JP2011116669A - Skin care preparation - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a skin care preparation, bleaching ingredient, antioxidant, hyaluronic acid production promoter and hyaluronidase inhibitor that contain extracts of Calea urticifolia. <P>SOLUTION: The extract of Calea urticifolia has excellent melanogenesis inhibitory action, antioxidant action, hyaluronic acid production promoting action and hyaluronidase inhibitory action and excellent safety. The skin care preparation containing the extract of Calea urticifolia is effective as a skin care preparation for aging prevention or a skin care preparation for bleaching. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a novel skin external preparation excellent in anti-aging and whitening action.

  In recent years, free radicals and active oxygen have been taken up as factors that oxidize biological components, and their adverse effects have become a problem. It is said that free radicals and active oxygen are generated in the living body, decompose or crosslink biological tissues such as collagen, and oxidize fats and oils to form lipid peroxides that damage cells. Such disorders are thought to cause aging such as wrinkles and firmness of the skin, and one method of preventing aging is to incorporate an antioxidant that removes free radicals and active oxygen. Are known. Conventional free radical scavengers used to prevent aging include ascorbic acid (vitamin C), tocopherol (vitamin E), 3,5-tert-butyl-4-hydroxytoluene (BHT), superoxide dismutase (SOD) Etc. have been used (see Patent Documents 1 and 2).

  The skin consists of the epidermis, dermis, and subcutaneous tissue. Among them, the dermis is extremely important for maintaining the structure of the skin and consists of fibroblasts and matrix components. Fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue and keep the skin firm. It is believed that this connective tissue loses its contractile force and further loses its elasticity, resulting in skin wrinkles and sagging.

  In particular, hyaluronic acid is known as a high molecular weight polysaccharide widely distributed in connective tissue, retains a large amount of moisture in the skin, and exhibits a gel-like form. Therefore, alteration and reduction of hyaluronic acid are considered to be important in skin aging. Further, since hyaluronic acid is a polymer, there is a problem that it is difficult to absorb even if a cosmetic containing the hyaluronic acid is directly applied to the skin. So far, an external preparation for skin that can promote the synthesis of its own collagen and hyaluronic acid by activating fibroblasts has been sought (see Patent Document 3).

  In addition, hyaluronidase activated during inflammation is known to reduce the elasticity of the skin by reducing the molecular weight of high-molecular hyaluronic acid, thereby causing aging such as wrinkles. It is known to add a hyaluronidase inhibitor as one of the methods for preventing the skin wrinkles and tarmi (see Patent Documents 4 and 5).

  In general, pigmentation of the skin seen in spots, buckwheat, sunburn, etc. is caused by excessive melanin pigment formation by melanin-producing cells present in the skin due to hormonal abnormalities or stimulation of ultraviolet rays, which deposits in the skin. Is considered to be the cause. As one method for preventing such pigmentation, a method for suppressing excessive production of melanin is known. Conventionally, treatments for applying pigment such as hydroquinone or ascorbic acid (vitamin C) have been performed for the treatment of pigmentation.

  However, as a plant-derived natural raw material having these antioxidant effects, hyaluronic acid production promoting effects, hyaluronidase inhibitory effects, and melanin production suppressing effects, the fanis llama used in the present invention has not been studied.

JP 61-30510 A JP-A-62-19511 JP2007-1924 Japanese Patent Laid-Open No. 02-11520 JP 06-80553 A

  SOD used for the purpose of preventing skin aging or anti-oxidation is unstable, difficult to formulate, and tocopherol is not effective enough. Moreover, since BHT etc. which are synthetic compounds have a problem in stability and there are restrictions on the amount of compounding, natural raw materials that are stable and have few side effects are desired rather than chemically synthesized products. Similarly, it is preferable for preventing aging that it has a natural hyaluronidase inhibitory action and hyaluronic acid production promoting action derived from natural products. In addition, since ascorbic acid used as a whitening agent and an antioxidant has drawbacks such as being easily decomposed over time, a skin external preparation derived from natural products having high stability and excellent effect is also desired. .

  From the above, a skin external preparation excellent in stability and anti-aging and whitening action derived from a natural product having excellent stability is desired.

  Under these circumstances, the present inventors have intensively studied, and as a result, the extract obtained from Fanislama has excellent antioxidant action, hyaluronic acid production promoting action, hyaluronidase inhibitory action and melanin production inhibitory action, and stability. Was found to be excellent, and the present invention was completed. That is, the present invention is an external preparation for skin, a whitening agent, an antioxidant, a hyaluronic acid production promoter and a hyaluronidase inhibitor characterized by containing an extract of fanislama.

  The extract of the fanis llama of the present invention had excellent antioxidative action, hyaluronic acid production promoting action, hyaluronidase inhibitory action and melanin production inhibitory action, and was also excellent in stability. Therefore, the skin external preparation containing the extract of the fanis lama of the present invention is particularly effective as a skin external preparation for anti-aging or a skin external preparation for whitening.

  The Fanis Lama (scientific name: Carea urticifolia) used in the present invention is a plant of the family Asteraceae that mainly inhabits Latin America. As this plant, a native plant or a cultivated plant can be used.

  The extract of the fanis llama used in the present invention is one extracted from a part of the plant body such as leaves, branches, bark, flowers, fruits, seeds, roots or the whole plant of the fanis llama. The extraction method is not particularly limited, and for example, it may be a heat extraction or a room temperature extraction. The extract of the fanis llama of the present invention can be obtained by extracting from the whole or any part of the fanis llama plant, but it is particularly preferable to extract from the whole plant.

  Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol). , Glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether) Etc.). Preferred are polar solvents such as water, lower alcohols and liquid polyhydric alcohols, and particularly preferred are water, ethanol, 1,3-butylene glycol and propylene glycol. These solvents may be used alone or in combination of two or more.

  The extract may be used as it is, or may be used after concentration, dilution and filtration treatment, decolorization with activated carbon, deodorization treatment, or the like, if necessary. Further, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

  In the external preparation for skin of the present invention, the above extract may be used as it is, and within the range where the effect is not impaired, fats and oils, waxes, hydrocarbons, fatty acids, alcohols which are components used in the external preparation , Esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, dyes, antioxidants, whitening agents, chelating agents, etc. Can be blended.

  The external preparation for skin of the present invention can be used for any of cosmetics, quasi drugs, and pharmaceuticals. Examples of the dosage form include skin lotions, creams, emulsions, gels, aerosols, essences, packs, Examples of the cleaning agent, bath preparation, foundation, dusting powder, lipstick, ointment, and poultice applied to the skin.

  The amount of the extract used in the present invention is 0.000001% by weight or more, preferably 0.00001 to 10% by weight in terms of solid matter with respect to the external preparation for skin of the present invention. If it is less than 0.000001% by weight, a sufficient effect is hardly expected. When the blending amount exceeds 10% by weight, the effect is hardly recognized and it is uneconomical. In addition, the addition method may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  Next, in order to describe the present invention in detail, examples of production of the extract used in the present invention, formulation examples and experimental examples will be given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.

Production Example 1 Hot Water Extract of Fanislama 500 ml of purified water was added to 25 g of dried material of whole Fanislama, extracted at 95-100 ° C for 2 hours, filtered, the filtrate was concentrated, freeze-dried, 4.9 g of hot water extract was obtained.

Production Example 2 50% Ethanol Extract of Fanislama 500 ml of 50% ethanol was added to 25 g of dried whole plant of Fanislama, extracted at room temperature for 3 days, filtered, and the filtrate was concentrated to dryness to give 50% 4.5 g of ethanol extract was obtained.

Production Example 3 Ethanol Extract of Fanislama 500 mL of ethanol was added to 25 g of a dried product of the whole plant of Fanislama, extracted at room temperature for 3 days, filtered, and the filtrate was concentrated to dryness. 7 g was obtained.

Production Example 4 50% 1,3-Butylene Glycol Extract of Fanislama To 500 g of 50% 1,3-butyleneglycol was added to 25 g of dried whole plant of Fanislama, extracted at room temperature for 3 days, filtered, and filtered. 450 g of% 1,3-butylene glycol extract was obtained.

Formulation Example 1 Lotion Prescription Formulation Amount (parts)
1. Fanislama hot water extract (Production Example 1) 1.0
2.1,3-Butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5). Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Formulation Example 2 Cream Formulation Amount (parts)
1. Fanislama 50% ethanol extract (Production Example 2) 0.5
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5). Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12 Ethyl paraoxybenzoate 0.05
13.1,3-Butylene glycol 8.5
14 [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 3 Emulsion Formulation Blending amount (parts)
1. Fanislama hot water extract (Production Example 1) 0.001
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5). Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to obtain an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 9 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 4 Gel formulation Formulation Amount (parts)
1. Fanislama hot water extract (Production Example 1) 1.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5). Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 5 Pack Formulation Amount (parts)
1. Fanislama hot water extract (Production Example 1) 0.1
2. Fanislama 50% ethanol extract (Production Example 2) 0.1
3. Polyvinyl alcohol 12.0
4). Ethanol 5.0
5.1,3-butylene glycol 8.0
6). Methyl paraoxybenzoate 0.2
7). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
8). Citric acid 0.1
9. Sodium citrate 0.3
10. Perfume proper amount11. [Production Method] Components 1 to 11 are uniformly dissolved in purified water to make a total amount of 100 to obtain a product.

Formulation Example 6 Foundation Formulation Amount (parts)
1. Ethanol extract of Fanislama (Production Example 3) 1.0
2. Stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
4). Polyoxyethylene cetyl ether (20E.O.) 2.0
5). Cetanol 1.0
6). Liquid lanolin 2.0
7). Liquid paraffin 3.0
8). Isopropyl myristate 6.5
9. Sodium carboxymethylcellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12 Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14 Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Perfume proper amount19. [Manufacturing method] Components 2 to 8 are heated and dissolved in purified water to a total amount of 100, and kept at 80 ° C to obtain an oil phase. Swell component 9 well in component 19, then add components 1 and 10-13 and mix uniformly. To this, components 14 to 17 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The oil phase is added to this aqueous phase with stirring, cooled, component 18 is added at 45 ° C., and cooled to 30 ° C. with stirring to give a product.

Formulation Example 7 Bath preparation Formulation Blending (parts)
1. Fanislama hot water extract (Production Example 1) 5.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume appropriate amount 5. [Production method] Ingredients 1-5 are uniformly mixed with sodium sulfate to make a product.

Formulation Example 8 Ointment Formulation Amount (parts)
1. Fanislama hot water extract (Production Example 1) 0.01
2. Fanislama 50% 1,3-butylene glycol extract (Production Example 4) 0.5
3. Polyoxyethylene cetyl ether (30E.O.) 2.0
4). Glycerol monostearate 10.0
5). Liquid paraffin 5.0
6). Cetanol 6.0
7). Methyl paraoxybenzoate 0.1
8). Propylene glycol 10.0
9. [Production Method] Components 3 to 6 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C. to obtain an oil phase. Ingredients 1, 2, and 7-9 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled to 30 ° C. with stirring to obtain a product.

  Next, experimental examples will be given to explain the effects of the present invention in detail.

Experimental Example 1 Free radical scavenging action Free radical scavenging action was evaluated. The free radical model is α, α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), which is a stable free radical. Was determined from the decrease in absorbance at a wavelength of 517 nm.

Method for measuring free radical scavenging action The extract used in Preparation Examples 1 to 3 was used as a sample.
Each sample was used as a reaction solution by adding 2 mL of absolute ethanol and 1 mL of 0.5 mM DPPH absolute ethanol solution to 2 mL of 0.1 M acetate buffer (pH 5.5) added to a final concentration of 0.1 mg / mL. In the case of an oil-soluble sample, the sample was added to 2 mL of absolute ethanol to prepare a reaction solution. Then, it was made to react at 37 degreeC for 30 minute (s), and the light absorbency (A) of wavelength 517nm was measured by using water as a control. Moreover, the light absorbency (B) was measured using the purified water instead of the sample as a blank. The free radical elimination rate was calculated from the following formula.
Free radical scavenging rate (%) = (1−A / B) × 100

  The test results are shown in Table 1. The fanislama extract of the present invention showed an excellent antioxidant action due to free radical scavenging action. The effect was high in all hot water, 50% ethanol and ethanol extract.

Experimental Example 2 Melanin Production Inhibition Test Using B16 Mouse Melanoma The extract used in Production Examples 1 to 3 was used as a sample.
B16 mouse melanoma in the logarithmic growth phase is seeded with 3 × 10 ⁴ cells in a φ60 mm dish, and an Eagles'MEM (containing 10% fetal bovine serum) medium containing samples with final concentrations of 0.1 and 0.01 μg / mL is used. In addition, the cells were cultured under the conditions of 37 ° C. and 5% CO ₂ . After 5 days of culturing, the cells were detached from the dish, and the cells were sonicated, then 4N NaOH was added and treated at 60 ° C. for 2 hours. D. 475 nm was measured. In addition, cell lysate after sonication was subjected to protein quantification by Lowry's method (J. Biol. Chem., 193, 265-275, 1951), and the amount of melanin per amount of protein was compared to suppress melanin production. It was used as an effect index.

  The test results are shown in Table 2. The extract of the fanis lama of this invention showed the outstanding whitening effect by suppressing the production | generation of melanin. In particular, an excellent whitening effect was observed in the ethanol extract.

Experimental Example 3 Measurement of hyaluronic acid synthase II mRNA expression level The extract described in Production Examples 1 to 3 was used as a sample.
1 × 10 ⁵ human fibroblasts NB1RGB were seeded in a 60 mm dish, and 1 μg / mL sample was added when the cells became confluent. As a control, a solvent in which the sample was diluted was added. After culturing for 24 hours, total RNA was extracted. Extraction of total RNA from cells was performed using TRIZOL Reagent (Invitrogen), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). Measurement of mRNA expression level was performed by real-time RT-PCR method based on total RNA extracted from cells. For the real-time RT-PCR method, SuperScript3 Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen) was used. Specifically, 500 ng of total RNA was subjected to a reverse transcription reaction, followed by a PCR reaction (95 ° C .: 15 seconds, 60 ° C .: 30 seconds, 40 cycles). For other operations, the expression level of hyaluronic acid synthase II mRNA was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, in accordance with a prescribed method. The hyaluronic acid synthase expression promoting effect was calculated as the ratio of the expression level of the hyaluronic acid synthase II mRNA in the sample addition group to the control hyaluronic acid synthase II mRNA expression level. The primers used for measuring the expression level of each gene are as follows.

Primer set TGGATGACCCTACGAAGCGATTA for hyaluronic acid synthase II (SEQ ID NO: 1)
GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 2)
Primer set CACTCTCCCAGCCCTTCCTCC for β-actin (SEQ ID NO: 3)
GTGTTGCGCGTACAGGTCTTTG (SEQ ID NO: 4)

  The results of these experiments are shown in Table 3. As a result, an excellent hyaluronic acid synthase expression promoting effect was observed in the extract of the fanis llama of the present invention. Therefore, the extract of Fanislama showed an excellent anti-aging effect by promoting the production of hyaluronic acid. The effect was high in all hot water, 50% ethanol and ethanol extract.

Experimental Example 4 Hyaluronidase Inhibition Test The extract described in Production Examples 1 to 3 was used as a sample.
The test was performed according to a method applying the Morgan-Elson method [Food Hygiene Journal, 31, 3 (1990)]. 175 μL of 0.1 M acetate buffer (pH 4.0) was added to a sample solution with a final concentration of 1.0 mg / mL, and the enzyme activity of hyaluronidase was 250 U / mL, the concentration of hyaluronic acid was 0.4 mg / mL, and the activator The total amount was adjusted to 500 μL so that compound 48/80 was 0.08 mg / mL, and then the hyaluronidase reaction was performed at 37 ° C. for 40 minutes. After the reaction, a p-dimethylaminobenzaldehyde reagent was added to develop color, and the absorbance at 585 nm was measured. Moreover, the inhibitory action of each sample was calculated by the inhibition rate calculated | required from the following formula. For the control, purified water was used instead of the sample solution, and 0.1 M acetate buffer (pH 4.0) was used instead of hyaluronidase as a blank.
Inhibition rate (%) = [1- (C−D) / (A−B)] × 100
A: Absorbance at 585 nm of control (OD 585)
B: O. D. 585
C: Sample O.D. D. 585
D: Sample blank O.D. D. 585

  The results of these experiments are shown in Table 4. An excellent hyaluronidase inhibitory effect was observed in the extract of the fanis llama of the present invention. Therefore, the extract of Fanislama showed an excellent anti-aging effect by suppressing the degradation of hyaluronic acid by suppressing the activity of hyaluronidase. In particular, a high effect was observed on the hot water extract.

  From the above, the extract of Fanislama had an excellent antioxidant effect, hyaluronic acid production promoting effect, hyaluronidase inhibitory effect and melanin production inhibitory effect, and was also excellent in stability. Therefore, the skin external preparation containing the extract of the fanis lama of the present invention is particularly effective as a skin external preparation for anti-aging or a skin external preparation for whitening.

Claims (5)

An external preparation for skin containing an extract of Fanislama.
A whitening agent containing an extract of Fanislama.
An antioxidant comprising an extract of Fanislama.
A hyaluronic acid production promoter characterized by containing an extract of Fanis Lama.
A hyaluronidase inhibitor characterized by containing an extract of Fanislama.