JP2010100534A - Nfat signal inhibitor and hair-growing agent, and novel compound exhibiting nfat signal-inhibiting and hair-growing activity - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To identify an active ingredient exhibiting NFAT signal-inhibiting activities and/or hair-growing activities. <P>SOLUTION: An active ingredient that is contained in the extract from Styrax benzoin and exhibits NFAT signal-inhibiting activities and/or hair-growing activities is identified. The active ingredient is a novel neolignan derivative having a predetermined structure. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a NFAT (nuclear factor of activated T cells) signal inhibitor and a hair restorer, which contain an active ingredient contained in a plant or plant extract as an active ingredient.

  Nuclear factor of activated T cells (hereinafter abbreviated as NFAT) was discovered as a factor that activates the transcription of Interleukin-2 (IL-2), which is important for T cell activation, and is an immunosuppressant cyclosporine. It has been reported that the transcriptional activity is regulated by serine / threonine phosphatase calcineurin which is a target of A (hereinafter abbreviated as CsA) and tacrolimus (hereinafter abbreviated as FK506) (FIG. 4). reference). That is, CsA and FK506 suppress T cell activation by inhibiting the NFAT signal. CsA and FK506 are approved not only as transplant immunosuppressants but also as therapeutic agents for rheumatoid arthritis, psoriasis, and atopic dermatitis, which are known to be involved in the immune system. A system in which such NFAT binds to an NFAT binding sequence (“NFAT site” in FIG. 4) to promote transcription of a gene downstream from the NFAT binding sequence is referred to as “NFAT signal”.

  On the other hand, it has been reported that the effect of hair growth (including hair growth) can be expected by inhibiting the NFAT signal (Non-patent Document 1). It has also been reported that CsA derivatives that inhibit the NFAT signal can be used as hair restorers (Patent Documents 1 and 2).

  In addition, NFAT is not limited to hair-growth and immune system, but is also used in many organs such as muscle tissue formation by regulating myocardial / skeletal muscle differentiation, neural network formation in the brain, and bone metabolism by regulating osteoblast differentiation. It has come to be understood as a "multifunctional transcription factor" that plays an important role.

  The role of the NFAT signal in the living body is as described above. By inhibiting the NFAT signal, immunosuppressive action (Non-Patent Document 2), psoriasis treatment (Non-Patent Document 3), atopic dermatitis treatment (Non-Patent Document 2) Patent document 4), (heart) muscle hypertrophy suppression (non-patent document 5), possibility as an anti-rheumatic drug (non-patent document 6), osteoclast differentiation inhibitory action (non-patent document 7), etc. Has been. In addition, as described above, since NFAT is mediated by a pathway that produces the immune cytokine IL-2, NFAT signal inhibitors are used to treat diseases that are thought to involve immune cytokines including autoimmune diseases. Useful for prevention. Examples of such target diseases include various cancers, various leukemias, various hepatitis, various infectious diseases, systemic lupus erythematosus, inflammatory bowel diseases (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes, digestion Ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral Examples include vascular disease, sepsis, interstitial liver disease, localized ileitis, and multiple sclerosis. Therefore, if a new NFAT signal inhibitor is identified, an immunosuppressive agent, a psoriasis therapeutic agent, an atopic dermatitis therapeutic agent, a (heart) muscle hypertrophy inhibitor, an anti-rheumatic agent, a bone metabolic disease therapeutic agent, and the above New medical uses such as those listed are expected. In addition, if a NFAT signal inhibitor is newly identified, quasi-drugs and cosmetics are expected as hair restorers and hair growth promoters.

  On the other hand, a resin extract of anthracanthus (referred to as anthracnose) is widely used as a fragrance. In addition, it is known that anthracnose has an important role as a preservative for medicines and cosmetics (Non-patent Document 8). However, there is no suggestion about an association with the NFAT signal with respect to anthony cypress or its extract or its component. Currently, apigenin (non-patent document 9) and rosmarinic acid (non-patent document 10) contained in various edible plants are known as compounds having NFAT signal inhibitory activity, and NFAT signal enhancing activity. Genistein (Non-patent Document 11) is known as a compound having a salt.

WO 01/035914 (Special Table No. 2003-514000) WO 2004/041221 (Special Table No. 2006-508103) Gafter-Gvili A, Sredni B, Gal R, Gafter U, and Kalechman Y, "Cyclosporin A-induced hair growth in mice is associated with inhibition of calcineurin-dependent activation of NFAT in follicular keratinocytes" Am J Physiol Cell Physiol, 284: C1593-C603, 2003 Lee M and Park J, "Regulation of NFAT activation: a potential therapeutic target for immunosuppression" Mol Cells, 22: 1-7, 2006 Feldman S, "Advances in psoriasis treatment" Dermatol Online J, 6: 4, 2000 Hultsch T, "Immunomodulation and safety of topical calcineurin inhibitors for the treatment of atopic dermatitis" Dermatology, 211: 2, 2005 Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, and Olson EN, "A calcineurin-dependent transcriptional pathway for cardiac hypertrophy" Cell, 93: 215-228, 1998 Urushibara M, Takayanagi H, Koga T, Kim S, Isobe M, Morishita Y, Nakagawa T, Loeffler M, Kodama T, Kurosawa H, and Taniguchi T, "Antirheumatic drug, leflunomide, inhibits osteoclastgenesis by interfering with RANKL-stimulated induction of NFATc1 "Arthritis and Rheumatism, 50: 794-804, 2004 Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, and Taniguchi T, "Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in termial differentiation of osteoclasts "Developmental Cell, 3: 889-901, 2002 World of Plants Issued June 18, 1995 Volume 62 38-39 Asahi Shimbun Jin Park et al., Immunology Letters, 103, 108-114, 2006 Mi-Ae Kang et al., Blood, 101, 3534-3542, 2003 Jin Park et al., Toxicology and Applied Pharmacology, 212, 188-199, 2006

  Therefore, in view of the above-described circumstances, the present invention identifies an active ingredient exhibiting NFAT signal inhibitory activity and / or hair restoring activity, and an object thereof is to provide an NFAT signal inhibitor and a hair restoring agent containing the active ingredient as an active ingredient. And

  As a result of diligent research to solve the above problems, the present inventors have succeeded in identifying a novel compound as an active ingredient that is contained in an extract of Anthony japonica and contributes to NFAT signal inhibitory activity and hair growth activity. It came to complete. The present invention includes the following.

（上記一般式（I）中、R1、R2、R3、R4、R5及びR6は、各々同じであっても異なっていてもよく、水素原子、ヒドロキシル基又はメトキシ基であり、R7は、水素原子、メチル基又はエチル基である）で示されるネオリグナン誘導体である。 That is, the novel compound having NFAT signal inhibitory activity and hair growth activity identified in the present invention is represented by the following general formula (I):

(In the above general formula (I), R1, R2, R3, R4, R5 and R6 may be the same or different and each is a hydrogen atom, a hydroxyl group or a methoxy group, and R7 is a hydrogen atom. , A methyl group or an ethyl group).

で示される化合物であることが好ましい。 In particular, the novel compound or neolignan derivative according to the present invention has the following structural formula (II):

It is preferable that it is a compound shown by these.

で示される化合物であることが好ましい。 Moreover, as a novel compound and neolignan derivative according to the present invention, the following structural formula (III):

It is preferable that it is a compound shown by these.

  The NFAT signal inhibitor according to the present invention contains, as an active ingredient, at least one compound selected from the group consisting of the above-described neolignan derivatives which are novel compounds and pharmacologically acceptable salts thereof.

  Furthermore, the hair restorer according to the present invention contains, as an active ingredient, at least one compound selected from the group consisting of the above-mentioned neolignan derivatives which are novel compounds and pharmacologically acceptable salts thereof.

  According to the present invention, a novel compound having an NFAT signal inhibitory activity and a hair-growing activity is provided, and an NFAT signal inhibitor and a hair-growing agent having an excellent NFAT signal inhibitory activity and a hair-growing activity, including the discussed novel compound or a salt thereof Can be provided.

Hereinafter, the present invention will be described in detail.
The NFAT signal inhibitor and hair restorer according to the present invention are contained in an anthracnose plant or an extract of the plant, and an active ingredient having an NFAT signal inhibitory activity and / or hair restorer activity is used as an active ingredient. Here, anthony is a plant that has the scientific name Styrax benzoin and is classified into the family Echinaceae.

  Here, the active ingredient is a neolignan derivative represented by the following general formula (I) or a pharmacologically acceptable salt thereof.

  In the general formula (I), R1, R2, R3, R4, R5 and R6 may be the same or different and each is a hydrogen atom, a hydroxyl group or a methoxy group, and R7 is a hydrogen atom, A methyl group or an ethyl group.

  That is, the neolignan derivative that can be used as an active ingredient includes various compounds in the range of R1 to R7 defined as described above. In particular, as a neolignan derivative that can be used as an active ingredient, it is preferable that one of R1 and R2 is a methoxy group and the other is a hydroxyl group. In addition, as a neolignan derivative that can be used as an active ingredient, it is preferable that one of R3 and R4 is a hydroxyl group and the other is a methoxy group or a hydrogen atom. Furthermore, as a neolignan derivative that can be used as an active ingredient, it is preferable that both R5 and R6 are hydrogen atoms. Furthermore, R7 is preferably an ethyl group.

で示される化合物又は次の構造式（III）：

で示される化合物であることが好ましい。 Among these, as a neolignan derivative that can be used as an active ingredient, the following structural formula (II):

Or a compound represented by the following structural formula (III):

It is preferable that it is a compound shown by these.

  In addition, the NFAT signal inhibitory activity and / or hair growth activity in the neolignan derivative described above can be measured as follows. Here, NFAT signal inhibition means reducing the transcription promoting activity by NFAT by acting directly or indirectly on NFAT. The method for measuring the NFAT signal inhibitory action is not particularly limited, and examples thereof include a reporter assay using a host in which a known NFAT binding sequence and a plasmid having a reporter gene downstream of the NFAT binding sequence are introduced (FIG. 1). Since the activity of NFAT depends on calcium ions, the reporter assay is performed under conditions where calcium ions are allowed to flow into the host. The reporter gene is not particularly limited, and any reporter gene conventionally used in the field of biochemical experiments can be used. For example, examples of the reporter gene include luciferase gene, β-glucuronidase gene (GUS gene), and green fluorescent protein gene (GFP gene).

  Examples of the NFAT-binding sequence include oligonucleotides composed of sequences to which NFAT binds, for example, base sequences such as GGAGGAAAAACTGTTTCATACAGAAGGCGT (pNFAT-Luc, Stratagene). In the above-described plasmid, a plurality of sets of such NFAT binding sequences may be linked and introduced. By linking and using a plurality of NFAT binding sequences, the transcription promoting activity by NFAT can be measured with higher sensitivity. The NFAT signal inhibitory activity can be evaluated as the NFAT signal inhibition rate calculated from the reporter assay described above.

  Further, the hair growth activity can be evaluated using the hair elongation promotion rate as an index. Here, the hair elongation promotion rate means the acceleration rate of the hair elongation rate when the neolignan derivative is allowed to act on the hair elongation rate when the neolignan derivative is not acted upon. Hair growth activity refers to the action of hair follicles, promoting hair elongation, increasing thickness, promoting the transition from the rest period to the growth stage of the hair cycle, and inhibiting the transition from the growth stage to the regression stage. Means to increase the amount. Therefore, the concept of hair growth, hair restoration, and hair loss prevention is included in hair growth. The method for measuring the hair-growth effect is not particularly limited, and examples thereof include a method of organ-culturing an isolated hair follicle and measuring the amount of hair elongation during the culture period.

  On the other hand, among the neolignan derivatives which are active ingredients, the compounds represented by the structural formula (II) and the structural formula (III) described above can be isolated from, for example, a plant extract of an anonymia plant. The plant extract of Anthony plant is extracted from the resin, whole grass, leaves, stems, flowers, fruits, seeds, rhizomes, roots, etc. of Anthony plant at room temperature or under heating, or an extractor such as a Soxhlet extractor. It is obtained by using and extracting. As an extraction solvent used for obtaining a plant extract, either a polar solvent or a nonpolar solvent can be used. Examples of the extraction solvent include water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; Chain and cyclic ethers such as tetrahydrofuran and diethyl ether; Polyethers such as polyethylene glycol; Hydrocarbons such as squalane, hexane, cyclohexane and petroleum ether; Aromatic hydrocarbons such as toluene; Dichloromethane, chloroform, dichloroethane, etc. And halogenated hydrocarbons; and carbon dioxide. Alternatively, a mixture obtained by combining two or more of the above solvents can be used as the extraction solvent.

  In particular, the compounds represented by the structural formulas (II) and (III) described above can be isolated from a plant extract using 50% ethanol-water. Specifically, a plant extract is prepared by immersing an Anthony cypress resin (Anthony corn) in 50% ethanol-water. The obtained plant extract is subjected to a separation technique such as chromatographic liquid-liquid partitioning, and by removing inactive impurities from the extract, the above-described structural formula (II) and structural formula (III) are shown. The compound can be isolated.

  Moreover, the neolignan derivative which is an active ingredient can improve water solubility by making it into a salt, and can increase physiological effectiveness. These salts may be pharmaceutically acceptable salts. Examples of such basic substances for salt formation include hydroxides of alkali metals such as lithium hydroxide, sodium hydroxide and potassium hydroxide; hydroxides of alkaline earth metals such as magnesium hydroxide and calcium hydroxide. Products; inorganic bases such as ammonium hydroxide, basic amino acids such as arginine, lysine, histidine, ornithine; organic bases such as monoethanolamine, diethanolamine, and triethanolamine are used, particularly alkali metals or alkaline earth metals Hydroxides are preferred. In the present invention, these salts may be prepared and then added to a composition comprising other components, or a neolignan derivative or the like and a salt-forming component may be separately added to the composition, In this, a salt may be formed.

  Since the active ingredient described above reduces the transcription promoting activity by NFAT, it can inhibit the NFAT signal in cells and tissues. Specifically, the NFAT signal in the cell or tissue can be inhibited by bringing the active ingredient described above into contact with the target cell or tissue. Thereby, in the cells and tissues, various gene expressions caused by NFAT signals can be suppressed at the transcription level.

  The NFAT signal inhibitor according to the present invention can be used as a hair restorer or a hair growth promoter because it reduces the transcription promoting activity by NFAT. Further, it can be used as a therapeutic agent or a preventive agent for symptoms and diseases caused by enhancement of transcription promoting activity by NFAT. Symptoms and diseases resulting from the enhanced transcription promoting activity by NFAT include immune system diseases, psoriasis, atopic dermatitis, myopathy including myocardium, rheumatism, bone metabolic diseases, various cancers, various leukemias, various hepatitis, Various infections, systemic lupus erythematosus, inflammatory bowel disease (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes, peptic ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, Asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral vascular disease, sepsis, interstitial liver disease, localized ileitis, Examples include multiple sclerosis. Therefore, the NFAT signal inhibitor according to the present invention can be used as an immunosuppressant, a psoriasis therapeutic agent, a (cardiac) muscle hypertrophy inhibitor, an anti-rheumatic drug, a bone metabolic disease therapeutic agent, and the like.

  When the NFAT signal inhibitor according to the present invention is used for pharmaceutical purposes, the dosage form is not particularly limited, but for example, solid preparations such as powders, granules, capsules, pills, tablets, liquids, suspensions, Examples thereof include liquids such as emulsions and ointments. When the NFAT signal inhibitor according to the present invention is used as a pharmaceutical composition for oral administration, in addition to the NFAT signal inhibitor, an excipient, a disintegrant, and a binder that are generally used according to the form of the oral administration agent , Lubricants, surfactants, alcohols, water, water-soluble polymers, sweeteners, corrigents, acidulants and the like, and can be produced according to conventional methods. Examples of the pharmaceutical composition for oral administration include an immunosuppressant, a psoriasis therapeutic agent, a (heart) muscle hypertrophy inhibitor and an anti-rheumatic drug. When using the NFAT signal inhibitor according to the present invention as a pharmaceutical composition for transdermal administration, in addition to the NFAT signal inhibitor, generally used according to the form of the transdermal administration agent, vegetable oil, animal oil, synthetic oil, Fatty acids and oily bases such as natural and synthetic glycerides, lubricants, surfactants, alcohols, thickeners, and the like can be added and produced according to conventional methods. Examples of the pharmaceutical composition for transdermal administration include an immunosuppressive agent, a psoriasis therapeutic agent, an atopic dermatitis therapeutic agent, and a hair growth promoter.

  Moreover, the hair restorer which concerns on this invention is used as a quasi-drug for skin, for example, and is provided as a dosage form suitable for a use form. Specific dosage forms are not particularly limited, and examples thereof include ointments, liquids, extracts, lotions, tonics, sprays, and emulsions. In addition to the above-mentioned active ingredients, the quasi-drug contains any combination of pharmaceutically acceptable carriers such as auxiliaries, stabilizers, wetting agents, emulsifiers, absorption promoters and surfactants. can do. In addition, in the hair restorer, in addition to the above-mentioned active ingredients, commonly used hair nourishing agents such as hair follicle activators, blood circulation promoters, antibacterial agents, anti-inflammatory agents, moisturizers, antiseborrheic agents, topical A stimulant, an anti-androgen agent, a potassium channel opener, an antioxidant and the like can be appropriately blended as necessary to improve the hair-growth effect. Examples of hair follicle activators include flavonols, N-acetyl-L-methionine, pantothenic acid and its derivatives, adenosine and its derivatives, potassium aspartate, glyceride pentadecanoate, 6-benzylaminopurine, mononitroguaiacol sodium, etc. It is done. Examples of the blood circulation promoter include carbon dioxide, nicotinamide, benzyl nicotinate, assembly extract, carrot extract, carpronium chloride, vitamin E and derivatives thereof. Antibacterial agents include isopropylmethylphenol, benzalkonium chloride, octopirox, zinc pyrithione, hinokitiol and the like. Examples of anti-inflammatory agents include licorice extract, glycyrrhizic acid and its derivatives, glycyrrhetinic acid and its derivatives, azulene, guaiazulene, oxon extract, chamomile extract, kumazasa extract, birch extract, mallow extract, peach leaf extract, yarrow extract . Examples of the humectant include hypericum extract, oat extract, glycerin, tuberose polysaccharide, cordyceps extract, life-saving grass extract, barley extract, grape extract, propylene glycol, bellflower extract, and cypressin extract. Examples of antiseborrheic agents include sulfur, lecithin, cachet extract, and thioxolone. Examples of local stimulants include camphor and chili tincture. Anti-androgen drugs include cyproterone acetate, 1 1α-hydroxyprogesterone, flutamide, 3-deoxyadenosine, chlormadinone acetate, ethinyl estradiol, spironolactone, epitesterone, finasteride, aloe, salamander, clove extract, quacharalate extract, Panax ginseng. Examples of potassium channel openers include minoxidil, cromakalim, diazoxide and its derivatives, pinacidil and the like. Examples of the antioxidant include black tea extract, tea extract, age extract, jaundice extract, vitamin C and its derivatives, erythorbic acid, propyl gallate, dibutylhydroxytoluene and the like.

  On the other hand, the active ingredient mentioned above can also be used as a cosmetic. In this case, the dosage form is not particularly limited, and examples thereof include water-in-oil or oil-in-water emulsified cosmetics, creams, lotions, gels, foams, essences, foundations, packs, sticks, and the like. Powder etc. are mentioned. In addition to the above-mentioned active ingredients, the cosmetics include oils, surfactants, ultraviolet absorbers, alcohols, chelating agents, pH adjusters, preservatives, thickeners, which are commonly used as cosmetic ingredients. Pigments, fragrances, various skin nutrients, and the like can be combined in any combination. Specifically, medicinal ingredients blended in skin cosmetics, for example, ultraviolet absorbers such as fine particle zinc oxide, titanium oxide, persole MCX, persole 1789, vitamins such as ascorbic acid, sodium hyaluronate, petrolatum, glycerin, urea Moisturizers such as humectants, hormonal agents, and other whitening ingredients such as kojic acid, arbutin, placenta extract, lucinol, steroids, arachidonic acid metabolites and histamine, and other chemical transmitter production / release inhibitors (indomethacin, Ibuprofen), anti-inflammatory agents such as receptor antagonists, anti-androgen agents, vitamin A acid, royal jelly extract, sebum secretion inhibitors such as royal jelly acid, peripheral blood vessels such as tocopherol nicotinate, alprostadil, isoxpurine hydrochloride, and trazoline hydrochloride Dilator and peripheral vasodilatory effect Certain carbon dioxide, minoxidil, carpronium chloride, red pepper tincture, vitamin E derivative, blood circulation promoters such as ginkgo biloba extract and assembly extract, cell activating agents such as pentadecanoic acid glyceride and nicotinamide, hinokitiol, L-menthol, isopropylmethyl Bactericides such as phenol, glycyrrhizic acid and its derivatives or salts thereof, ceramide and ceramide-like compounds, etc. can be added and blended.

  When the above-mentioned active ingredient is used as a medicine, quasi-drug or cosmetic, the compounding amount is usually 0.00001 to 5% by weight, particularly 0.0001 to 0.1% by weight, based on the total composition of the drug, quasi-drug or cosmetic. It is preferable that Moreover, when using the NFAT signal inhibitor based on this invention as a pharmaceutical, it is desirable that the dosage of the active ingredient mentioned above shall be 0.01 mg-1 g / day in a normal adult.

  In addition, when the above-mentioned active ingredient is used as cosmetics, medicines or quasi drugs, for example, powders such as chalk, talc, fuller's earth, kaolin, starch, gum, colloidal silica sodium polyacrylate; for example mineral oil, vegetable oil, silicone Oils or oily substances such as oils; for example, emulsifiers such as sorbitan trioleate, sorbitan tristearate, glycerol monooleate, polymeric silicone surfactants; preservatives such as para-hydroxybenzoate esters; antioxidants such as butylhydroxytoluene Agents; humectants such as glycerol, sorbitol, 2-pyrrolidone-5-carboxylate, dibutyl phthalate, gelatin, polyethylene glycol; buffers such as lactic acid with a base such as triethanolamine or sodium hydroxide; glycerin fatty acid Requires surfactants such as stealth, sorbitan fatty acid esters, sucrose fatty acid esters, alkyl glucosides; waxes such as beeswax, ozokerite wax, paraffin wax; thickeners; activity enhancers; coloring agents; Can be used in appropriate combinations.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.
Example 1 Isolation of Active Ingredients from Antarctic cypress (1) According to the process shown in FIG. 2, new compounds “SB-4k1” and “SB-” are obtained from Styrax benzoin resin. 2f "was isolated.

(2) Styrax benzoin resin (name of crude drug, Ansokukou; dry weight 500g) was extracted by immersing in 50% ethanol-water (5L) for 30 days, and 50% ethanol-water extract (extract solid content 243g) Got. 1.98 g of the concentrated dried product of this extract was dissolved in chloroform (10 mL) to obtain a chloroform-soluble fraction (1.90 g). The chloroform-soluble fraction (1.90 g) was subjected to silica gel column chromatography (inner diameter: 3.0 × 30.5 cm) and eluted with chloroform (hereinafter referred to as CHCl ₃ ) -methanol (hereinafter referred to as MeOH) system to obtain the following fraction (fr. 1 ~ 8) was obtained.
_{. fr 1: CHCl 3 - MeOH} (100: 0) eluate, 35 mg
fr. 2: CHCl ₃ − MeOH (100: 0) eluate, 264 mg
fr. 3: CHCl ₃ -MeOH (98: 2) eluate, 85 mg
fr. 4: CHCl ₃ -MeOH (97: 3) eluate, 716 mg
fr. 5: CHCl ₃ -MeOH (97: 3) eluate, 243 mg
fr. 6: CHCl ₃ − MeOH (96: 4) elution part, 144 mg
fr. 7: CHCl ₃ − MeOH (94: 6) eluate, 161 mg
fr. 8: CHCl ₃ − MeOH (92: 8) → CHCl ₃ − MeOH (0: 100) eluate, 190 mg

(3) Fr. 2 (264 mg) obtained in (2) above was subjected to medium pressure silica gel column chromatography (inner diameter 26 × 300 mm) and eluted with hexane-ethyl acetate (0-100%) system. Fractions (fr. 2a-2j) were obtained. As a result of analysis, the component of fraction 2f was confirmed to be a single compound (compound SB-2f).
fr. 2a: 23.2 mg
fr. 2b: 32.0 mg
fr. 2c: 57.2 mg
fr. 2d: 11.9 mg
fr. 2e: 15.5 mg
fr. 2f: 7.9 mg
fr. 2g: 6.0 mg
fr. 2h: 25.7 mg
fr. 2i: 31.0 mg
fr. 2j: 24.8 mg

(4) Fr. 4 (716 mg) obtained in (2) above was subjected to preparative high performance liquid chromatography (inner diameter 10 × 250 mm) and eluted with 0.1% formic acid-acetonitrile (50-100%) system. Fractions (fr. 4a-4l) were obtained.
fr. 4a: 74.4 mg
fr.4b: 77.3 mg
fr.4c: 83.1 mg
fr. 4d: 94.5 mg
fr.4e: 17.2 mg
fr. 4f: 47.3 mg
fr. 4g: 125 mg
fr. 4h: 37.2 mg
fr. 4i: 109 mg
fr. 4j: 32.9 mg
fr. 4k: 20.0 mg
fr. 4l: 95.9 mg

(5) Fr. 4k (20.0 mg) was purified by recycle preparative high performance liquid chromatography (inner diameter 20 × 250 mm) to obtain 7.9 mg of a new compound (SB-4k1).

[Example 2] Identification of SB-2f and SB-4k1 (1) The novel compounds (SB-2f and SB-4k1) obtained in Example 1 were subjected to ¹ H NMR analysis and ¹³ C NMR analysis. Table 1 shows data obtained as a result of ¹ H NMR (500 MHz, CDCl ₃ ) and ¹³ C NMR (125 MHz, CDCl ₃ ) analysis.

ESI − MS（SB-2f）: 491.25 [Calcd for C₂₉H₃₂O₇ (M-H)^- 491.56]
ESI − MS（SB-4k1）: 461.00 [Calcd for C₂₈H₃₀O₆ (M-H)^- 461.53]

ESI - MS (SB-2f) : 491.25 [Calcd for C 29 H 32 O 7 (MH) - 491.56]
ESI - MS (SB-4k1) : 461.00 [Calcd for C 28 H 30 O 6 (MH) - 461.53]

(2) From the analysis results shown in Table 1, it was shown that the compounds of SB-2f and SB-4k1 are neolignan derivatives having the following structure.

  Here, in the novel compound SB-2f, R8 is a methoxy group. In the new compound SB-4k1, R8 is a hydrogen atom. These compounds were not reported in the past and were novel compounds.

[Example 3] NFAT signal inhibitory effect In this example, the NFAT signal inhibitory effect of SB-2f and SB-4k1 obtained in Example 1 was verified.
(1) Materials and methods for evaluation systems
Cell culture In the above evaluation system, human kidney (HEK293) cells were purchased from ATCC (American Type Culture Collection) and used. HEK293 cells were cultured in DMEM (High glucose, 10% heat-inactivated FBS) at 37 ° C. and 5% CO ₂ .

Plasmid and Transfection The HEK293 cells were transfected with plasmid pNFAT-Luc (Stratagene) in which firefly luciferase was introduced downstream of the NFAT binding sequence. Specifically, pNFAT-luc (STRATAGENE) in which a firefly luciferase gene was introduced downstream of a quadruple NFAT binding sequence was transfected into HEK293 cells for evaluation of NFAT transcriptional activity. In addition, in order to eliminate variation due to transfection efficiency, pRL-CMV (Promega) in which a Renilla luciferase was introduced downstream of the CMV promoter was simultaneously transfected in order to correct a signal derived from firefly luciferase.
Transfection was performed using LipofectAMINE 2000 reagent (Invitrogen) according to the instruction manual. The medium was changed 8 hours after transfection and incubated overnight. Thereafter, the components A and B obtained in Example 1 and the deacylated form of Component A prepared in Example 3 were added (final concentration: 2 or 20 μM), and 1 μM Ionomycin was added after 1 hour. After 8 hours, a luciferase reporter assay was performed.

Luciferase reporter assay The luciferase reporter assay was performed using Dual-Glo Luciferase Assay System (Promega) according to the instruction manual. That is, after removing the medium, Dual-Glo luciferase reagent diluted 2-fold with PBS was added, stirred, and firefly luciferase activity was measured 20 minutes later. Thereafter, an equal amount of Dual-Glo Stop & Glo reagent was added and stirred, and then Renilla luciferase activity was measured. The luciferase activity was measured using MiniLumat LB 9506 (EG & G BERTHOLD), and the amount of luminescence by luciferase was quantitatively detected. In both cases, the measurement time for luciferase activity was 2 seconds.

Calculation of NFAT signal inhibition rate All NFAT transcriptional activity (firefly luciferase activity) was corrected by dividing by the Renilla luciferase activity introduced for transfection efficiency correction. Thereafter, the NFAT signal inhibition rate was calculated by the following formula.
NFAT signal inhibition rate (%) = 100− (test sample and Ionomycin added group−unstimulated group) / (Ionomycin only added group−unstimulated group) × 100
Based on the above calculation, it is possible to calculate how much the test sample inhibited NFAT signal activation by Ionomycin stimulation.

result
The results of calculating the NFAT signal inhibition rate are shown in FIG. As can be seen from FIG. 3, both SB-2f and SB-4k1 obtained in Example 1 inhibited the NFAT signal. That is, SB-2f and SB-4k1 can suppress transcription that is positively controlled by NFAT. Therefore, SB-2f and SB-4k1 are excellent NFAT signal inhibitors, such as immunosuppressants, psoriasis treatment agents, atopic dermatitis treatment agents, hair growth agents, hair growth promoters, (cardiac) muscle hypertrophy suppression It was identified as a candidate substance such as a drug and an anti-rheumatic drug.

[Example 4] Hair growth effect In this example, the hair growth effect of SB-2f and SB-4k1 obtained in Example 1 was verified using an in vitro experimental system capable of verifying the hair growth effect of the target substance.
Evaluation of hair elongation by porcine hair follicle organ culture The buttocks skin of pork for meat was cut into an appropriate size, and excess adipose tissue was removed. Porcine skin was disinfected by immersing it in hibiten under aseptic conditions (5% hibiten solution (Sumitomo Pharmaceutical) diluted 5 to 20 times with water) for 5 to 10 minutes and then washed several times with D-PBS. . Thereafter, hair follicles were isolated from pig skin washed under a stereomicroscope and collected in William's Medium E medium (Invitrogen) medium.

The isolated hair follicles were placed one by one in a 24-well culture plate containing 400 μl of William's Medium E medium (added with 1% Penicillin-Streptomycin solution (Invitrogen)) per well. Hair follicles 37 ° C., and cultured for 8 days at 5% CO ₂ conditions, during which were medium exchange per day or every two days.

  SB-2f and SB-4k1 obtained in Example 1 were added to the above medium and cultured for 8 days together with the ethanol addition group as a solvent control. Take a stereomicroscopic image of the start date (day 0) and 8th day with a CCD camera (pixera model.No.PVC 100C) and measure the length from the base of the hair bulb to the tip of the hair shaft. It was measured. Thereafter, the hair elongation rate of SB-2f and SB-4k1 obtained in Example 1 was calculated by setting the amount of hair elongation before and after culturing in the solvent control group as 100%.

Results The results of calculating the hair elongation rate are shown in FIG. As can be seen from FIG. 4, in the SB-2f and SB-4k1 addition groups obtained in Example 1, hair elongation rates of 135.6% and 150.2% were recognized as compared with the solvent control group, respectively. From this result, it was revealed that SB-2f and SB-4k1 obtained in Example 1 have a hair-growth effect. That is, it has been clarified that SB-2f and SB-4k1 obtained in Example 1 are active ingredients exhibiting a hair-growth effect and can be used as a hair-growth agent or an external preparation.

It is a schematic block diagram of an NFAT signal showing the binding between NFAT and an NFAT binding site and the promotion of gene transcription downstream thereof. It is a schematic diagram which shows the elution fraction at the time of isolating an active ingredient from an Anonymous cypress. It is a characteristic view which shows the result of having calculated the NFAT signal inhibition rate about SB-2f and SB-4k1 obtained in Example 1. FIG. It is a characteristic view which shows the result of having calculated the hair elongation rate about SB-2f and SB-4k1 obtained in Example 1. FIG.

Claims (5)

The following general formula (I):

(In the above general formula (I), R1, R2, R3, R4, R5 and R6 may be the same or different and each is a hydrogen atom, a hydroxyl group or a methoxy group, and R7 is a hydrogen atom. , A methyl group or an ethyl group). The following structural formula (II):

The neolignan derivative of Claim 1 shown by these. The following structural formula (III):

The neolignan derivative of Claim 1 shown by these.   Inhibition of NFAT signal, comprising as an active ingredient at least one compound selected from the group consisting of neolignan derivatives according to any one of claims 1 to 3 and pharmacologically acceptable salts thereof Agent.   A hair restorer comprising, as an active ingredient, at least one compound selected from the group consisting of the neolignan derivative according to any one of claims 1 to 3 and a pharmacologically acceptable salt thereof.

Images