JP2008249700A - Method of evaluating hair condition and its application - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of evaluating hair conditions which is noninvasive and enables the acquisition of highly objective evaluation results. <P>SOLUTION: The hair condition is evaluated by the results of gene expression analysis performed using hair shafts extracted from the hairs of an object to be inspected. In a preferred embodiment, mRNA extracted from the hair shafts is used as a specimen. Since the hair shafts projecting from the skin surface are used as a specimen of the gene expression analysis, the hair condition evaluation method of the invention is noninvasive and becomes easily implementable. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method and use for evaluating the condition of hair.

  Accurately grasping the state of the hair is important for maintaining healthy hair and for providing appropriate hair care for hair problems such as white hair and thin hair. When performing hair care with cosmetics, hair styling agents, hair restorers, hair nourishing agents, etc., the hair quality of product users has been evaluated through, for example, visual interviews. Recently, in order to more objectively evaluate the state or function of the hair, a method of notifying the hair quality with various parameters using various measuring devices, the expression level of proteins involved in the hair quality, Biochemical and molecular biological methods for measuring enzyme activity are also incorporated. Genetic studies are also being conducted. As an example, a method has been proposed in which genetic testing of genes involved in hair is applied to cosmetics, hair treatment or diagnosis (Patent Document 1). In these methods, attention is paid to skin- or hair-related genes, and the state of hair and the like are evaluated based on the information (DNA sequence information). Certainly, the genetic information of skin- or hair-related genes is an important factor that characterizes the properties of hair. However, the expression of genes is necessary for DNA sequence information to contribute to or affect hair function, and some genes are expressed for life due to internal factors such as individual lifestyle and external factors such as climate. Considering that there is a possibility that it may not be possible, the DNA state information of hair-related genes alone cannot accurately capture the state of hair formed as a result of intertwining various factors. It is impossible to understand the changes in the hair state due to various factors.

  By the way, the hair is divided into a hair shaft appearing on the surface of the skin and a hair root buried in the skin. The hair shaft is composed of three layers of outer skin, fur and medulla from the outside. The hair root is wrapped and fixed in a sheath-like follicle recessed in the skin, the lower end swells spherically to form a hair bulb, the bottom of the hair bulb is recessed and the hair papilla enters, and the hair matrix on the hair bulb side It touches. The hair follicle is composed of a collagen sheath and an outer root sheath, which is a cell prior to terminal differentiation as a hair tissue, and these undergo a complex maturation process by interacting with the hair papilla, resulting in It becomes the hair shaft, the final differentiated tissue, and goes to the skin surface.

  As a study paying attention to the hair follicle part, a method for evaluating white hair caused by tyrosinase and anti-whitening agents against them using the whole hair including the hair follicle has been reported (Patent Document 2). In addition, a method for evaluating the difference in hair quality by using hair keratin or the like as an index using the entire hair including the hair follicle has been reported (Patent Document 3). In addition, an evaluation method has been reported in which expression of genes contained in the skin is analyzed to predict a thinning portion and an appropriate hair restorer / hair restorer is applied (Patent Document 4). In the methods disclosed in these patent documents, mRNA extracted from living cells present in the hair follicle part or skin tissue buried under the skin is used. Therefore, it is necessary to remove a large amount of hair or to collect skin tissue to a relatively deep layer in order to collect hair including the outer root sheath, and there is a risk that the subject suffers pain and remains damaged. is there. In addition, a plurality of types of cells such as fibroblasts, nerve cells, and vascular cells are present in the hair follicle portion of the removed hair and the excised skin tissue. In other words, the entire hair including the hair follicles contains many cells that are different from the cells that form the hair shaft that is the terminally differentiated tissue of the hair. There was a problem that could not be evaluated accurately.

On the other hand, studies focusing on the hair shaft on the skin surface are also being conducted. That is, as a method for evaluating the state of hair, a method for evaluating the degree of damage to hair by measuring the amount of cholesterol, carboxyl group, amino group, and DNA in the hair shaft has been devised (Patent Document 5). The method for evaluating the condition of hair using such a specific protein as an index is an approach based on the phenotypic character of hair, so most of the detailed studies on the root cause of changes in the condition of the hair are required. The current situation is that nothing has been done. Therefore, it is very difficult to find a hair treatment method or a medicine corresponding to the cause in a situation where it is unclear how white hair and thin hair are generated.
JP 2003-271728 A JP 2000-300288 A JP 2006-14721 A Japanese Patent Laid-Open No. 10-165374 JP-A-9-127105

Since the cells present in the hair shaft were enucleated, nascent mRNA was not synthesized there, and it was thought that mRNA was not present. In fact, there is no report of gene expression analysis using mRNA present in the hair shaft. On the other hand, gene expression analysis is performed on nucleated cell tissues present in hair follicles or hair roots buried in the skin other than the hair shaft (Patent Documents 2 to 4 etc.). However, as described above, gene expression analysis using nucleated cell tissues other than hair shafts involves invasive problems and cosmetic problems. For example, the scalp is an important tissue to analyze in hair research, but considering that it requires a doctor's treatment, gene expression using nucleated cell tissue other than the hair shaft is necessary. Analysis is not appropriate as a method for evaluating the condition of hair for the purpose of hair care or beauty. Furthermore, since many cells different from the cells that form the hair shaft that is the final differentiated tissue are contained, there is a problem that factors such as white hair and thin hair cannot be accurately evaluated. In addition, although there are some research reports as described above, studies for elucidating changes in the state of hair from approaches at the gene level or gene expression level have not been sufficiently conducted.
In view of the above background, the main object of the present invention is to provide a method for evaluating the state of hair, which is non-invasive and obtains highly objective evaluation results.

Under the above-mentioned problems, the present inventors have intensively studied paying attention to the hair shaft. As a result, it was found that a sufficient amount of mRNA could be extracted from the hair shaft. On the other hand, as a result of gene expression analysis using the extracted mRNA, a plurality of genes related to hair condition were found. In this way, the knowledge that gene expression analysis using mRNA extracted from hair shafts is effective as a method for evaluating the state of hair is obtained, and specific genes to be noted in gene expression analysis are identified. Also succeeded. The present invention is mainly based on the findings and results, and provides a method for evaluating the hair state and the like listed below.
[1] A method for evaluating the state of hair, wherein the gene expression level of the hair shaft collected from the test subject is used as an index.
[2] The method according to [1], wherein the gene expression level is a gene expression level analyzed using mRNA extracted from the hair shaft as a sample.
[3] (1) A step of preparing a hair shaft collected from hair of a specific part of a test subject,
(2) a step of performing gene expression analysis using mRNA extracted from the hair shaft as a sample, and calculating an expression level of a gene related to a hair state, and (3) using the expression level calculated in step (2). Assessing the condition of the hair,
The method according to [2], comprising:
[4] The method according to [3], wherein in step (3), the expression level calculated in step (2) is collated with a reference expression level to evaluate the state of the hair.
[5] The method according to any one of [3] to [4], wherein the gene expression analysis is performed by a microarray method or a PCR method.
[6] The genes are CDC42, FSIP2, CEPT1, GOSR1, LIPT1, ZNF66, ZNF253, SCAND2, RFX4, CYP2B6, UGT2B15, ALG5, LRRC41, RABL2B, MAP1LC3C, ABCC9, TRPV1, H4PA3 The method according to any one of [1] to [5], wherein the gene is one or more genes selected from the group consisting of MICB and DFFB.
[7] The method according to any one of [1] to [5], wherein the gene is one or more genes selected from the group consisting of KRTAP2-2, KRTAP4-9, and HIAT1.
[8] The method according to any one of [1] to [7], wherein the state of the hair is a state relating to gray hair.
[9] The gene is C22ORF29, RS25_HUMAN, KRT10, RS27A_HUMAN, RS13_HUMAN, OR2K2, NAALADL1, TBCA, KRT1, RHOT2, RPL36, WDR45L, USP2, MADCAM1, CBX8, AKR7A2G3, AKR7A2G2 , PGF, LYPD2, ETFA, ACAA1, WNT3A, USP22, ALDOA, and one or more genes selected from the group consisting of IL32, the method according to any one of [1] to [5].
[10] The method according to any one of [1] to [5], wherein the gene is one or more genes selected from the group consisting of KRTHB6, SLAMF1, KRTAP3-1, and CHRNA10.
[11] The method according to any one of [1] to [5] and [9] to [10], wherein the state of the hair is a state relating to thin hair.
[12] Before and after the treatment means is applied to the test subject, the method according to any one of [1] to [11] is performed, and the evaluation results obtained are compared to determine the effectiveness of the treatment means. A method for evaluating a treatment means for hair, characterized by evaluating sex.
[13] The method according to [12], wherein the treatment means is a method for determining the effect of the anti-whitening agent.
[14] The method according to [12], wherein the treatment means is a method for determining the effect of an anti-haircut agent.

The first aspect of the present invention provides a method for evaluating the condition of hair (hereinafter also referred to as “hair condition evaluation method”). In the hair condition evaluation method of the present invention, the hair condition is evaluated using the gene expression level of the hair shaft collected from the test subject as an index. Since the hair shaft that appears on the skin surface in the hair is used as a sample for gene expression analysis, the hair condition evaluation method of the present invention is non-invasive and can be easily implemented.
The test subject is typically a human. However, an animal that is a subject of body hair treatment, such as a pet animal such as a dog or a cat, may be a test subject. That is, the hair condition evaluation method of the present invention can be applied to a human having hair or a non-human animal as long as it is a target for hair care or the like. Specific examples of animals other than humans include monkeys, dogs, cats, mice, rats, guinea pigs, rabbits and the like.

  The method for collecting the hair shaft from the hair is not particularly limited. For example, the hair shaft can be collected from the hair that has been cut off or the hair that has been naturally removed. The former method is particularly preferable in that it can be carried out very simply.

The site | part which collects hair is not specifically limited. In principle, the hair shaft is collected from the site where the hair condition is to be evaluated. For example, in order to evaluate the condition of the hair on the head, the hair shaft may be collected from the hair on the head. However, it does not preclude the use of hair shafts collected from other sites when evaluating the state of hair at a certain site.
Since the head is the most important object for hair care among various parts, the hair shaft is collected from the hair of the head in a preferred embodiment of the present invention.

  The “gene expression level” in the present invention is the amount of mRNA that is a gene transcription product, and can be measured by examining the expression state of the gene by gene expression analysis. Or you may make it analyze the quantity of the protein which is an expression product of a gene.

  For the measurement of the amount of mRNA, microarray analysis, a method of performing a polymerase chain reaction method (PCR method) after performing a reverse transcription reaction, or the like can be used. These methods may be carried out according to conventional methods. Various protocols have been reported for each method, and those skilled in the art can construct and implement an appropriate measurement system according to a known protocol or according to a protocol obtained by appropriately modifying or changing a known protocol. Details of the gene expression analysis by measuring the amount of mRNA will be described later.

  On the other hand, when measuring the amount of protein, for example, an immunostaining method using a fluorescent substance, a dye, an enzyme or the like, a Western blot method, an immunoassay method (for example, ELISA method, EIA method) or the like can be used. These methods may be carried out according to a conventional method. Various protocols have been reported for each method, and those skilled in the art can construct and implement an appropriate measurement system according to a known protocol or according to a protocol obtained by appropriately modifying or changing a known protocol.

  In the present invention, “hair condition” refers to white hair, thin hair, comb hair, flexibility, thickness, gloss, color tone, smoothness, combing, elongation, tensile strength, water absorption, length of hair cycle, growth This refers to the degree of index related to speed and water content. In the hair condition evaluation method of the present invention, one or more of these are evaluated. Preferably, the evaluation is performed with respect to a white hair index and a thin hair index.

The hair evaluation method of the present invention is preferably carried out by the following series of steps (1) to (3).
(1) A step of preparing a hair shaft collected from hair of a specific part of a test subject,
(2) a step of performing gene expression analysis using mRNA extracted from the hair shaft as a sample, and calculating an expression level of a gene related to a hair state, and (3) using the expression level calculated in step (2). Assessing the condition of the hair.

In step (1), a hair shaft collected from a specific site to be tested is prepared. As described above, the collection site of the hair shaft is not particularly limited. The hair shaft is preferably collected from the head. Specific examples of hair shaft collection method and mRNA extraction method are shown below.
(A) Cut and collect a part of hair so as not to damage the skin. For example, the hair shaft part is cut with scissors and the hair shaft portion is collected.
(B) The collected hair shaft is shredded and immersed in a soluble buffer containing SDS, β-mercaptoethanol, guanidine isothiocyanate, etc., and then reacted with a proteolytic enzyme.
(C) After completion of the reaction, the hair shaft is crushed by a physical force such as an ultrasonic crusher.
(D) An ethanol solution is added to the supernatant, and mRNA is extracted by a method according to a known nucleic acid extraction method or a method using a commercially available kit. For example, mRNA is extracted by an RNA extraction method using guanidine isothiocyanate, phenol and chloroform, a method using ISOGEN from Nippon Gene, TRIzol Reagent from Invitrogen, RNeasy Kit from QIAGEN, RNAqueous Kit from Ambion, or the like.
(E) If necessary, mixed DNA is removed by using a nucleolytic enzyme such as a DNA degrading enzyme.
(F) Concentrate mRNA using a nucleic acid concentration method such as ethanol precipitation.

  In step (2) following step (1), gene expression analysis is performed using mRNA extracted from the collected hair shaft as a sample. Then, the expression level of a specific gene is calculated by the gene expression analysis. Thus, in one embodiment of the present invention, gene expression analysis is performed using the amount of mRNA remaining in the hair shaft as an index. By the way, the hair shaft is keratinized as new cells made from the hair matrix are pushed up, loses cellular components such as the nucleus, and changes mainly into keratin fiber mass, and is a mass of dead cells. Normally no nascent mRNA is produced. One of the greatest features of the present invention is that mRNA remaining in the hair shaft without being decomposed is used. In gene expression analysis, the “gene expression level” is calculated as an absolute value or a relative value (such as a ratio or difference from the comparison target or standard expression level).

The “specific gene” whose expression level will be examined by gene expression analysis is a gene related to the condition of the hair. Any gene can be analyzed as long as it is a gene related to the condition of the hair. Genes related to the condition of hair can be identified by experiments using a microarray or the like, as shown in the examples described later. We have several genes that are particularly effective in assessing the extent of gray hair, namely CDC42, FSIP2, CEPT1, GOSR1, LIPT1, ZNF66, ZNF253, SCAND2, RFX4, CYP2B6, UGT2B15, ALG5, LRRC41, RABL2B, MAP1LC3C , ABCC9, TRPV1, P4HA3, HIST1H2BG, PARP3, MOG, HIATL2, MICB, and DFFB (hereinafter, a gene group having a high expression ratio of black hair to gray hair. Also referred to as “first gene group”), KRTAP2-2, KRTAP4 -9, and HIAT1 (the gene group having a low gene expression ratio of black hair to gray hair, also referred to as “second gene group”), and C22ORF29, RS25_HUMAN, KRT10, RS 7A_HUMAN, RS13_HUMAN, OR2K2, NAALADL1, TBCA, KRT1, RHOT2, RPL36, WDR45L, USP2, MAGCAM1, CBX8, AKR7A2, GYPC, CCL3, APOL3, PRL1, NR2F6, PRL1, NR2F6, P3 ALDOA and IL32 (the gene group having a high gene expression ratio of thick hair to thin hair, also referred to as “third gene group”), and KRTHB6, SLAMF1, KRTAP3-1, and CHRNA10 (above, gene for thick hair for thin hair) A gene group having a low expression ratio (also referred to as “fourth gene group”) was successfully identified (see the Example section). In the present invention, preferably, the amount of mRNA of one or more genes selected from the first gene group, the amount of mRNA of one or more genes selected from the second gene group, or The amount of mRNA of one or more genes selected from the three gene groups or the amount of mRNA of one or more genes selected from the fourth gene group is measured. In general, it can be said that a more reliable evaluation can be obtained as the number of genes to be analyzed increases. On the other hand, an increase in the number of genes to be analyzed complicates data processing and may impair convenience and speed. It also causes an increase in the cost required for analysis. Therefore, the number of genes to be analyzed is preferably 1-30, more preferably 3-20, and still more preferably 5-10.
The number and description of each of the above genes in RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) and GenBank (http://www.ncbi.nlm.nih.gov/Genbank) 1, 2, 6 and 7 show the accession number (Accession number) at /index.html).

Here, a specific example of the gene expression analysis method using mRNA extracted from the hair shaft is shown below. 1. Method using microarray (a) In order to prepare a microarray target or sample probe from a small amount of hair shaft RNA, mRNA is amplified by a method based on the PCR method or the T7 linear amplification method. For example, it can be carried out using an Express Art Aminoally mRNA amplification kit (Artus, Germany) using a T7 linear amplification method. An amplification reaction of a reference RNA (reference RNA) and a small amount of hair shaft RNA as a comparative control is also performed in parallel. As the reference RNA, commercially available RNA for microarray reference can be used.
(B) The amplified mRNA obtained from the target hair shaft and the reference RNA or comparative control RNA are labeled with two fluorescent dyes and then fragmented under alkaline conditions. The fluorescent dye can be used in any combination as long as it emits a fluorescence wavelength capable of discriminating two types of targets, but a combination such as Cy3 and Cy5, Alexa555 and Alexa647 is preferable.
(C) The fragmented fluorescently labeled RNA is hybridized to the microarray.
(D) After washing the microarray, scanning is performed and the expression level of each spot is measured.

2. Method using RT-PCR (a) cDNA is prepared from the extracted mRNA using reverse transcriptase.
(B) A PCR (polymerase chain reaction) reaction is performed using cDNA as a template and a primer corresponding to the target gene to obtain a DNA fragment corresponding to the target gene.
(C) The reaction of a gene (GAPDH, β-actin, etc.) as an internal standard is also performed in parallel.
(D) After electrophoresis of the obtained DNA fragment, it is stained with ethidium bromide and the intensity of the band is measured to obtain the expression level of the gene.
(E) If necessary, quantitative PCR reaction is performed using a fluorescent dye such as Syber green or a fluorescent probe such as Taqman probe to quantify the expression level.
(F) The ratio of the expression level of the target gene to the expression level of the gene serving as an internal standard is calculated.

In step (3), the state of hair is evaluated using the expression level calculated in step (2). For example, the calculated expression level is compared with a preset reference expression level to evaluate the state of the hair. Specifically, for example, a plurality of categories are set in which an evaluation relating to the state of hair and an expression level range corresponding to the evaluation are associated, and it is examined which category the calculated expression level corresponds to . Specific examples relating to the setting of the categories (examples in the case of evaluating “progression of whitening” and “progression of thinning” as an index of the state of hair) are shown below.
(Example 1: Example of using a gene whose increase in gene expression correlates with the progression of gray hair)
Whitening progress 1 (low): expression level <a, graying progress 2 (medium): a ≦ expression <b, graying progress 3 (high): b ≦ expression (example) 2: Example of using a gene whose decrease in gene expression correlates with the progression of gray hair)
Whitening progress 1 (equivalent to 20s): a <expression level, graying progress 2 (equivalent to 30s) b <expression level ≦ a, whitening progress 3 (equivalent to 40s): c <expression Amount ≦ b, whitening progress degree 4 (equivalent to 50s): d <expression amount ≦ c, whitening progress degree 5 (equivalent to 60s): expression level ≦ d
(Example 3: Example of using a gene whose increase in gene expression correlates with the progression of thin hair)
Thinning progress 1 (low): expression level <a, thinning progress 2 (medium): a ≦ expression level <b, thinning progress 3 (high): b ≦ expression Amount (Example 4: Example of using a gene whose decrease in gene expression correlates with the progression of thin hair)
Thinning progress 1 (equivalent to 20s): a <expression level, thinning progress 2 (equivalent to 30s) b <expression level ≦ a, thinning progress 3 (equivalent to 40s): c <expression level ≦ b, thinning degree of progress 4 (corresponding to 50s): d <expression amount ≦ c, thinning degree of progress 5 (corresponding to 60s): expression level ≦ d

In one embodiment of the present invention, hair shafts are collected from two sites, and gene expression analysis of each hair shaft is performed. And the expression level computed regarding each hair shaft is compared, and the state of hair is evaluated based on a comparison result. That is, in the hair condition evaluation method of this aspect, the following series of steps (i) to (iii) are performed.
(I) a step of preparing a hair shaft collected from the first site of the test subject and a hair shaft collected from the second site of the test subject; (ii) for each of the hair shafts, mRNA extracted therefrom is used as a sample; Performing a gene expression analysis, calculating a gene expression level related to the hair condition, and (iii) comparing the two expression levels calculated in step (ii) to evaluate the hair condition of the first part Step to do.

In step (iii), the two calculated expression levels are compared. For example, the ratio of the first expression level to the second expression level or the difference between the first expression level and the second expression level (first expression level−second expression level) is calculated. Then, it is checked which of the plurality of categories the evaluation value relating to the condition of the hair is associated with. Specific example regarding setting of category (example in which “progression of whitening” and “progression of thinning” are evaluated as a hair condition index using the ratio of the first expression to the second expression) Is shown below.
(Example 5: Example of using a gene whose increase in expression ratio correlates with the progress of graying)
Whitening progress 1 (low): ratio <a, whitening progress 2 (medium): a ≦ ratio <b, whitening progress 3 (high): b ≦ ratio (Example 6: expression) Example of using a gene whose decrease in the proportion of quantity correlates with the progress of graying)
Whitening progress 1 (equivalent to 20s): a <ratio, whitening progress 2 (equivalent to 30s) b <ratio ≦ a, whitening progress 3 (equivalent to 40s): c <ratio ≦ b Whitening progress 4 (equivalent to 50s): d <ratio ≦ c, whitening progress 5 (equivalent to 60s): ratio ≦ d
(Example 7: Example of using a gene in which an increase in the ratio of expression level correlates with the progress of thinning of hair)
Thinning progress 1 (low): ratio <a, thinning progress 2 (medium): a ≦ ratio <b, thinning progress 3 (high): b ≦ ratio (example) 8: Example using a gene whose decrease in the ratio of expression level correlates with the progress of thinning of the hair)
Thinning progress 1 (equivalent to 20s): a <ratio, thinning 2 (equivalent to 30s) b <ratio ≦ a, thinning 3 (equivalent to 40s): c < Ratio ≦ b, thinning progress 4 (equivalent to 50s): d <ratio ≦ c, thinning progress 5 (equivalent to 60s): ratio ≦ d

  In Examples 1 to 8 above, the number of sections is 3 (Examples 1, 3, 5, 7) or 5 (Examples 2, 4, 6, 8), but the number of sections is not particularly limited. For example, the number of sections can be any of 2-10. The number of sections and the range of reference values associated with each section can be arbitrarily set based on the results of preliminary experiments.

As a second aspect, the present invention provides a method for evaluating treatment means for hair (hereinafter also referred to as “treatment means evaluation method”). The treatment means evaluation method of the present invention uses the hair condition evaluation method of the present invention. Specifically, the effectiveness of the treatment means is evaluated by performing the hair condition evaluation method of the present invention before and after the treatment means is applied to the test subject, and comparing the obtained evaluation results. . The treatment means evaluation method of the present invention is highly objective and reliable because it evaluates based on the scientific basis of the expression level of genes related to the condition of hair.
“Treatment means” means means applied to the hair or skin for the purpose of improving or restoring the condition of the hair, and representative examples thereof include the use of anti-whitening agents, hair styling agents, hair restorers, hair nourishing agents, and cosmetics. The concept represented by the term “treatment means” includes hair care methods, treatment methods, and skin care methods.

1. Extraction of mRNA contained in hair shaft From the hair of the subject's head, the hair shaft portion appearing on the skin surface was cut with three scissors to obtain a hair shaft. The mRNA contained in the obtained hair shaft was extracted using an RNA extraction kit (Ambion, RNAqueous-4PCR Kit). That is, the obtained hair shaft was shredded, placed in 350 μL of Lysis / Binding Solution, proteinase K (manufactured by Invitrogen) was added, and the mixture was incubated at 56 ° C. for 16 hours. Then, after making it disperse | distribute using an ultrasonic crusher, 350 microliters 64% ethanol was added and stirred, and the hair shaft extract was obtained. After adsorbing mRNA to the attached Filter Cartridge, the mRNA was eluted with 100 μL of eluate. DNase I was added to the obtained eluate to completely remove the remaining DNA, and then mRNA was precipitated using ethanol to concentrate the mRNA. The obtained mRNA pellet was dissolved in a required amount of water to obtain residual mRNA contained in the hair shaft.

2. Microarray analysis of mRNA contained in hair shaft (1)
(1) Materials and Methods From the hair shafts of the white hair and black hair of the top of the six subjects, the above 1. Thus, residual mRNA was obtained. Each RNA was amplified with Express Art Aminoally mRNA amplification kit (Artus, Germany), labeled with Cy3 and Cy5 fluorescent dyes, and then fragmented under alkaline conditions. Next, the fragmented target was hybridized with human oligonucleotide microarray Human 35K (Filgen, Nagoya) at 42 ° C. overnight, washed, and image data was read with a microarray scanner scan array Gx (Perkin Elmer). . From the image data, the signal intensity of each spot was digitized by Scan Array Express, which is microarray analysis software. Microarray data for 6 hair shaft samples of white hair and black hair were analyzed, and the gene expression ratio of black hair to white hair (log (expression value of black hair) / (expression value of white hair)) was calculated. The experiment was performed by the Dye swap method in which the fluorescent dye that labels the mRNA was replaced in one set of comparisons and hybridized twice. Microarray data was normalized by summing the total signal after subtracting the background value from the signal value. Cy3 / Cy5 values were calculated, log transformed and standardized. Then, genes whose expression ratio was changed from plus to minus or minus to plus by exchanging the fluorescent dye were selected as those whose expression was fluctuated without being affected by noise caused by the fluorescent dye.

(2) Analysis result (1)
As a result of clustering, it was possible to identify 24 genes having a high gene expression ratio of black hair to white hair and 3 genes having a low gene expression ratio of black hair to white hair (FIGS. 3 and 4). Thus, we succeeded in finding a useful gene involved in graying. It can be said that the degree of whitening of hair can be evaluated by paying attention to the expression levels of these genes.

  Among gene groups (first gene group) having a high gene expression ratio of black hair to gray hair, CDC42, FSIP2, CEPT1, GOSR1, LIPT1, ZNF66, ZNF253, SCAND2, RFX4, CYP2B6, UGT2B15, ALG5, LRRC41, RABL2B, MAP1LC3C, ABCC9, TRPV1, P4HA3, HIST1H2BG, PARP3, MOG, HIATL2, MICB, and DFFB were included (see FIG. 1). Further, KRTAP2-2, KRTAP4-9, and HIAT1 were included in the gene group (second gene group) having a low gene expression ratio of black hair to gray hair (see FIG. 2).

3. Microarray analysis of mRNA contained in hair shaft (2)
(1) Material and method From the hair shafts of the thin hair of the top of the head and the thick hair of the back of the head of six subjects, the above 1. Thus, residual mRNA was obtained. Each RNA was amplified with Express Art Aminoally mRNA amplification kit (Artus, Germany), labeled with Cy3 and Cy5 fluorescent dyes, and then fragmented under alkaline conditions. Next, the fragmented target was hybridized with human oligonucleotide microarray Human 35K (Filgen, Nagoya) at 42 ° C. overnight, washed, and image data was read with a microarray scanner scan array Gx (Perkin Elmer). . From the image data, the signal intensity of each spot was digitized by Scan Array Express, which is microarray analysis software. Microarray data for 6 hair shaft samples of thin hair and thick hair was analyzed, and gene expression ratio of thick hair to thin hair (log (expression value of thick hair) / (expression value of thin hair)) was calculated. Microarray data was normalized by summing the total signal after subtracting the background value from the signal value. Cy3 / Cy5 values were calculated and log transformed. Then, in common among 6 people, genes with log ₂ (Cy3 / Cy5) of -1 or less were selected as those whose expression was reduced in thick hair, and one or more genes were selected as those whose expression was increased in thick hair.

(2) Analysis result (2)
As a result of clustering, 30 genes with a high gene expression ratio of thick hair to thin hair and 4 genes with a low gene expression ratio of thick hair to thin hair were identified (FIGS. 5 and 6). Thus, it succeeded in finding a useful gene involved in thinning hair. It can be said that the degree of hair thinning can be evaluated by paying attention to the expression levels of these genes.

  Among gene groups (third gene group) having a high gene expression ratio of thick hair to thin hair, C22ORF29, RS25_HUMAN, KRT10, RS27A_HUMAN, RS13_HUMAN, OR2K2, NAALADL1, TBCA, KRT1, RHOT2, RPL36, WDR45L, USP2, MADCAM1, CBX8, AKR7A2, GYPC, CCL3, APOL3, PVRL1, NR2F6, CDC2L5, PGF, LYPD2, ETFA, ACAA1, WNT3A, USP22, ALDOA and IL32 were included (see FIG. 5). Moreover, KRTHB6, SLAMF1, KRTAP3-1, and CHRNA10 were included in the gene group (fourth gene group) having a low gene expression ratio of thick hair to thin hair (see FIG. 6).

4). PCR analysis of mRNA contained in hair shaft (1)
From the white hair and black hair shafts of the top of the head of 6 subjects, the above 1. Thus, residual RNA was obtained. Each RNA was subjected to a quantitative PCR reaction using an RT-PCR kit (Superscript III Platinum SYBR Green Two-step qRT-PCR kit, manufactured by Invitrogen), and the expression levels of CDC42, FSIP2, CEPT1, and GOSR1 were quantified. The expression levels of all genes were normalized (normalized) with the expression levels of GAPDH. The primers used for measuring the expression of each gene are as follows.

Primer set for CDC42
GAGCCTCCAGAACCGAAGAA (SEQ ID NO: 1)
CGACACCAGCTGTGCAGAAA (SEQ ID NO: 2)
Primer set for FSIP2
GCATTACCATTCGGGACATAGG (SEQ ID NO: 3)
TGCTGTGCAGAAGCTCTTTAGTTT (SEQ ID NO: 4)
Primer set for CEPT1
CGCCCTAACTATCCTGTGTGAGA (SEQ ID NO: 5)
TGGCCCAAACCCTGCAT (SEQ ID NO: 6)
Primer set for GOSR1
TCTCCTTTTTTGCTGTCCTCCTT (SEQ ID NO: 7)
CTTCTGACCTCCTGGCTGTGA (SEQ ID NO: 8)
Primer set for GAPDH
TGCACCACCAACTGCTTAGC (SEQ ID NO: 9)
TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 10)

  The quantification was performed by the ΔΔCt method, and the gene expression level (log (expression value of black hair) / (expression value of white hair)) of the black hair shaft relative to the gene expression level of the white hair shaft was calculated. The result is shown in FIG. As shown in the drawing, CDC42, FSIP2, CEPT1 and GOSR1 have a high gene expression ratio of black hair to white hair. Thus, it was shown that the gene expression levels of CDC42, FSIP2, CEPT1 and GOSR1 are useful for evaluating and predicting the degree of graying.

5. PCR analysis of mRNA contained in hair shaft (2)
From the thin and thick hair shafts of the top of the head of six subjects, the above 1. Thus, residual RNA was obtained. Each RNA was subjected to a quantitative PCR reaction using an RT-PCR kit (Superscript III Platinum SYBR Green Two-step qRT-PCR kit, manufactured by Invitrogen), and the expression levels of ALDOA and PGF were quantified. The expression levels of all genes were normalized (normalized) with the expression levels of GAPDH. The primers used for measuring the expression of each gene are as follows.

Primer set for ALDOA
GTCCCTTCCCCCAAGTTATCAA (SEQ ID NO: 11)
TGGGTGGTAGTCTCGCCATT (SEQ ID NO: 12)
Primer set for PGF
CAGCCACTTCCCCCTCTTC (SEQ ID NO: 13)
GCCCCCAGGCAACCA (SEQ ID NO: 14)

  The quantification was carried out by the ΔΔCt method, and the gene expression level of the thick hair shaft (log (expression value of thick hair) / (expression value of light hair)) relative to the gene expression level of the hair shaft of thin hair was calculated. The result is shown in FIG. As shown in the figure, ALDOA and PGF have a high gene expression ratio of thick hair to thin hair. Thus, it was shown that the gene expression levels of ALDOA and PGF are useful for evaluating and predicting the degree of thinning of the hair.

  As described above, the results of PCR analysis showed the same tendency as the results of microarray analysis. This confirms the usefulness of the genes found by microarray analysis, and at the same time proves that the knowledge of microarray analysis does not depend on the type of analysis method.

  According to the hair condition evaluation method of the present invention, the condition of the hair can be evaluated non-invasively without causing pain to the customer. Moreover, since the state of hair which is not understood from morphological observation can be evaluated by gene expression, highly objective evaluation results can be obtained. The present invention makes it possible to select treatments or skin care methods such as selection of hair styling agents, hair growth agents, hair nourishing agents, cosmetics suitable for the customer's hair, and methods of using the same, using indices evaluated by gene expression.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes and the like specified in this specification are incorporated by reference in their entirety.

A group of genes identified by microarray analysis with a high expression ratio of black hair to white hair. A group of genes identified by microarray analysis with a low gene expression ratio of black hair to gray hair. The result of the microarray analysis about the gene group with the high gene expression ratio of the black hair with respect to white hair. The result of the microarray analysis about the gene group with the low gene expression ratio of the black hair with respect to white hair. Results of PCR analysis using four genes identified by microarray analysis. A group of genes identified by microarray analysis with a high gene expression ratio for thick hair to thin hair. A group of genes identified by microarray analysis with a low gene expression ratio of thick hair to thin hair. The result of the microarray analysis about the gene group with a high gene expression ratio of thick hair to thin hair. The result of the microarray analysis about the gene group with a low gene expression ratio of thick hair to thin hair. Results of PCR analysis using two kinds of genes identified by microarray analysis.

Claims (14)

  A method for evaluating the condition of hair, wherein the gene expression level of the hair shaft collected from the test subject is used as an index.   The method according to claim 1, wherein the gene expression level is a gene expression level obtained by analyzing mRNA extracted from the hair shaft as a sample. (1) A step of preparing a hair shaft collected from hair of a specific part of a test subject,
(2) a step of performing gene expression analysis using mRNA extracted from the hair shaft as a sample, and calculating an expression level of a gene related to a hair state, and (3) using the expression level calculated in step (2). Assessing the condition of the hair,
The method of claim 2 comprising:   The method according to claim 3, wherein in step (3), the expression level calculated in step (2) is collated with a reference expression level to evaluate the state of the hair.   The method according to any one of claims 3 to 4, wherein the gene expression analysis is performed by a microarray method or a PCR method.   The genes are CDC42, FSIP2, CEPT1, GOSR1, LIPT1, ZNF66, ZNF253, SCAND2, RFX4, CYP2B6, UGT2B15, ALG5, LRRC41, RABL2B, MAP1LC3C, ABCC9, TRPV1, G4ST3H, TR4, P4HA3 The method according to claim 1, wherein the gene is one or more genes selected from the group consisting of DFFB.   The method according to any one of claims 1 to 5, wherein the gene is one or more genes selected from the group consisting of KRTAP2-2, KRTAP4-9, and HIAT1.   The method according to any one of claims 1 to 7, wherein the state of the hair is a state relating to a white hair index.   The genes are C22ORF29, RS25_HUMAN, KRT10, RS27A_HUMAN, RS13_HUMAN, OR2K2, NAALADL1, TBCA, KRT1, RHOT2, RPL36, WDR45L, USP2, MAGCAM1, CBX8, AKL7L2, GLP3A, GRL3A The method according to any one of claims 1 to 5, which is one or more genes selected from the group consisting of LYPD2, ETFA, ACAA1, WNT3A, USP22, ALDOA and IL32.   The method according to any one of claims 1 to 5, wherein the gene is one or more genes selected from the group consisting of KRTHB6, SLAMF1, KRTAP3-1, and CHRNA10.   The method according to any one of claims 1 to 5 and 9 to 10, wherein the state of the hair is a state relating to an indicator of thin hair.   The method according to any one of claims 1 to 11 is performed before and after the treatment means is applied to the test subject, and the effectiveness of the treatment means is evaluated by comparing the obtained evaluation results. A method for evaluating treatment means for hair, characterized by   The method according to claim 12, wherein the treatment means is a method for determining an effect of an anti-whitening agent. The method according to claim 12, wherein the treatment means is a method for determining an effect of an anti-haircut agent.

Images