolog 1 (Drosophila)), GRM3 (metabolism 3 for glutamate receptors), ADK (adenosine kina) RIPK2 (receptor interaction serine-threonine kinase 2), AMPEP (alanyl (membrane) aminopeptidase), DRD1 (dopamine receptor D1), NFE2L2 (nuclear factor (erythrocyte-derived 2) -like 2), RET (Ret proto-oncogene), AHSP (alpha hemoglobin stabilizing protein), ESR2 (estrogen receptor 2 (ERbeta)), HLA-A (major histocompatibility complex class IA), CHRM2 (cholinergic receptor) Muscarinic 2), ALAD (aminolevulinic acid delta-dehydratase), CXCL2 (chemokine (CX-C motif) ligand 2), HSPG2 (heparan sulfate proteoglycan 2), F2R (coagulation factor II (thrombin) receptor), KCNIP3 (Kv channel interacting protein 3 Calsenillin), GRIN1 (glutamate receptor ionic N-methyl D-aspartate 1), GRIK1 (glutamate receptor ionic kainate 1), P2RX7 (purinergic receptor P2X ligand-gated ion channel 7) CACNA1B (calcium channel voltage-gated N type alpha 1B subunit), TACR2 (tachykinin receptor 2), NPFFR2 (neuropeptide FF receptor 2), MRGPRX1 (MAS-related GPR member X1), MRGPRX4 (MAS-related GPR member X4) ), PTH2 (parathyroid hormone 2), DRGX (dorsal root ganglion homeobox), CCR3 (chemokine (CC motif) receptor 3), CYBA (cytochrome b-245 alpha polypeptide), CCL7 (chemokine (C − Motif) Ligand 7), S100A6 (S100 calcium binding protein A6), CHGA (chromogranin A (parathyroid secreted protein 1)), CCL4 (chemokine (CC motif) ligand 4), HTR5A (5-hydroxytryptamine (serotonin) Receptor 5A), KCNC3 (potassium voltage-gated channel show (Shaw) -related subfamily member 3), PNMT (phenylethanolamine N-methyltransferase), CCL8 (chemokine (CC motif) ligand 8), LTB4R (leukotriene) B4 receptor), NOXA1 (NADPH oxidase activator 1), PHOX2B (pairing-like homeobox 2b), NOX1 (NADPH oxidase 1), NOX4 (NADPH oxidase) ), TAS1R3 (taste receptor type 1 member 3), nerve G1 (neurogenin 1), NOXO1 (NADPH oxidase organizer 1), TRIM26 (containing trisomic motif 26), OMP (olfactory marker protein), ZC3H12A (zinc finger CCCH) Type containing 12A), CXCR4 (chemokine (C—X—C motif) receptor 4), PLA2G2A (phospholipase A2 group IIA (platelet symphyrin fluid)), PLA2G1B (phospholipase A2 group IB (pancreas)), GNRH1 (gonadotropic hormone) Release hormone 1 (Luteinizing release hormone)), TJP1 (tight junction protein 1 (closed zone 1)), NRG1 (neuregulin 1), GRIN2B (glutamate receptor counterionic N-methyl D-aspartate 2B), C L18A1 (collagen XVIII type alpha 1), HTR6 (5-hydroxytryptamine (serotonin) receptor 6), HTR7 (5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase binding)), SLC1A3 (solute carrier family 1 ( Glial cell high-affinity glutamate transporter) member 3), CACNA1D (calcium channel potential-dependent L-type alpha 1D subunit), GRM2 (metabolism for glutamate receptor 2), HNMT (histamine N-methyltransferase), ADORA2B ( Adenosine A2b receptor), SLC1A1 (solute carrier family 1 (neurotype / epithelial high affinity glutamate transport system Xag) member 1), GABBR2 (gamma-aminobutyric acid (GABA) B receptor 2), PCSK (Proprotein convertase subtilisin / kexin type 2), CD160 (CD160 molecule), TSPO (translocator protein (18 kDa)), NPSR1 (neuropeptide S receptor 1), PROL1 (proline-rich lacrimal gland 1), NPVF ( Neuropeptide VF precursor), NPS (neuropeptide S), PRNP (prion protein), GRIA2 (glutamate receptor ionic AMPA2), GRIA1 (glutamate receptor ionic AMPA1), PRKCE (protein kinase C epsilon), ITPR1 (Inositol 1 (4 (5-triphosphate receptor type 1), CBR1 (carbonyl reductase 1), ADORA3 (adenosine A3 receptor), FMR1 (fragile X mental retardation 1), ALOX5 (arachidonic acid 5-lipoxy) Shigenase), GRM7 (metabolism 7 for glutamate receptor), PRKG1 (protein kinase cGMP-dependent type I), IL7 (interleukin 7), GRIK5 (glutamate receptor ionotropic kainate 5), HCRTR1 (hypocretin (hypocretin ( Orexin) receptor 1), CCL21 (chemokine (CC motif) ligand 21), IL1RN (interleukin 1 receptor antagonist), CX3CR1 (chemokine (CX3-C motif) receptor 1), P2RX4 (purine agonist) Sex receptor P2X ligand-gated ion channel 4), AVP (arginine vasopressin), PRPH (peripherin), MTOR (mechanical target of rapamycin (serine / threonine kinase)), NFATC4 (nuclear factor cytoplasmic calcium of activated T cells) -Rin dependence 4), F2RL1 (coagulation factor II (thrombin) receptor-like 1), EDN2 (endothelin 2), ACCN2 (amylolide-sensitive cation channel 2 neural type), P2RX1 (purinergic receptor P2X ligand-opened type) Ion channel 1), ENPEP (glutamylaminopeptidase (aminopeptidase A)), CLDN5 (clodin 5), GFRA3 (GDNF family receptor alpha 3), PTGER1 (prostaglandin E receptor 1 (subtype EP1) 42 kDa) , OCLN (Occludin), P2RX5 (Purinergic receptor P2X ligand-gated ion channel 5), CALB1 (Calbindin 1 28 kDa), CXCL1 (Chemokine (CXC motif) ligand 1 (Malignant melanoma growth stimulating activity Alf) )), BDKRB1 (bradykinin receptor B1), TRPV4 (transient receptor potential cation channel subfamily V member 4), PRLHR (prolactin-releasing hormone receptor), P2RX6 (purinergic receptor P2X ligand-gated ion) Channel 6), LALBA (lactalbumin alpha-), IL17A (interleukin 17A), NPFFR1 (neuropeptide FF receptor 1), ARTN (artemin), PTH2R (parathyroid hormone 2 receptor), PROK2 (prokineticin 2), PROKR2 (prokineticin receptor 2), MAS1L (MAS1 oncogene-like), PROKR1 (prokineticin receptor 1), MRGPRD (MAS-related GPR member D), MRGPRE (MAS-related GPR member E), MRG RF (MAS associated GPR members F), and PRLH (prolactin releasing hormone) and the like.

Furthermore, sensory associated chromosomal sequences may be associated with pain perception. Non-limiting examples of pain-related chromosomal sequences include PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), SCN9A (sodium channel voltage-gated IX alpha subunit), TRPV1 ( Transient receptor potential cation channel subfamily V member 1), KNG1 (kininogen 1), IL1B (interleukin 1 beta), NTRK1 (neurotrophic tyrosine kinase receptor type 1), BDKRB1 (bradykinin receptor B1) , BDKRB2 (bradykinin receptor B2), P2RX3 (purinergic receptor P2X ligand-gated ion channel 3), POMC (proopiomelanocortin), GAL (galanine prepropeptide), SCN10A Sodium channel voltage-gated X alpha subunit), PRKCG (protein kinase C gamma), PTGS1 (prostaglandin-endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)), GRIN1 (glutamate receptor ionotropic) N-methyl D-aspartate 1), NGF (nerve growth factor (beta polypeptide)), CALCA (calcitonin related polypeptide alpha), TNF (tumor necrosis factor (TNF superfamily member 2)), IL6 (interleukin 6) (Interferon beta 2)), CRP (C-reactive protein pentraxin related), INS (insulin), OPRM1 (opioid receptor mu1), COMT (catechol-O-methyltrane) Ferrase), CNR1 (cannabinoid receptor 1 (brain)), IL10 (interleukin 10), CCK (cholecystokinin), TACR1 (tachykinin receptor 1), OPRD1 (opioid receptor delta1), NPFFR2 (neuropeptide FF) Receptor 2), TGFB1 (conversion growth factor beta 1), NOS1 (nitric oxide synthase 1 (neural type)), CRH (corticotropin-releasing hormone), GALR3 (galanin receptor 3), MSD (both convulsive) Microcephaly with paralysis (pain syndrome), IL8 (interleukin 8), MB (myoglobin), DYT10 (dystonia 10), PRL (prolactin), MAPK1 (mitogen-activated protein kinase 1), TAC1 (tachykinin precursor) 1) PDYN (Prodynorphin), GCH1 (GTP cyclohydrolase 1), SOD1 (superoxide dismutase 1 soluble), SLC6A4 (solute carrier family 6 (neurotransmitter transporter serotonin) member 4), GRIN2B (glutamate receptor anionic N-methyl D-asparagine Acid 2B), NPY (neuropeptide Y), OPRK1 (opioid receptor kappa 1), PENK (proenkephalin), TRPA1 (transient receptor potential cation channel subfamily A member 1), IL2 (interleukin 2) , CABIN1 (calcineurin binding protein 1), NOS2 (nitrogen monoxide synthase 2 inducible), PNOC (prepronociceptin), GRIN2A (glutamate receptor counterionic N-methyl D-aspartate 2A), CHKA (co Kinase A), FOS (FBJ mouse osteosarcoma oncogene homolog), GRIN2D (glutamate receptor ionic N-methyl D-aspartate 2D), CCL2 (chemokine (CC motif) ligand 2), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A), CYP19A1 (cytochrome P450 family 19 subfamily A polypeptide 1), GRIN2C (glutamate receptor counterionic N-methyl D-aspartate 2C), PTGES (prostaglandin) E synthase), HTR3A (5-hydroxytryptamine (serotonin) receptor 3A), FAAH (fatty acid amide hydrolase), NTRK2 (neurotrophic tyrosine kinase receptor type 2), ACE (angiotensin I converting fermentation) (Peptidyl-dipeptidase A) 1), GRM1 (metabolism for glutamate receptor 1), GDNF (glial cell-derived neurotrophic factor), TLR4 (toll-like receptor 4), DRD2 (dopamine receptor D2), GRM5 (Metabolism 5 for glutamate receptor), VIP (vasoactive intestinal peptide), PROK1 (prokineticin 1), GALR2 (galanin receptor 2), ESR1 (estrogen receptor 1), NR3C1 (nuclear receptor subfamily 3 C Group member 1 (glucocorticoid receptor)), MME (membrane metallo-endopeptidase), EDN1 (endothelin 1), NPY1R (neuropeptide Y receptor Y1), ADK (adenosine kinase), NPY2R (neuropeptide Y receptor) Y2), GALR1 (Garanin receptor 1), TRPC1 (Transient Receptor potential cation channel subfamily C member 1), TRPC5 (transient receptor potential cation channel subfamily C member 5), TRPC6 (transient receptor potential cation channel subfamily C member 6), HBS1L (HBS1-like (budding yeast)), GRIN3A (glutamate receptor ionic N-methyl-D-aspartate 3A), GRIN3B (glutamate receptor ionic N-methyl-D-aspartate 3B), GPR55 (G Protein-coupled receptor 55), MRGPRX3 (MAS-related GPR member X3), HSN2 (hereditary sensory neuropathy type II), AKR1B1 (aldo-ketoreductase family 1 member B1 (aldose reductase)), NGFR (nerve growth factor receptor ( TNFR Superfamily member 16)), PRKCE (protein kinase C epsilon), TRPM8 (transient receptor potential cation channel subfamily M member 8), SST (somatostatin), IL1RN (interleukin 1 receptor antagonist), CD40LG ( CD40 ligand), BCHE (butyrylcholinesterase), ACPP (acid phosphatase prostate), NPPC (natriuretic peptide precursor C), SCN11A (sodium channel voltage-gated XI alpha subunit), KLK3 (kallikrein-related peptidase 3), PTGIR (Prostaglandin I2 (prostacyclin) receptor (IP)), PPYR1 (pancreatic polypeptide receptor 1), NPY5R (neuropeptide Y receptor Y5), NPFF 1 (neuropeptide FF receptor 1), ACCN4 (amylolide-sensitive cation channel 4 pituitary), MMEL1 (membrane metallo-endopeptidase-like 1), UCN (urocortin), IFNG (interferon gamma), CYP2D6 (cytochrome P450 family) 2 subfamily D polypeptide 6), CACNA1B (calcium channel voltage-gated N-type alpha 1B subunit), ACCN3 (amylolide-sensitive cation channel 3), BDNF (brain-derived neurotrophic factor), MAPK14 (mitogen-activating protein) Kinase 14), CNR2 (cannabinoid receptor 2 (macrophage)), MMP9 (matrix metallopeptidase 9 (gelatinase B 92 kDa gelatinase 92 kDa type IV collagenase)) IL4 (interleukin 4), ADRB2 (adrenergic beta-2-receptor surface), GFAP (glial fibrillary acidic protein), KCNIP3 (Kv channel interacting protein 3 calsenilin), IL1R1 (interleukin 1 receptor type I) ), ABCB1 (ATP binding cassette subfamily B (MDR / TAP) member 1), MAPK8 (mitogen activated protein kinase 8), MC1R (melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)), ALB (albumin), CAMK2G (calcium / calmodulin-dependent protein kinase II gamma), PLAT (plasminogen activator tissue), P2RX4 (purinergic receptor P2X ligand-gated ion channel 4), MAPK3 ( Itogen-activated protein kinase 3), TNFRSF1A (tumor necrosis factor receptor superfamily member 1A), TTF2 (transcription termination factor RNA polymerase II), ITIH4 (inter-alpha (globulin) inhibitor H4 (plasma kallikrein sensitive glycoprotein)) , CXCR4 (chemokine (C—X—C motif) receptor 4), SOD2 (superoxide dismutase 2 mitochondria), SRC (v-src sarcoma (Schmidt-Lupin A-2) virus oncogene homolog (bird)) PPARA (peroxisome proliferator activated receptor alpha), CREB1 (cAMP responsive element binding protein 1), F2 (coagulation factor II (thrombin)), GAD1 (glutamate decarboxylase 1 (brain 67 kDa)), P2RX7 (purinergic receptor P2X ligand-gated ion channel 7), F3 (coagulation factor III (thromboplastin tissue factor)), MIF (macrophage migration inhibitory factor (glycosylation inhibitor)), LEP (leptin), GNRH1 ( Gonadotropin releasing hormone 1 (luteinizing releasing hormone)), OPRL1 (opiate receptor-like 1), CCL3 (chemokine (CC motif) ligand 3), UCP1 (uncoupled protein 1 (mitochondrial proton carrier)), NTS (neurotensin), SLC12A5 (solute carrier family 12 (potassium / chloride transporter) member 5), CD160 (CD160 molecule), NPFF (neuropeptide FF-amide peptide precursor), AMPEP (alanyl (membrane) aminopeptidase VDR (vitamin D (1 (25-dihydroxyvitamin D3) receptor), JUN (jun oncogene), ADIPOQ (containing adiponectin C1Q and collagen domain), ELK1 (ELK1 member ETS oncogene family), FGF2 (fibroblasts) Cell growth factor 2 (basic)), GABBR1 (gamma-aminobutyric acid (GABA) B receptor 1), COMP (cartilage oligomeric matrix protein), serpin E1 (serpin peptidase inhibitor clade E (nexin plasminogen activator inhibition) Factor 1) member 1), GRM2 (metabolism for glutamate receptor 2), GAD2 (glutamate decarboxylase 2 (islet and brain 65 kDa)), EPO (erythropoietin), NTF3 (neurotrophin 3), L1R2 (interleukin 1 receptor type II), ADCY1 (adenylate cyclase 1 (brain)), PEPD (peptidase D), HBEGF (heparin-binding EGF-like growth factor), GAST (gastrin), KCND1 (potassium potential opening type) Channel-related subfamily member 1), OXT (oxytocin prepropeptide), SLC17A5 (solute carrier family 17 (anion / sugar transporter) member 5), PL-5283 (PL-5283 protein), STN (statin) ), EGF (epidermal growth factor (beta-urogastrone)), CACNA1A (calcium channel potential-dependent P / Q type alpha 1A subunit), VWF (von Willebrand factor), ANXA5 (annexin A5), MMP2 (matrix) Cusmetallopeptidase 2 (gelatinase A 72 kDa gelatinase 72 kDa type IV collagenase), HMGCR (3-hydroxy-3-methylglutaryl-coenzyme A reductase), SPP1 (secreted phosphorylated protein 1), SCN5A (sodium channel potential opening type V) Alpha subunit), GLA (galactosidase alpha), CHRNA4 (cholinergic receptor nicotinic alpha 4), PITX2 (pairing-like homeodomain 2), DLG4 (discs large homolog 4 (Drosophila)), GNB3 (Guanine nucleotide binding protein (G protein) beta polypeptide 3), ADORA1 (adenosine A1 receptor), MYH7 (myosin heavy chain 7 myocardial beta), TXN (thioredoxin), CP (cell Loplasmin (ferrooxidase), CSF3 (colony stimulating factor 3 (granulocyte)), SLC1A1 (solute carrier family 1 (neurotype / epithelial high affinity glutamate transport system Xag) member 1
), IAPP (islet amyloid polypeptide), GUK1 (guanylate kinase 1), NPPA (natriuretic peptide precursor A), ADCYAP1 (adenylate cyclase activating polypeptide 1 (pituitary)), XDH (xanthine dehydrogenase) ), SRD5A1 (steroid-5-alpha-reductase alpha polypeptide 1 (3-oxo-5alpha-steroid delta4-dehydrogenase alpha 1)), IDO1 (indoleamine 2 (3-dioxygenase 1), REN (rennin) , CX3CL1 (chemokine (C-X3-C motif) ligand 1), NEK3 (NIMA (never in mitosis a) -related kinase 3), KIAA0101 (KIAA0101) ARTN (Artemin), SLC17A6 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter) member 6), GPR172B (G protein-coupled receptor 172B), BCL2 (B cell CLL / lymphoma 2), CREBBP (CREB binding) Protein), NCAM1 (nerve cell adhesion molecule 1), EPOR (erythropoietin receptor), ATP2A2 (ATPase Ca ++ transport myocardial slow muscle 2), HTR7 (5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase binding)), MYH11 (myosin heavy chain 11 smooth muscle), AGTR2 (angiotensin II receptor type 2), ENO2 (enolase 2 (gamma neural type)), VIM (vimentin), MAP2K3 (mitogen-activated protein kinase kinase 3) ADAM17 (ADAM metallopeptidase domain 17), IL6ST (interleukin-6 signaling factor (gp130 oncostatin M receptor)), PSMA2 (proteasome (prosome macropain) subunit alpha type 2), MAP2K6 (mitogen-activated protein kinase) Kinase 6), S100A9 (S100 calcium binding protein A9), S100A8 (S100 calcium binding protein A8), CCL21 (chemokine (CC motif) ligand 21), EPHA4 (EPH receptor A4), ADCYAP1R1 (adenylate cyclase activity) Polypeptide 1 (pituitary) receptor type I), CGB (chorionic gonadotropin beta polypeptide), IBSP (integrin-binding sialoprotein), SORT1 (Sortilin 1), CNTF (Ciliary Neurotrophic Factor), DAO (D-amino acid oxidase), NRTN (Neurturin), HCRT (Hypocretin (orexin) neuropeptide precursor), MAP1B (microtubule-associated protein 1B), ADAMTS13 (ADAM metallopeptidase 13 having thrombospondin type 1 motif), ABP1 (amylolide binding protein 1 (amine oxidase (copper-containing))), SLC17A7 (solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter) members 7), CADM1 (cell adhesion molecule 1), AIF1 (allograft inflammatory factor 1), ADCY10 (adenylate cyclase 10 (soluble)), TRIM26 (containing a trisomic motif 26), GGT2 (gamma-glutamylt) Encephalase 2), IL1A (interleukin 1 alpha), C1S (complement component 1 s subcomponent), MPO (myeloperoxidase), NPPB (natriuretic peptide precursor B), F2RL1 (coagulation factor II (thrombin) ) Receptor-like 1), TNNI3 (troponin I type 3 (heart)), SELP (selectin P (granular membrane protein 140 kDa antigen CD62)), TNFRSF11B (tumor necrosis factor receptor superfamily member 11b), FABP3 (fatty acid binding protein) 3 muscles and heart (breast-derived growth inhibitory factor)), ADRA2A (adrenergic alpha-2A-receptor), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), CASP3 (caspase-3 apoptosis-related cysteine pep Thidase), CPOX (coproporphyrinogen oxidase), SCN7A (sodium channel voltage-gated VII alpha), PPARG (peroxisome proliferator-activated receptor gamma), MYL3 (myosin light chain 3 alkali, ventricular skeletal slow), CRHR1 (corticotropin-releasing hormone receptor 1), ICAM1 (intracellular adhesion molecule 1), MAPK10 (mitogen activated protein kinase 10), CAMK2A (calcium / calmodulin-dependent protein kinase II alpha), EDNRB (endothelin receptor) B type), CSF2 (colony stimulating factor 2 (granulocyte-macrophage)), SCN4A (sodium channel voltage-gated IV alpha subunit), EPRS (glutamyl-prolyl-tRNA synthetase) Z), HBB (hemoglobin beta), IL5 (interleukin 5 (colony stimulating factor eosinophils)), EDNRA (endothelin receptor type A), MEFV (Mediterranean fever), PAPPA (pregnancy-related plasma protein A Paparicin 1), PTGER4 (prostaglandin E receptor 4 (subtype EP4)), PIK3C2A (phosphoinositide-3-kinase class 2 alpha polypeptide), BGLAP (bone gamma-carboxyglutamate (gla) protein), POR (P450 (cytochrome) oxide Reductase), NOS3 (nitric oxide synthase 3 (endothelial cells)), PRKACA (protein kinase cAMP-dependent catalytic alpha), TP53 (tumor protein p53), RPS6KB1 (ribosomal protein 6 kinase 70 kDa) Repeptide 1), PRKAR1A (protein kinase cAMP-dependent regulatory type I alpha (tissue-specific loss factor 1)), IGF1 (insulin-like growth factor 1 (somatomedin C)), GRIA2 (glutamate receptor ionotropic AMPA2), GRIA1 (glutamate receptor ionotropic AMPA1), IL13 (interleukin 13), HSP90AA1 (heat shock protein 90 kDa alpha (cytosol) class A member 1), PIK3CG (phosphoinositide-3-kinase-catalyzed gamma polypeptide), IL12B ( Interleukin 12B (natural killer cell stimulating factor 2 cytotoxic lymphocyte maturation factor 2 p40)), CYP3A4 (cytochrome P450 family 3 subfamily A polypeptide 4), PRKA B (protein kinase cAMP-dependent catalytic beta), PRKAR2A (protein kinase cAMP-dependent regulatory type II alpha), GRM8 (metabotropic for glutamate receptor 8), CAMK2D (calcium / calmodulin-dependent protein kinase II delta), GRM7 (Metabolism 7 for glutamate receptor), GH1 (growth hormone 1), TNNT2 (troponin T2 type (heart)), MAOA (monoamine oxidase A), CAMK2B (calcium / calmodulin-dependent protein kinase II beta), serpin C1 ( Serpin peptidase inhibitor clade C (antithrombin) member 1), SLC12A2 (solute carrier family 12 (sodium / potassium / chloride transporter) member 2), COL2A1 (collagen II) Type alpha 1), PRKAR1B (protein kinase cAMP-dependent regulatory type I beta), CX3CR1 (chemokine (C-X3-C motif) receptor 1), PRKACG (protein kinase cAMP-dependent catalytic gamma), SLC6A2 (solute carrier) Family 6 (neurotransmitter transporter noradrenaline) member 2), MTOR (mechanical target of rapamycin (serine / threonine kinase)), DLG2 (discs large homolog 2 (Drosophila)), MGLL (monoglyceride lipase) , ATF3 (activated transcription factor 3), ALPP (alkaline phosphatase placenta (Reagan isozyme)), COL9A2 (collagen IX type alpha 2), HBG2 (hemoglobin gamma G), MRGPRX1 (MAS-related GP) Member X1), FGFR1 (fibroblast growth factor receptor 1), NFKB1 (nuclear factor 1 of kappa light polypeptide gene enhancer in B cells), EIF4E (eukaryotic cell translation initiation factor 4E), PRKCA (protein kinase C alpha) ), EGFR (epidermal growth factor receptor (erythroblastic leukemia virus (v-erb-b) oncogene homologue bird)), PIK3R1 (phosphoinositide-3-kinase regulatory subunit 1 (alpha)), PTPN6 ( Protein tyrosine phosphatase non-receptor type 6), PLCG2 (phospholipase C gamma 2 (phosphatidylinositol specific)), PRKCQ (protein kinase C theta), PLG (plasminogen), GRIA3 (glutamate receptor ionic AMPA3), IL6R ( Interleukin-6 receptor), HIF1A (hypoxia-inducible factor 1 alpha subunit (basic helix-loop-helix transcription factor)), ALPL (alkaline phosphatase liver / bone / kidney), ADCY6 (adenylate cyclase 6) ), PRKCZ (protein kinase C zeta), GRM3 (metabotropic for glutamate receptor 3), IL2RA (interleukin 2 receptor alpha), PIK3CD (phosphoinositide-3-kinase-catalyzed delta polypeptide), SNCA (synuclein alpha (amyloid) Non-A4 component of the precursor)), CYP1A1 (cytochrome P450 family 1 subfamily A polypeptide 1), PLCG1 (phospholipase C gamma 1), DBH (dopamine beta-hydroxylase (dopamine base) Data-monooxygenase)), GRIK1 (glutamate receptor ionotropic kainate 1), PRKCH (protein kinase C eta), PRKCD (protein kinase C delta), CAT (catalase), ITPR1 (inositol 1 (4 ( 5-triphosphate receptor type 1), PLCB3 (phospholipase Cbeta3 (phosphatidylinositol specific)), PLCB2 (phospholipase Cbeta2), PIK3CB (phosphoinositide-3-kinase catalytic beta polypeptide), PLA2G2A (phospholipase A2) Group IIA (platelet symphyrin liquid)), PIK3CA (phosphoinositide-3-kinase catalytic alpha polypeptide), DRD3 (dopamine receptor D3), DMD (dystrophin), MAPK7 (mitogen) Activated protein kinase 7), PIK3C3 (phosphoinositide-3-kinase class 3), LPL (lipoprotein lipase), ADCY8 (adenylate cyclase 8 (brain)), HSPG2 (heparan sulfate proteoglycan 2), CCL5 (chemokine (C -C motif) ligand 5), ALOX5 (arachidonic acid 5-lipoxygenase), PRKCI (protein kinase C iota), PRKAR2B (protein kinase cAMP-dependent regulatory type II beta), GLRA1 (glycine receptor alpha 1), MMP12 ( Matrix metallopeptidase 12 (macrophage elastase)), CHAT (choline acetyltransferase), LRP5 (low density lipoprotein receptor-related protein 5), TIMP1 (TIMP) Talopeptidase inhibitor 1), PLCB1 (phospholipase Cbeta1 (phosphoinositide specific)), F2R (coagulation factor II (thrombin) receptor), EIF2S1 (eukaryotic translation initiation factor 2 subunit 1 alpha 35 kDa), SELL (Selectin L), THBS2 (thrombospondin 2), ADRA2C (adrenergic alpha-2C-receptor), HTR2B (5-hydroxytryptamine (serotonin) receptor 2B), TF (transferrin), CST3 (cystatin C), PIK3C2B (phosphoinositide-3-kinase class 2 beta polypeptide), PLCD1 (phospholipase Cdelta1), PLCB4 (phospholipase Cbeta4), NR1I2 (nuclear receptor subfamily 1 group I member 2), PIK R2 (phosphoinositide-3-kinase regulatory subunit 2 (beta)), PYGM (Phosphorylase glycogen muscle), KCNQ3 (Potassium voltage-gated channel KQT-like subfamily members 3), PECAM1 (Platelet / endothelial cell adhesion molecule),
CCL4 (chemokine (CC motif) ligand 4), TACR3 (tachykinin receptor 3), GRM4 (glutamate receptor metabolic 4), 9-Sep (septin 9), LBP (lipopolysaccharide binding protein), CAMK1 ( Calcium / calmodulin-dependent protein kinase I), SCN1A (sodium channel voltage-gated type I alpha subunit), OSM (oncostatin M), SQSTM1 (sequestsome 1), AVP (arginine vasopressin), PRPH (peripherin), GLRA3 (Glycine receptor alpha 3), PIK3R3 (phosphoinositide-3-kinase regulatory subunit 3 (gamma)), PTGER3 (prostaglandin E receptor 3 (subtype EP3)), SPTLC1 (serine palmitoyl trans Long chain base subunit 1), PIK3C2G (phosphoinositide-3-kinase class 2 gamma polypeptide), PTH (parathyroid hormone), TJP1 (tight junction protein 1 (closed zone 1)), SCN2B (sodium channel voltage-gated) II beta), EIF2AK2 (eukaryotic translation initiation factor 2-alpha kinase 2), CACNA2D2 (calcium channel voltage-dependent alpha 2 / delta subunit 2), ADCY5 (adenylate cyclase 5), PRKCB (protein kinase C beta) ), TAT (tyrosine aminotransferase), CLDN5 (claudin 5), HYAL1 (hyaluronoglucosaminidase 1), PLCD3 (phospholipase Cdelta3), PTGER1 (prostaglandin E receptor) 1 (subtype EP1) 42 kDa), KRT7 (keratin 7), PPIG (peptidylprolyl isomerase G (cyclophilin G)), OCLN (occludine), CACNA2D1 (calcium channel voltage-dependent alpha2 / delta subunit 1), CXCL1 (Chemokine (C—X—C motif) ligand 1 (malignant melanoma growth stimulating activity alpha)), SLC6A1 (solute carrier family 6 (neurotransmitter transporter GABA) member 1), serpin A6 (serpin peptidase inhibitor clade A (Alpha-1 antiproteinase antitrypsin) member 6), TRPV4 (transient receptor potential cation channel subfamily V member 4), NNT (nicotinamide nucleotide transhydrogenase), GRM6 (glutamate reception) Metabolicity 6), DPP3 (dipeptidyl-peptidase 3), SLC18A3 (solute carrier family 18 (vesicle acetylcholine) member 3), GPT (glutamate-pyruvate transaminase (alanine aminotransferase)), TFIP11 (tufterin interacting protein) 11), KCNK2 (potassium channel subfamily K member 2), CYB5A (cytochrome b5 type A (microsome)), PLCZ1 (phospholipase C zeta 1), ANK3 (ankyrin 3 lambye choke (ankyrin G)), BLVRB (biliverdin reductase) B (flavin reductase (NADPH))), FGF23 (fibroblast growth factor 23), CAMK1G (calcium / calmodulin-dependent protein kinase IG), T RPV2 (transient receptor potential cation channel subfamily V member 2), PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5), GRINA (glutamate receptor counterionic N-methyl D-aspartate related protein 1 (Glutamate binding)), PROK2 (prokineticin 2), ENAM (enamelin), NPBWR1 (neuropeptide B / W receptor 1), LXN (latexin), MRGPRX2 (MAS-related GPR member X2), AMBN (ameloblastin (enamel)) Matrix protein)), UCN2 (urocortin 2), TUFT1 (tufterin 1), FAM134B (family 134 member B having sequence similarity), TAC4 (tachykinin 4 (hemokinin)), NPB (neuropeptide B) PDGFRB (platelet derived growth factor receptor beta polypeptide), ITGB2 (integrin beta 2 (complement component 3 receptors 3 and 4 subunits)), FGFR2 (fibroblast growth factor receptor 2), TSC1 (nodular sclerosis) Disease 1), RUNX1 (runt-related transcription factor 1), PTPRC (protein tyrosine phosphatase receptor type C), FYN (SRC FGR YES related to FYN oncogene), APP (amyloid beta (A4) precursor protein), PGR ( Progesterone receptor), ERBB2 (v-erb-b2 erythroblastic leukemia virus oncogene homolog 2 neuronal / glioblastoma oncogene homolog (bird)), ERBB3 (v-erb-b2 erythroblastic leukemia) Virus oncogene homolog 3 (bird)), CSTB (cystatin B Tefin B)), CASP8 (Caspase-8 apoptosis-related cysteine peptidase), ADA (adenosine deaminase), WT1 (Wilms tumor 1), CD44 (CD44 molecule (Indian blood group)), NFKBIA (Kappa light polypeptide gene enhancer in B cells) Nuclear factor inhibitor alpha), RB1 (retinoblastoma 1), S100B (S100 calcium binding protein B), MYL2 (myosin light chain 2 regulated cardiac slow), PSEN1 (presenilin 1), EGR1 (early proliferative response 1) ), GJA1 (gap junction protein alpha 1 43 kDa), SLC6A3 (solute carrier family 6 (neurotransmitter transporter dopamine) member 3), JAK2 (Janus kinase 2), RYR1 (ryanodine receptor 1 (skeleton)), CCK BR (cholecystokinin B receptor), RELA (v-rel reticuloendotheliosis virus oncogene homolog A (bird)), RET (ret proto-oncogene), ANXA2 (annexin A2), CCR5 (chemokine (C -C motif) receptor 5), TGFBR1 (transformed growth factor beta receptor 1), PARK2 (Parkinson's disease (autosomal recessive juvenile) 2 parkin), ITGA6 (integrin alpha 6), DPYD (dihydropyrimidine dehydrogenase), TH (Tyrosine hydroxylase), GNAS (GNAS complex locus), TNFRSF1B (tumor necrosis factor receptor superfamily member 1B), COL1A1 (collagen type I alpha 1), HMOX1 (heme oxygenase (decycling) 1), LDHA ( Lactic acid dehydride Genase A), MBP (myelin basic protein), serpin A1 (serpin peptidase inhibitor clade A (alpha-1 antiproteinase antitrypsin) member 1), SCNN1A (sodium channel non-potential open type 1 alpha), ACTN2 (actinin alpha) 2), ACHE (acetylcholinesterase (Yt blood group)), TTN (titin), CCNH (cyclin H), SLC1A2 (solute carrier family 1 (glial cell high affinity glutamate transporter) member 2), ESR2 (estrogen receptor) 2 (ERbeta)), HTR4 (5-hydroxytryptamine (serotonin) receptor 4), KCNH2 (potassium voltage-gated channel subfamily H (eag related) member 2), ADRBK1 (adrenergic base) Receptor kinase 1), IRS1 (insulin receptor substrate 1), C3 (complement component 3), LTA4H (leukotriene A4 hydrolase), GSR (glutathione reductase), NF2 (nerve fibromin 2 (merlin)), ATF2 (activity) Transcription factor 2), IGFBP3 (insulin-like growth factor binding protein 3), BMP4 (bone morphogenetic protein 4), CDK5 (cyclin-dependent kinase 5), CDC25C (cell division cycle 25 homolog C (fission yeast)), CD36 (CD36 molecule (thrombospondin receptor)), TPM1 (tropomyosin 1 (alpha)), CD40 (CD40 molecule TNF receptor superfamily member 5), CYP1A2 (cytochrome P450 family 1 subfamily A polypeptide 2), FN1 ( Phi Bonectin 1), PKM2 (pyruvate kinase muscle), G6PD (glucose-6-phosphate dehydrogenase), CGA (glycoprotein hormone alpha polypeptide), HSF1 (heat shock transcription factor 1), CD3E (CD3e molecule epsilon (CD3- TCR complex)), CYP3A5 (cytochrome P450 family 3 subfamily A polypeptide 5), CYP2C9 (cytochrome P450 family 2 subfamily C polypeptide 9), ADRA1A (adrenergic alpha-1A-receptor), CD14 (CD14 molecule) ), IL4R (interleukin 4 receptor), ITPR3 (inositol 1 (4 (5-triphosphate receptor type 3), IL15 (interleukin 15), MECP2 (methyl CpG binding protein 2 (let)) Symptom group)), ANXA1 (annexin A1), PRKAG1 (protein kinase AMP-activated gamma 1 non-catalytic subunit), DCN (decorin), MYB (v-myb myeloblastosis virus oncogene homolog (bird)), AVPR1A (arginine vasopressin receptor 1A), HLA-DQB1 (major histocompatibility complex class II DQbeta1), NEFL (neurofilament light polypeptide), SCNN1B (sodium channel non-potential open type 1 beta), CACNA1H (calcium Channel voltage-dependent T-type alpha 1H subunit), IFNAR1 (interferon (alpha beta and omega) receptor 1), PDE4D (phosphodiesterase 4D cAMP specific (phosphodiesterase E3 dance phase) Homologous Drosophila)), HDAC9 (histone deacetylase 9), ABCC1 (ATP binding cassette subfamily C (CFTR / MRP) member 1), PRDX5 (peroxiredoxin 5), EPHX2 (epoxide hydrolase 2 cytoplasm), VCAM1 (blood vessels) Cell adhesion molecule 1), PRKAG2 (protein kinase AMP-activated gamma 2 non-catalytic subunit), ADCY2 (adenylate cyclase 2 (brain)), HTR1B (5-hydroxytryptamine (serotonin) receptor 1B), ADCY9 (a Denylate cyclase 9), HLA-A (major histocompatibility complex class IA), SLC1A3 (solute carrier family 1 (glia cell high affinity glutamate transporter) member 3), HLA-B (major histocompatibility complex) Body class I ), ITGA2 (integrin alpha 2 (CD49B alpha 2 subunit of VLA-2 receptor)), GABRA2 (gamma-aminobutyric acid (GABA) A receptor alpha 2), IL2RB (interleukin 2 receptor beta), GLRB ( Glycine receptor beta), SOCS3 (suppressor 3 of cytokine signaling), CSNK2B (casein kinase 2 beta polypeptide), KCNK3 (potassium channel subfamily K member 3), KCNQ2 (potassium voltage-gated channel KQT-like subfamily member) 2), DPYSL2 (dihydropyrimidinase-like 2), CYP2J2 (cytochrome P450 family 2 subfamily J polypeptide 2), DRD4 (dopamine receptor D4), PRKG1 (protein kinase) cGMP-dependent type I), TNFSF11 (tumor necrosis factor (ligand) superfamily member 11), IFNAR2 (interferon (alphabeta and omega) receptor 2), EIF4EBP1 (eukaryotic translation initiation factor 4E binding protein 1), EIF4G1 (Eukaryotic translation initiation factor 4 gamma 1), EIF4G3 (eukaryotic translation initiation factor 4 gamma 3), SCNN1G (sodium channel non-potential opening type 1 gamma), serpin G1 (serpin peptidase inhibitor clade G (C1 inhibitor) ) Member 1), PABPN1 (poly (A) binding protein nucleus 1), CAST (calpastatin), CTSC (cathepsin C), CTGF (connective tissue growth factor), CHRNB2 (cholinergic receptor nicotinic beta 2 (neural type) )), ADCY3 ( Adenylate cyclase 3), ADCY7 (adenylate cyclase 7), ADRA1D (adrenergic alpha -1D- receptor), CHRM2 (cholinergic receptor muscarinic 2), DHFR (dihydrofolate reductase), MC2R (melanocortin 2 receiving
Condition (adrenocorticotropic hormone)), THBD (thrombomodulin), IL7 (interleukin 7), IL18 (interleukin 18 (interferon-gamma inducer)), SIRT1 (sirtuin (silent mating type information control 2 homolog) 1 ( Budding yeast)), GRIA4 (glutamate receptor ionotropic AMPA4), CSNK1E (casein kinase 1 epsilon), CPE (carboxypeptidase E), PRSS1 (protease serine 1 (trypsin 1)), GOT2 (glutamate-oxaloacetate transaminase 2) Mitochondria (aspartate aminotransferase 2)), GABRB1 (gamma-aminobutyric acid (GABA) A receptor beta1), ALOX12 (arachidonic acid 12-lipoxygenase), C L11 (chemokine (CC motif) ligand 11), HLA-DRB1 (major histocompatibility complex class II DRbeta1), RBL2 (retinoblastoma-like 2 (p130)), AGER (final glycation product specific Receptor), LAMP1 (lysosome-associated membrane protein 1), MAPKAPK2 (mitogen activated protein kinase activated protein kinase 2), LTA (lymphotoxin alpha (TNF superfamily member 1)), CYP4A11 (cytochrome P450 family 4 subfamily) A polypeptide 11), MAOB (monoamine oxidase B), TPH1 (tryptophan hydroxylase 1), SPARC (secreted protein acidic cysteine rich (ostonectin)), PIK3R4 (phosphoinositide- -Kinase regulatory subunit 4), CYP17A1 (cytochrome P450 family 17 subfamily A polypeptide 1), CD63 (CD63 molecule), CLCN1 (chloride channel 1 skeletal muscle), NFE2L2 (nuclear factor (red blood cell origin 2) -like 2), TNFRSF11A (tumor necrosis factor receptor superfamily member 11a NFKB activator), CRHR2 (corticotropin releasing hormone receptor 2), COPE (coatmer protein complex subunit epsilon), CYP4F2 (cytochrome P450 family) 4 subfamily F polypeptide 2), APOB (apolipoprotein B (including Ag (x) antigen)), GFRA1 (GDNF family receptor alpha 1), HMBS (hydroxymethylbilan synthase) , F5 (coagulation factor V (proacrelin labile factor)), TPO (thyroid peroxidase), AMPH (amphiphysin), PTGER2 (prostaglandin E receptor 2 (subtype EP2) 53 kDa), PKLR (pyruvate kinase) Liver and RBC), SMPD1 (sphingomyelin phosphodiesterase monoacid lysosome), PLA2G4A (phospholipase A2 group IVA (cytosolic calcium dependent)), JUNB (jun B proto-oncogene), GSN (gelsolin), PLCE1 (phospholipase C epsilon) 1) PSMB8 (proteasome (prosome macropain) subunit beta type 8 (large multifunctional peptidase 7)), CYCS (cytochrome c somatic cell type), KCNK1 (potassium channel subfamily) Lee K member 1), PGF (placental growth factor), IL10RA (interleukin 10 receptor alpha), CHRM1 (cholinergic receptor muscarinic 1), IL12RB1 (interleukin 12 receptor beta 1), CHGA (chromogranin A ( Parathyroid secreted protein 1)), GABRE (gamma-aminobutyric acid (GABA) A receptor epsilon), GJA4 (gap junction protein alpha 4 37 kDa), ALAD (aminolevulinate delta-dehydratase), GLRA2 (glycine receptor alpha 2) ITPR2 (Inositol 1 (4 (5-triphosphate receptor type 2), MPZ (Myelin protein zero), AQP1 (Aquaporin 1 (Colton blood group)), MYBPC3 (Myosin binding protein C heart), CPT2 (Karnichi) Npalmitoyltransferase 2), STAR (steroid-producing acute regulatory protein), GLB1 (galactosidase beta 1), SCN8A (sodium channel voltage-gated type VIII alpha subunit), LGALS1 (lectigalactoside-binding soluble 1), PCSK1 (proprotein) Convertase subtilisin / kexin type 1), IKBKAP (Kappa light polypeptide gene enhancer inhibitor complex complex protein in B cells), REST (RE1-silencing transcription factor), OXTR (oxytocin receptor), UGT2B7 (UDP glucuronosyltransferase 2 family polypeptide B7), LTF (lactotransferrin), TYRP1 (tyrosinase-related protein 1), RB 1 (retinoblastoma-like 1 (p107)), TCAP (titin-cap (teletonin)), KCNJ1 (potassium inward rectifier channel subfamily J member 1), KCNN3 (potassium intermediate / small conductance calcium activation channel) Subfamily N member 3), PSMC1 (proteasome (prosome macropain) 26S subunit ATPase1), RELN (Reelin), MYH14 (myosin heavy chain 14 nonmuscle), ADCY4 (adenylate cyclase 4), MMP10 (matrix metallo Peptidase 10 (stromelysin 2)), FXN (frataxin), ATF4 (activated transcription factor 4 (tax responsive enhancer element B67)), NOG (noggin), PPOX (protoporphyrinogen oxidase) TNNC1 (troponin C1 type (slow)), HRH2 (histamine receptor H2), PLA2G4C (phospholipase A2 group I VC (cytosolic calcium independent)), NR3C2 (nuclear receptor subfamily 3 group C member 2), AMPD1 (Adenosine monophosphate deaminase 1), FKBP4 (FK506 binding protein 4 59 kDa), MBD2 (methyl-CpG binding domain protein 2), NRG1 (neuregulin 1), MBL2 (mannose binding lectin (protein C) 2 soluble (opsonin defect) )), AGA (aspartyl glucosaminidase), SP1 (Sp1 transcription factor), SCN3A (sodium channel voltage-gated III alpha subunit), FABP2 (fatty acid binding protein 2 intestine), PABPC1 (poly (A ) Binding protein cytoplasm 1), ACCN2 (amylolide sensitive cation channel 2 neural type), ACTC1 (actin alpha myocardium 1), ACP5 (acid phosphatase 5 tartrate resistant), EIF4B (eukaryotic translation initiation factor 4B), EIF4EBP2 (true Nuclear cell translation initiation factor 4E binding protein 2), EIF4A1 (eukaryotic cell translation initiation factor 4A1), CAMK4 (calcium / calmodulin-dependent protein kinase IV), CACNB3 (calcium channel voltage-dependent beta 3 subunit), CAV3 (caveolin) 3), CA6 (carbonic anhydrase VI), ALOX12B (arachidonic acid 12-lipoxygenase 12R type), CCL17 (chemokine (CC motif) ligand 17), CCL22 (chemokine (CC motif) ligand 22), MMP20 (matrix metallopeptidase 20), GAP43 (growth binding protein 43), ALOX5AP (arachidonic acid 5-lipoxygenase activating protein), ANTXR2 (anthrax toxin receptor 2), HGD (homogentisic acid 1 (2-di-acid) Oxygenase), SELE (selectin E), MYLK2 (myosin light chain kinase 2), VEGFA (vascular endothelial growth factor A), PRX (periaxin), IL10RB (interleukin 10 receptor beta), HAS1 (hyaluronan synthase 1), GTF2IRD1 (Containing GTF2I repeat domain 1), IL16 (interleukin 16 (lymphocyte chemoattractant)), GRIP1 (glutamate receptor interacting protein 1), PHKA1 (phosphorylase kinase protein) Pha 1 (muscle)), FOXP3 (forkhead box P3), SFTPC (surfactant protein C), PDIA3 (protein disulfide isomerase family A member 3), SRM (spermidine synthase), MARCKS (myristoylated alanine rich protein kinase C substrate) , RAPGEF3 (Rap guanine nucleotide exchanger (GEF) 3), RAGE (kidney tumor antigen), MRC1 (mannose receptor C1 type), SPINK1 (serine peptidase inhibitor casal type 1), CYP4F3 (cytochrome P450 family 4 subfamily F) Polypeptide 3), LPIN1 (Ripin 1), TREX1 (Three prime repair exonucleases 1), CYSLTR2 (Cysteinyl leukotriene receptor) 2), PTX3 (3 pentraxin length), PTGES2 (prostaglandin E synthase 2), ASAH1 (N-acyl sphingosine amide hydrolase (acid ceramidase) 1), H2AFZ (H2A histone family member Z), HFE (hemopigmentation) , PYGB (phosphorylase glycogen, brain), NR2F6 (nuclear receptor subfamily 2 F group member 6), CYP3A7 (cytochrome P450 family 3 subfamily A polypeptide 7), RAB6A (RAB6A member RAS oncogene family), F2RL3 (coagulation) Factor II (thrombin) receptor-like 3), RGS4 (regulator 4 of G-protein signaling), SCNN1D (sodium channel non-potential open type 1 delta), SCN1B (sodium thiol) Channel potential open type I beta), SCN2A (sodium channel potential open type II alpha subunit), CALCRL (calcitonin receptor-like), CALB1 (calbindin 1 28 kDa), CACNG2 (calcium channel potential dependent gamma subunit 2), TACR2 (Tachykinin receptor 2), GPC3 (glypican 3), GALNT3 (UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)), CXCL10 (chemokine (C- XC motif) ligand 10), ANKH (progressive rigor homolog (mouse)), PRKD1 (protein kinase D1), KCNN4 (potassium intermediate / small conductance calcium activation channel sub Family N member 4), TGM1 (transglutaminase 1 (K polypeptide epithelial type I protein-glutamine-gamma-glutamyltransferase)), SLC26A2 (solute carrier family 26 (sulfate transporter) member 2), MTNR1A (melatonin receptor 1A) ), MIPEP (mitochondrial intermediate peptidase), SI (sucrase-isomaltase (alpha-glucosidase)), RHAG (Rh-related glycoprotein), SLC12A3 (solute carrier family 12 (sodium / chloride transporter) member 3), RNASE1 ( Ribonuclease RNase A family 1 (pancreas)), ELANE (elastase neutrophil expression), GPC6 (glypican 6), ENPP2 (ectonucleotide pyrophosphatase / phosphodi) Esterase 2), SCN3B (sodium channel voltage-gated III beta), CALB2 (calbindin 2), CTSA (cathepsin A), EIF2AK1 (eukaryotic translation initiation factor 2-alpha kinase 1), TMSB4X (thymosin beta 4 X-linked), LPO (Lactoperoxidase), NDN (Nexin homologue (mouse)), PICK1 (Protein interaction with PRKCA 1), PLCD4 (Phospholipase Cdelta4), CLDN3 (Claudin3), HCN1 (Hyperpolarization activated cyclic nucleotide) -Opened potassium channel 1), MATN3 (Matrilin 3), COL9A3 (Collagen IX type alpha 3), BTG1 (B cell translocation gene 1 antiproliferative), LCN1 (Lipocalin 1 (tear prealbumin)), FDX1 (Fered) Xin 1), UTRN (utrophin), FMOD (fibrojuline), PDE4A (phosphodiesterase 4A cAMP specific (phosphodiesterase E2 dance homologue Drosophila)), RRBP1 (ribosome-binding protein)
Protein 1 homolog 180 kDa (dog)), MLYCD (malonyl-CoA decarboxylase), ANXA3 (annexin A3), PRKD3 (protein kinase D3), GHRL (ghrelin / obstatin prepropeptide), GDF15 (growth differentiation factor 15) , BCL11A (B cell CLL / lymphoma 11A (zinc finger protein)), CSRP3 (cysteine and glycine rich protein 3 (heart LIM protein)), CXCL2 (chemokine (CXC motif) ligand 2), TOMM40 (extramitochondrial) Membrane translocase 40 homolog (yeast)), KCNK6 (potassium channel subfamily K member 6), KCNN2 (potassium intermediate / small conductance calcium activated channel subfamily) N member 2), SLC6A12 (solute carrier family 6 (neurotransmitter transporter betaine / GABA) member 12), ALOXE3 (arachidonic acid lipoxygenase 3), SOST (sclerosis ossification), PRLHR (prolactin releasing hormone receptor) TIMM44 (internal mitochondrial membrane 44 translocase homolog (yeast)), KCNN1 (potassium intermediate / small conductance calcium activation channel subfamily N member 1), CHRNA9 (cholinergic receptor nicotinic alpha 9), GPC5 ( Glypican 5), GPR37 (G protein-coupled receptor 37 (endothelin receptor type B-like)), NKX2-1 (NK2 homeobox 1), HMMR (hyaluronan-mediated motility receptor (RHAMM)), PKHD1 (polycyst) Sex kidney And liver disease 1 (autosomal recessive)), AOC2 (copper-containing amine oxidase 2 (retinal specific)), KRT20 (keratin 20), CORIN (choline serine peptidase), AZU1 (azurocidin 1), MAPK6 (mitogen-activated protein) Kinase 6), PAEP (progesterone-related endometrial protein), CACNA2D4 (calcium channel voltage-dependent alpha 2 / delta subunit 4), EIF3A (eukaryotic translation initiation factor 3 subunit A), BTG2 (BTG) Family member 2), P2RY14 (purinergic receptor P2Y G-protein binding 14), PDLIM7 (PDZ and LIM domain 7 (Enigma)), CACNA2D3 (calcium channel voltage-dependent alpha2 / delta subunit) ), LAMP3 (lysosome-related membrane protein 3), PLCL2 (phospholipase C-like 2), NOSIP (nitrogen monoxide synthase interacting protein), CRHBP (corticotropin-releasing hormone binding protein), KLK5 (kallikrein-related peptidase 5), ADAM2 (ADAM metallopeptidase domain 2), SIRPA (signal-regulating protein alpha), PMPCB (peptidase (mitochondrial processing) beta), GPC4 (glypican 4), MYH6 (myosin heavy chain 6 cardiac muscle alpha), CXCL9 (chemokine (C- XC motif) ligand 9), KCNK5 (potassium channel subfamily K member 5), KCNK10 (potassium channel subfamily K member 10), NMU (nu Lomedin U), SCN4B (sodium channel voltage-gated IV beta), CAMK1D (calcium / calmodulin-dependent protein kinase ID), COL8A2 (collagen VIII type alpha 2), RAB11FIP1 (RAB11 family interacting protein 1 (class I)), NDOR1 (NADPH-dependent diflavin oxidoreductase 1), ZNF318 (zinc finger protein 318), P2RX2 (purinergic receptor P2X ligand-gated ion channel 2), UGT1A6 (UDP glucuronosyltransferase 1 family polypeptide A6), LEMD3 (LEM domain containing 3), UGT1A1 (UDP glucuronosyltransferase 1 family polypeptide A1), PDLIM3 (P DZ and LIM domains 3), KCTD12 (containing potassium channel tetramerization domain 12), KCNK9 (potassium channel subfamily K member 9), DSE (dermatan sulfate epimerase), DSPP (dentin sialophosphate protein), KCNT2 (potassium) Channel subfamily T member 2), NMUR2 (neuromedin U receptor 2), CHST6 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6), CCL28 (chemokine (CC motif) ligand 28), SLPI (secretion) Leukocyte peptidase inhibitor), CCL1 (chemokine (CC motif) ligand 1), KCNK15 (potassium channel subfamily K member 15), KCTD15 (potassium channel tetramerization domain) 15), ANKRD1 (ankyrin repeat domain 1 (myocardial)), sigma R1 (sigma non-opioid intracellular receptor 1), SLCO2A1 (solute carrier organic anion transporter family member 2A1), MUC16 (mucin 16 cell surface binding) , CNTNAP1 (contactin-binding protein 1), LGR6 (leucine-rich repeat-containing G protein-coupled receptor 6), ASPN (asporin), PLCH2 (phospholipase C eta 2), PLCL1 (phospholipase C-like 1), and AGFG1 (FG repeat) ArfGAP 1), HOXB8 (homeobox B8), KCNK12 (potassium channel subfamily K member 12), KCNK4 (potassium channel subfamily K member 4), KCNRG (potassium channel) Regulator), KCTD13 (containing potassium channel tetramerization domain 13), KCNT1 (potassium channel subfamily T member 1), RNF19A (ring finger protein 19A), CIAPIN1 (cytokine-induced apoptosis inhibitor 1), TNS3 (tensin 3 ), AMELX (amelogenin X-linked), CRBN (cereblon), MLN (motilin), CXCR1 (chemokine (C-X-C motif) receptor 1), NPBWR2 (neuropeptide B / W receptor 2), KCMF1 (potassium) Channel regulatory factor 1), KCNK7 (potassium channel subfamily K member 7), KCNV1 (potassium channel subfamily V member 1), KCTD5 (containing potassium channel tetramerization domain 5), KCN 2 (potassium channel subfamily V member 2), KCNK13 (potassium channel subfamily K member 13), ERAP2 (endoplasmic reticulum aminopeptidase 2), KCTD2 (containing potassium channel tetramerization domain 2), KCTD3 (potassium channel tetramer) 3), KCNK17 (potassium channel subfamily K member 17), KCTD10 (containing potassium channel tetramerization domain 10), KCTD7 (containing potassium channel tetramerization domain 7), SCT (secretin), NGDN (Neurogaidin EIF4E binding protein), MLNR (motilin receptor), MPZL2 (myelin protein zero-like 2), PROL1 (proline-rich lacrimal gland 1), KCNK16 (potassium channel subfamily K Member 16), KCTD9 (containing potassium channel tetramerization domain 9), KCTD11 (containing potassium channel tetramerization domain 11), KCTD8 (containing potassium channel tetramerization domain 8), KCTD4 (potassium channel tetramerization) Domain containing 4), KCTD6 (containing potassium channel tetramerization domain 6), KCTD1 (containing potassium channel tetramerization domain 1), NPVF (neuropeptide VF precursor), MAGIX (MAGI family member X-linked), MRGPRX4 (MAS-related GPR member X4), MRGPRD (MAS-related GPR member D), TET2 (tet oncogene family member 2), KCTD14 (containing potassium channel tetramerization domain 14), GLYATL1 (glycine-N-acylto) Sulferase-like 1), ZNF493 (zinc finger protein 493), ZNF429 (zinc finger protein 429), MRGPRE (MAS-related GPR member E), sun (SUN) 2 (Sad1 and UNC84 domain-containing 2), AMTN (amelrotin), MRGPRF (MAS-related GPR member F), CDK20 (cyclin-dependent kinase 20), KCNU1 (potassium channel subfamily U member 1), GATS (GATS stromal antigen 3 reverse strand), GLRA4 (glycine receptor alpha 4), IGHE (Immunoglobulin heavy stationary epsilon), DRGX (dorsal root ganglion homeobox), MRGPRG (MAS-related GPR member G), LOC729997 (hypothesis LOC729997), MT-TK (Mito TRNA lysine encoded by Ndria), LOC400680 (AK097381, hypothesis gene supported by BC040866), COP (clathrin ordered protein), IGES (immunoglobulin E concentrated serum), MGS (Mungen syndrome), TRNAS -AGA (transport RNA serine (anticodon AGA)), and LOC100132258 (similar to secretory carrier membrane protein 2).

Non-limiting examples of taste-related genes include TAS2R38 (taste receptor, type 2, member 38), TAS1R1 (taste receptor, type 1, member 1), TAS2R3 (taste receptor, type 2, member 3), TAS2R5 (taste receptor, type 2, member 5), TAS2R1 (taste receptor, type 2, member 1), TAS2R16 (taste receptor, type 2, member 16), TAS2R4 (taste receptor, type 2, member 4) ), TAS2R14 (taste receptor, type 2, member 14), TAS2R10 (taste receptor, type 2, member 10), TAS2R7 (taste receptor, type 2, member 7), TAS2R13 (taste receptor, type 2, Member 13), TAS2R9 (taste receptor, type 2, member 9), TAS2R8 (taste receptor, type 2, member 8), TAS1R3 Taste receptor, type 1, member 3), TAS2R31 (taste receptor, type 2, member 31), TAS1R2 (taste receptor, type 1, member 2), TAS2R43 (taste receptor, type 2, member 43), TAS2R50 (taste receptor, type 2, member 50), TAS2R46 (taste receptor, type 2, member 46), TAS2R30 (taste receptor, type 2, member 30), TAS2R42 (taste receptor, type 2, member 42) ), PLCB2 (phospholipase C, beta 2), TAS2R20 (taste receptor, type 2, member 20), TAS2R19 (taste receptor, type 2, member 19), GNG13 ((guanine nucleotide binding protein (G protein)), Gamma 13), TAS2R12 (taste receptor, type 2, member 12 pseudogene), GN T1 (guanine nucleotide-binding protein (G protein), alpha-transmitting active polypeptide 1), TAS2R41 (taste receptor, type 2, member 41), TAS2R60 (taste receptor, type 2, member 60), TAS2R40 (taste receptor) Type 2, member 40), TAS2R39 (taste receptor, type 2, member 39), GCG (glucagon), TAS2R18 (taste receptor, type 2, member 18 pseudogene), GRM4 (glutamate receptor, metabotropic) 4), LCN1 (lipocalin 1 (tear prealbumin)), TRPV1 (transient receptor potential cation channel, subfamily V, member 1), ACCN1 (amylolide-sensitive cation channel 1, neural type), TAS2R45 (taste) Receptor, type 2, member 45), TAS2R15 ( Taste receptor, type 2, member 15 pseudogene), FOS (mouse osteosarcoma virus oncogene homolog), SLC9A1 (solute carrier family 9 (sodium / hydrogen exchanger), member 1), INS (insulin), ACCN5 ( Amiloride-sensitive cation channel 5, intestine), TAS2R2 (taste receptor, type 2, member 2 pseudogene), GRM7 (glutamate receptor, metabotropic 7), NPY (neuropeptide Y), LEP (leptin), CASR (Calcium-sensing receptor), GNAZ (guanine nucleotide binding protein (G protein), alpha z polypeptide), CIB1 (calcium and integrin binding 1 (carmyrin)), ADCY10 (adenylate cyclase 10 (soluble)), LEPR (Leptin receptor), DRD1 Pamine receptor D1), LGR6 (leucine rich repeat-containing G protein coupled receptor 6), GRM8 (glutamate receptor, metabotropic 8), GRM6 (glutamate receptor, metabotropic 6), GLP1R (glucagon-like peptide 1) Receptor), AGER (final glycation product specific receptor), SLC2A2 (solute carrier family 2 (promoted glucose transporter), member 2), GIP (gastric inhibitory polypeptide), REN (rennin), PDYN ( Prodynorphin), RRBP1 (ribosome binding protein 1 homolog 180 kDa (dog)), SLC15A1 (solute carrier family 15 (oligopeptide transporter), member 1), OXT (oxytocin, prepropeptide), IL4I1 (interleukin 4 induction) 1), VN1R17P ( Nasal 1 receptor 17 pseudogene), TAS2R62P (taste receptor, type 2, member 62, pseudogene), TAS2R64P (taste receptor, type 2, member 64 pseudogene), TAS2R63P (taste receptor, type 2, member) 63 pseudogene), PS5 (bitter taste receptor pseudogene PS5), PS3 (bitter taste receptor PS3), PS7 (bitter taste receptor Ps7 pseudogene), C6orf15 (chromosome 6 open reading frame 15), TAS2R6 (taste receptor, 2 Type, member 6), TAS2R22 (taste receptor, type 2, member 22), TAS2R33 (taste receptor, type 2, member 33), TAS2R37 (taste receptor, type 2, member 37), TAS2R36 (taste receptor) Type 2, member 36), GNAT3 (guanine nucleotide binding protein, al Pha transmission 3), TRPM5 (transient receptor potential cation channel, subfamily M, member 5), TRPM7 (transient receptor potential cation channel, subfamily M, member 7), GNB1 (guanine nucleotide binding) Protein (G protein), beta polypeptide 1), ITPR3 (inositol 1,4,5-triphosphate receptor, type 3), ACE (angiotensin I converting enzyme (peptidyl-dipeptidase A) 1), ENO2 (enolase) 2 (gamma, neural type)), CALCA (calcitonin-related polypeptide alpha), CCK (cholecystokinin), RTP3 (receptor (chemosensitive) transporter protein 3), PL-5283 (PL-5283 protein), PRKCG (Protein kinase C, gamma), KCNQ1 (ca Um voltage-gated channel, KQT-like subfamily, member 1), BDNF (brain-derived neurotrophic factor), SCNN1A (sodium channel, non-voltage-gated type 1 alpha), GNB3 (guanine nucleotide binding protein (G protein), beta Polypeptide 3), SCNN1B (sodium channel, non-potential opening type 1, beta), SCNN1G (sodium channel, non-potential opening type 1, gamma), GNB4 (guanine nucleotide binding protein (G protein), beta polypeptide 4), PDE1A (phosphodiesterase 1A, calmodulin dependent), DMBT1 (deleted in malignant brain tumor 1), PDE3B (phosphodiesterase 3B, cGMP inhibitory), PDE1C (phosphodiesterase 1C, calmodulin dependent) 0 kDa), PRKCA (protein kinase C, alpha), NTRK3 (neurotrophic tyrosine kinase, receptor, type 3), NTRK2 (neurotrophic tyrosine kinase, receptor, type 2), PRKCQ (protein kinase C, theta) , PRKACA (protein kinase, cAMP dependent, catalyst, alpha), CCKBR (cholecystokinin B receptor), PRKCZ (protein kinase C, zeta), TH (tyrosine hydroxylase), NGFR (nerve growth factor receptor (TNFR) Superfamily, member 16)), DRD2 (dopamine receptor D2), NOS1 (nitric oxide synthase 1 (neural type)), PRKCE (protein kinase C, epsilon), PRKCH (protein kinase C, eta), PRKCD (tamper) Protein kinase C, delta), ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), MAPK1 (mitogen activated protein kinase 1), PLCB3 (phospholipase C, beta3 (phosphatidylinositol specific) ), ADCY8 (adenylate cyclase 8 (brain)), ADRBK2 (adrenergic, beta, receptor kinase 2), PRKACB (protein kinase, cAMP-dependent, catalyst, beta), PRKCI (protein kinase C, iota), CCKAR (cholecystokinin A receptor), KCNK3 (potassium channel, subfamily K, member 3), PLCB1 (phospholipase C, beta1 (phosphoinositide specific)), ADCY3 (adenylate cyclase 3), N F3 (neurotrophin 3), PLCB4 (phospholipase C, beta 4), GNB5 (guanine nucleotide binding protein (G protein), beta 5), GNAL (guanine nucleotide binding protein (G protein), alpha-activating active polypeptide, Olfactory type), GNB2 (guanine nucleotide binding protein (G protein), beta polypeptide 2), KCNK1 (potassium channel, subfamily K, member 1), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), CNGA3 ( Cyclic nucleotide-gated channel alpha 3), PRKCG (protein kinase, cAMP-dependent, catalyst, gamma), PRKCB (protein kinase C, beta), RBP4 (retinol binding protein) , Plasma), GRP (gastrin releasing peptide), PDE3A (phosphodiesterase 3A, cGMP inhibitory), KRT14 (keratin 14), SCNN1D (sodium channel, non-potential opening type 1, delta), PRKD1 (protein kinase D1), PDE1B ( Phosphodiesterase 1B, calmodulin-dependent), PDE2A (phosphodiesterase 2A, cGMP stimulatory), PRKD3 (protein kinase D3), SST (somatostatin), KCNK6 (potassium channel, subfamily K, member 6), KCNK2 (potassium channel, subfamily) K, member 2), NTF4 (neurotrophin 4), GNG3 (guanine nucleotide binding protein (G protein), gamma 3), RNH1 (ribonuclease) / Angiogenin inhibitor 1), KCNK5 (potassium channel, subfamily K, member 5), KCNK10 (potassium channel, subfamily K, member 10), P2RX2 (purinergic receptor P2X, ligand-gated ion channel, 2) , KCTD12 (potassium channel tetramerization domain containing 12), KCNK9 (potassium channel, subfamily K, member 9), KCNT2 (potassium channel, subfamily T, member 2), KCNK15 (potassium channel, subfamily K, member) 15), KCTD15 (containing potassium channel tetramerization domain 15), KCNK12 (potassium channel, subfamily K, member 12), KCNK4 (potassium channel, subfamily K, member 4), CNRG (potassium channel regulator), KCTD13 (potassium channel tetramerization domain containing 13), KCNT1 (potassium channel, subfamily T, member 1), KCMF1 (potassium channel regulatory factor 1), KCNK7 (potassium channel, subfamily) K, member 7), KCNV1 (potassium channel, subfamily V, member 1), KCTD5 (containing potassium channel tetramerization domain 5), KCNV2 (potassium channel, subfamily V, member 2), KCNK13 (potassium channel, Subfamily K, member 13), KCTD2 (containing potassium channel tetramerization domain 2), KCTD3 (containing potassium channel tetramerization domain 3), KCNK17 (potassium channel, subfamily) K, member 17), KCTD10 (containing potassium channel tetramerization domain 10), KCTD7 (containing potassium channel tetramerization domain 7), KCNK16 (potassium channel, subfamily K, member 16), KCTD9 (potassium channel four) Merization domain containing 9), KCTD11 (potassium channel tetramerization domain containing 11), KCTD8 (potassium channel tetramerization domain containing 8), KCTD4 (potassium channel tetramerization domain containing 4), KCTD6 (potassium) Channel tetramerization domain containing 6), KCTD1 (potassium channel tetramerization domain containing 1), KCTD14 (potassium channel tetramerization domain containing 14), RTP4 (receptor (chemically sensitive) transporter protein 4), KCNU1 (potassium channel, Subfamily U, member 1), LOC730036 (hypothesis LOC730036), RPS6KA3 (ribosomal protein 6 kinase, 90 kDa, polypeptide 3), MAPT (microtubule-associated protein tau), CHEK2 (CHK2 checkpoint homolog (min)
Fission yeast)), FYN (FYN oncogene associated with SRC, FGR, YES), APP (amyloid beta (A4) precursor protein), PTEN (phosphatase and tensin homolog), SOD1 (superoxide dismutase 1, soluble ), CSTB (cystatin B (stephin B)), SHH (sonic hedgehog homolog (Drosophila)), AKR1B1 (Aldo-ketoreductase family 1, member B1 (aldose reductase)), COMT (catechol-O-methyltransferase) , S100B (S100 calcium binding protein B), PTK2B (PTK2B protein tyrosine kinase 2 beta), PLCG2 (phospholipase C, gamma 2 (phosphatidylinositol specific)), PSE 1 (presenilin 1), SLC6A3 (solute carrier family 6 (neurotransmitter transporter, dopamine), member 3), PAX6 (pairing box 6), MMP1 (matrix metallopeptidase 1 (interstitial collagenase)), CACNA1A ( Calcium channel, voltage-dependent, P / Q type, alpha 1A subunit), CASP9 (caspase 9, apoptosis-related cysteine peptidase), PRKAR1A (protein kinase, cAMP-dependent, regulatory, type I alpha (tissue-specific loss factor) 1)), MMP3 (matrix metallopeptidase 3 (stromelysin 1, progelatinase)), ADCY6 (adenylate cyclase 6), CASP3 (caspase 3, apoptosis-related cysteine peptidase), GNAS (GN S complex locus), MMP9 (matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)), Notch2 (Notch homolog 2 (Drosophila)), CREB1 (cAMP responsive element binding protein 1), SNCA (Synuclein, alpha (non-A4 component of amyloid precursor)), OPRM1 (opioid receptor, mu1), CALM1 (calmodulin 1 (phosphorylase kinase, delta)), PLCG1 (phospholipase C, gamma1), BRCA1 (breast cancer) 1, early onset), APOE (apolipoprotein E), DBH (dopamine beta-hydroxylase (dopamine beta-monooxygenase)), PTGS2 (prostaglandin-endoperoxide sinter) Ze2 (prostaglandin G / H synthase and cyclooxygenase)), ADRBK1 (adrenergic, beta, receptor kinase 1), ITGB4 (integrin, beta4), NLGN3 (neuroligin 3), CD36 (CD36 molecule (thrombosponge) Receptor)), EEF2 (eukaryotic translation elongation factor 2), OPRD1 (opioid receptor, delta 1), HSPG2 (heparan sulfate proteoglycan 2), GAD1 (glutamate decarboxylase 1 (brain, 67 kDa)), ANXA1 ( Annexin A1), PRKAR2A (protein kinase, cAMP-dependent, regulatory, type II alpha), HHEX (hematopoietic expression homeobox), GRM1 (glutamate receptor, metabotropic 1), NPR1 (natriuretic peptide receptor) Body A / guanylate cyclase A (atrial natriuretic), peptide receptor A), SYP (synaptophysin), CALM3 (calmodulin 3 (phosphorylase kinase, delta)), PRKAR2B (protein kinase, cAMP-dependent, regulatory, type II Beta), ADCY2 (adenylate cyclase 2 (brain)), SLC1A3 (solute carrier family 1 (glial cell high affinity glutamate transporter), member 3), GABBR1 (gamma-aminobutyric acid (GABA) B receptor, 1 ), PTPRS (protein tyrosine phosphatase, receptor type, S), KNG1 (kininogen 1), DDC (dopa decarboxylase (aromatic L-amino acid decarboxylase)), GNAQ (guanine nucleotide binding protein (G protein)) q polypeptide), E2F4 (E2F transcription factor 4, p107 / p130 binding), DRD4 (dopamine receptor D4), MAOA (monoamine oxidase A), CALM2 (calmodulin 2 (phosphorylase kinase, delta)), CHRNB2 (cholinergic receptor) Body, nicotinic, beta 2 (neural type)), GRK5 (G protein-coupled receptor kinase 5), PRLR (prolactin receptor), ID2 (DNA binding inhibitor 2, dominant inhibitory helix-loop-helix protein), TPH1 (tryptophan hydroxylase 1), PLCD1 (phospholipase C, delta 1), GNA11 (guanine nucleotide-binding protein (G protein), alpha 11 (Gq class)), GNA12 (guanine nucleotide-binding protein ( G protein) alpha 12), CRH (corticotropin releasing hormone), GNRH1 (gonadotropin releasing hormone 1 (luteinizing releasing hormone)), S100A8 (S100 calcium binding protein A8), CYCS (cytochrome c, somatic cell type) ), KCNB1 (potassium voltage-gated channel, Shab-related subfamily, member 1), DST (dystonin), ADCY1 (adenylate cyclase 1 (brain)), CHGA (chromogranin A (parathyroid secreted protein 1)) ), HTR3A (5-hydroxytryptamine (serotonin) receptor 3A), GAL (galanine prepropeptide), TACR3 (tachykinin receptor 3), ALDH7A1 (aldehyde dehydrogenase 7 family, member A1), PRK R1B (protein kinase, cAMP-dependent, regulatory, type I beta), AQP5 (aquaporin 5), AQP2 (aquaporin 2 (collecting tube)), AQP1 (aquaporin 1 (Colton blood group)), GLI3 (GLI family zinc finger) 3), POU2F1 (POU class 2 homeobox 1), OTX2 (orthodentic homeobox 2), TTR (transthyretin), CACNA1B (calcium channel, voltage-dependent, N-type, alpha 1B subunit), IKBKAP ( Inhibitor of kappa light polypeptide gene enhancer in B cells, kinase complex-related protein), RHO (rhodopsin), UGT2B7 (UDP glucuronosyltransferase 2 family, polypeptide B7), LCT (Lactor) ), TCOF1 (Tricher Collins-Franchesketti syndrome 1), KCNJ1 (potassium inward rectifier channel, subfamily J, member 1), VIP (vasoactive intestinal peptide), AQP3 (aquaporin 3 (Gill blood) Type)), TAC1 (tachykinin, precursor 1), ADCY4 (adenylate cyclase 4), HP (haptoglobin), ALDH4A1 (aldehyde dehydrogenase 4 family, member A1), GDI1 (GDP dissociation inhibitor 1), SOX2 (SRY (Sex determination region Y) box 2), NOG (noggin), FST (follistatin), NDST1 (N-deacetylase / N-sulfotransferase (heparan glucosaminyl) 1), ABLIM1 (actin-binding LIM protein 1), NOS2 ( Monoacid Nitrogen synthase 2, inducible), EIF2B1 (eukaryotic cell translation initiation factor 2B, subunit 1 alpha, 26 kDa), CA6 (carbonic anhydrase VI), DKK1 (dickkopf homolog 1 (Xenopus laevis)) , SIX3 (SIX homeobox 3), SIX1 (SIX homeobox 1), HTT (huntingtin), AGRP (agouti-related protein homologue (mouse)), NCAM2 (nerve cell adhesion molecule 2), BBS4 (Bardy-Bedle syndrome) 4), GNA15 (guanine nucleotide binding protein (G protein), alpha 15 (Gq class)), GNA13 (guanine nucleotide binding protein (G protein), alpha 13), ASCL1 (acaete-scote complex homolog 1 (shojo) Flies)), MGLL (monoglyceride lipase), PLCD3 (phospholipase C, delta 3), CEBPB (CCAAT / enhancer binding protein (C / EBP), beta), BBS1 (Valday-Beidol syndrome 1), HES1 (split hair-like) And enhancer 1, (Drosophila)), GNG2 (guanine nucleotide binding protein (G protein), gamma 2), TPH2 (tryptophan hydroxylase 2), P2RX3 (purinergic receptor P2X, ligand-gated ion channel, 3), AQP7 (aquaporin 7), CNGB1 (cyclic nucleotide-gated channel beta 1), GABRR1 (gamma-aminobutyric acid (GABA) receptor, rho 1), GBX2 (gastroenteric brain homeobox 2), SLC6 1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1), PEBP1 (phosphatidylethanolamine-binding protein 1), KRT13 (keratin 13), NAV2 (neuron navigator 2), BBS2 (Bardy-Beedle syndrome 2) ), PLCD4 (phospholipase C, delta 4), CLDN8 (claudin 8), CLDN7 (claudin 7), CISH (cytokine-inducible SH2-containing protein), GNGT2 (guanine nucleotide-binding protein (G protein), gamma transfer activity poly Peptide 2), GNG4 (guanine nucleotide binding protein (G protein), gamma 4), GNA14 (guanine nucleotide binding protein (G protein), alpha 14), UCN (urocortin) PDE4A (phosphodiesterase 4A, cAMP specific (phosphodiesterase E2 dance homologue, Drosophila)), MKKS (Macksick-Kaufmann syndrome), GAST (gastrin), PRKX (protein kinase, X-linked), CHRD (coden), PRSS2 (protease, serine, 2 (trypsin 2)), KRT20 (keratin 20), CLDN6 (clodin 6), CLCN4 (chloride channel 4), DLX5 (distal-less homeobox 5), TRPA1 (transient receptor potential cation channel, subfamily A, member 1), TRPM8 (transient receptor potential cation channel, subfamily M, member 8), PLCZ1 (phospholipase C, zeta 1) SLC5A2 (solute carrier family 5 (sodium / glucose symporter), member 2), GDF11 (growth differentiation factor 11), BLVRB (biliverdin reductase B (flavin reductase (NADPH))), SCN7A (sodium channel, voltage-gated type) , Type VII, alpha), PANX1 (p annexin 1), IFI35 (interferon-inducible protein 35), NRAP (nebulin related anchoring protein), HES5 (split hair-like and enhancer 5 (Drosophila)), GSC (goosecoid) Homeobox), REEP1 (receptor accessory protein 1), CCL28 (chemokine (CC motif) ligand 28), GJB4 (gap junction protein, beta 4, 30.3 kDa), 3GNT2 (UDP-GlcNAc: beta Galbeta-1,3-N-acetylglucosaminyltransferase 2), CNGA2 (cyclic nucleotide-open channel alpha 2), ZNF423 (zinc finger protein 423), HESX1 (HESX homeobox 1) CNGA4 (cyclic nucleotide-gated channel alpha 4), GPR158 (G protein-coupled receptor 158), MAGE2 (MAGE-like 2), UBR3 (ubiquitin protein ligase E3 component n-recognition 3 (presumed)), NPTXR (neural type) Pentraxin receptor), SLC24A6 (solute carrier family 24 (sodium / potassium / calcium exchanger), member 6), GPRC6A (G protein-coupled receptor, family C, group 6, members ), SLC24A3 (solute carrier family 24 (sodium / potassium / calcium exchanger), member 3), BEST2 (bestrophin 2), OR8D2 (olfactory receptor, family 8, subfamily D, member 2), OR5P2 (olfactory receptor) Body, family 5,
Subfamily P, member 2), FOXG1 (fork head box G1), OR8B8 (olfactory receptor, family 8, subfamily B, member 8), OR8D1 (olfactory receptor, family 8, subfamily D, member 1), OR10A5 (olfactory receptor, family 10, subfamily A, member 5), OMP (olfactory marker protein), TFAP2E (transcription factor AP-2 epsilon (activation enhancer binding protein 2, epsilon)), OR5P3 (olfactory receptor, family 5, subfamily P, member 3), OR10A4 (olfactory receptor, family 10, subfamily A, member 4), DMRTA1 (DMRT-like family A1), TMEM147 (transmembrane protein 147), OR8A1 (olfactory receptor, Amily 8, subfamily A, member 1), EBF2 (early B cell factor 2), PKD1L3 (polycystic kidney disease 1-like 3), GPR179 (G protein-coupled receptor 179), RTP1 (receptor (chemical sensitivity)) Transporter protein 1), KLHL35 (kelch-like 35 (Drosophila)), RGS21 (G-protein signaling regulator 21), RTP2 (receptor (chemically sensitive) transporter protein 2), ACSM4 (in acyl-CoA synthetase- Chain family member 4), GUCY2E (guanylate cyclase 2E), CYP2G1P (cytochrome P450, family 2, subfamily G, polypeptide 1 pseudogene), OR7E35P (olfactory receptor, family 7, subfamily E, member 35 pseudogene) ) And NUDT16P1 (Nudikkusu (Nudix) (nucleoside diphosphate binding moiety X motif 16, pseudogene 1).

  Exemplary sensory related chromosomal sequences include TRPM7 (transient receptor potential cation channel, subfamily M, member 7), TRPM5 (transient receptor potential cation channel, subfamily M, member 5), TRPC5 (Transient receptor potential cation channel subfamily C member 5), TRPC6 (transient receptor potential cation channel subfamily C member 6), TRPC1 (transient receptor potential cation channel subfamily C member 5) 1), CNR1 (cannabinoid receptor 1 (brain)), CNR2 (cannabinoid receptor 2 (macrophage)), ADRBK1 (adrenergic beta receptor kinase 1), TRPA1 (transient receptor potential cation channel subfamily A Member 1), POMC (Pro-opiomelanocortin) , CALCA (CGRP, calcitonin related polypeptide alpha), CRF (CRH, corticotropin releasing factor), PKA such as PRKACA (protein kinase cAMP-dependent catalytic alpha), PRKACB (protein kinase cAMP-dependent catalytic beta), PRKAR1A (protein kinase) cAMP-dependent regulatory type I alpha (tissue-specific loss factor 1)), and PRKAR2A (protein kinase cAMP-dependent regulatory type II alpha), ERAL1 (Era G-protein-like 1 (E. coli)), NR2B (GRIN2B, Glutamate receptor counterionic N-methyl D-aspartate 2B), LGALS1 (lectigalactoside-binding soluble 1), TRPV1 (transient receptor potential cation channel subfamily V member -1), SCN9A (sodium channel voltage-gated IX alpha subunit), OPRD1 (opioid receptor delta 1), OPRK1 (opioid receptor kappa 1), and OPRM1 (opioid receptor mu 1).

  In certain embodiments, animals created by the methods of the invention can be used to study the effects of mutations on animals and sensory disorders.

  A further aspect of the present disclosure encompasses a method for assessing the indication of sensory impairment in an animal model, wherein the animal model is genetically modified comprising at least one edited chromosomal sequence encoding a sensory associated protein. Including animals. The method includes comparing selected parameters obtained from an animal model with selected parameters obtained from a wild type animal. Non-limiting examples of selected parameters used to assess at least one indication of sensory impairment include: a) spontaneous behavior, b) performance during behavioral testing, c) physiological variants, d) tissue Or abnormalities in cells, e) biochemical function, f) molecular structure, and combinations thereof.

  Sensory disorders assessed by this method may include any one or more of the nociceptive and taste disorders associated with the genes described above. Non-limiting examples of nociceptive disorders include: allodynia; neuralgia; hereditary sensory radical neuropathy, ulcer-limb amputation neuropathy, Tevenard syndrome, familial trophic neuropathy, mal perforant du pied, HSAN-1 such as familial syringomyelia and Charcot-Marie-Tooth type 2B syndrome; HSAN-2 such as congenital sensory neuropathy or Morvan disease; familial autonomic ataxia (FD) or Riley-Day syndrome HSAN-3; HSAN-4 such as congenital painless anhidrosis (CIPA); and HSAN-5 such as congenital indolent partial anhidrosis. Non-limiting examples of taste disorders include abnormal taste, decreased taste, and loss of taste.

Sensory impairment indications can occur spontaneously in animal models or exposure to exogenous drugs including, but not limited to, nociceptive stimuli, taste stimuli, sensory related proteins, sensory related agonists, and sensory related antagonists Can be promoted by.

C. ABC transporter

  ABC transporter proteins are a large and important superfamily of membrane transport proteins ubiquitous in the animal kingdom. These transmembrane proteins hydrolyze ATP and use its energy to activate a variety of other functions, including the movement of molecules across the intracellular and extracellular membranes, often against concentration gradients. (For review, see Higgins, C.F., ABC transporters: from microorganisms to man, Annu. Rev. Cell Biol. 8 67-113 (1992), M. Dean, Human ABC Transporter SuperN). See Center for Biotechnology Information (US) (available online at November 18, 2002, www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mono_001).

  In one embodiment, the methods of the invention can be used to create animals or cells in which at least one chromosomal sequence associated with ABC transporters has been edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  The ABC transporter chromosomal sequence can encode an ABC transporter protein or can be an ABC transporter control sequence. The ABC transporter sequence can typically be selected based on experimental association of the ABC transporter sequence with an animal disease or condition, particularly a mammalian (eg, human) disease or condition. For example, ABC transporter protein expression in a particular tissue may be enhanced or suppressed in a population having an ABC transporter-related disease or condition compared to a population lacking the disease or condition. Protein level differences can be assessed using proteomic or genomic analysis techniques known in the art.

  Non-limiting examples of human ABC transporter genes include: ABCA1 (ABC1), ABCA2 (ABC2), ABCA3 (ABC3), ABCC, ABCA4 (ABCR), ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCA10, ABCA12, ABCA13, ABCB1 (PGY1, MDR), ABCB2 (TAP1), ABCB3 (TAP2), ABCB4 (PGY3), ABCB5, ABCB6 (MTABC), ABCB7ABC7 (ABC7ABC7ABC7) (MTABC2), ABCB11 (SPGP), ABCC1 (MRP1), ABCC2 (MRP2), ABCC3 (MRP3), ABCC4 (MRP4), ABCC5 (MRP5), ABCC6 ( RP6), CFTR (ABCC7), ABCC8 (SUR), ABCC9 (SUR2), ABCC10 (MRP7), ABCC11 (ABCC12), ABCD1 (ALD), ABCD2 (ALDL1, ALDR), ABCD3 (PXMP1, PMP70), 69 , P70R), ABCE1 (OABP, RNS4I), ABCF1 (ABC50), ABCF2 (ABCF3), ABCG1 (ABC8, White), ABCG2 (ABCP, MXR, BCRP), ABCG4 (White5), B

  Non-limiting examples of mouse ABC transporter genes include Abca1, Abca2, Abca3, Abca4, Abca5, Abca6, Abca7, Abca8a, Abca8b, Abca9, Abca12, Abca13, Abca13, Abca13, Abc13, Abc13, Abc13, Abc13 , Abcb4, Abcb5, Abcb6, Abcb7, Abcb8, Abcb9, Abcb10, Abcb11, Abcc1, Abcc2, Abcc3, Abcc4, Abcc5, Abcc6, Abcc7 (Cftr), Abcc8Ac, Accb4 Abce1, Abcf1, Abcf2, Abcf3, Abcg1, Abcg2, Abcg3, Abcg4, bcg5, and Abcg8, and the like.

  The Drosophila genome includes 56 ABC transporter genes with at least one representative of each of the known mammalian subfamilies. Non-limiting examples of the Drosophila ABC transporter gene include: G3156 (AAF45509, AE003417), CG2759 (w, AAF45826, AE003425), CG1703 (AAF48069, AE003486), CG1824 (AAF48177, AE003489), CG9291 (AAF48493, AE003500), CG8473 (AAF48511, AE003500), CG12703 (AE003513, AE003513), CG1819 (AAF50847, AE003569), CG1718 (AAF50837, AE003568, G3881A, E38508E, E38508E, E38508E, E38508A) AAF51548, AE003590), CG4822 (AAF51551, AE003590), CG17646 (AAF51341, AE003585), CG9892 (AAF51223, AE003582), CG9664 (AAF51131, AE003580A, AF3130A, AE00358A , AAF51027, AE003576), CG11147 (AAF52284, AE003611), CG7806 (AAF52639, AE003620), CG7627 (AAF52648, AE003620), CG5853 (AAF52835, AE003626), CG5772 (Sur, AAF52866A, 003627), CG6214 (AAF53223, AE003637), CG7481 (AAF53328, AE003641), CG17338 (AAF53736, AE003661), CG10441 (AAF53737, AE003661), CG9270 (AAF53950, AE003668), CG8794 (A38538, G38799) AE003820), CG8523 (Mdr50, AAF58271, AE003815), CG8908 (AAF57490, AE003792), CG10505 (AAF46706, AE003453), CG17632 (bw, AAF47020, AE003461), CG7955 (AAF47526, E0047526A) 472), CG10226 (AAF50670, AE003563), Mdr65 (AAF50669, AE003563), CG5651 (AAF50342, AE003553), CG7346 (AAF50035, AE003544), CCG4314 (st, AAF49455, AE003527), CG5944A4 , AE003523), CG9330 (AAF49142, AE003516), CG14709 (AAF54656, AE003692), CG4225 (AAF55241, AE003710), CG4562 AAF55707, AE003728), CG4794 (AAF55726, AE003728), CG5789 6312, AE003748), CG18633 (AAF56360, AE003749), CG11069 (AAF56361, AE003749), CG6162 (AAF55658, AE003756), CG9990 (AAF56807, AE003766), CG11898 (AAF56869, 68AE, AE003768), AE003768) AAF59367, AE003844).

  Exemplary ABC transporter proteins include MDR1, BCRP (ABCG2), MRP1 (ABCC2) and MRP2 (ABCC2), and their mouse homologues Mdr1a (Abcb1a), Mdr1b (Abcb1b), Bcrp (Abcg2), ccrlA ), And Mrp2 (Abcc2), and any combination thereof. Genetic designations as used herein refer to the human and mouse genomes, but include, but are not limited to, invertebrates such as Caenorhabditis elegans and Drosophila, and rats, hamsters, cats, and dogs. It should be understood to encompass any of these closely-matched homologs that have been identified in other animals, including mammals that are not. Very similar homologues can be identified by sequence analysis, phylogenetic analysis, functional assays, or any combination thereof.

In certain embodiments, animals created by the methods of the invention can be used to study the effects of mutations on animals or on ABC transporters.

v. Humanized model

Animals created by the methods of the present invention can also be used as humanized models. Humanized models express human nucleic acid sequences in non-human animals as detailed above. In one embodiment, the research application or model described in Section II (a) may be humanized. In another embodiment, the following livestock animals or companion animals may be humanized:

(B) Livestock use

  In one embodiment, the methods of the invention can be used to create livestock animals that have one or more chromosome edits that result in one or more desirable characteristics. As used herein, “domestic animals” refers to animals that can be bred for profit. Non-limiting examples of livestock animals are listed in this section and detailed below.

Non-limiting examples of desirable characteristics in livestock animals include specific coat color or fur, disease resistance, increased fertility, increased meat production, increased muscle to fat ratio, increased milk yield, decreased excretion Examples include contamination of materials. In another embodiment, the methods of the invention can be used to create livestock animals with chromosomal editing in the genes listed in Table D.

Additionally, in exemplary embodiments, the livestock animal may be a sheep, horse, cow, or pig animal, as detailed below.

i. Sheep use

  In one embodiment, the methods of the invention can be used to create sheep or sheep cells in which at least one chromosomal sequence has been edited. Non-limiting examples of sheep chromosomal sequences to be edited can include sequences that encode proteins associated with coat color, hair pattern, wool fiber structure, and disease resistance. For example, non-limiting examples of proteins associated with hair color, hair pattern, and / or wool fiber structure include MSH receptor protein, agouti protein, tyrosinase-related protein, and keratin-related protein. Non-limiting examples of suitable hair color proteins include tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signaling protein (ASIP), and melanophylline (MLPH). One skilled in the art understands that there are other proteins associated with hair color, hair pattern, and wool fiber structure, but the loci encoding these other proteins have not yet been determined. Non-limiting examples of sequences involved in disease resistance include PRPN, which is associated with transmissible spongiform encephalopathy (TSE).

In one embodiment, the methods of the invention can be used to create a genetically modified sheep that includes at least one edited chromosomal sequence that exhibits the desired phenotype in humans. For example, inactivation of chromosomal sequences encoding agouti can result in sheep with a striped color. In other embodiments, sheep animals comprising at least one edited chromosomal sequence may be used as a model for studying the genetics of hair color, hair pattern, and / or hair growth. Additionally, sheep animals containing at least one perturbed chromosomal sequence may be used as a disease model for studying diseases or conditions affecting humans or other animals. Non-limiting examples of suitable diseases or conditions include albinism, hair disorders, and alopecia. Additionally, the disclosed sheep cells and lysates of the cells may be used for similar research purposes.

ii. Horse use

  In one embodiment, the methods of the invention can be used to create horses or horse cells in which at least one chromosomal sequence has been edited. Non-limiting examples of horse chromosome sequences to be edited include sequences that encode coat color, hair pattern, and disease resistance.

  Non-limiting examples of suitable hair color genes that encode proteins for hair color and hair pattern include extensions (black / red factor), agouti, MC1R, gray modifier, champagne-like dilution, tobiano, silver-like dilution, MATP (cream Like dilution), pearl like dilution, and Sabino 1. One skilled in the art will appreciate that other genes and proteins may be associated with hair color and hair pattern, but their loci have not yet been determined.

  In a further embodiment, the methods of the invention can be used to create a genetically modified horse that includes an edited chromosomal sequence encoding HERDA, where the chromosomal sequence is a certain allele of the HERD protein. Is inactivated so that it is not produced. In addition, genetically modified horses with inactivated HERDA variants of the chromosomal sequences described herein exhibit reduced expression and transmission carriers of HERDA. In a non-limiting embodiment, the genetically modified horse may comprise an edited chromosomal sequence encoding HERDA. In another non-limiting embodiment, the genetically modified horse may comprise an edited chromosomal sequence that only inactivates a variant form of HERDA known as a carrier.

  In another embodiment, the methods of the invention can be used to create a genetically modified horse that includes an edited chromosomal sequence encoding HYPP, where the chromosomal sequence is inactive for the HYPP dominant allele. And inactivated such that no HYPP protein is produced. Furthermore, genetically modified horses with the inactivated HYPP dominant alleles and chromosomal sequences described herein may exhibit reduced transmission and perpetuation of HYPP in horses. In a non-limiting example, a genetically modified horse may include an edited chromosomal sequence that encodes HYPP.

  In yet another embodiment, the methods of the invention can be used to create a genetically modified horse that includes an edited chromosomal sequence encoding an oberoprotein, wherein the chromosomal sequence is oberoprotein Certain alleles are not produced and / or are not lethal, but are still inactivated so that the flame obero phenotype can be produced. In a non-limiting example, a genetically modified horse animal may include an edited chromosomal sequence that encodes an obero in which the dominant allele is inactivated. In another non-limiting example, a genetically modified horse may contain an edited chromosomal sequence that inactivates only a mutant form of Obero known to express a lethal or deleterious phenotype. Good. In yet another embodiment, the modification alters the dinucleotide TC-> AG mutation to revert the mutation to isoleucine in the EDNRB protein.

  In yet a further embodiment, the methods of the invention can be used to create a genetically modified horse that includes an edited chromosomal sequence encoding GBE, wherein the chromosomal sequence is inactivated by a recessive allele. And inactivated such that the corresponding protein is not produced. Furthermore, genetically modified horses with inactivated GBE variants may exhibit reduced expression and carriers of GBE. In a non-limiting example, a genetically modified horse may include an edited chromosomal sequence that encodes GBE. In another non-limiting embodiment, the genetically modified horse comprises an edited chromosomal sequence that inactivates only a mutant form of GBE known to express a lethal or deleterious phenotype. But you can.

  In an alternative embodiment, the methods of the invention can be used to create a genetically modified horse that can include an edited chromosomal sequence encoding JEB, wherein the chromosomal sequence is free of a JEB recessive allele. Activated and inactivated such that no JEB protein is produced. Furthermore, genetically modified horses with inactivated JEB variants may show reduced expression and transmission of JEB. In a non-limiting example, a genetically modified horse may include an edited chromosomal sequence that encodes JEB. The genetically modified horse may include: In another non-limiting example, a genetically modified horse may include an edited chromosomal sequence that inactivates only a variant form of JEB known as a carrier.

  In another alternative embodiment, the methods of the invention can be used to create a genetically modified horse that includes an edited chromosomal sequence encoding PSSM, wherein the chromosomal sequence comprises a PSSM dominant allele and Inactivated so that no protein is produced. Furthermore, genetically modified horses with inactivated PSSM dominant alleles and chromosomal sequences described herein may exhibit reduced transmission and perpetuation of PSSM in horses. In a non-limiting embodiment, the genetically modified horse may include an edited chromosomal sequence encoding PSSM.

  In yet another alternative, the methods of the invention are used to include C / C, C / T, or T / T variants of myostatin with respect to speed and athletic performance, depending on the nature of the desired phenotypic characteristics. A genetically modified horse containing the edited chromosomal sequence can be created.

  The methods of the present invention can also be used to create genetically modified horses containing any combination of the above-described chromosomal changes. For example, a genetically modified horse may contain an inactivated agouti and / or an edited PSSM chromosomal sequence, a modified MATP chromosomal sequence, and / or a modified or inactivated JEB chromosomal sequence. Good.

The horses or horse cells detailed herein can have multiple uses. In one embodiment, a genetically modified horse that includes at least one edited chromosomal sequence may exhibit a desired phenotype in humans. For example, inactivation of chromosomal sequences encoding agouti may result in horses with striped colored hair. In other embodiments, a horse comprising at least one edited chromosomal sequence may be used as a model for studying the genetics of hair color, hair pattern, and / or hair growth. In addition, horses containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans or other animals (see section II (a) above). Wanna) Non-limiting examples of suitable diseases or conditions include skin diseases such as hyperelastic fibrosis of the skin, or hyperkalemic periodic limb paralysis disease, fatal white cat Obero syndrome, glycogen branching enzyme deficiency disorder, and polysaccharide accumulation In addition to muscular diseases such as type myopathy, recurrent exertional rhabdomyolysis (RER), severe combined immunodeficiency disorder (SCID), there are fetus, hair disorders, and alopecia. Additionally, the disclosed horse cells and lysates of the cells may be used for similar research purposes.

iii. Pig application

  In one embodiment, the methods of the invention can be used to create pigs or pig cells in which at least one chromosomal sequence has been edited. Non-limiting examples of porcine chromosomal sequences to be edited and / or inserted include hair color, stalk, disease resistance, meat quality, increased litter count, sequences encoding meat / fat ratio, and phosphates such as phytase Mention may be made of arrangements that reduce contamination.

  In some embodiments, the methods of the invention can be used to create pigs that contain chromosomal edits in nucleic acid sequences associated with coat color or hair pattern. Non-limiting examples of porcine chromosomal sequences that affect hair color or hair pattern include MC1R. Melanocortin receptor 1 (MC1R) plays a central role in the control of eumelanin (black / brown) and pheomelanin (red / yellow) synthesis within mammalian melanocytes, and is driven by the classic extension (E) coat locus Coded.

  In another non-limiting embodiment, the methods of the invention can be used to create pigs that contain chromosomal editing in nucleic acids associated with disease resistance. Such genetically modified pigs may contain edited chromosomal sequences such as CD163 or sialo adhesion.

  In yet another embodiment, the methods of the invention can be used to create pigs that contain chromosomal editing in nucleic acids related to meat quality, meat quantity, and / or meat to fat ratio. For example, non-limiting examples of porcine chromosomal sequences to be deleted or edited in pigs for increased muscle growth include sequences encoding proteins such as myostatin / GDF8. Non-limiting examples of chromosomal sequences involved in meat quality include HAL, RN, or PSS. In yet another embodiment, the genetically modified pig encodes a sequence involved in the meat / fat ratio, such as IGF2, GHRH, H-FABP, GH, IGF1, PIT1, GHRHR, GHR, or combinations thereof. The edited chromosomal sequence may be included.

  In still yet another embodiment, the methods of the invention can be used to create pigs that contain chromosomal editing in nucleic acids associated with litter production. For example, a genetically modified pig may include an edited or modified chromosomal sequence that encodes an ESR for increased litter production.

  In further embodiments, the methods of the invention can be used to create pigs that contain chromosomal editing in nucleic acids associated with reduced phosphate contamination. For example, a genetically modified pig may contain an edited chromosomal sequence that encodes a phytase for reducing phosphate contamination.

The pig animals and cells disclosed herein may have multiple uses. In one embodiment, a genetically modified pig comprising at least one edited chromosomal sequence may exhibit a desired phenotype in humans. For example, modification of the chromosomal sequence encoding one of the MC1R alleles can result in pigs producing hair with the desired coat color or stalk. In other embodiments, pigs containing at least one edited chromosomal sequence may be used as a model for studying the genetics of hair color, hair pattern, and / or hair growth. Additionally, pigs containing at least one disrupted chromosomal sequence may be used as a model for studying diseases or conditions affecting humans or other animals (see section II (a) above). See). Non-limiting examples of suitable diseases or conditions include albinism, hair disorders, and alopecia. Additionally, the disclosed porcine cells and lysates of the cells may be used for similar research purposes detailed in section II (a) above.

iv. Cattle use

  In one embodiment, the methods of the invention can be used to create bovine or bovine cells in which at least one chromosomal sequence has been edited. Non-limiting examples of bovine chromosomal sequences to be edited and / or inserted include proteins that are related to milk production, milk quality, and milk processing, meat production and quality, coat color and quality, environmental effects, and reproduction Sequence.

  In certain embodiments, the methods of the invention can be used to create cows with chromosomal editing in milk yield, milk quality, and sequences related to milk processing. For example, chromosomal sequences to be edited include casein, lactase and lactase-related proteins (eg, galactosidase, lactase, galactose, beta-lactoglobulin, alpha-lactalbumin, lactoferrin), osteopontin, acetyl coA carboxylase, tyrosinase and related proteins Regeneration-inducing peptides for tissues and cells (RIPTAC) and other growth hormones, proline rich polypeptide (PRP), alpha-lactalbumin (LA), lactoperoxidase, and lysozyme may be included.

  In another embodiment, the methods of the present invention can be used to produce cattle with chromosomal editing in meat products and meat quality related sequences such as, for example, FGFR3, EVC2, MC1R, and myostatin (mh). .

  In other embodiments, the methods of the invention are used to edit chromosomes in sequences related to BSE resistance (such as PRPN), hair color and hair quality (such as MC1R, TYRP1, MGF, or KITLG), environmental effects, and reproduction. Can be produced. In certain embodiments, the locus is not necessarily determined, but can be determined using methods known in the art.

The bovine animals and cells disclosed herein may have multiple uses. In one embodiment, a genetically modified bovine comprising at least one edited chromosomal sequence may exhibit a phenotype desired for humans. For example, inactivation of chromosomal sequences encoding agouti may result in cattle with striped hair. In other embodiments, cattle containing at least one edited chromosomal sequence may be used as a model for studying the genetic characteristics of hair color, hair pattern, and / or hair growth. Additionally, cattle containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans or other animals. Non-limiting examples of suitable diseases or conditions include albinism, hair disorders, and alopecia. Additionally, the disclosed bovine cells and lysates of the cells may be used for similar research purposes.

(C) Companion animal use

  In another embodiment, the methods of the present invention can be used to create companion animals with one or more chromosomal edits that result in one or more desirable properties. As used herein, “companion animal” refers to an animal that is traditionally raised for non-profit purposes. However, it should be noted that in some cases companion animals can be bred for profit. Non-limiting examples of companion animals are detailed herein and in section III below. Non-limiting examples of suitable desirable properties in companion animals include hypoallergenicity, specific coat color or fur, disease resistance, reduced fecal odor, and the like.

  In certain embodiments, the methods of the invention can be used to create companion animals with chromosomal editing in the genes listed in Table D above.

In an exemplary embodiment, the methods of the invention can be used to create companion animals that include one or more chromosome edits, such as cats, dogs, or rabbits. Each is described in more detail below.

i. cat

  In one embodiment, the methods of the invention can be used to create a cat or cat cell in which at least one chromosomal sequence has been edited. Non-limiting examples of cat chromosome sequences to be edited include sequences encoding proteins such as allergen proteins, proteins involved in urine odor production, and proteins involved in hair color, hair pattern and / or hair feet. Can do.

  In certain embodiments, the methods of the invention can be used to create cats with chromosomal editing in nucleic acid sequences associated with hypoallergenicity. Preferred allergen proteins include Ferris domesticus 1 (Fel d1), which is the primary allergen present on the cat and is a heterodimer of chain 1 and chain 2 peptides encoded by distinct genes in the cat genome It is.

  In another embodiment, the methods of the invention can be used to create cats that contain chromosomal edits in nucleic acid sequences associated with urine odor production. For example, chromosomal editing may be performed on proteins involved in the production of urine odors such as cauxin, which produce the main urinary pheromone ferrinin.

  In yet another embodiment, the methods of the invention can be used to create cats that have chromosomal editing in nucleic acid sequences associated with coat color, hair paw, or hair pattern. Non-limiting examples of suitable hair color proteins include tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signaling protein (ASIP), and melanophylline (MLPH). Non-limiting examples of proteins involved in hair feet include fibroblast growth factor 5 (FGF5). One skilled in the art understands that many other proteins are involved in hair color, hair pattern, and hair feet, but their loci have not been determined.

The animals and cells disclosed herein may have multiple uses. In one embodiment, a genetically modified cat comprising at least one edited chromosomal sequence may exhibit a phenotype desired for humans. For example, inactivation of chromosomal sequences encoding Fel d1 can result in cats that are hypoallergenic or non-allergenic. In other embodiments, a cat comprising at least one edited chromosomal sequence may be used as a model for studying the genetics of hair color, hair pattern, and / or hair growth. Additionally, cats containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans or other animals (see section II (a) above). See). Non-limiting examples of suitable diseases or conditions include albinism, hearing loss, skin disorders, hair disorders, and alopecia. Additionally, the disclosed feline cells and lysates of the cells may be used for similar research purposes.

ii. Rabbit

  In one embodiment, the methods of the invention can be used to create rabbits or rabbit cells in which at least one chromosomal sequence has been edited. Non-limiting examples of rabbit chromosomal sequences to be edited and / or inserted can include sequences related to cardiovascular disease, immunodeficiency, and coat color, hair print and / or hair feet.

  In one embodiment, the methods of the invention can be used to create rabbits that contain one or more chromosomal edits in sequences associated with cardiovascular disease. Non-limiting examples of rabbit chromosomal sequences associated with cardiovascular disease include apo A, apoA-I, apoB, apoE2, apoE3, and lecithin-cholesterol acyltransferase (LCAT), and apolipoprotein B, mRNA editing enzyme for rabbits Mention may be made of catalytic poly-peptide 1 (APOBEC-1). Additional non-limiting examples of rabbit chromosomal sequences to be edited include sequences encoding proteins associated with one autosomal dominant disorder, familial hypertrophic cardiomyopathy (FHC). FHC can be caused by multiple mutations in genes encoding various contractile, structural, channel and kinase proteins.

  In another embodiment, the methods of the invention can be used to create rabbits that contain chromosomal edits in nucleic acid sequences associated with immunodeficiency. Non-limiting examples of rabbit chromosome sequences to be edited include fumaryl acetoacetate hydrolase (FAH), recombinant activation gene-1 (Rag1), recombinant activation gene-1 (Rag2), forkhead box O1 (Foxo1) , DNAPK (dsDNA-dependent protein kinase), IL2 gamma receptor.

  The methods of the invention can also be used to create genetically modified rabbits that contain any combination of the above-described chromosomal changes. For example, a genetically modified rabbit may have a modified or inactivated FAH, and / or a modified or inactivated RAG1 chromosomal sequence, and / or a modified RAG2 chromosomal sequence, and / or modified or inactivated. Modified Foxo1, DNAPK, and / or IL2 gamma receptors. All and any combination of the above chromosomal changes may be used for hepatocyte expansion from either human or other sources, which further includes drug metabolism studies, toxicology studies, safety assessment studies, infectious diseases Allows investigations, chronic liver disease, acute liver disease, hepatocellular carcinoma, hepatitis, and any other liver infection or disease.

  In yet another embodiment, the methods of the invention can be used to create a genetically modified rabbit that contains an edited chromosomal sequence encoding a hairless homolog protein (hr). Rabbits carrying mutations at the hr locus can develop seemingly normal hair follicles (HF), but hairs are completely lost soon after birth. Genetically modified rabbits containing edited hr chromosomal sequences can be wound healing assays, skin irritation assays, viral infections, treatment of bacterial infections, for mating with other rabbit models, and if normal rabbits It may be used as a model organism for any application that needs to be shaved.

  Furthermore, the methods of the invention can be used to create genetically modified rabbits containing any combination of the above-described chromosomal changes. For example, genetically modified rabbits may have inactivated ApoE and / or FAH and / or RAG1 chromosomal sequences, and / or modified RAG2 chromosomal sequences, and / or modified or inactivated Foxo1, It may include DNAPK and / or IL2 gamma receptors, and / or hairless homolog protein chromosomal sequences.

The genetically modified rabbits and cells disclosed herein may have multiple uses. In one embodiment, a genetically modified rabbit comprising at least one edited chromosomal sequence may exhibit a desired phenotype in humans. For example, inactivation of chromosomal sequences encoding hairless homolog genes can result in rabbits that become hairless shortly after birth, without the need for rabbit shaving that is often required in various laboratory applications. In other embodiments, a rabbit comprising at least one edited chromosomal sequence studies hair color, hair pattern, and / or hair growth, body size, bone development, and muscle development and structural genetics May be used as a model for Additionally, rabbits containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans, rabbits, or other animals (II (a above) See section)). Non-limiting examples of suitable diseases or conditions include cardiovascular disease, eye disease, thyroid disease, autoimmune disease, and immunodeficiency. Additionally, the disclosed rabbit cells and lysates of the cells may be used for similar research purposes.

iii. Dog

  In one embodiment, the methods of the invention can be used to create a dog or canine cell in which at least one chromosomal sequence has been edited. Non-limiting examples of canine chromosomal sequences to be edited and / or inserted include sequences encoding allergy-related proteins, limb length, body size, hair color, hair pattern, and / or fur, and diseases. Can be mentioned.

  In certain embodiments, the methods of the invention can be used to create dogs that have one or more chromosomal edits in nucleic acid sequences associated with hypoallergenicity. Non-limiting examples of such canine chromosomal sequences include Can f 1. Dogs with Can f 1 “knockouts” or modifications may be hypoallergenic or non-allergenic and / or not bark too much.

  In other embodiments, the methods of the invention can be used to create dogs that have one or more chromosomal edits in nucleic acid sequences related to limb length or body size. For example, suitable nucleic acid sequences can include fibroblast growth factor-4 (FGF4) and insulin-like growth factor-1 (IGF-1).

  In another embodiment, the methods of the invention can be used to create dogs that have one or more chromosomal edits in nucleic acid sequences associated with hair color, hair print, hair paw, and / or hair alignment. For example, suitable nucleic acid sequences include smooth hair versus wire-like hair (T-spondin-2, PSPO2 for wire-like hair), long versus short hair (fibroblast growth factor-5, FGF5), curly hair pair Straight hair (keratin 71, KRT71), hairless (forkhead box transcription factor family, FOX13), hair color (melanocortin 1 receptor, Mcr; agouti; and β-defensin, CBD103), and full or partial pigmentation May be related to absence (microphthalmia-related transcription factor, MITF). One skilled in the art understands that other proteins are involved in hair color, hair pattern, and hair feet, but their loci have not been determined.

  In a further embodiment, the methods of the invention can be used to create dogs that have one or more chromosomal edits in nucleic acid sequences associated with human disease. Non-limiting examples of such diseases include visual impairment, kidney cancer, narcolepsy, rheumatoid arthritis, SCID, keratin related diseases, cystinuria, bleeding disorders, ceroid lipobrinosis, and copper-induced hepatitis. In one embodiment, the genetically modified dog may comprise an edited chromosomal sequence encoding the hypocretin-2-receptor gene HCRTR2. In another embodiment, chromosomal editing is performed at the RCND locus. In yet another embodiment, the genetically modified dog may comprise an edited chromosomal sequence encoding a protein follicular hormone. In yet another embodiment, the genetically modified dog may include chromosomal editing in the RPE65 gene.

  The methods of the invention can be used to create genetically modified dogs that contain any combination of the chromosomal changes described above. For example, a genetically modified dog may have an inactivated Can f 1 and / or agouti chromosomal sequence, a modified FGF4 chromosomal sequence, and / or a modified or inactivated HCRTR2, RCND, and / or The RPE65 chromosomal sequence may be included.

Canine animals and cells created by the methods of the present invention may have multiple uses. In one embodiment, a genetically modified dog that includes at least one edited chromosomal sequence may exhibit a desired phenotype in humans. For example, inactivation of the chromosomal sequence encoding Can f 1 may result in a dog that is hypoallergenic or non-allergenic and / or does not overly bark. In other embodiments, the dog comprising at least one edited chromosomal sequence is inherited in hair color, hair pattern and / or hair growth, body size, leg length vs. thickness, and head shape. It may be used as a model for studying science. In addition, dogs containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans, dogs, or other animals (section II (a) above). See). Non-limiting examples of suitable diseases or conditions include cancer, hearing loss, heart disease, cataract, hip dysplasia, thyroid disease, bloating, autoimmune disease, progressive retinal atrophy, and epilepsy. Additionally, the disclosed canine cells and lysates of the cells may be used for similar research purposes.

(D) Biomolecule production

  In some embodiments, the methods of the invention can be used to create animals or cells that produce biomolecules. For example, in one embodiment, using the methods of the present invention, the animal or cell produces one biomolecule that the animal or cell would typically not produce in the absence of chromosomal editing. An animal or cell containing the above chromosomal editing can be created. For example, the methods of the invention can be used to create cells that produce antibiotics. Alternatively, the method of the invention can be used to create a cow that produces the desired biomolecule in its milk, as detailed in section II (b) above.

  Additional aspects of the invention include methods of producing purified biological components using genetically modified cells or animals that contain an edited chromosomal sequence encoding a protein. Non-limiting examples of such biological components include antibodies, cytokines, signal proteins, enzymes, receptor agonists, and receptor antagonists.

  In another embodiment, the method of the invention is used to produce a modified biomolecule as compared to a biomolecule that the animal or cell would typically produce using the method of the invention. Animals or cells can be created that contain more than one chromosome edit. For example, the methods of the present invention can be used to create silkworms that contain chromosomal editing so that silkworms produce more desirable silk. Non-limiting examples of silkworm chromosome sequences to be edited include sequences that encode proteins that are specifically expressed in silk glands. The silk gland is a site where silk proteins are synthesized and can be classified into three morphologically and functionally distinct compartments: ASG, MSG and PSG. In one embodiment, a genetically modified silkworm comprising silk fibroin protein modified in PSG, including fibroin heavy chain (FibH), fibroin light chain (FibL), and fibrohexamelin P25, has a color, texture, smoothness It is possible to have silk fibers of different phenotypes in length, strength, weight, or ability to absorb dyes. In other embodiments, the genetically modified silkworm comprises a modified gene encoding a juvenile hormone binding protein that is involved in juvenile hormone signaling in PSG and mediates silk gland growth and development. In yet another embodiment, the genetically modified silkworm comprises a ser1 gene modified in MSG that is sticky and produces a glial protein sericin that coats the outside of the silk strand covering the fibroin protein core. Sericin constitutes about 10-25% of silk and needs to be degummed during silk processing. Genetically modified silkworms containing a modified ser1 gene can produce silk fibers without the need for extensive degumming. As a result, genetically modified silk fibers do not need to be “increased” by adding metal to the silk fabric during fabric manufacture.

  Non-limiting examples of a group of proteins involved in silk production include silk formation, such as members of the solute carrier family (family 35 member B3, member E1, and family 39 member 9), and transmembrane transport protein isoform 2. There are transporters involved in the transport of substances related to. One skilled in the art understands that other proteins are involved in silk color, texture, smoothness, length, strength, weight, or ability to absorb dye, but the locus has not been determined.

  Protease inhibitors in A / MSG may play an important role in protecting fibroin proteins in the silk gland lumen from degradation by proteases such as antennal esterases and serine proteases expressed in A / MSG. In another embodiment, the genetically modified silkworm may comprise an edited chromosomal sequence that encodes a protease inhibitor in A / MSG. Modified protease inhibitor coding regions can result in silk proteins with different physical properties. In one embodiment, a genetically modified silkworm comprising a modified protease inhibitor chromosomal region produces a silk that does not contain a high percentage of sericin but still retains its shape and other physical properties. May have a mold.

  In yet another embodiment, the genetically modified silkworm may comprise an edited chromosomal sequence encoding fibroin, sericin, solute carrier, protease inhibitor, or a combination thereof. The edited chromosomal sequence may include at least one modification such that fibroin, a modified version of sericin, or other silk fiber formation-related protein is produced. The chromosomal sequence may be modified to contain at least one nucleotide change such that the expressed protein contains at least one amino acid change detailed above. Alternatively, the edited chromosomal sequence may contain mutations such that the sequence is inactivated and no protein is produced or a defective protein is produced. As detailed above, the mutation may include a deletion, insertion, or point mutation. A genetically modified silkworm containing an edited FibH, ser1, and / or protease inhibitor chromosomal sequence may have a different fiber color, texture, and weight than a silkworm in which the chromosomal region (s) are not edited There is.

  Silk is natural and hypoallergenic. However, several people experience silk allergies due to a wide variety of causes. Often, allergies originate from silkworm diets such as mulberry or oak leaves that affect protein chains found in silk strands produced by silkworms. Silk allergies can cause asthma or allergic rhinitis. In one embodiment, the genetically modified silkworm may include an edited chromosomal sequence encoding alpha and beta glucosidase, glycoside hydrolase, and the glucose transporter is all mulberry leaves, the only food source for silkworms Is involved in glucose hydrolysis and transport in the degradation of. These proteins are expressed in the midgut of the silkworm and are associated with functions such as nutrient degradation, transport, and absorption. In another embodiment, the genetically modified silkworm may comprise an edited chromosomal sequence encoding a lipase protein family, a tactile esterase, a carboxylesterase, and a scavenger receptor SR-B1, which are mainly composed of triglycerides. Related to lipid metabolism in the midgut, such as hydrolysis, degradation of odorous acetic acid compounds, and binding of modified low density lipoproteins. Genetically modified silkworms containing the edited chromosomal sequences described above will generally not contain allergens that cause silk allergic reactions in silk manufacturing workers and consumers.

  The midgut also represents the first-line resistance and immune response of silkworms. In one embodiment, the genetically modified silkworm may include an edited chromosomal sequence encoding an aminopeptidase that binds to various classes of Cry toxins. For example, BtR175, a cadherin-like protein expressed in silkworms, functions as a Cry toxin receptor in signal transduction. In another embodiment, the genetically modified silkworm may comprise an edited chromosomal sequence of 17 members of the cytochrome P450 gene family in the midgut, including CYP4, CYP6, and CYP9. The cytochrome P450 gene family in the midgut is involved in the metabolism of plant toxins and insecticides.

  Another midgut specific gene encodes a peptidoglycan recognition protein that binds strongly to the cell wall peptidoglycan of Gram-positive bacteria and can trigger an immune response. In addition, two lymphocyte receptor genes that are specifically expressed in the midgut encode binding proteins that function during pathogen recognition. In another group of embodiments, the genetically modified silkworm may comprise an edited chromosomal sequence in a peptidoglycan recognition protein or lymphocyte binding protein, wherein the chromosomal sequence is higher so that the silkworm is more disease resistant. Be controlled. Due to the preferred mutations described above, genetically modified silkworms generally have a better immune system, are disease and pathogen free, and are less susceptible to phytotoxins and pesticides in their food sources.

  Similar to silkworm fibers, spider silk is another natural fiber that is three times stronger than Kevlar®, the material used in the military's current bulletproof vest. The spider's superior elongation ability allows more energy to be absorbed more effectively during projectile rupture and deceleration. However, it is impractical to collect strong and supple yarns produced by spiders. The gene that makes spider silk from the spider spider has been cloned, and there are also synthetic genes that mimic the spider dragline silk. In one embodiment, the genetically modified silkworm may include an edited chromosomal sequence that includes an integrated sequence, such as a flagellar gene, that encodes a spider silk. Genetically modified silkworms will allow the systematic and mass production of spider silks due to the need for new materials with unique properties.

  The present disclosure also encompasses genetically modified silkworms containing any combination of the above-described chromosomal changes. For example, a genetically modified silkworm can be a modified FibH and / or FibL chromosomal sequence, a modified ser1 chromosomal sequence, and / or a modified BtR175, and / or CYP4 chromosomal sequence, and / or other species or organisms. May include sequences incorporated from

The silkworms and cells disclosed herein may have multiple uses. In one embodiment, a transgenic silkworm comprising at least one edited chromosomal sequence may exhibit a desired phenotype in humans. For example, modification of the chromosomal sequence encoding fibroin can result in silk fibers with a unique color, texture, weight, or strength. In other embodiments, silkworms comprising at least one edited chromosomal sequence may be used as a model to study the genetics of silk composition, production, and / or transport. Additionally, silkworms containing at least one perturbed chromosomal sequence may be used as a model for studying diseases or conditions affecting humans or other animals. Non-limiting examples of suitable diseases or conditions include mulberry allergy. Additionally, the disclosed silkworm cells and lysates of the cells may be used for similar research purposes.

III. Animals with chromosome editing

  One aspect of the present disclosure provides a genetically modified animal in which at least one chromosomal sequence is edited. Suitable chromosomal editing may include, but is not limited to, the types of editing detailed in section I (f) above.

  As used herein, the term “animal” refers to a non-human animal. The animal may be an embryo, a young body, or an adult. Suitable animals may include vertebrates such as mammals, birds, reptiles, amphibians, and fish. Examples of suitable mammals can include, without limitation, rodents, companion animals, livestock, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Suitable companion animals may include, but are not limited to, cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, pigs, cows, llamas, and alpaca. Suitable primates may include, for example, new world monkeys, old world monkeys, and apes such as capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and tailed monkeys. It is not limited to. Non-limiting examples of birds include chickens, turkeys, ducks, and geese. Alternatively, the animal may be an invertebrate such as an insect or a nematode. Non-limiting examples of insects include silkworms, Drosophila, and mosquitoes.

  In one embodiment, the exemplary animal is a rat. Non-limiting examples of suitable rat strains include Dahl salt sensitive hypertensive strains, Fisher 344 strains, Lewis strains, Long Evans strains, Sprag-Dawley strains, and Wistar strains.

  In each of the foregoing repeats of animals suitable for the present invention, the animals do not contain exogenously introduced transposon sequences that are introduced randomly.

  The animals of the invention may include genome editing in the genes listed in Section II above or Tables A, B, C, and D above. In additional embodiments, the animals of the invention may include genome editing as described in the Examples.

  In an exemplary embodiment, the methods of the invention can be used to develop an animal derived from an embryo that includes chromosomal editing on at least one chromosome in every cell of the animal. In some embodiments, the method can be used to develop an animal that includes chromosomal editing on two chromosomes in every cell of the animal. In some embodiments, chromosomal editing is performed on at least one autosome. In other embodiments, chromosomal editing is performed on at least one sex chromosome.

  Two animals of the present invention may be cross-bred to create animals that are homozygous for chromosome editing. Alternatively, animals can be cross-bred and chromosomal editing combined with other genetic backgrounds. As non-limiting examples, other genetic backgrounds include genetic backgrounds with different chromosomal editing, genetic backgrounds with non-targeted integration, genetic backgrounds with deletion mutations, and wild-type genetic backgrounds. included. In one embodiment, for example, animal A may include a first chromosomal edit and animal B may include a second chromosomal edit. F1 generation, including both first and second chromosome editing, can be obtained by crossing A with B. This mating scheme or similar mating scheme is one way to combine more than one chromosomal editing in the same animal.

In certain embodiments, animals containing chromosomal editing can be used to create primary cell lines as detailed in Section IV below. The resulting cell line will contain chromosomal editing originally introduced into the embryo. The animals of the present invention can be used in any of the applications detailed in Section II above.

IV. Genetically modified cells

  Yet another aspect of the present invention encompasses cells produced by the methods of the present invention, i.e. cells that contain at least one chromosomal edit. Suitable edits may include, but are not limited to, the types of edits detailed in section I (f) above.

  The type of cell containing at least one chromosomal edit can and will be different. In general, the cells will be eukaryotic cells. In some cases, the cells can be primary cells, cultured cells, or immortalized cell lines. Suitable cells include fungi or yeast such as Pichia, Saccharomyces, or Schizosaccharomyces; insect cells such as SF9 cells from Drosophila or S2 cells from Drosophila; and rats, hamsters, non-humans Animal cells such as primates or human cells may also be included. An exemplary cell is a mammal. The mammalian cell may be a primary cell. In general, any primary cell that is sensitive to double-strand breaks can be used. The cells may be cells of various cell types, such as fibroblasts, myoblasts, T or B cells, macrophages, epithelial cells and the like.

  If a mammalian cell line is used, the cell line may be any established or primary cell line not yet described. The cell line may be adherent or non-adherent, or the cell line is grown under conditions that promote adherent, non-adherent, or organotypic growth using standard techniques known to those skilled in the art. May be allowed. Non-limiting examples of suitable mammalian cell lines include Chinese hamster ovary (CHO) cells, monkey kidney CVI strain transformed with SV40 (COS7), human embryonic kidney strain 293, baby hamster kidney cells (BHK) Mouse Sertoli cells (TM4), monkey kidney cells (CVI-76), African green monkey kidney cells (VERO), human cervical cancer cells (HeLa), canine kidney cells (MDCK), buffalo rat liver cells (BRL3A), human Lung cells (W138), human liver cells (Hep G2), mouse mammary tumor cells (MMT), rat hepatoma cells (HTC), HIH / 3T3 cells, human U2-OS osteosarcoma cell line, human A549 cell line, human K562 cell line, human HEK293 cell line, human HEK293T cell line, and TRI Vesicles, and the like. For an extensive list of mammalian cell lines, one skilled in the art can refer to the American Type Culture Collection catalog (ATCC®, Mamassas, VA).

  In an exemplary embodiment, the cells of the invention are embryos. The embryo may be a single cell embryo or an embryo of more than one cell. Suitable embryos may be derived from a number of different vertebrate species, including mammalian, avian, reptile, amphibian, and fish species. Generally speaking, suitable embryos are those that can be collected, injected and cultured to allow expression of zinc finger nuclease. In some embodiments, suitable embryos may include embryos from rodents, companion animals, livestock animals, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Non-limiting examples of companion animals include cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, pigs, llamas, alpaca, and cows. Non-limiting examples of primates include capuchin monkey, chimpanzee, lemur, macaque, marmoset, tamarin, spider monkey, squirrel monkey, and tailed monkey. In other embodiments, suitable embryos may include embryos from fish, reptiles, amphibians, or birds. Alternatively, a suitable embryo may be an insect embryo, such as a Drosophila embryo, a mosquito embryo, or a silkworm embryo. One skilled in the art will understand that methods for embryo collection, injection, and culture are known in the art and may and will vary depending on the species of embryo. Let's go. In all cases, routine optimization can be used to determine the best technique for a particular species of embryo.

  In still other embodiments, the cell may be a stem cell. Suitable stem cells include, without limitation, embryonic stem cells, ES-like stem cells, embryonic stem cells, adult stem cells, pluripotent stem cells, induced pluripotent stem cells, tissue stem cells, pluripotent stem cells, and unipotent stem cells It is.

Additionally, the cells of the invention may be modified to include a tag or reporter gene. Reporter genes encode genes encoding selectable markers such as chloramphenicol acetyltransferase (CAT) and neomycin phosphotransferase (neo), and fluorescent proteins such as green fluorescent protein (GFP) and red fluorescent protein Included are genes, or any genetically engineered variants that improve reporter performance. Non-limiting examples of such known FP variants include EGFP, blue fluorescent protein (EBFP, EBFP2, azurite, mKalama1), blue-green fluorescent protein (ECFP, Cerulean, CyPet) and yellow fluorescent protein derivative (YFP, citrine, Venus, YPet). For example, in a gene construct containing a reporter gene, the reporter gene sequence can be fused directly to the target gene to create a gene fusion. The reporter sequence can be incorporated into the target gene in a target manner, for example, the reporter sequence may be specifically incorporated at the 5 ′ or 3 ′ end of the target gene. Thus, the two genes are under the control of the same promoter element and are transcribed into a single messenger RNA molecule. Alternatively, the reporter gene is used to monitor the activity of the promoter in the gene construct, for example by placing the reporter sequence downstream of the target promoter such that expression of the reporter gene is under the control of the target promoter. The activity of the reporter gene can typically be measured directly and quantitatively compared to the activity observed under a strong consensus promoter. It will be appreciated that doing this may or may not lead to the destruction of the target gene.

Definition

  Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide those skilled in the art with many general definitions of terms used in the present invention: Singleton et al. , Dictionary of Microbiology and Molecular Biology (2nd ed. 1994), The Cambridge Dictionary of Science and Technology (Walker ed., 1988), G. , R. Rieger et al. (Eds.), Springer Verlag (1991), and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

  When introducing elements of the present disclosure or their preferred embodiment (s), the articles “a”, “an”, “the”, and “said” mean that one or more elements are present. Is intended. The terms “comprising”, “including”, and “having” are intended to be inclusive and there may be additional elements other than the listed elements. means.

  As used herein, “gene” refers to a DNA region (including exons and introns) that encodes a gene product, as well as all DNA regions that control the production of the gene product, such regulatory sequences being encoded and / or It does not matter whether it is adjacent to the transcription sequence. Thus, a gene includes a promoter sequence, terminator, translational regulatory sequences such as a ribosome binding site and an internal ribosome entry site, an enhancer, a silencer, an insulator, a border element, a replication origin, a matrix attachment site, and a locus regulatory region. However, it is not necessarily limited to them.

  The terms “nucleic acid” and “polynucleotide” refer to a deoxyribonucleotide polymer or ribonucleotide polymer in either a single-stranded or double-stranded form in a linear or circular conformation. For purposes of this disclosure, these terms should not be construed as limiting with respect to the length of the polymer. The term encompasses known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moieties (eg, phosphorothioate backbone). In general, analogs of a particular nucleotide have the same base-pairing specificity, ie, analogs of A base pair with T.

  The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues.

  The term “recombinant” refers to the process of exchange of genetic information between two polynucleotides. For the purposes of the present invention, “homologous recombination” refers to a special form of such exchange that occurs, for example, during repair of double-strand breaks in cells. This process requires sequence similarity between two polynucleotides and uses “donor” or “exchange” molecules for template repair of “target” molecules (ie, those that have undergone double-strand breaks), It is known variously as “non-cross gene conversion” or “short tract gene conversion” because it results in the transfer of genetic information from the donor to the target. Without being bound by any particular theory, such migration can reconstruct the genetic information that becomes part of the target and / or mismatch correction of heteroduplex DNA formed between the cleaved target and the donor. It may involve “synthesis-dependent strand annealing” and / or related processes where donors are used to synthesize. Such specialized homologous recombination often results in a change in the sequence of the target molecule such that part or all of the sequence of the donor or exchange polynucleotide is incorporated into the target polynucleotide.

  As used herein, the term “target site” or “target sequence” defines a portion of a chromosomal sequence to be edited and is defined by a zinc finger nuclease provided that sufficient conditions exist for binding. Refers to a nucleic acid sequence that is engineered to recognize and bind to it.

  Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of RNA for a gene and / or determining the amino acid sequence encoded thereby, and combining these sequences with a second nucleotide or amino acid sequence. Comparing is included. Genomic sequences can also be determined and compared in this manner. In general, identity refers to the complete nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity between two sequences, whether it is a nucleic acid or amino acid sequence, is divided by the length of the shorter sequence divided by the number of perfect matches between the two aligned sequences, multiplied by 100 Is. Approximate alignment of nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Materials 2: 482-489 (1981). This algorithm is described in Dayhoff, Atlas of Protein Sequences and Structure, M. et al. O. Dayhoff ed. , 5 suppl. 3: 353-358, National Biomedical Research Foundation, Washington, D.M. C. , USA, Gribskov, Nucl. Acids Res. 14 (6): 6745-6673 (1986) can be applied to amino acid sequences by using a scoring matrix normalized. An exemplary implementation of this algorithm for determining percent sequence identity is provided by the Genetics Computer Group (Madison, Wis.) In the “BestFit” utility application. Other programs suitable for calculating percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST used with default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = standard; filter = none; strand = both Cutoff = 60; expectation number = 10; matrix = BLOSUM62; description (Descriptions) = 50 sequence; sort by = high score (HIGH SCORE); database (Databases) ) = Non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + IR. Details of these programs can be found on the GenBank website. For the sequences described herein, the desired degree of sequence identity ranges from about 80% to 100% and any integer value therebetween. Typically, the percent identity between sequences is at least 70% -75%, preferably 80% -82%, more preferably 85-90%, even more preferably 92%, even more preferably 95%, most Preferably 98% sequence identity.

  Alternatively, polynucleotides are hybridized under conditions such that stable duplex formation can occur between regions sharing some degree of sequence identity, followed by single-strand specific nuclease (s) The degree of sequence similarity between polynucleotides can be determined by digesting with and sizing the digested fragments. Two nucleic acid sequences, or two polypeptide sequences, are at least about 70% to 75%, preferably 80% over a defined length on the molecule as determined using the method described above. They are substantially similar to each other if they show a sequence identity of from% to 82%, more preferably 85% to 90%, even more preferably 92%, even more preferably 95%, and most preferably 98%. As used herein, substantially similar also refers to sequences that exhibit complete identity to a designated DNA or polypeptide sequence. Substantially similar DNA sequences can be identified, for example, in Southern hybridization experiments performed under stringent conditions defined for that particular system. The definition of suitable hybridization conditions is made within the skill of the art. For example, Sambrook et al. Nucleic Acid Hybridization: A Practical Approach, editors B .; D. Hames and S.H. J. et al. Higgins, (1985) Oxford; Washington, D .; C. ; IRL Press).

  Selective hybridization of two nucleic acid fragments can be determined as follows. The degree of sequence identity between two nucleic acid molecules affects the efficiency and strength of hybridization events between such molecules. A partially identical nucleic acid sequence will at least partially inhibit the hybridization of a completely identical sequence to a target molecule. Inhibition of hybridization of completely identical sequences can be assessed using hybridization assays well known in the art (eg, Southern (DNA) blot, Northern (RNA) blot, solution hybridization, etc., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, NY). Such assays can be performed using varying degrees of selectivity, for example, using conditions that vary from low stringency to high stringency. When using low stringency conditions, the absence of non-specific binding has a secondary probe that lacks even a partial degree of sequence identity (eg, less than about 30% sequence identity with the target molecule). Probe) to ensure that the secondary probe does not hybridize to the target in the absence of non-specific binding events.

  When using a detection system based on hybridization, a nucleic acid probe complementary to a reference nucleic acid sequence is selected, and then the probe and reference sequence are selectively hybridized or bound to each other by selecting appropriate conditions. Thus, a double-stranded molecule is formed. Nucleic acid molecules capable of selectively hybridizing to a reference sequence under moderately stringent hybridization conditions typically have at least about 70% sequence identity with the sequence of the selected nucleic acid probe. Hybridize under conditions that allow detection of a target nucleic acid sequence 10-14 nucleotides long. Stringent hybridization conditions typically allow detection of target nucleic acid sequences that are at least about 10-14 nucleotides in length with greater than about 90-95% sequence identity with the sequence of the selected nucleic acid probe. Where the probe and reference sequence have a particular degree of sequence identity, hybridization conditions useful for probe / reference sequence hybridization can be determined as is known in the art (eg, Nucleic Acid Hybridization: A Practical Approach, editors BD Hames and SJ Higgins, (1985) Oxford; Washington, DC; see IRL Press). Hybridization conditions are well known to those skilled in the art.

  Hybridization stringency refers to the extent to which hybridization conditions dislike the formation of hybrids containing mismatched nucleotides, and high stringency correlates with low tolerance for mismatched hybrids. Factors affecting the stringency of hybridization are well known to those skilled in the art and include, but are not limited to, temperature, pH, ionic strength, and concentrations of organic solvents such as formamide and dimethyl sulfoxide. As known to those skilled in the art, hybridization stringency increases with high temperature, low ionic strength, and low solvent concentration. Regarding hybridization stringency conditions, it is well known in the art that a number of equivalent conditions can be used to establish a specific stringency, for example by changing the following factors: sequence length and Nature, base composition of various sequences, concentration of salts and other hybridization solution components, presence or absence of blocking agents (eg, dextran sulfate and polyethylene glycol) in the hybridization solution, hybridization reaction temperature and time parameters, and effects Cleaning conditions. A series of specific hybridization conditions can be selected according to the following standard methods in the art (eg, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.). See Y.).

The following examples are included to demonstrate preferred embodiments of the invention. It should be understood by those skilled in the art that the techniques disclosed in the examples that follow represent techniques found by the inventors to function properly in the practice of the invention. However, one of ordinary skill in the art, in light of this disclosure, may still obtain similar or similar results, even though many changes have been made in the particular embodiments disclosed, without departing from the spirit and scope of the present invention. Therefore, it should be understood that all matter described or shown in the accompanying drawings should be interpreted as illustrative rather than in a limiting sense.

Example

  The following examples are included to demonstrate preferred embodiments of the invention. It should be understood by those skilled in the art that the techniques disclosed in the examples that follow represent techniques found by the inventors to function properly in the practice of the invention. However, one of ordinary skill in the art, in light of the present disclosure, will still obtain similar or similar results, even though many changes have been made in the particular embodiments disclosed, without departing from the spirit and scope of the present invention. Therefore, it should be understood that all matter described or shown in the accompanying drawings should be interpreted as illustrative rather than in a limiting sense.

The following examples illustrate various iterations of the invention.

Example 1: Construction of a restriction fragment length polymorphism (RFLP) donor nucleic acid for targeted integration into the PXR nucleic acid region of the rat genome

  There are two possible DNA repair results after targeted ZFN-induced double-strand breaks (FIG. 1). Cleavage can be repaired with non-homologous end joining (NHEJ), leading to mutations containing base deletions or additions, or in the presence of donor DNA, the donor DNA is doubled by homologous recombination (HR). It can be used as a template for repairing strand breaks. If the donor DNA encodes a specific sequence change, these deliberate mutations are integrated into the organism's genome at the target site.

  In order to test targeted integration in the rat genome using pronuclear injection, the architecture was designed and prepared for targeted integration into the PXR gene region of the rat genome. Buildings were constructed and either Notl or Pmel restriction fragment length polymorphism (RFLP) sites were introduced into the PXR gene region (FIG. 2). The architecture was designed with either 200, 800, or 2000 base pairs of sequence homology to the PXR gene target site flanking the introduced RFLP site. Three sizes of homology regions were used to determine the size of homology required for efficient targeting and homologous recombination.

Clones were constructed using PCR amplification to introduce restriction sites favorable for cloning, and an RFLP site at the tip of the PXR homology region (FIG. 1). The PCR primers used to amplify the homologous PXR region are listed in Table 1. Accuprime HF DNA polymerase was used for PCR reaction amplification. A 30 second extension was used for the 200 bp fragment, a 1.5 minute extension was used for the 800 bp fragment, and a 4 minute extension was used for the Kbp fragment. The PCR fragment was then digested with the appropriate restriction enzymes and cloned into pBluescript using a three-way ligation to produce the six plasmids listed in Table 2.



Example 2: Construction of a restriction fragment length polymorphism (RFLP) donor nucleic acid for targeted integration into the rRosa26 nucleic acid region of the rat genome

The plasmid was also constructed to target the integration of Notl and Pmel RFLP sites into the rRosa26 nucleic acid region of the rat genome. Plasmid design and construction is described in Example 1 above. PCR primer pairs used to amplify the rRosa26 homology region are listed in Table 3.


Example 3: Construction of a restriction fragment length polymorphism (RFLP) donor nucleic acid for targeted integration into the Mdr1a nucleic acid region of the mouse or rat genome

Plasmids were constructed to target integration of Notl and Pmel RFLP sites into the mMdr1a nucleic acid region of the mouse genome or the rMdr1a nucleic acid region of the rat genome. The design and construction of the plasmid was as described in Example 1 above. PCR primer pairs used to amplify the Mdr1a homology region are listed in Table 4. “M” represents a mouse and “r” represents a rat.


Example 4: Construction of a GFP expression integration cassette

In order to test the targeted integration of nucleic acid fragments larger than RFLP, the architecture was designed and prepared for targeted integration of the GFP expression cassette into the rat PXR and rRosa26 nucleic acid genomic regions and the mouse mMdr1a nucleic acid genomic region. Briefly, a GFP expression cassette containing a human PGK promoter, a GFP open reading frame, and a polyadenylation signal was used to introduce a Notl restriction site at the tip using the following primers (FIG. 3): Amplified using: PGKGFP-F Notl (5'-aaagcggccgctttggggtttgcgccttttcc) (SEQ ID NO: 49) and PGKGFP-R Notl (5'-aaaagcggccgcccatgccccacccccatc) (SEQ ID NO: 50). Next, the PCR fragment was cloned into the Notl-containing plasmid constructed in Examples 1-3.

Example 5: Preparation of zinc finger mRNA for targeted integration

  A pair of zinc finger nucleases were designed for each target integration site and cloned as described on the Sigma website. For details, see Science (2009) 325: 433, which is incorporated herein by reference. Next, the ZFN expressing mRNA was first added at 37 ° C. for 2 hours, 10 μL of Buffer 2 (NEB, No. B7002S), 10 μL of 10 × BSA (diluted from 100 × BSA, NEB, No. B9001S), 8 μL In vitro produced by digesting 20 μg of each bulk prepared ZFN expression plasmid in a 100 μL reaction containing XbaI (NEB, number R0145S). The reaction was extracted with 100 μL phenol / chloroform (Sigma, P2069) and centrifuged at 20,000 × g for 10 minutes. The aqueous suspension was precipitated with 10 μL of 3M NaOAc (Sigma, S7899) and 250 μL of 100% ethanol and centrifuged at maximum speed for 25 minutes at room temperature. The resulting pellet was washed by adding 300 μL of 70% ethanol filtered through a 0.02 μM filter. The pellet was air dried and resuspended in 20 μL of 0.1 × TE filtered with 0.02 μM.

  The purified and digested DNA was then used to produce ZFN transcription using in vitro transcription with the MessageMax T7 Capped Message Transcription Kit (No. MMA60710) obtained from Epicentre Biotechnologies. Briefly, the kit components were preheated to room temperature and the reaction components in a 20 μL reaction were combined at room temperature in the following order: 5 μL RNase-free water filtered at 0.02 μM, 1 μL prepared template, 2 μL lox transcription buffer, 8 μL 2-way Cap / NTP premix, 2 μL 100 mM DTT and 2 μL MessageMax T7 Enzyme Solution. The reaction was then incubated for 30 minutes in a 37 ° C. incubator.

The capped RNA was then tailed with PolyA using the A-Plus Poly (A) Polymerase tailing kit (Epicentre, number PAP5 104H) as described. The reaction components were combined at room temperature in the following prescribed order: 55.5 μL 0.02 μM RNase-free water, 10 μL 10 × A-Plus reaction buffer, 10 μL 10 mM ATP, 2 .5 μL ScriptGuard RNase Inhibitor (40 units / μL), 20 μL extracorporeal transcription capping reaction, 2 μL A-plus PolyA Polymerase. The reaction was then incubated for 30 minutes at 37 ° C. The resulting capped PolyA tailed mRNA was purified twice by precipitation with an equal amount of 5M NH ₄ Oac. The mRNA pellet was then air dried and resuspended in 30 μL of filtered injection buffer (1 mM Tris, pH 7.4, 0.25 mM EDTA) and RNA concentration was measured using a nanodrop spectrophotometer.

Example 6: Targeted integration into the embryo

  To incorporate the nucleic acid into the rat or mouse genome, zinc finger nuclease mRNA was mixed with bulk prepared target DNA filtered through a 0.02 μM filter. The nucleic acid mixture consisted of a portion of ZFN mRNA versus a portion of donor DNA. The nucleic acid mixture was then microinjected into the pronuclei of single cell embryos using known methods. The injected embryos were either incubated in vitro or transferred to a pseudomother. Resulting embryo / fetus or production animal toe / tail clips were collected for DNA extraction and analysis.

To extract DNA, tissues were lysed in 100 μL Epicentre QuickExtract for 30 minutes at 50 ° C., then incubated at 65 ° C. for 10 minutes, and incubated at 98 ° C. for 3 minutes. To determine if target integration occurred, PCR was used to amplify the target region using appropriate primers. In experiments where RFLP was integrated into the genome of the animal, the PCR product was digested with the introduced RFLP enzyme to detect integration (FIG. 4A). In addition, a Cel-I endonuclease assay using wild-type PCR fragments and PCR fragments obtained from injected embryos to demonstrate that ZFN mRNA was functional in the embryo by detecting NHEJ. This is independent of targeted integration. In experiments that integrate GFP into the animal's genome, the transition in size of the PCR fragment indicates integration (FIG. 4B). Alternatively, integration junction amplification in which one primer lands only on the GFP cassette was used to assess donor nucleic acid integration.

Example 7: Examination of DNA extraction and PCR amplification of mMdr1a target site in mouse genome

PCR conditions for amplifying target nucleic acids extracted from tissues were tested using embryos with 1-64 cells extracted as described in Example 6. A 900 bp fragment containing the mouse mMdr1a target region was amplified in a reaction containing up to 5 μL of Epicentre's QuickExtract solution in a 50 μL reaction using 36 amplification cycles with a 4 minute extension at 60 ° C. (FIG. 5). These results indicate that QuickExtract does not interfere with PCR amplification and can amplify DNA from samples extracted from only 1-10 cells. To increase sensitivity, the number of PCR cycles may be increased or nested PCR reactions may be performed.

Example 8: Integration of Notl donor RFLP into rat PXR genomic region-Experiment A

A donor plasmid (with an 800 bp arm) for integration of the Notl RFLP site into the PXR region of the rat genome was injected into rat embryos with ZFN mRNA as described above. PCR, followed by Notl restriction enzyme analysis and Cel-I endonuclease analysis was performed using DNA extracted from several embryos. PCR amplification was successful in some embryos (FIG. 6A) and Cel-I endonuclease analysis revealed that most of the fragments had nucleic acid sequence changes at the desired target (FIG. 6B).

Example 9: Integration of Notl donor RFLP into the mouse mMdr1a genomic region-Experiment B

  Targeted integration of Notl RFLP into the mouse mMdr1a region was repeated as described in Example 8. The mMdr1a region was amplified using PCR and digested with Notl. PCR amplification was successful in some embryos (FIG. 7) and digestion with Notl revealed that some embryos contained integrated RFLP sites (eg, lanes 13, 17, 19, 20, and 23). In total, 7 of the 32 embryos were targeted to integrate and data were generated for it.

These results were confirmed by repeating the Notl digestion reaction after further washing the PCR reaction product (FIG. 8).

Example 10: Examination of DNA extraction and PCR amplification of PXR target sites in the rat genome

PCR amplification of the PXR region from the blastocyst was tested to determine the level of sensitivity. The PCR reaction contained 5 μL template, 5 μL PCR buffer, 5 μL of each primer, 0.5 μL Taq polymerase enzyme, and 33.5 μL water in a 50 μL reaction. The template consisted of undiluted DNA extracted from rat blastocysts or DNA diluted at ratios of 1: 2, 1: 6, 1:10, and 1:30 (FIG. 9).

Example 11: Integration of Notl donor RFLP into the rat PXR genomic region

  A donor plasmid (with an 800 bp homology arm) for integration of the Notl RFLP site into the PXR region of the rat genome was injected into rat embryos with ZFN mRNA as described above. A total of 123 embryos were injected and 106 survived. Decreasing concentrations of nucleic acid were injected and tested for toxicity. Seventeen of the 51 embryos injected with 5 ng of nucleic acid survived and were split into two cell embryos on the second day. Of the 23 embryos injected with 2 ng of nucleic acid, 17 out of 14 embryos survived and were split into 2 cell embryos on the second day. Twelve of 29 embryos injected with 10 ng of nucleic acid survived and split into 2 cell embryos on the second day. All 10 uninjected control embryos survived and were split into 2 cell embryos on day 2.

PCR amplification of the PXR region followed by Notl and Cel-I endonuclease analysis was performed using DNA extracted from several embryos. PCR amplification was successful in several embryos and Notl and Cel-I endonuclease analysis revealed that 18 of 47 embryos had nucleic acid sequence changes at the desired target (FIG. 10). .

Example 12: Targeted integration of RFLP into the mMdr1a target region of the mouse genome in the fetus

A donor plasmid (with an 800 bp homology arm) for introduction of Notl into the mMdr1a region of the mouse genome was injected into mouse embryos with ZFN mRNA as described above. One of four fetuses that developed well at 12.5 dpc was positive for the Notl site. All four decidua were negative (FIG. 11).

Example 13: Targeted integration of GFP into the fetal mMdr1a locus

A donor plasmid (with an 800 bp homology arm) for introduction of a GFP cassette into the mMdr1a region of the mouse genome was injected into the mouse embryo along with ZFN mRNA as described above. Two of the 40 fetuses at 12.5 dpc were positive for the GFP cassette (Figure 12).

Example 14: Targeted integration of RFLP into the PXR target region of the rat genome in the fetus

A donor plasmid (with an 800 bp homology arm) for introduction of Notl into the PXR region of the rat genome was injected into mouse embryos with ZFN mRNA as described above. One of 8 fetuses at 13 dpc was positive for the Notl site (FIG. 13).

Example 15: Genomic editing of SMAD4 in cat cells

Zinc finger nuclease (ZFN) -mediated genome editing was tested in cat cells using ZFNs that bind to human SMAD4 chromosomal sequences because the DNA binding sites in cats and humans are identical. The amino acid sequence of the SMAD4 ZFN pair (19160/19159) and the corresponding DNA binding site are shown in Table 5. A capped polyadenylated mRNA encoding SMAD4 ZFN (19160/19159) was produced using known molecular biology techniques. The mRNA was transfected into human K562, feline AKD (lung), and feline CRFK (kidney) cells. Control cells were injected with RNA encoding GFP.

The frequency of ZFN-induced double stranded chromosome breaks was determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch that forms between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ. As shown in FIG. 14, SMAD4 ZFN (19160/19159) cleaved the SMAD4 locus in human and cat cells.

Example 16: Genomic editing of SMAD4 in cat embryos

  Cat embryos are harvested using standard procedures and are incorporated herein by reference in their entirety. A capped polyadenylated mRNA encoding SMAD4 ZFN (19160/19159) was injected using a technique substantially similar to that described by Science (2009) 325: 433. Cat embryos were in the 2-4 cell stage at the time of microinjection. Control embryos were injected with 0.1 mM EDTA. The frequency of cleavage was estimated using the Cel-1 assay described in Example 15. As illustrated in FIG. 15, the cutting efficiency was estimated to be about 6-9%.

Table 6 shows embryo development after microinjection. Approximately 19% (3/16) of embryos injected with small amounts of SMAD4 ZFN mRNA developed to the blastocyst stage, and 50% (8/16) of control embryos injected with EDTA developed to the blastocyst stage.


Example 17: Genomic editing of Fel d1 in cat cells

ZFNs were designed to target different regions of the Fel d1 chromosomal sequence in cats (see Geurts et al. (2009) above). ZFN targeted strand 1-exon 1, strand 1-exon 2, or strand 2-exon 2 of Fel d1. The amino acid sequence and the DNA binding site of each ZFN are shown in Table 7.

Feline AKD cells can be treated with Fel d1 ZFN (17/18) targeting exon 1 of chain 1, Fel d1 ZFN (7/9) targeting exon 2 of chain 1, or exon 2 of chain 2 Transfected with mRNA encoding the target Fel d1 ZFN (12/13). The efficiency of ZFN-mediated cleavage was estimated using the Cel-1 assay described above. It was estimated that the cleavage efficiency of the 17/18 Fel d1 ZFN pair was approximately 17% (see FIG. 16). The 7/9 Fel d1 ZFN pair cleaved strand 1, exon 2 with approximately 16% efficiency (see FIG. 17). FIG. 18 shows that strand 2, exon 2 was cleaved by a 12/13 Fel d1 ZFN pair.

Example 18: Genomic editing of Fel d1 in feline embryos

To promote inactivation of the Fel d1 locus, feline embryos were treated with two pairs of Fel d1 ZFNs. One pair (17/18) targeted strand 1-exon 1 and the other pair (12/13) targeted strand 2-exon 2. Due to the genomic organization of the Fel d1 locus, the coding region of strand 2 (transcribed from the “lower” strand) is located approximately 4000 bp upstream of the coding region of strand 1 (transcribed from the “upper” strand). It was therefore hypothesized that editing events at two separate positions could mediate large deletions from the Fel d1 locus. Cat embryos were co-injected with capped polyadenylated mRNA encoding a ZFN pair essentially as described in Example 16 above. Table 8 shows embryo development after microinjection. Embryos injected with high concentrations of Fel d1 ZFN had higher survival rates than embryos injected with low concentrations of Fel d1 ZFN.

  On day 8, control and experimental embryos were harvested for analysis. Control blastocysts contain about 150-300 cells, laboratory blastocysts contain about 70-100 cells, and experimental morulae contain about 16-30 cells. Contained. Individual embryo DNA was extracted using standard procedures and subjected to Cel-1 analysis (see FIG. 19). The samples in lanes 1, 3, and 7 showed the expected Cel-1 digestion product. Sequence analysis revealed that extra bands in other lanes (including control lane 6) were attributed to adjacent SNPs.

To further analyze the edited Fel d1 locus, the target region was PCR amplified and sequenced using standard methods. Sequence analysis confirmed that sample number 5 had a 4541 bp deletion between the coding region of strand 2 and strand 1 (see FIG. 20). Specifically, the binding site to ZFN13 was cut at 2 bp, and the binding to ZFN12 was deleted along with additional downstream sequences. Surprisingly, the binding site to the 17/18 pair was intact, indicating that the deletion was the result of cleavage by the 12 / 13ZFN pair (see FIG. 21).

Example 19: Genomic editing of cauxin in cat cells

As detailed above, ZFN pairs targeting the region of the cauxin locus were designed and tested in cat cells. Table 9 shows the amino acid sequence of the zinc finger helix and the DNA binding site of each active ZFN.

FIG. 22 shows the results from the Cel-1 assay confirming cleavage of the cauxin locus by the 1/2, 9/10, and 17/18 ZFN pairs. FIG. 23 illustrates the cleavage of the cauxin locus by the 29 / 30ZFN pair.

Example 20: Agouti genome editing in model organism cells

  Genome editing mediated by zinc finger nuclease (ZFN) is related to the color of sheep cells such as MSH receptor protein, tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signaling protein (ASIP), melanophylline (MLPH), etc. ZFNs that bind to the chromosomal sequence of the gene can be used to test in cells of model organisms such as sheep. The particular hair color-related gene being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding sheep homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into sheep cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can be used to demonstrate cleavage of selected coat-related loci in sheep cells using ZFN.

Example 21: Agouti genome editing in a model organism embryo

  Embryos of model organisms such as sheep can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 20. Sheep embryos can be in the 2-4 cell stage upon microinjection. Control embryos were injected with 0.1 mM EDTA. The frequency of ZFN-induced double-stranded chromosome breaks was estimated using the Cel-1 assay described in Example 20. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival up to the blastocyst stage.

Example 22: FibH genome editing in model organism cells

  Zinc finger nuclease (ZFN) -mediated genome editing was performed using fibroin heavy chain (FibH), fibroin light chain (FibL), fibrohexamerin P25, sericin (Ser1), Cry toxin receptor (BtR175), cytochrome P450 (CYP4, CYP6). , CYP9) can be tested in the cells of model organisms such as silkworms and silkworms using ZFNs that bind to the chromosomal sequence of silkworm fiber-related genes of silkworm cells such as CYP9). The particular silk fiber-related gene being edited can be a gene having the same DNA binding site as the corresponding insect DNA binding site, such as a spider homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into silkworm, silkworm cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can be used to demonstrate the cleavage of selected cognitive-related loci in silkworm, Bombyx mori cells using ZFN.

Example 23: Genomic editing of FibH in model organism embryos

  Embryos of model organisms such as silkworms, silkworms, egg embryos, etc. can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 22. . Silkworms, silkworms, and egg embryos can be in the 2-4 cell stage upon microinjection. Control embryos were injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks was estimated using the Cel-1 assay described in Example 22. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with a small amount of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival to later stages.

Example 24: TUBA1B promoter

  The following examples detail the use of the tubulin promoter to control the expression of heterologous proteins. TUBA1B encoding tubulin alpha-1B was selected as the target chromosome sequence. A pair of zinc finger nucleases (ZFNs) were designed to target positions within the TUBA1B coding region. For further details, see Science (2009) 325: 433, which is hereby incorporated by reference in its entirety. One ZFN was designed to bind to the sequence 5'CTTCGCCCTCCTAATC3 '(SEQ ID NO: 86) and the other ZFN was designed to bind to the sequence 5'CACTATGGTGTAAA3' (SEQ ID NO: 87) (Figure 24A). Upon binding, the ZFN pair introduces a double strand break in the sequence 5'CCTAGC3 'that exists between the two ZFN recognition sequences. A capped polyadenylated mRNA encoding a ZFN pair was produced using known molecular biology techniques.

  The gene of interest (ie, SH2 biosensor) contained a sequence encoding GFP linked to two SH2 domains and a 2A peptide domain (see FIG. 24B). The plasmid (Figure 25) was constructed to serve as a donor polynucleotide for the targeted integration of the SH2 biosensor sequence into the TUBA1B locus of the human cell line. The plasmid contained an SH2 biosensor coding sequence flanked by upstream and downstream of the 1 Kb and 700 bp TUBA1B locus sequences of the cleavage site introduced by the ZFN pair. The plasmid was designed such that the SH2 biosensor coding sequence would be incorporated in frame with the endogenous sequence just downstream of the tubulin start codon. When the TUBA1B locus is activated, two separate proteins are created, as shown in FIG. 24B.

  A pair of RNA encoding donor plasmid and ZFN was transfected into U2OS, A549, K562, HEK293, or HEK293T cells. The nucleic acid mixture contained a portion of donor DNA versus a portion of FN RNA. The transfected cells were then cultured under standard conditions. Analysis of individual cell clones revealed GFP fluorescence and showed heterologous biosensor expression. Western analysis confirmed that α-tubulin expression was not affected by targeted integration (FIG. 24C).

Another donor plasmid was constructed to allow insertion in the case of a Grb2-containing biosensor (ie, GFP-2xSH2-Grb2-2A). Grb2-containing biosensors are activated with EGF and undergo nuclear translocation. A549 cells were transfected with nucleic acids and cultured to allow integration and expression of the TUBA1B locus. Cells were exposed to 100 ng / ml EGF and imaged. FIG. 26 shows the time course of the translocation of the SH2 biosensor.

Example 25: ACTB promoter

  The following examples were designed to test the use of stronger promoters. A well-known strong promoter is present in the ACTB locus and encodes β-actin. A pair of ZFNs was designed to target the ACTB locus. One ZFN was designed to bind to the sequence 5'GTCGTCGACAACGGCTCC3 '(SEQ ID NO: 88), and the other ZFN was designed to bind to the sequence 5'TGCAAGGCCGCTTCGCGG3' (SEQ ID NO: 89). Upon binding, the ZFN pair introduces a double-strand break in the sequence 5'GGCATG3 'that exists between the two ZFN recognition sequences.

  The donor plasmid was designed to provide the SH2 biosensor sequence and tag the endogenously produced β-actin (ie, GFP-2x-SH2-2A-RFP) (FIG. 27). Nucleic acid was introduced into the cells to produce two fluorescent proteins (ie, actin tagged with a GFP biosensor and RFP). The fluorescence of each protein was monitored using fluorescence microscopy.

In order to better monitor different fluorescent proteins, another donor plasmid was constructed to contain a Grb2-containing biosensor. Therefore, the donor plasmid contained GFP-2xSH2-Grb2-2A-RFP. A549 cells were transfected with nucleic acids and cultured to allow integration and expression of the ACTB locus. Cells were exposed to 100 ng / ml EGF and imaged. FIG. 28 shows the time course of translocation of the GFP-Grb2 biosensor and the position of RFP-actin. Since the biosensor produced so much, there was a high level of unbound or “free” biosensor, thereby greatly increasing the amount of background fluorescence.

Example 26: LMNB1 promoter

  Another pair of ZFNs was created to target the LMNB1 locus encoding the lamin B1 protein. One ZFN was designed to bind to the sequence 5'CCTCCGCCGCCCCGCT3 '(SEQ ID NO: 90), and the other ZFN was designed to bind to the sequence 5'GCCGCCGCCATGGCG3' (SEQ ID NO: 91). Upon binding, the ZFN pair introduces a double-strand break in the sequence 5'GTCTCC 3 'that exists between the two recognition sequences.

Donor plasmids can be constructed to contain sequences encoding biosensor proteins flanked by LMNB1 sequences upstream and downstream of the ZFN cleavage site. Nucleic acids encoding ZFNs and donor plasmids can be introduced into the cells and the cells can be monitored as detailed above.

Example 27: Identification of ZFNs editing the LRRK2 locus

  The rat LRRK2 gene was selected for zinc finger nuclease (ZFN) -mediated genome editing. ZFN was designed, constructed, and verified using the strategies and procedures described above. (See Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The LRRK2 gene region (XM — 235581) is paired with a pair of 4, 5, or 6 that an existing module will fuse to bind to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. Finger proteins were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

Capped polyadenylated mRNAs encoding each pair of ZFNs were produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay involves a ZFN pair targeted to bind to 5′-tgGGTCCATGAAGTGGGGGTGgtgtct-3 ′ (SEQ ID NO: 94, contact site capitalized) and 5′-gaGCCCGTTACCTGCTGTCTCacacctt 3 ′ (SEQ ID NO: 95) LRRK2 locus It was revealed that it was cut within.

Example 28: Editing of the LRRK2 locus in rat embryos

Capped polyadenylated mRNA encoding an active pair of ZFN was microinjected into rat fertilized embryos using standard procedures (see, eg, Geurts et al. (2009) above). The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the LRRK2 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 29 illustrates the edited LRRK2 locus in two founder animals. One animal had a 10 bp deletion in the exon 30 target sequence and the second animal had an 8 bp deletion in the exon 30 target sequence. These deletions disrupt the reading frame of the LRRK2 coding region.

Example 29: Identification of ZFNs that edit the SNCA locus

A ZFN capable of editing the SNCA (α-synuclein) locus was designed by examining the rat SNCA locus (NM — 018169) for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 27. This analysis revealed that the ZFN pair targeted to bind to agTCAGCACAGGCATGTccatgttgagt-3 ′ (SEQ ID NO: 96) and 5′-ccTCTGGGGGTAGGAACAGGGtctccccac-3 ′ (SEQ ID NO: 97) was cleaved within the SNCA gene.

Example 30: Identification of ZFNs editing the DJ-1 locus

ZFNs having activity at the DJ-1 locus were identified as described above. That is, the rat DJ-1 gene (NM_0169169) was examined for a putative zinc finger binding site and ZFN was constructed and tested essentially as described in Example 27. It was found that a ZFN pair targeted to bind to 5'-aaGCCGACTAGAGAGAGAGAgaccaccaacgc-3 '(SEQ ID NO: 98) and 5'-gtGAAGGAGATCcCACAgagcaggaga-3' (SEQ ID NO: 99) edited the DJ-1 locus. It was.

Example 31: Identification of ZFNs that edit the parkin locus

To identify the ZFN that targets and cleaves the parkin locus, the rat parkin gene (NM — 020093) was examined for putative zinc finger binding sites. ZFN pairs were constructed and tested essentially as described in Example 27. This analysis reveals that the ZFN pair targeted to bind to 5′-gaACTCGGaGTTCCCAGgctggacctt-3 ′ (SEQ ID NO: 100) and 5′-gtGCGGCACCTGCAGACaagcaacccct-3 ′ (SEQ ID NO: 101) was cleaved within the Parkin gene. I made it.

Example 32: Identification of ZFNs that edit the PINK1 locus

  ZFNs active at the PINK1 locus were identified essentially as described above. The rat PINK1 gene (NM — 020093) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 27. This analysis reveals that a ZFN pair targeted to bind to 5′-ggGTAGTAGTGGGGGGGtagcatgtcag-3 ′ (SEQ ID NO: 102) and 5′-aaGGCCTGgGCCAGGCCGCactactctt-3 ′ (SEQ ID NO: 103) edits the PINK1 gene did.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 33: Genome editing of the ApoE locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rabbit ApoE locus can be designed, constructed, and validated using previously described strategies and procedures (Geurts et al. Science (2009)). 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. A pair of four, five, or six finger proteins that would bind the rabbit ApoE gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into rabbit cells. Control cells can be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay can detect alleles at target loci that deviate from wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay can identify a pair of active ZFNs edited at the ApoE locus.

To mediate editing of the ApoE locus in animals, fertilized rabbit single cell embryos can be microinjected using standard procedures with mRNA encoding an active pair of ZFNs (see, for example, Geerts et al, supra). (See 2009). The injected embryos can either be incubated in vitro or transferred to pseudopregnant female rabbits to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA can be isolated using standard procedures. The target region of the ApoE locus can be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 34: FAH genome editing in a model organism

  Using ZFN-mediated genome editing, for "knockout" mutations in rabbit or human disease-related chromosomal sequences, such as chromosomal sequences encoding fumaryl acetoacetate hydrolase (FAH) in genetically modified model animals and cells obtained from the animals You can study the effects. Such a model animal can be a rabbit. Generally, ZFNs that bind to the rabbit chromosomal sequence encoding fumaryl acetoacetate hydrolase associated with rabbit immunodeficiency are used to disrupt the coding region of the FAH gene so that a functional FAH protein cannot be produced. Insertion can be introduced.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 33 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. Symptoms of immunodeficiency and the development of disorders caused by fumaryl acetoacetate hydrolase “knockouts” can be assessed in genetically modified rabbits or their offspring. In addition, molecular analysis of immune deficiency related pathways can be performed on cells obtained from genetically modified animals containing FAH “knockouts”.

Example 35: Generation of a humanized rabbit expressing a mutant form of human cTnl

  Familial hypertrophic cardiomyopathy (FHC) represents an autosomal dominant form of inheritance and diverse genetic pathogenesis. FHC or phenotypic replication can be caused by multiple mutations in genes encoding various contractile, structural, channel, and kinase proteins. In general, arrhythmias, particularly ventricular tachycardia and fibrillation associated with FHC, will result in sudden death. A single base change at the cTnl locus leads to a change in cardiac troponin, a disease-related protein. ZFN-mediated genome editing can be used to generate humanized rabbits, where the rabbit cTnl locus is replaced with a variant of the human cTnl locus that contains one or more mutations. Such humanized rabbits can be used to study the development of diseases associated with human FHC. In addition, humanized rabbits can be used to assess the efficacy of potential therapeutic agents targeting pathways leading to FHC, including cTnl.

Genetically modified rabbits can be generated using the methods described in the above examples. However, to generate a humanized rabbit, ZFN mRNA may be co-injected into a rabbit embryo with a human chromosomal sequence encoding a mutant cardiac troponin protein. The rabbit chromosomal sequence can then be replaced by the mutant human sequence by homologous recombination, producing a humanized rabbit that expresses a mutant form of cardiac troponin protein.

Example 36: Genomic editing of PRPN in model organism cells

  Zinc finger nuclease (ZFN) -mediated genome editing can be tested in cells of model organisms such as cattle using ZFNs that bind to the chromosomal sequence of the prion protein gene of bovine cells such as PRPN. The particular gene being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding bovine homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into bovine cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can demonstrate the cleavage of selected PRPN loci in bovine cells using ZFN.

Example 37: Genomic editing of PRPN in a model organism embryo

  Embryos of model organisms such as cattle can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 36. Bovine embryos can be in the 1 cell stage at the time of microinjection. Control embryos can be injected with 0.1 mM EDTA. The frequency of ZFN-induced double-stranded chromosome breaks can be estimated using the Cel-1 assay described in Example 36. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival up to the blastocyst stage.

Example 38: Identification of ZFNs editing the ApoE locus

  The ApoE gene was selected for zinc finger nuclease (ZFN) mediated genome editing. ZFNs were designed, constructed, and verified using the strategies and procedures described previously (see Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The rat ApoE gene region (NM — 138828) is paired with a pair of 4, 5, or an existing module that will fuse to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. A 6-finger protein was examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

Capped polyadenylated mRNAs encoding each pair of ZFNs were produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay was performed with a ZFN pair within the ApoE locus targeted to bind to 5′aaGCGGTTCAGGGCCTGCctccccgggggt-3 ′ (SEQ ID NO: 117, contact site capitalized) and 5′ggGATTACCTTGcGCTGGGtgcagaggct-3 ′ (SEQ ID NO: 118). Clarified that it was cut.

Example 39: Editing of the ApoE locus in rat embryos

Capped polyadenylated mRNA encoding an active pair of ZFN was microinjected into rat fertilized embryos using standard procedures (see, eg, Geurts et al. (2009) above). The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the ApoE locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 30 shows two edited ApoE loci. One animal had a 16 bp deletion in the exon 2 target sequence and the second animal had a 1 bp deletion in the exon 2 target sequence. These deletions disrupt the reading frame of the ApoE coding region.

Example 40: Identification of ZFNs that edit the leptin locus

A ZFN that targets and cleaves the rat leptin gene was identified essentially as described above. The rat leptin gene (NM_013076) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 38. This assay was performed when a pair of ZFNs targeted to bind to 5'-gtGGATAGGCACAgtctgaacatagacac-3 '(SEQ ID NO: 119, contact site capitalized) and 5'aaGTCCAGGATCACCaaaacccctcat-3' (SEQ ID NO: 120) are within the leptin locus. It was revealed that it was cut at.

Example 41: Editing the leptin locus in the rat embryo

Rat embryos were microinjected with mRNA encoding an active pair of leptin ZFN, essentially as described in Example 39. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the leptin locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 31 shows an edited leptin locus in which the 151 bp region has been deleted from the 3 ′ end of exon 1 and the 5 ′ end of intron 1.

Example 42: Editing the Pten locus in the rat embryo

A ZFN that targets and cleaves the rat Pten locus was designed and tested for activity essentially as described in Example 38 above. An active pair of ZFNs was identified. The DNA binding sites were 5'-CCCCAGTTTGTGTCTCgcca-3 '(SEQ ID NO: 121) and 5'-gcTAAAGGTGAAGATCTA-3' (SEQ ID NO: 122). The capped polyadenylated mRNA encoding the active pair can be microinjected into rat embryos and the resulting embryos can be analyzed as described in Example 39. Thus, the Pten locus can be edited to contain deletions or insertions so that the coding region is perturbed and no functional gene product is created.

Example 43: Genomic editing of Canca1C in model organism cells

  Using ZFNs that bind zinc finger nuclease (ZFN) -mediated genome editing to the chromosomal sequence of cardiovascular-related genes in rat cells such as Canca1C, Sod1, Pten, Ppar (alpha), and combinations thereof, It can be tested in cells of a model organism. The particular chromosomal sequence involved in the cardiovascular disease being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding human homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. Assuming that K562 cells have the same DNA binding site, mRNA can be transfected into rat cells as well as human K562 cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can demonstrate the cleavage of selected cognition-related loci in human and rat cells using ZFN.

Example 44: Genomic editing of Canca1C in a model organism embryo

  Embryos of model organisms such as rats can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 43. Rat embryos can be at the 1 cell stage upon microinjection. Control embryos can be injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks can be estimated using the Cel-1 assay described in Example 43. Cleavage efficiency can be estimated using Cel-1 assay results.

  Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival up to the blastocyst stage.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 45: Genome editing of myostatin / GDF8, CD163, or sialoadhesin in model organism cells

  Zinc finger nuclease (ZFN) -mediated genome editing of porcine cells such as MC1R, MSH receptor protein, tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signaling protein (ASIP), melanophylline (MLPH), etc. ZFNs that bind to the chromosomal sequence of hair color-related genes can be used to test in cells of model organisms such as pigs. The particular coat color-related gene being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding porcine homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into porcine cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can use ZFNs to demonstrate cleavage of selected myostatin / GDF8, CD163, or sialoadhesin loci in porcine cells.

Example 46: Genomic editing of HAL, RN, ESR, IGF2, GHRH, H-FABP, GH, IGF1, PIT1, GHRHR, or GHR in a model organism embryo

  Embryos of model organisms such as pigs can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 45. Porcine embryos can be in the 2-4 cell stage upon microinjection. Control embryos were injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks was estimated using the Cel-1 assay described in Example 45. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival up to the blastocyst stage.

Example 47: Genomic editing of the Can f 1 locus

  A zinc finger nuclease (ZFN) that targets and cleaves the can f1 locus of the dog can be designed, constructed, and validated using the strategies and procedures previously described (Geurts et al. Science ( 2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The canine Can f 1 gene region is paired with a pair of 4, 5, or 6 that an existing module will fuse to bind to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. Finger proteins were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into canine cells. Control cells can be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay can detect alleles at target loci that deviate from wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay can identify a pair of active ZFNs compiled from the Can f 1 locus.

To mediate editing of the Can f 1 locus in animals, canine fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (see, eg, Geerts et al, supra). (See 2009). The injected embryos can either be incubated in vitro or transferred to a pseudopregnant female dog to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the Can f 1 locus can be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 48: Genomic editing of HCRTR2 in a model organism

  Using ZFN-mediated genome editing, the effects of “knock-out” mutations in canine or human disease-related chromosome sequences, such as genetically modified model animals and chromosomal sequences encoding hypocretin receptor proteins in cells derived from the animals Can study. Such a model animal can be a dog. In general, deletions are made so that the coding region of the HCRTR2 gene is perturbed and a functional hypocretin receptor protein cannot be produced using ZFNs that bind to the canine chromosomal sequence encoding the hypocretin receptor associated with canine narcolepsy. Or an insertion can be introduced.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 47 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of narcolepsy symptoms and disorders caused by the hypocretin receptor “knockout” can be assessed in genetically modified dogs or their offspring. In addition, molecular analysis of narcolepsy-related pathways can be performed on cells obtained from genetically modified animals containing HCRTR2 “knockouts”.

Example 49: Generation of a humanized dog expressing a mutant form of human BHD

  BHD is a multi-organ disorder in humans with a strong similarity to RCND, a naturally occurring canine hereditary cancer syndrome. The RCND locus overlaps with the human BHD locus in genome comparisons. A single base change at the RCND locus leads to a change in the disease-related protein folliculin. ZFN-mediated genome editing can be used to generate humanized dogs, where the canine RCND locus is replaced with a variant of the human BHD locus that contains one or more mutations. Such humanized dogs can be used to study the development of diseases associated with mutant human BHD proteins. In addition, humanized dogs can be used to evaluate the efficacy of potential therapeutic agents targeting pathways leading to kidney cancer, including BHD.

Genetically modified dogs can be generated using the methods described in the examples above. However, to generate a humanized dog, ZFN mRNA may be co-injected into a canine embryo with a human chromosomal sequence encoding a mutant BHD protein. The canine chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized dog that expresses a mutant form of the BHD protein.

Example 50: Genome editing of addiction-related proteins in model organism cells

  Zinc finger nuclease (ZFN) -mediated genome editing was performed using ABAT (4-aminobutyrate aminotransferase), DRD2 (dopamine receptor D2), DRD3 (dopamine receptor D3), DRD4 (dopamine receptor D4), GRIA1 (glutamine receptor) Body, ion channel type, AMPA1), GRIA2 (glutamine receptor, ion channel type, AMPA2), GRIN1 (glutamine receptor, ion channel type, N-methyl D-aspartate 1), GRIN2A (glutamine receptor, ion channel) Type, N-methyl D-aspartate 2A), GRM5 (metabotropic glutamine receptor 5), HTR1B (5-hydroxytryptamine (serotonin) receptor 1B), PDYN (dynorphin), or PRKCE (tamper) Quality kinase C, and using a ZFN binding to chromosomal sequences of addiction-related genes in rat cells epsilon), etc. can be tested in a model organism cells, such as rats. The particular addiction-related gene being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding human homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. Assuming that K562 cells have the same DNA binding site, mRNA can be transfected into rat cells as well as human K562 cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can demonstrate the cleavage of selected addiction-related loci in human and rat cells using ZFN.

Example 51: Genome editing of addiction-related proteins in model organism embryos

  Embryos of model organisms such as rats can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 50. Rat embryos can be in the single cell stage upon microinjection. Control embryos were injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks was estimated using the Cel-1 assay described in Example 50. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to EDTA injected with EDTA to determine the effect of ZFN mRNA on embryo survival up to the blastocyst stage.

Example 52: Genome editing of the APP locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat APP locus was designed, constructed, and validated using the strategies and procedures previously described. (See Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. A pair of 4, 5, or 6 finger proteins that will bind the rat APP gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a pair of ZFNs was produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay identified a pair of active ZFNs that edited the APP locus. The zinc finger binding sites were 5'-GCCCAGCACCCTGACgcag'3- (SEQ ID NO: 129) and 5'-tcGACAAGTACCTGGAG'3 '(SEQ ID NO: 130).

To mediate editing of the APP locus in animals, rat fertilized embryos were microinjected with mRNA encoding an active pair of ZFNs using standard procedures. (See, eg, Geurts et al. (2009) above). The injected embryos were either incubated or transferred to in vitro pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the APP locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 32 shows the edited APP locus of two founder animals, one with a 292 bp deletion in exon 9 (FIG. 32A) and the other with a 309 bp deletion in exon 9 (FIG. 32B).

Example 53: Genome editing of cognition-related genes in model organism cells

ZFN-mediated genome editing was performed using ANK3 (ankyrin 3), APP (amyloid precursor protein), B2M (beta-2 microglobulin), BRD1 (bromodomain containing 1), FMR1 (fragile X mental retardation 1), MECP2 ( Rats and other models using ZFNs that bind to the chromosomal sequences of cognition-related genes such as methyl CpG binding protein 2), NGFR (nerve growth factor receptor), NLGN3 (neurolidine 3), or NRXN1 (neulexin 1) It can be tested in cells of an organism. A ZFN can be designed and tested essentially as described in Example 52. ZFNs that target specific cognition-related genes can be used to introduce deletions or insertions such that the coding region of the gene of interest is inactivated.

Example 54: Genome editing of cognition-related genes in model organisms

Embryos of model organisms such as rats are harvested using standard procedures, as detailed in Example 52 above, and injected with capped polyadenylated mRNA encoding a ZFN that targets cognition-related genes. can do. A donor or exchange polynucleotide comprising a sequence for integration or exchange can be co-injected with ZFN. The resulting chromosomal region of the resulting animal can be analyzed as described above. Modified animals can be phenotypically analyzed for changes in behavior, learning, etc. In addition, genetically modified animals can be used to assess the efficacy of potential therapeutic agents for the treatment of cognition related disorders.

Example 55: Genomic editing of CCR2 in a model organism

  Using zinc finger nuclease (ZFN) -mediated genome editing, the effect of “knock-out” mutations on inflammation-related chromosomal sequences such as chromosomal sequences encoding CCR2 protein in genetically modified model animals and cells obtained from those animals Can study. Such a model animal can be a rat. In general, ZFNs that bind to the rat chromosomal sequence encoding the inflammation-related protein CCR2 can be used to introduce nonsense mutations into the coding region of the CCR2 gene so that no active CCR2 protein can be produced.

  Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into rat embryos. Rat embryos can be in the single cell stage upon microinjection. Control embryos can be injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

Embryo development after microinjection and the development of inflammation-related symptoms and disorders caused by CCR2 “knockout” can be assessed in genetically modified rats. With respect to CCR2, inflammation-related symptoms and disorders can include the development of rheumatoid arthritis and an altered inflammatory response to the tumor. The results can be compared to control rats injected with 0.1 mM EDTA, where the chromosomal region encoding the CCR2 protein is unchanged. In addition, molecular analysis of inflammation-related pathways can be performed on cells obtained from genetically modified animals containing CCR2 “knockouts”.

Example 56: Generation of a humanized rat expressing a mutant form of human perforin-1

  Missense mutations in Perforin-1, a significant effector of lymphocyte cytotoxicity, lead to a wide variety of diseases ranging from familial hemophagocytic lymphohistiocytosis to an increased risk of tumor formation. One such mutation is a V50M missense mutation in which the valine amino acid at position 50 in perforin-1 is replaced with methionine. ZFN-mediated genome editing can be used to generate humanized rats in which the rat PRF1 gene is replaced with a mutant form of the human PRF1 gene containing the V50M mutation. Such humanized rats can be used to study the onset of diseases associated with mutant human perforin-1 protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may have targeted inflammatory pathways including perforin-1.

Genetically modified rats can be generated using the method described in Example 55 above. However, to generate humanized rats, ZFN mRNA can be co-injected into rat embryos with human chromosomal sequences encoding mutant perforin-1 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination to produce a humanized rat that expresses a mutant form of perforin-1 protein.

Example 57: Editing the Pten locus

A ZFN that targets and cleaves the rat Pten locus was designed and tested for activity essentially as described in Example 55 above. An active pair of ZFNs was identified. The DNA binding sites were 5′-CCCCAGTTTGTGTCTCgcca-3 ′ (SEQ ID NO: 135) and 5′-gcTAAAGGTGAAGATCTA-3 ′ (SEQ ID NO: 136). Capped polyadenylated mRNA encoding the active pair can be microinjected into rat embryos and the resulting embryos can be analyzed as described in Example 55. Thus, the Pten locus can be edited to contain deletions or insertions such that the coding region is perturbed and no functional gene product is created.

Example 58: Identification of ZFNs editing the Rag1 locus

The Rag1 gene was selected for zinc finger nuclease (ZFN) mediated genome editing. ZFN was designed, constructed, and verified using the strategies and procedures described in the examples above. The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The rat Rag1 gene region (XM_001079242) is paired with a pair of 4, 5, or an existing module that will fuse to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. A 6-finger protein was examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites. Capped polyadenylated mRNAs encoding each pair of ZFNs were produced and transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay involves a ZFN pair targeted to bind to 5′-ttCCTGTGGCAGTAGGActctgactgtgag-3 ′ (SEQ ID NO: 137, contact site capitalized) and 5′-gtGACCGTGGAGTGGCaccccacacac-3 ′ (SEQ ID NO: 138), the Rag1 locus. It was revealed that it was cut within.

Example 59: Editing the Rag1 locus

Capped polyadenylated mRNA encoding an active pair of ZFNs was microinjected into rat fertilized embryos as described in the above example. The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the Rag1 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 33 shows the DNA sequence of the edited Rag1 locus of two animals (SEQ ID NOs 131 and 132). One animal had a 808 bp deletion in exon 2 and the second animal had a 29 bp deletion in the exon 2 target sequence. These deletions disrupt the reading frame of the Rag1 coding region.

Example 60: Identification of ZFNs that edit the Rag2 locus

A ZFN that targets and cleaves the Rag2 gene was identified essentially as described above. The rat Rag2 gene (XM_001079235) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 55. This assay involves a pair of ZFNs targeted to bind to 5′-acGGTGTATATaGCCCAGGAaaaaaagtgt-3 ′ (SEQ ID NO: 139, contact site capitalized) and 5′-atACCACGTCAATGGGAattggcatatct-′3 ′ (SEQ ID NO: 140). It was revealed that it was cut in the seat.

Example 61: Editing the Rag2 locus

Rat embryos were microinjected with mRNA encoding an active pair of Rag2ZFN, essentially as described in Example 56. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the Rag2 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 34 shows the DNA sequence of the edited Rag2 locus of two animals. One animal had a 13 bp deletion in the exon 3 target sequence and the second animal had a 2 bp deletion in the exon 3 target sequence. These deletions disrupt the reading frame of the Rag2 coding region.

Example 62: Identification of ZFNs that edit the FoxN1 locus

A ZFN that targets and cleaves the FoxN1 gene was identified, essentially as described in Example 55 above. The rat FoxN1 gene (XM_220632) was examined for putative zinc finger binding sites. ZFN was constructed and tested essentially as described in Example 55. This assay binds to two pairs cleaved within the FoxN1 locus: 5′-ttAAGGGCCATGAAGATgagatgctac-3 ′ (SEQ ID NO: 141, contact site is capitalized) and 5′-caGCAAAGCGCGAGAGTCttccagtcagt-'3 ′ (SEQ ID NO: 142) A first pair targeted to bind, and a second pair targeted to bind 5'-ttGTCGATTTTGGGAAGGattgagggcccc-3 '(SEQ ID NO: 143) and 5'-atGCAGGAAGAGCTGCCAgaagtgagaga-'3' (SEQ ID NO: 144) The active ZFN was revealed.

Example 63: Identification of ZFNs editing the DNAPK locus

  A ZFN that targets and cleaves the DNAPK gene was identified essentially as described in Example 55 above. The rat DNAPK gene (NM_001108327) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 55. This assay involves a DNAPK gene in which a ZFN pair targeted to bind to 5'-taCACAAGTCCCTCTCCCAggagctagagaa-3 '(SEQ ID NO: 145, contact site is capitalized) and 5'-acAAAGCTTATGAGtgtagataaaaa-'3' (SEQ ID NO: 146) It was revealed that it was cut in the seat.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 64: Genomic editing of Oct1 in a model organism

  ZFN-mediated genome editing can be used to study the effects of “knock-out” mutations in AD-related chromosomal sequences, such as chromosomal sequences encoding Oct1 protein in genetically modified model animals and cells obtained from the animals . Such a model animal can be a rat. In general, ZFNs that bind to the rat chromosomal sequence encoding the Oct1 protein associated with AD are used to disrupt deletions or insertions so that the coding region of the Oct1 gene may be disrupted and a functional Oct1 protein may not be produced. Can be introduced.

A suitable fertilized embryo, which can be in the single cell stage, can be microinjected with a capped polyadenylated mRNA encoding ZFN. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of AD symptoms and disorders caused by Oct1 “knockouts” can be assessed in genetically modified rats or their offspring. In addition, molecular analysis of AD-related pathways can be performed on cells obtained from genetically modified animals containing ErbB4 “knockouts”.

Example 65: Generation of humanized rats expressing variants of human genes for ADME and toxicology

  Mutations in any of the chromosomal sequences for ADME and toxicology can be used in the generation of humanized rats that express mutant forms of the gene. The gene can be Oct1, Oct2, Hfe2, Ppar (alpha), and combinations thereof. ZFN-mediated genome editing can be used to generate humanized rats, where the rat gene is replaced with a variant of the human gene containing the mutation. Such humanized rats can be used to study the development of diseases associated with mutant human proteins encoding the gene of interest. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target pathways leading to AD containing the gene of interest.

Genetically modified rats can be generated using the methods described in the above examples. However, to generate humanized rats, ZFN mRNA can be co-injected into rat embryos with human chromosomal sequences encoding mutant proteins. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the protein.

Example 66: Identification of ZFNs editing the Mdr1a locus

  The Mdr1a gene was selected for zinc finger nuclease (ZFN) mediated genome editing. ZFN was designed, constructed, and verified using the strategies and procedures described above. (See Geurts et al., Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The rat Mdr1a gene region (NM_133401) is paired with a pair of 4, 5, or an existing module that will bind to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. A 6-finger protein was examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

Capped polyadenylated mRNAs encoding each pair of ZFNs were produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay involves a ZFN pair targeted to bind to 5'-acAGGGCTGATGGCcaaaaatcacaagag-3 '(SEQ ID NO: 164, contact site capitalized) and 5'-ttGGACTGTCAGCTGGTattttggcaaaa-'3' (SEQ ID NO: 165). It was revealed that it was cut in the seat.

Example 67: Editing of the Mdr1a locus

  Capped polyadenylated mRNA encoding an active pair of ZFNs was microinjected into rat fertilized embryos using standard procedures (see, eg, Geurts et al. (2009) above). The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus or production animal toe / tail clip was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the Mdr1a locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 35 shows the DNA sequence of the edited Mdr1a locus of two animals. One animal had a 20 bp deletion in the exon 7 target sequence, and the second animal had a 15 bp deletion and 3 bp insertion in the exon 7 target sequence. The edited locus had a frameshift mutation and multiple translation stop codons.

Western analysis was performed to confirm that the Mdr1a locus was inactivated so that no Mdr1a protein was produced. Cell lysates were prepared from the proximal colon of Mdr1a knockout rats. Control cell lysates were prepared from human neuroblastoma cell lines. As shown in FIG. 36, no Mdr1a protein was detected in Mdr1a (− / −) animals, indicating that the Mdr1a locus was inactivated.

Example 68: Identification of a ZFN that edits the Mdr1b locus

ZFNs that target and cleave the Mdr1b gene were identified essentially as described above. The rat Mdr1b gene (NM_016233) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 64. The assay involves a ZFN pair targeted to bind to 5'-agGAGGGGGAAGCAGGGTtccgtggaga-3 '(SEQ ID NO: 166, contact site capitalized) and 5'-atGCTGGTGTCGGAcatagagagata-3' (SEQ ID NO: 167). It was revealed that it was cut within.

Example 69: Identification of ZFNs that edit the Mrp1 locus

A ZFN that targets and cleaves the Mrp1 gene was identified essentially as described in Example 64 above. The rat Mrp1 gene (NM — 022881) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 64. This assay involves a Zrp gene pair that is targeted to bind to 5′-gaAGGGCCCGGTTCTAagaaaaaaaccca-3 ′ (SEQ ID NO: 168, contact site is capitalized) and 5′-tgCTGGCTGGGGTGCTgttagtattcct-'3 '(SEQ ID NO: 169). It was revealed that it was cut in the seat.

Example 70: Editing of the Mrp1 locus

Rat embryos were microinjected with mRNA encoding an active pair of Mrp1 ZFN, essentially as described in Example 65. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the Mrp1 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 37 shows the DNA sequence of the edited Mrp1 locus of two animals. One animal had a 43 bp deletion in exon 11, and the second animal had a 14 bp deletion in exon 11. These deletions disrupt the reading frame of the Mrp1 coding region.

Example 71: Identification of ZFNs editing the Mrp2 locus

A ZFN that targets and cleaves the Mrp2 gene was identified essentially as described in Example 64 above. The rat Mrp2 gene (NM_012833) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 64. This assay involves a Zrp pair targeted to bind to 5'-ttGCTGGTGACtGACCTTgtttaaaacc-3 '(SEQ ID NO: 170, contact site capitalized) and 5'-ttGAGGCGGCCATGACAAAGgacctgca-'3' (SEQ ID NO: 171). It was revealed that it was cut in the seat.

Example 72: Editing of the Mrp2 locus

Rat embryos were microinjected with mRNA encoding an active pair of Mrp2 ZFN, essentially as described in Example 65. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the Mrp2 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 38 shows the DNA sequence of the edited Mrp2 locus in which 726 bp has been deleted from exon 7, thereby disrupting the reading frame of the Mrp2 coding region.

Example 73: Identification of ZFNs that edit the BCRP locus

A ZFN that targets and cleaves the BCRP gene was identified essentially as described in Example 64 above. The rat BCRP gene (NM — 181381) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 64. This assay involves a ZFN pair targeted to bind to 5′-atGACGTCAAGGAAGAAgtctgcagggt-3 ′ (SEQ ID NO: 172, contact site capitalized) and 5′-acGGAGATTCTTCGGCTgtatagtgtaa-'3 '(SEQ ID NO: 173). It was revealed that it was cut in the seat.

Example 74: Editing the BCRP locus

Rat embryos were microinjected with mRNA encoding an active pair of BCRP ZFN, essentially as described in Example 65. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the BCRP gene was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 39 shows the DNA sequence of the edited BCRP locus of two founder animals. One animal had a 588 bp deletion in exon 7 and the second animal had a 696 bp deletion in exon 7. These deletions disrupt the reading frame of the BCRP coding region.

Example 75: Destruction of Mdr1a

In vitro preparation of ZFN mRNA: ZFN expression plasmids were obtained from Sigma's CompoZr product line. Each plasmid was linearized with an XbaI site located at the 3 ′ end of the FokI ORF. A 5 'cap and 3' PolyA tailed message RNA is converted into a MessageMax T7 Captured transcription kit and a poly (A) polymerase tailing kit (Epicente Biotechnology, Madison, WI), or 7 Ambion, Austin, TX). The PolyA tail reaction was precipitated twice with _NH 4 OAc same amount of 5M, then injection buffer (1 mM Tris -HCl, pH7.4,0.25mM EDTA) was dissolved in. The concentration of mRNA was estimated using a NanoDrop 2000 spectrometer (Thermo Scientific, Wilmington, DE).

  ZFN validation in cultured cells: Briefly, when ZFN makes a double-strand break at a target site that is repaired by a non-homologous end-joining pathway, it introduces a deletion or insertion. Wild type and mutant alleles are amplified in the same PCR reaction. When the mixture is denatured and reannealed, the wild type and mutant alleles form duplexes, have an unpaired region around the cleavage site, and two smaller in addition to the parent PCR product It may be recognized and cleaved by a single strand specific endonuclease to produce a molecule. The presence of the cleaved PCR band indicates ZFN activity in the transfected cells.

NIH 3T3 cells were grown in DMEM at 37 ° C., 5% CO ₂ with 10% FBS and antibiotics. To confirm ZFN activity according to the manufacturer's 96-well shuttle protocol for 3T3 cells, ZFN mRNA was paired at a 1: 1 ratio using Nucleofector (Lonza, Basel, Switzerland) and transduced into NIH 3T3 cells. I did it. Twenty-four hours after transfection, the culture medium was removed and the cells were incubated with 15 μL trypsin per well for 5 minutes at 37 ° C. The cell suspension was then transferred to 100 μL QuickExtract (Epicentre) and incubated at 68 ° C. for 10 minutes and 98 ° C. for 3 minutes. The extracted DNA was then used as a template in a PCR reaction and amplified around the target site with the following primer pairs:
Mdr1a Cel-IF: ctgtttctttgacaaaaacactacggctc (SEQ ID NO: 174)
Mdr1a Cel-IR: gggtcatgggaagatgtaaaatac (SEQ ID NO: 175)

  Each 50 μL PCR reaction contained 1 μL template, 5 μL Buffer II, 5 μL each 10 μM primer, 0.5 μL AccuPrime High Fidelity (Invitrogen, Carsbad, Calif.), And 38.5 μL water. . The following PCR program was used: 35 cycles of 95 ° C. for 5 minutes, 95 ° C. for 30 seconds, 60 ° C. for 30 seconds, and 68 ° C. for 45 seconds, then 68 ° C. for 5 minutes, 4 ° C. Three microliters of the above PCR reaction was mixed with 7 μL of 1 × Buffer II and incubated under the following program: 95 ° C. for 10 minutes, −2 ° C./second from 95 ° C. to 85 ° C., −0 .85 ° C. to 25 ° C. at 1 ° C./second, permanently 4 ° C. One microliter each of nuclease S and enhancer (Transgenomic, Omaha, NE) was added at 42 ° C. for 20 minutes to digest the above reaction. The mixture was resolved on a 10% polyacrylamide TBE gel (Bio-Rad, Hercules, CA).

  Microinjection and mouse rearing: FVB / NTac and C57BL / 6NTac mice were housed in static cages and maintained in a 14 hour / 10 hour sunlight / dark cycle, with optional access to food and water. Three to four week old females were injected with PMS (5 IU / mouse) 48 hours prior to hCG (5 IU / mouse) injection. Single cell fertilized eggs were harvested for microinjection 10-12 hours after hCG injection. ZFN mRNA was injected at 2 ng / μL. The injected eggs were transferred to pseudopregnant females (Swiss Webster (SW) females from Taconic Lab mated with vasectomized SW males) at 0.5 dpc.

  Founder identification using mutation detection assay: Toe clips were incubated in 100-200 μL of QuickExtract (Epicentre Biotechnology) for 30 minutes at 50 ° C., 10 minutes at 65 ° C., and 3 minutes at 98 ° C. PCR and mutation detection assays were performed under the same conditions as in ZFN validation of cultured cells using the same set of primers.

  TA cloning and sequencing: To identify modifications in the founders, extracted DNA was amplified using Sigma's JumpStart Taq ReadyMix PCR kit. Each PCR reaction contained 25 μL 2 × ReadyMix, 5 μL primer, 1 μL template, and 19 μL water. The same PCR program as ZFN verification in cultured cells was used. Each PCR reaction was cloned using a TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions. At least 8 colonies were picked from each transformation, PCR amplified with T3 and T7 primers, and sequenced with either T3 or T7 primers. Sequencing was performed at Elim Biopharmaceuticals (Hayward, CA).

PCR to detect large deletions: To detect larger deletions, another set of primers was used for each of the targets:
Mdr1a 800F: catgctgtgaagcagatacc (SEQ ID NO: 176)
Mdr1a 800R: ctgaaaaactgaatgagacatttgc (SEQ ID NO: 177)

  Each 50 μL PCR contains 1 μL template, 5 μL 10 × Buffer II, 5 μL 10 μM each 800 F / R primer, 0.5 μL AccuPrime Taq Polymerase High Fidelity (Invitrogen), and 38.5 μL water did. The following program was used: 35 cycles of 95 ° C for 5 minutes, 95 ° C for 30 seconds, 2 ° C for 30 seconds, and 68 ° C for 45 seconds, then 68 ° C for 5 minutes, permanently 4 ° C. Samples were resolved on a 1% agarose gel. A specific band with a molecular weight lower than the weight was sequenced.

RNA preparation from tissues and RT-PCR: Mdr1a − / − or Mdr1a + / + littermates were sacrificed at 5-9 weeks of age for tissue collection. Large intestine, kidney, and liver tissues were dissected and used immediately or stored for later processing, and tissue biopsies were placed in RNAlater solution (Ambion) and stored at -20 ° C. All RNA was prepared using the GenElute Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer's instructions. To eliminate any DNA contamination, RNA was treated with DNAseI (New England Biolabs, Ipswich, Mass.) Before loading onto the purification column. The RT-PCR reaction was performed using 1 μL total RNA, primer RT-F (5′-GCCCGATAATAGATAGGAT) AGAT using the SuperScript ™ III One-Step RT-PCR System with Platinum® Taq High Fidelity kit (Invitrogen). (SEQ ID NO: 178), and RT-R (5′-GATAAGGAGAAAAGCTGCACC) (SEQ ID NO: 179). Reverse transcription and subsequent PCR were performed in one cycle at 55 ° C. for 30 minutes and 94 ° C. for 2 minutes for cDNA synthesis and for amplification at 94 ° C. for 15 seconds, 56 ° C. for 30 seconds, and 68 Run at 40 ° C for 1 minute for 40 cycles. PCR products were loaded into 1.2% agarose gel and visualized with ethidium bromide.

  Interestingly, the following three small deletions were found in two founders respectively: a 19 bp deletion in founders 7 and 36, a 21 bp deletion in founders 17 and 27, and a 6 bp deletion in founders 34 and 44. (FIG. 43).

Fast germline transmission from the Mdr1a founder was observed. In order to backcross wild-type FVB / N mice back to the F1 generation, nine of the founders were selected, all of which transmitted at least one mutant allele to their offspring. Seven founders transmitted multiple mutant alleles. Interestingly, in some cases, new alleles that were not identified in the founders also transmitted germline such as founders 6, 8, 13, 21, and 44 (Table 11).

  To verify that a deletion in the Mdr1a gene abolishes its expression, using a forward and reverse primer located in exons 5 and 9, respectively, from founder 23 with a 396 bp deletion (FIG. 44A) RT-PCR was performed on all RNA from the liver, kidney and intestine of constructed Mdr1a − / − mice. Mdr1a protein is specifically expressed in tissues. The liver and large intestine mainly express Mdr1a, and the kidney expresses both Mdr1a and Mdr1b. Samples from all Mdr1a − / − tissues have a sequence that is correlated with exon 7 skipping that introduces multiple immature stop codons in exon 8 in mutant animals than the corresponding wild-type sample. Less product was produced with lower yield.

  RT-PCR results show that the Mdr1a − / − sample lacks 172 bp exon 7 at a level lower than the wild-type level, probably due to an immature stop codon introduced by exon skipping (FIG. 44B) leading to disruption due to nonsense mutations. To produce transcripts that In the Mdr1a − / − sample, there are faint bands that are larger than the size of the wild type transcript, because amplification of those bands excised from the gel yields mainly exon skipped products. Is likely. The wild type size band in the second period of PCR was a mixture that did not yield a readable sequence (not shown). The mouse Mdr1a gene has 28 exons and the encoded protein consists of 2 units of 6 transmembrane domains (TM1-6 and TM7-12) and an ATP binding site with a linker region between them. All twelve TM domains as well as two ATP binding motifs are crucial for Mdr1a function. Mdr1a ZFN targets exon 7 which encodes TM3 and TM4. Partial proteins resulting from exon skipping and premature translational arrest do not function. Therefore, Mdr1a − / − mice obtained from founder 23 represent a functional knockout.

  To validate possible off-target sites for Mdr1a ZFN, 20 sites in the mouse genome that were most similar to the Mdr1a target site were identified and all had a 5 bp mismatch with the ZFN binding sequence. One site is present in the Mdr1b gene and is 88% identical to the Mdr1a gene. To verify the specificity of Mdr1a ZFN, a mutation detection assay was used to test the Mdr1b site in all 44 Mdr1a F0 mouse pups. None of the 44 mouse pups had NHEJ events at the Mdr1b site (FIG. 45). The finding that no modification was detected at the Mdr1b site in any of the 44 newborns indicates the specificity of Mdr1a ZFN. In addition, undesirable modifications at loci that are not bound to the target site are lost during subsequent mating.

Table 12 lists the sites at 20 sites in the mouse genome that were checked for off-target activity of Mdr1a ZFN, which are most similar (with 5 mismatches) to the Mdr1a target site. The number of chromosomes on which they are present and, if known, the gene name are listed. All mismatch bases are shown in lower case. Spacer sequences between binding sites are shown in bold.

The following 13 shows the amino acid sequence of the helix of active ZFN.


Example 76: Genome editing of the APP locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat APP locus was designed, constructed, and validated using the strategies and procedures previously described. (See Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. A pair of 4, 5, or 6 finger proteins that will bind the rat APP gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a pair of ZFNs was produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay identified a pair of active ZFNs that edited the APP locus. The zinc finger binding sites were 5'-GCCCAGCACCCTGACgcag-3 '(SEQ ID NO: 213) and 5'-tcGACAAGTACCTGGAG-3' (SEQ ID NO: 214).

To mediate editing of the APP locus in animals, rat fertilized embryos were microinjected with mRNA encoding an active pair of ZFNs using standard procedures. (See, eg, Geurts et al. (2009) above). The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the APP locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 32 shows the edited APP locus in two founder animals, one with a 292 bp deletion in exon 9 (FIG. 32A) and the other with a 309 bp deletion in exon 9 (FIG. 32B).

Example 77: Genome editing of the ApoE locus

  ZFNs active at the ApoE locus were identified as described above. That is, the rat ApoE gene (NM — 138828) was examined for putative zinc finger binding sites and ZFN pairs were constructed and tested essentially as described in Example 76. The ZFN pair targeted to bind to 5′-aaGCGGTTCAGGGCCTGctccccgggggt-3 ′ (SEQ ID NO: 215, contact site capitalized) and 5′-ggGATTACCTTGcGCTGGGtgcagactct-3 ′ (SEQ ID NO: 216) is the ApoE locus Was found.

Fertilized single cell embryos were injected with mRNA encoding an active ZFN pair as described in Example 76 above. The resulting animals were analyzed as detailed in Example 76. FIG. 30 shows two edited ApoE loci. One animal had a 16 bp deletion in the exon 2 target sequence and the second animal had a 1 bp deletion in the exon 2 target sequence. These deletions disrupt the reading frame of the ApoE coding region.

Example 78: Genomic editing of the BDNF locus

  To identify ZFNs that target and cleave the BDNF locus, the rat BDNF gene (NM — 012513) was examined for putative zinc finger binding sites. ZFN pairs were constructed and tested essentially as described in Example 76. This analysis revealed that ZFN pairs targeted to bind to 5'-cgGGGTCGGAGtGGCGCCgaacccctcat-3 '(SEQ ID NO: 217) and 5'-cgGGGTCGGAGtGGCGCCgaacctcat-3' (SEQ ID NO: 218) edited the BDNF locus I made it.

  Rat fertilized embryos were microinjected with mRNA encoding an active ZNF pair and analyzed essentially as described in Example 76 above. FIG. 46 shows the edited BDNF locus of two founder animals, one having a 14 bp deletion in the exon 2 target sequence and the other having a 7 bp deletion in the exon 2 target sequence. .

Genetically modified rats were observed for phenotypic changes. Homozygous animals died within 2 weeks of life. Heterozygotes and homozygous animals were smaller than the corresponding control animals (ie, from embryos microinjected with GFP mRNA).

Example 79: Genomic editing of PSEN1 in a model organism

  ZFN-mediated genome editing can be used to study the effects of “knock-out” mutations in AD-related chromosomal sequences, such as chromosomal sequences encoding PSEN1 protein in genetically modified model animals and cells derived from the animals . Such a model animal can be a rat. In general, ZFNs that bind to rat chromosomal sequences encoding PSEN1 protein associated with AD are used to introduce deletions or insertions so that the coding region of the PSEN1 gene is perturbed and a functional PSEN1 protein cannot be produced. can do.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 76 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of AD symptoms and disorders caused by PSEN1 “knockouts” can be assessed in genetically modified rats or their offspring. In addition, molecular analysis of AD-related pathways can be performed on cells obtained from genetically modified animals containing PSEN1 “knockouts”.

Example 80: Generation of a humanized rat expressing a mutant form of human PSEN2

  A missense mutation in PSEN2, which is part of an enzyme complex that cleaves amyloid beta peptide from APP, causes type 4 familial AD. One such mutation is the M239V missense mutation in which the methionine residue acid at position 239 in PSEN2 is replaced with a valine residue. ZFN-mediated genome editing can be used to generate humanized rats in which the rat PSEN2 gene is replaced with a mutant form of the human PSEN2 gene containing the M239V mutation. Such humanized rats can be used to study the development of diseases associated with mutant human PSEN2 protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target pathways leading to AD, including PSEN2.

  Genetically modified rats can be generated using the methods described in the above examples. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant PSEN2 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the PSEN2 protein.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 81: Genome editing of BZRAP1 in a model organism

  Using zinc finger nuclease (ZFN) -mediated genome editing, the effect of “knock-out” mutations on ASD-related chromosomal sequences, such as chromosomal sequences encoding the BZRAP1 protein, in genetically modified model animals and cells obtained from those animals Can study. Such a model animal can be a rat. In general, ZFNs that bind to the rat chromosomal sequence encoding the BZRAP1 protein associated with ASD can be used to introduce nonsense mutations into the coding region of the BZRAP1 gene so that no active BZRAP1 protein can be produced.

  Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into rat embryos. Rat embryos can be in the single cell stage upon microinjection. Control embryos can be injected with 0.1 mM EDTA. The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

Embryo development after microinjection and the development of ASD-related symptoms and disorders caused by BZRAP1 “knockout” can be assessed in genetically modified rats. With respect to BZRAP1, ASD-related symptoms and disorders can include the development of rheumatoid arthritis and altered inflammatory responses to the tumor. The results can be compared to control rats injected with 0.1 mM EDTA in which the chromosomal region encoding the BZRAP1 protein is not altered. In addition, molecular analysis of ASD-related pathways can be performed on cells obtained from genetically modified animals containing BZRAP1 “knockouts”.

Example 82: Generation of a humanized rat expressing a mutant form of human neulexin-1

  Missense mutations in neulexin-1, a synaptic protein that helps adhere neurons together at the synapse, are associated with autism. One such mutation is an L18Q missense mutation in which the leucine amino acid at position 18 in Neulexin-1 is replaced with glutamine. ZFN-mediated genome editing can be used to generate humanized rats in which the rat NRXN1 gene is replaced with a mutant form of the human NRXN1 gene containing the L18Q mutation. Such humanized rats can be used to study the onset of autism. In addition, humanized rats can be used to evaluate the efficacy of therapeutic agents for autism that may have targeted perforin-1.

Genetically modified rats can be generated using the method described in Example 81 above. However, to generate humanized rats, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant neulexin-1 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the Neulexin-1 protein.

Example 83: Genome editing of the NOG locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat NOG locus can be designed, constructed, and validated using the strategies and procedures previously described (Geurts et al. Science (2009)). 325: 433). The ZFN design can make use of pre-verified one-finger and two-finger module archive records. A pair of 4, 5, or 6 finger proteins that would bind the rat NOG gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into rat cells. Control cells can be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay can be used to identify a pair of active ZFNs that have edited the APP locus.

To mediate editing of the NOG locus in animals, rat fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (see, eg, Geurts et al., Supra). (2009)). The injected embryos can be either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the NOG locus can be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 84: Genome editing of BMP4 in a model organism

  Using ZFN-mediated genome editing to study the effects of “knock-out” mutations in neurodevelopmental disorder-related chromosomal sequences such as chromosomal sequences encoding BMP4 protein in genetically modified model animals and cells obtained from the animals Can do. Such a model animal can be a rat. Generally, deletions or insertions are made such that the coding region of the BMP4 gene is perturbed and a functional BMP4 protein cannot be produced using ZFNs that bind to the rat chromosomal sequence encoding the BMP4 protein associated with the neurodevelopmental pathway. Can be introduced.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 83 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The development of neurodevelopmental symptoms and disorders caused by BMP4 “knockouts” can be assessed in genetically modified rats or their offspring. In addition, molecular analysis of neurodevelopmental pathways can be performed on cells obtained from genetically modified animals containing BMP4 “knockouts”.

Example 85: Generation of a humanized rat expressing a mutant form of human BMP4

  Four missense mutations in BMP4 were detected in a population of human open spina bifida patients. ZFN-mediated genome editing can be used to generate humanized rats, where the rat BMP4 gene is replaced with a variant of the human BMP4 gene associated with the open spina bifida or any combination of the four mutations . Such humanized rats can be used to study the development of the open spina associated with mutant human BMP4 protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target the pathway leading to the open spina bifida containing BMP4.

Genetically modified rats can be generated using the method described in Example 83. However, to generate humanized rats, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant BMP4 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the BMP4 protein.

Example 86: Generation of a humanized rat expressing a mutant form of human perforin-1

  Missense mutations in perforin-1, a significant effector of lymphocyte cytotoxicity, lead to a wide variety of diseases ranging from familial hemophagocytic lymphohistiocytosis to an increased risk of tumor formation. One such mutation is a V50M missense mutation in which the valine amino acid at position 50 in perforin-1 is replaced with methionine. ZFN-mediated genome editing can be used to generate humanized rats, where the rat PRF1 gene is replaced with a mutant form of the human PRF1 gene containing the V50M mutation. Such humanized rats can be used to study the onset of diseases associated with mutant human perforin-1 protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may have targeted inflammatory pathways including perforin-1.

  Genetically modified rats can be generated using the method described in Example 38 above. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant perforin-1 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination to produce a humanized rat that expresses a mutant form of perforin-1 protein.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 87: Genomic editing of the TRPM5 locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat TRPM5 locus can be designed, constructed, and validated using previously described strategies and procedures (Geurts et al. Science (2009)). 325: 433). The ZFN design can be utilized for pre-verified 1-finger and 2-finger module archive records. A pair of 4, 5, or 6 finger proteins that would bind the rat TRPM5 gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylation encoding a pair of mRNAZFNs can be produced using known molecular biology techniques. mRNA can be transfected into rat cells. Control cells can be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay can be used to identify a pair of active ZFNs edited at the TRPM5 locus.

To mediate editing of the TRPM5 locus in animals, rat fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (see, eg, Geurts et al., Supra). (2009)). The injected embryos can be either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the TRPM5 locus can be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 88: ERAL1 genome editing in model organisms

  ZFN-mediated genome editing can be used to study the effects of “knock-out” mutations in nociceptive-related chromosomal sequences, such as chromosomal sequences encoding ERAL1 protein in genetically modified model animals and cells obtained from the animals . Such a model animal can be a rat. In general, ZFNs that bind to rat chromosomal sequences encoding ERAL1 proteins associated with the nociceptive pathway are used to disrupt deletions or insertions so that the coding region of the ERAL1 gene is perturbed and a functional ERAL1 protein cannot be produced. Can be introduced.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 87 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of AD symptoms and disorders caused by ERAL1 “knockouts” can be assessed in genetically modified rats or their offspring. Furthermore, molecular analysis of nociceptive-related pathways can be performed on cells obtained from genetically modified animals containing ERAL1 “knockouts”.

Example 89: Generation of a humanized rat expressing a mutant form of human SCN9A

  A missense mutation in SCN9A, a sodium ion channel expressed at high levels in nociceptive dorsal root ganglion (DRG) neurons, is a hereditary disorder characterized by symmetrical burning pain in the legs, lower limbs, and hands Related to limb pain. Three mutations are characterized in SCN9A: W897X located in the P loop of domain 2, I767X located in the S2 fragment of domain 2, and S459X located in the linker region between domain 1 and domain 2 , Any one of them will result in a truncated non-functional protein. Using ZFN-mediated genome editing, humanized rats can be generated, and the rat SCN9A gene is transformed into a variant of the human SCN9A gene that includes the W897X mutation, the I767X mutation, the S459X mutation, or any combination of the three mutations. Replaced. Such humanized rats can be used to study the development of limb erythema associated with mutant human SCN9A protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target pathways leading to lumbago, including SCN9A.

Genetically modified rats can be generated using the method described in Example 87 above. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant SCN9A protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the SCN9A protein.

Example 90: Identification of ZFNs editing the DISC1 locus

  The rat DISC1 gene was selected for zinc finger nuclease (ZFN) -mediated genome editing. ZFNs were designed, constructed, and verified using the strategies and procedures described previously (see Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The DISC1 gene region (NM_175596) is paired with a pair of 4, 5, or 6 that an existing module will fuse to bind to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. Finger proteins were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

Capped polyadenylated mRNAs encoding each pair of ZFNs were produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were injected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The assay involves a ZSC1 locus in which a ZFN pair targeted to bind to 5'-taGTCCCCGGCAGGCTATcctggggcgggtg-3 '(SEQ ID NO: 226, contact site is capitalized) and 5'-ccGTCACCAGGCGGGAgtggctgagtg-3' (SEQ ID NO: 227). It was revealed that it was cut within.

Example 91: Editing of the DISC1 locus in rat embryos Capped polyadenylated mRNA encoding an active pair of ZFNs was microinjected into rat fertilized embryos using standard procedures (see, eg, Geurts et al., Supra). (See 2009). The injected embryos were either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal was harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the DISC1 locus was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 47 shows the edited DISC1 locus with 20 bp deleted from the exon 5 target sequence. This deletion disrupts the reading frame of the DISC1 coding region.

Example 92: Identification of ZFNs that edit the BDNF locus

  To identify ZFNs that target and cleave the BDNF locus, the rat BDNF gene (NM — 012513) was examined for putative zinc finger binding sites. ZFN was constructed and tested essentially as described in Example 90. This analysis indicated that ZFN pairs targeted to bind to 5′-cgGGGTCGGAGtGGCGCCgaacccctcat-3 ′ (SEQ ID NO: 228) and 5′-ccGCCGTGGGGaGCTGAGcgtgtgtgac-3 ′ (SEQ ID NO: 229) were cleaved within the BDNF locus. Revealed.

  Rat fertilized embryos were microinjected with mRNA encoding an active ZNF pair and analyzed essentially as described in Example 91 above. FIG. 46 shows the edited BDNF locus of two founder animals, one having a 14 bp deletion in the exon 2 target sequence and the other having a 7 bp deletion in the exon 2 target sequence. .

Genetically modified rats were observed for phenotypic changes. Homozygous animals died within 2 weeks of life. Heterozygotes and homozygous animals were smaller than the corresponding control animals (ie, from embryos microinjected with GFP mRNA).

Example 93: ErbB4 genome editing in model organisms

  Using ZFN-mediated genome editing to study the effects of “knock-out” mutations in chromosomal sequences associated with schizophrenia, such as chromosomal sequences encoding ErbB4 protein in genetically modified model animals and cells obtained from the animals can do. Such a model animal can be a rat. In general, deletions or insertions are made such that the coding region of the ErbB4 gene is perturbed and a functional ErbB4 protein cannot be produced using ZFNs that bind to the rat chromosomal sequence encoding ErbB4 protein associated with schizophrenia. Can be introduced.

A suitable fertilized embryo can be microinjected with a capped polyadenylated mRNA encoding ZFN. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of schizophrenia symptoms and disorders caused by ErbB4 “knockouts” can be assessed in genetically modified rats or their offspring. Furthermore, molecular analysis of schizophrenia-related pathways can be performed on cells obtained from genetically modified animals containing ErbB4 “knockouts”.

Example 94: Generation of a humanized rat expressing a mutant form of human TPH1

  To develop “humanized” animal models for the assessment and treatment of symptoms of schizophrenia, rats can be generated that contain a genome containing a human variant of TPH1. The human variant may be A218C found within intron 7 of TPH1, which is thought to be highly associated with schizophrenia. ZFN-mediated genome editing can be used to generate humanized rats in which the rat gene is replaced with the A218C variant of human TPH1. Such humanized rats can be used to study the development of schizophrenia associated with mutant human proteins encoded by mutant TPH1. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may have targeted pathways related to TPH1.

  Genetically modified rats can be generated using the method described in Example 91 above. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding a mutant TPH1 protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the protein.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 95: Identification of ZFNs that edit the p53 locus

  The p53 gene was selected for zinc finger nuclease (ZFN) mediated genome editing. ZFN was designed, constructed, and verified using the strategies and procedures described above. (See Geurts et al. Science (2009) 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. The rat p53 gene region (NM — 0300989) is paired with a pair of 4, 5, or a pre-existing module that will fuse to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand. A 6-finger protein was examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

Capped polyadenylated mRNAs encoding each pair of ZFNs were produced using known molecular biology techniques. mRNA was transfected into rat cells. Control cells were transfected with mRNA encoding GFP. Active ZFN pairs were identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. In this assay, a ZFN pair targeted to bind to 5′-atCTGGAGGAAGACtGGAGAAcaagacc-3 ′ (SEQ ID NO: 234, contact sites are capitalized) and 5′-atATTCTGTAAGGAGCCCGGgcaagagg-3 ′ (SEQ ID NO: 235) Clarified that he edited the seat.

Example 96: Editing of the p53 locus in rat embryos

Capped polyadenylated mRNA encoding an active pair of ZFN was microinjected into rat fertilized embryos using standard procedures (see, eg, Geurts et al. (2009) above). Control embryos were microinjected with saline or mRNA encoding GFP. The injected embryos were transferred to pseudopregnant female rats to reach birth. Toe / tail clips of each production animal were collected for DNA extraction and analysis using the Cel-1 assay. As shown in FIG. 48, approximately 25% of laboratory animals had an edited p53 locus.

Example 97: Inactivation of p53 locus in rats

To determine that the edited p53 locus was inactivated, Western analysis was performed to confirm that no p53 protein was produced. Cell lysates were prepared from kidneys and livers of wild type and p53 knockout animals. As shown in FIG. 49, both cytoplasmic and nuclear lysates of p53 knockout animals lacked p53 protein. However, actin protein levels were constant in wild type and mutant samples. Therefore, the p53 edited rat was a p53 knockout rat.

Example 98: Identification of ZFNs that edit the BCRP locus in rats

A ZFN that targets and cleaves the BCRP gene was identified essentially as described in Example 95 above. The rat BCRP gene (NM — 1811381) was examined for a putative zinc finger binding site. ZFN was constructed and tested essentially as described in Example 95. It was found that ZFN pairs targeted to bind to 5'-atGACGTCCAAGGAAGAAAgtctgcagggt-3 '(SEQ ID NO: 236) and 5'-acGAGAATTCTTCGGCTgtatagtgtaa-3' (SEQ ID NO: 237) edited the BCRP gene.

Example 99: Editing the BCRP locus

Rat embryos were microinjected with mRNA encoding an active pair of BCRP ZFN, essentially as described in Examples 95 and 96. The injected embryos were incubated and DNA was extracted from the resulting animals. The target region of the BCRP gene was PCR amplified using appropriate primers. Amplified DNA was subcloned into a suitable vector and sequenced using standard methods. FIG. 39 shows the BCRP locus compiled in two founder animals. One animal had a 588 bp deletion in exon 7 and the second animal had a 696 bp deletion in exon 7. These deletions disrupt the reading frame of the BCRP coding region.

Example 100: Editing the Pten locus

  A ZFN that targets and cleaves the rat Pten locus was designed and tested for activity essentially as described in Example 95 above. An active pair of ZFNs was identified. The DNA binding sites were 5'-CCCCAGTTTGTGTCTCgcca-3 '(SEQ ID NO: 238) and 5'-gcTAAAGGTGAAGATCTA-3' (SEQ ID NO: 239). Capped polyadenylated mRNA encoding an active pair can be microinjected into rat embryos and the resulting embryos can be analyzed as described in Examples 95 and 96. Thus, the Pten locus can be edited to contain deletions or insertions so that the coding region is perturbed and no functional protein is created.

The table below shows the amino acid sequence of the helix of active ZFN.


Example 101: Genomic editing of HTT in a model organism

  Using ZFN-mediated genome editing to study the effects of “knock-out” mutations in trinucleotide repeat extension-related chromosomal sequences such as chromosomal sequences encoding HTT proteins in genetically modified model animals and cells derived from the animals be able to. Such a model animal can be a rat. In general, using ZFNs that bind to rat chromosomal sequences encoding HTT proteins associated with trinucleotide repeat elongation disorders, deletions are made so that the coding region of the HTT gene is perturbed and a functional HTT protein cannot be produced. Or an insertion can be introduced.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN according to known molecular biology techniques. The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of the target region from a pool of ZFN-treated cells produces a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture results in a mismatch formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The sequence of the edited chromosomal sequence can be analyzed. The development of a trinucleotide repeat stretch disorder caused by an HTT “knockout” can be assessed in genetically modified rats or their offspring. In addition, molecular analysis of trinucleotide repeat extension-related pathways can be performed on cells obtained from genetically modified animals that contain HTT “knockouts”.

Example 102: Generation of a humanized rat expressing a mutant form of a human gene involved in trinucleotide repeat elongation disorder

  Mutations in any of the chromosomal sequences involved in trinucleotide repeat elongation disorders were used in the generation of humanized rats that express mutant forms of the gene. The gene can be htt, ar, fxn, atxn1, atxn2, atxn3, atxn7, atxn10, dmpk, atn1, cbp, vldrr, and combinations thereof. ZFN-mediated genome editing can be used to generate humanized rats in which the rat gene is replaced with a mutant form of the human gene containing the mutation. Such humanized rats can be used to study the development of diseases associated with mutant human proteins encoding the gene of interest. In addition, humanized rats can be used to evaluate the efficacy of therapeutic agents that may have targeted pathways leading to trinucleotide repeat elongation disorders involving the gene of interest.

Genetically modified rats can be generated using the methods described in the above examples. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding the mutant protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the protein.

Example 103: Genome editing of 5-HTT in a model organism

  Using ZFN-mediated genome editing to study the effects of “knock-out” mutations in neurotransmission-related chromosomal sequences such as chromosomal sequences encoding 5-HTT protein in genetically modified model animals and cells obtained from the animals be able to. Such a model animal can be a rat. In general, using ZFNs that bind to rat chromosomal sequences encoding 5-HTT proteins associated with neurotransmission-related disorders, the coding region of the 5-HTT gene is perturbed and a functional 5-HTT protein cannot be produced As such, deletions or insertions can be introduced.

A suitable fertilized embryo can be microinjected with a capped polyadenylated mRNA encoding ZFN. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. Symptoms of neurotransmission and disorders caused by 5-HTT “knockouts” can be assessed in genetically modified rats or their offspring. In addition, molecular analysis of neurotransmission-related pathways can be performed on cells obtained from genetically modified animals containing ErbB4 “knockouts”.

Example 104: Generation of a humanized rat expressing a mutant form of a human gene involved in neurotransmission

  Mutations in any of the chromosomal sequences involved in neurotransmission disorders can be used in the generation of humanized rats that express gene variants. The genes are 5-HTT, COMT, DRD, SLC6A3, DAO, DTNBP1, GABAa, NMDA, NMMDAR, NR1, NR2a, NR2b, mGLUR1, mGLUR2, mGLUR3, mGLUR5, GLUR1, GLUR1, GAD3, GAT1, TAT4 , COMT, MAO, DBH, TyrH, CB1, CB2, FAAH, MAGL, and combinations thereof. ZFN-mediated genome editing can be used to generate humanized rats, where the rat gene is replaced with a variant of the human gene containing the mutation. Such humanized rats can be used to study the development of diseases associated with mutant human proteins encoding the gene of interest. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target pathways that lead to impaired neurotransmission, including the gene of interest.

Genetically modified rats can be generated using the methods described in the above examples. However, to generate a humanized rat, ZFN mRNA can be co-injected into the rat embryo with a human chromosomal sequence encoding the mutant protein. The rat chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized rat that expresses a mutant form of the protein.

Example 105: Genome editing of the APH-1 locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat APH-1 locus can be designed, constructed, and validated using the strategies and procedures previously described (Geurts et al. Science ( 2009) 325: 433). The ZFN design can make use of pre-verified one-finger and two-finger module archive records. A pair of 4, 5, or 6 finger proteins that can bind the rat APH-1 gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into rat cells. Control cells can then be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay can detect alleles at target loci that deviate from wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. The DNA “bubble” formed at the mismatch site can be cleaved with the surveyor nuclease Cel-1 and the cleavage product can be resolved by gel electrophoresis. This assay can identify a pair of active ZFNs that edit the APH-1 locus.

To mediate editing of the APH-1 locus in animals, rat fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (eg, Geurts et al, supra). (See 2009). The injected embryos can be either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA was isolated using standard procedures. The target region of the APH-1 locus can then be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 106: Genome editing of secretase-related genes in model organism cells

Design ZFN-mediated genome editing and bind to chromosomal sequences of secretase-related genes such as APH-1A, APH-1B, PSEN1, NCSTN, or PEN-2 ZFN essentially as described in Example 105 ZFNs can be used to test in cells of model organisms such as rats. Deletions or insertions can be introduced such that the coding region of the gene of interest is inactivated using ZFNs that target specific secretase-related genes.

Example 107: Genome editing of secretase-related genes in model organisms

Embryos of model organisms such as rats are harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN targeting secretase-related genes as detailed in Example 105 above. can do. A donor or exchange polynucleotide comprising a sequence for integration or exchange can be co-injected with ZFN. The resulting chromosomal region of the resulting animal can be analyzed as described above. Modified animals can be phenotypically analyzed for changes in behavior, learning, etc. In addition, genetically modified animals can be used to assess the efficacy of potential therapeutic agents for the treatment of secretase disorders.

Example 108: Genomic editing of the SOD1 locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat SOD1 locus can be designed, constructed, and validated using the strategies and procedures previously described (Geurts et al. Science (2009)). 325: 433). The ZFN design can make use of pre-verified one-finger and two-finger module archive records. A pair of 4, 5, or 6 finger proteins that would bind the rat SOD1 gene region to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand fused to an existing module Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into rat cells. Control cells can then be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. A DNA “bubble” that can be cleaved by the surveyor nuclease Cel-1 can be formed at the mismatch site, and the cleavage product can be resolved by gel electrophoresis. This assay can be used to identify a pair of active ZFNs that have edited the SOD1 locus.

To mediate editing of the SOD1 locus in animals, rat fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (see, eg, Geurts et al., Supra). (2009)). The injected embryos can be either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA can be isolated using standard procedures. The target region of the SOD1 locus can be PCR amplified using appropriate primers. Amplified DNA can be subcloned into a suitable vector and sequenced using standard methods.

Example 109: Genome editing of ALS-related genes in model organism cells

Designed ZFN-mediated genome editing and essentially chromosomal sequences of ALS-related genes such as SOD1, ALS2, FUS, TARDBP, or VEGF (A, B, or C) ZFN, as described in Example 108. ZFNs that bind can be used to test in cells of model organisms such as rats. ZFNs that target specific ALS-related genes can be used to introduce deletions or insertions such that the coding region of the gene of interest is inactivated.

Example 110: Genome editing of ALS-related genes in model organisms

Embryos of model organisms such as rats are harvested using standard procedures and injected with capped polyadenylated mRNA encoding ZFN targeting ALS-related genes as detailed in Example 108 above. can do. A donor or exchange polynucleotide comprising a sequence for integration or exchange can be co-injected with ZFN. The resulting chromosomal region of the resulting animal can be analyzed as described above. Modified animals can be phenotypically analyzed for changes in behavior, learning, etc. In addition, genetically modified animals can be used to assess the efficacy of potential therapeutic agents for the treatment of ALS.

Example 111: Genomic editing of the prnd locus

  A zinc finger nuclease (ZFN) that targets and cleaves the rat prdn locus can be designed, constructed, and validated using the strategies and procedures previously described (Geurts et al. Science (2009)). 325: 433). The ZFN design utilized a pre-validated archive of 1-finger and 2-finger modules. A pair of 4, 5, or 6 finger proteins that would bind the rat prdn gene region to an existing module fused to a 12-18 bp sequence on one strand and a 12-18 bp sequence on the other strand Were examined for a putative zinc finger binding site that can be generated with an approximately 5-6 bp sequence between the two binding sites.

  A capped polyadenylated mRNA encoding a ZFN pair can be produced using known molecular biology techniques. mRNA can be transfected into rat cells. Control cells can be injected with mRNA encoding GFP. Active ZFN pairs can be identified by detecting ZFN-induced double-strand chromosomal breaks using a Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from the wild type as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. This assay can identify a pair of active ZFNs edited at the prnd locus.

To mediate the editing of the prnd locus in animals, rat fertilized embryos can be microinjected with mRNA encoding an active pair of ZFNs using standard procedures (see, eg, Geurts et al., Supra). (2009)). The injected embryos can be either incubated in vitro or transferred to pseudopregnant female rats to reach birth. The resulting embryo / fetus, or toe / tail clip of the production animal can be harvested for DNA extraction and analysis. DNA can be isolated using standard procedures. The target region of the prnd locus is PCR amplified using appropriate primers. Amplified DNA is subcloned into a suitable vector and sequenced using standard methods.

Example 112: Genomic editing of the Dpl gene in model organism cells

  ZFN-mediated genome editing can be used to study the effects of “knock-out” mutations in AD-related chromosomal sequences, such as chromosomal sequences encoding Dpl protein in genetically modified model animals and cells derived from the animals . Such a model animal can be a rat. In general, ZFNs that bind to rat chromosomal sequences encoding Dpl proteins associated with AD are used to introduce deletions or insertions so that the coding region of the Dpl gene is perturbed and a functional Dpl protein cannot be produced. can do.

Suitable fertilized embryos can be microinjected with capped polyadenylated mRNA encoding ZFN essentially as detailed in Example 111 above. The frequency of ZFN-induced double-strand chromosomal breaks can be determined using the Cel-1 nuclease assay, as detailed above. The edited chromosomal sequence can be analyzed as described above. The onset of AD symptoms and disorders caused by Dpl “knockouts” can be assessed in genetically modified rats or their offspring. Furthermore, molecular analysis of AD-related pathways can be performed on cells obtained from genetically modified animals containing Dpl “knockouts”.

Example 113: Genomic editing of the Prp gene in a model organism

Coding the polymorphism at PrP codon 129 is strongly associated with susceptibility and phenotypic effects, especially when the amino acid at codon 129 is methionine or valine. ZFN-mediated genome editing can be used to generate humanized rats in which the rat Prp gene is replaced with a mutant form of the human Prpn gene comprising a sequence having 129M or 129V. Such humanized rats can be used to study the development of diseases associated with mutant human PSEN2 protein. In addition, humanized rats can be used to assess the efficacy of therapeutic agents that may target pathways leading to prion disorders, including neurotoxic PrP isoforms.

Example 114: Agouti genome editing in model organism cells

  Using ZFNs that bind zinc finger nuclease (ZFN) -mediated genome editing to the chromosomal sequences of equine cell coat colors such as MSH receptor protein, agouti signaling protein (ASIP), and melanophylline (MLPH), It can be tested in cells of model organisms such as horses. The particular hair color-related gene being edited can be a gene having a DNA binding site identical to the DNA binding site of the corresponding equine homologue of the gene. Capped polyadenylated mRNA encoding ZFNs includes, but is not limited to, techniques substantially similar to those described in Science (2009) 325: 433, which is incorporated herein by reference in its entirety. It can be produced using known molecular biology techniques. mRNA can be transfected into horse cells. Control cells can be injected with mRNA encoding GFP.

  The frequency of ZFN-induced double stranded chromosome breaks can be determined using the Cel-1 nuclease assay. This assay detects alleles at target loci that deviate from wild type (WT) as a result of non-homologous end joining (NHEJ) -mediated incomplete repair of ZFN-induced DNA double-strand breaks. PCR amplification of target regions from a pool of ZFN-treated cells can produce a mixture of WT and mutant amplicons. Melting and re-annealing of this mixture can result in mismatches formed between the WT heteroduplex and the mutant allele. DNA “bubbles” formed at mismatch sites can be cleaved with Surveyor Nuclease Cel-1 and the cleavage products can be separated by gel electrophoresis. The relative intensity of the cleavage product compared to the parent band is a measure of the level of heteroduplex Cel-1 cleavage. This, in turn, reflects the frequency of ZFN-mediated cleavage of the endogenous target locus that later undergoes incomplete repair by NHEJ.

The results of this experiment can demonstrate the cleavage of selected hair color-related loci in horse cells using ZFNs.

Example 115: Agouti genome editing in a model organism embryo

  Embryos of model organisms such as horses can be harvested using standard procedures and injected with capped polyadenylated mRNA encoding a ZFN similar to the ZFN described in Example 114. Horse embryos can generally be at the 1 cell stage upon microinjection. Control embryos can be injected with 0.1 mM EDTA. The frequency of ZFN-induced double-stranded chromosome breaks can be estimated using the Cel-1 assay described in Example 114. Cleavage efficiency can be estimated using Cel-1 assay results.

Embryo development after microinjection can be assessed. Embryos injected with small amounts of ZFN mRNA can be compared to embryos injected with EDTA to determine the effect of ZFN mRNA on embryo survival to the blastocyst stage.

Example 116: Generation of a humanized horse that expresses a mutant form of human SCID

  The first human mutation in the gene encoding DNA-PKcs (DNA-dependent protein kinase catalytic subunit) was identified in radiation sensitive TB-SCID patients. Although mutations in the DNA-PKcs gene have long been predicted, accidental mutations have only been identified in mouse, horse, and dog models. Single base changes in DNA-PKcs can lead to changes in disease-related kinase subunit proteins. ZFN-mediated genome editing can be used to generate humanized horses in which horse DNA-PKcs is replaced with a mutant form of human DNA-PKcs containing one or more mutations. Such humanized horses can be used to study the development of diseases associated with mutant human DNA-PKcs proteins. In addition, humanized horses can be used to assess the efficacy of therapeutic agents that may target pathways leading to immunodeficiency, including DNA-PKcs.

  Genetically modified horses can be generated using the methods described in the above examples. However, to generate a humanized horse, ZFN mRNA can be co-injected into a horse embryo with a human chromosomal sequence encoding a mutant DNA-PKcs protein. The equine chromosomal sequence can then be replaced by a mutant human sequence by homologous recombination, producing a humanized horse that expresses a mutant form of the DNA-PKcs protein.

Claims (20)

A method for editing a chromosomal sequence comprising:
(A) at least one nucleic acid encoding a zinc finger nuclease capable of recognizing a target sequence in the chromosomal sequence and cleaving a cleavage site in the chromosomal sequence in a cell containing the chromosomal sequence; In addition,
(I) at least one donor polynucleotide comprising a donor sequence for integration, an upstream sequence, and a downstream sequence, said donor sequence being flanked by said upstream sequence and said downstream sequence, said upstream sequence and The downstream sequence shares substantial sequence identity with either side of the cleavage site, or (ii) an exchange sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site Introducing at least one exchange polynucleotide further comprising at least one nucleotide change; and
(B) culturing the cell to allow expression of the zinc finger nuclease such that the zinc finger nuclease introduces a double-strand break into the chromosomal sequence at the cleavage site, The double-strand break is
(I) a non-homologous end-joining repair process, such that mutations are introduced into the chromosomal sequence, or optionally,
(Ii) the donor sequence is incorporated into the chromosomal sequence, or repaired by a homology-directed repair process such that the exchange sequence is replaced with the portion of the chromosomal sequence. .   The method of claim 1, wherein the cell is an embryo.   The method of claim 2, wherein the embryo is a unicellular embryo.   2. The method of claim 1, wherein two or more nucleic acids encoding a zinc finger nuclease are introduced into the cell.   The method of claim 1, wherein the nucleic acid encoding a zinc finger nuclease is RNA.   6. The method of claim 5, wherein the RNA is capped.   6. The method of claim 5, wherein the RNA is polyadenylated.   2. The method of claim 1, wherein two or more of the polynucleotides selected from the donor polynucleotide, the exchange polynucleotide, or any combination thereof are introduced into the cell.   The method according to claim 1, wherein the cell is a cultured cell, a primary cell, or a stem cell.   The method of claim 1, wherein the cell is a human cell, a mammalian cell, a vertebrate cell, an invertebrate cell, or a fungal cell.   A non-human animal, wherein the animal is produced by the method of claim 1.   The non-human animal according to claim 11, wherein the animal is a rodent.   The non-human animal according to claim 11, wherein the animal is a livestock animal.   The non-human animal according to claim 11, wherein the animal is a companion animal.   A cell, wherein the cell is created using the method of claim 1.   The cell according to claim 15, wherein the cell is an embryo.   17. The cell of claim 16, wherein the embryo is a single cell embryo.   The cell according to claim 15, wherein the cell is a cultured cell, a primary cell, or a stem cell. An embryo, wherein the embryo recognizes a target sequence in the chromosomal sequence and optionally encodes a zinc finger nuclease capable of cleaving a cleavage site in the chromosomal sequence; and optionally,
(I) at least one donor polynucleotide comprising a donor sequence for integration, an upstream sequence, and a downstream sequence, said donor sequence being flanked by said upstream sequence and said downstream sequence, said upstream sequence and The downstream sequence shares substantial sequence identity with either side of the cleavage site, or (ii) an exchange sequence that is substantially identical to a portion of the chromosomal sequence at the cleavage site And at least one exchange polynucleotide further comprising at least one nucleotide change.   20. The embryo of claim 19, wherein the embryo is a single cell embryo.