JP7082354B2 - Method for preparing polynucleotide sample from body hair sample, method for RNA expression analysis method, method for DNA analysis, storage reagent for body hair sample and collection kit for body hair sample - Google Patents

Description

The present specification discloses a method for preparing a polynucleotide sample from a hair sample. Further, the present specification discloses a method for analyzing RNA expression or a method for analyzing DNA using the polynucleotide sample. Further, the present specification discloses a storage reagent for storing a hair sample and a hair sample collection kit.

Diagnosis of skin diseases is made by a doctor based on interviews, desquamation, redness, swelling, visual judgment such as rash shape, change in color tone, information on stiffness and fever, and blood test results. It has been. An excellent magnifying glass such as Dermoscorpy is used for more detailed visual diagnosis, which is a very useful method for diagnosis (Non-Patent Document 1). Histological examination is performed when it is not possible to estimate using these methods or when it is necessary to judge the internal condition, but usually a part of the skin is collected with an instrument called trepan to prepare a pathological specimen. In addition, although it is extremely rare, cytopathology of a sample collected by fine needle aspiration may be performed for diagnosis of cancer or the like (Non-Patent Document 2).

Information on the condition of the skin is also collected for cosmetic purposes as well as pathological diagnosis. Analysis of skin for cosmetic purposes is sometimes called skin diagnosis. Skin diagnosis is a method of monitoring skin quality, sensitivity, skin condition, relative age of skin, and the like. In skin diagnosis, a method of analyzing keratin, sebum (Patent Document 1) and the like collected using a tape or a collecting tool is common. In addition, as other skin diagnosis methods, a method of diagnosing the condition of the skin by performing image analysis on the appearance of the skin using a microscope or the like (Patent Document 2), and an image analysis of the entire skin to determine the age. (Patent Document 3) can be mentioned. As another skin diagnosis method, there is a replica method in which a rubber material or the like is applied to the skin and hardened to produce a skin replica, and the texture of the skin and the shape of wrinkles are determined based on the replica.

Furthermore, in addition to the skin diagnosis, factors indicating the skin condition such as the water content of the skin electrically measured using a water content measuring device such as SKION (Patent Document 4) and the evaporation amount of water measured using a TEWA meter. Is also measured and the condition of the skin is evaluated.

Skin diagnosis is used as a criterion for ensuring the effectiveness of the coating agent for each individual and for selecting cosmetics. For example, the method of collecting keratin on the skin surface with tape is called tape stripping, and the size of the collected keratinocytes indicates turnover, age, and the presence or absence of inflammation, and observation of nucleated cells shows inflammation and epidermal barrier. Information obtained from skin diagnosis methods using collected samples, such as showing normality, is widely used for skin diagnosis. In addition, since the measurement of wrinkle depth and frequency by diagnosis using images taken by replicas correlates well with the apparent age, it is also used as an effect standard for quasi-drugs. It is possible to estimate skin information such as the degree of dryness of the skin for measuring the amount of water and the TEWL value indicating the amount of evaporation of water, which correlates with the degree of inflammation of the skin by observing the barrier state of the skin. In addition, such information may be used not only for beauty but also for medical diagnosis.
Further, Patent Document 5 describes that a subject is genetically analyzed using a nucleic acid derived from sebum.

Patent No. 4157873 Japanese Patent Application 2000-192793 JP-A-2002-7568 Patent No. 1981624 Public Relations No. 2018/008319

How do you see How to cure The first step in skin treatment-Tips and skills for skin treatment that can be used immediately Yodosha 2013/11/12 Hisashi Uhara (Author) Shigeo Yokoyama, Shogo Urabe, Ayako Gamaike, Tsutomu Daa, Kenji Kashima: Part 2: Actual Cytopathology and Topics 24. Skin, Pathology and Clinic, 31 (Extra edition), 379-389, 2013

In the current cosmetics, not only the general classification but also the difference of each individual is focused on, and it is also excellent for tailor-made cosmetics that design products by paying attention to the difference of each person's skin condition. Development of skin diagnosis methods is always required.

However, in the conventional skin diagnosis method, it is difficult to standardize the judgment criteria and eliminate prejudice because the analysis results produced by the complex factors are comprehensively judged from a lot of indirect information. In addition, since a sufficient theory has not been established for information processing such as judging internal changes based on superficial information, it has been difficult to accumulate information for establishing an evaluation method.

In addition, one of the reasons why it is difficult to diagnose the skin condition using the current measurement method is that the obtained sample is not a living cell but only a secreted substance such as dead skin or lipid. Be done. It is the changes in cell activity that determine the aging and skin conditions, and there is a limit to the estimation of the prenatal state of cells by examining non-living keratin. Conversely, if we succeed in acquiring and analyzing living cells from local skin, it will be possible to obtain information indicating the amount of skin condition and age that is different from the conventional ones.

Live cells are not exposed on the surface of the skin, and invasion of the skin is required to obtain live cells from any target skin. For example, although accurate and large amounts of information can be obtained from pathological specimens, there are drawbacks such as the location and symptoms that can be collected are limited due to the invasiveness. If the purpose is beauty information, most of the information obtained by obtaining cells is skin condition, skin aging, etc., and it is in the consumer's interest to select invasive means to obtain such information. Not as good as it is, it is not acceptable. In addition, as mentioned above, it is indisputable that a method that is as minimally invasive as possible in the diagnosis for medical purposes is in the interest of the patient. Therefore, the establishment of a method that is less invasive and can analyze the cells of the target skin more directly has been potentially sought after by consumers, developers, and medical personnel.
However, in the method described in Patent Document 5, there is a limit to the amount of nucleic acid that can be sampled in a subject having a small amount of sebum secretion or a place having a small amount of sebum secretion.
In view of the above-mentioned problems of the conventional method, it is an object of the present invention to obtain skin cell information by a less invasive method and perform skin analysis such as assisting in diagnosis of skin diseases.

After repeated diligent research, the present inventor has found that polynucleotides can be analyzed from several hair samples.

The present invention has been completed based on the findings and includes the following aspects.
Item 1. A method for preparing a polynucleotide sample, which comprises preparing a polynucleotide sample from a body hair sample containing peri-root cells taken directly from a region of interest in a subject's skin tissue.
Item 2. Item 2. The preparation method according to Item 1, wherein when the subject is a human, the hair sample does not include the hair sample.
Item 3. Item 2. The preparation method according to Item 1 or 2, wherein the polynucleotide is RNA.
Item 4. A method for analyzing RNA expression, which comprises analyzing the expression of RNA in peri-root cells using the polynucleotide sample prepared by the preparation method according to Item 3.
Item 5. Item 4. The RNA expression analysis method according to Item 4, wherein the subject is an individual exposed to a test factor, and the analysis result is used for evaluating the effect of the test factor on the subject.
Item 6. Item 5. The RNA expression analysis method according to Item 5, wherein the evaluation is a safety evaluation of the test factor.
Item 7. Item 5. The RNA expression analysis method according to Item 5, wherein the evaluation is an evaluation of the usefulness of the test factor.
Item 8. Item 6. The RNA expression analysis method according to Item 6 or 7, wherein the evaluation index is an index indicating a skin health condition, a sign of a skin disease, or a skin disease in the subject due to the test factor.
Item 9. Item 2. The preparation method according to Item 1 or 2, wherein the polynucleotide is DNA.
Item 10. A method for analyzing DNA, which comprises performing at least one of mutation analysis, copy number analysis, and DNA methylation analysis of peri-root cell-derived DNA using the polynucleotide sample prepared by the preparation method according to Item 9. ..
Item 11. Item 6. The method for analyzing DNA according to Item 10, wherein the subject is an individual exposed to a test factor, and the analysis result is used for evaluating the effect of the test factor on the subject.
Item 12. Item 2. The method for analyzing DNA according to Item 11, wherein the evaluation is a safety evaluation of the test factor.
Item 13. Item 2. The method for analyzing DNA according to Item 11, wherein the evaluation is an evaluation of the usefulness of the test factor.
Item 14. Item 10. The method for analyzing DNA according to Item 10, wherein the subject is an individual exposed to a test factor, and the analysis result is used to evaluate the amount of damage accumulated by the test factor in the subject.
Item 15. Item 4. The method for analyzing DNA according to Item 14, wherein the test factor is ultraviolet light and / or aging.
Item 16. A polynucleotide analyzer for analyzing a polynucleotide derived from peri-hair root cells, wherein the polynucleotide analyzer includes a processing unit, and the processing unit is any one of Items 1 to 3 and Item 9. Tested with analysis information of polynucleotides derived from peri-root cells collected from areas of interest in the skin tissue of subjects exposed to the test factor, analyzed using polynucleotide samples prepared by the preparation method described in. The polynucleotide analyzer that obtains as information, compares the test information with the corresponding reference information, and evaluates the amount of accumulation or reduction of skin damage caused by the test factor in the area of interest of the subject's skin.
Item 17. A test exposed to a test factor analyzed by a computer using a polynucleotide sample prepared by the preparation method according to any one of Items 1 to 3 and Item 9 when run on a computer. A step of acquiring analysis information of a polynucleotide derived from peri-root cells collected from an area of interest in the skin tissue of the body as test information, a step of comparing the test information with the corresponding reference information, and a step of comparing the test information with the corresponding reference information, and the skin of the subject. A polynucleotide analysis program for analyzing peri-root cell-derived polynucleotides, which comprises a step of evaluating the amount of accumulation or reduction of skin damage caused by the test factor in the region of interest.
Item 18. Collected from areas of interest in the skin tissue of subjects exposed to the test factor, analyzed using a polynucleotide sample prepared by the preparation method according to any one of Items 1 to 3 and Item 9. A step of acquiring analysis information of a polynucleotide derived from peri-root cells as test information, a step of comparing the test information with the corresponding reference information, and a skin damage caused by the test factor in the area of interest of the subject's skin. A method for analyzing a polynucleotide for analyzing peri-root cell-derived polynucleotides, which comprises a step of evaluating an accumulated amount or a reduced amount of.
Item 19. A storage reagent for storing a hair sample containing peri-root cells taken directly from the area of interest of the subject's skin tissue, which maintains the quality of the polynucleotide contained in the hair sample, and is described in Items 1 to 3 and. A storage reagent used for the preparation method according to any one of 9.
Item 20. Item 2. A collection kit for collecting hair samples used in the preparation method of.

Since the above embodiment is characterized by analysis of peri-root cells to which hair growth or other body hair is collected and attached, a skin cell sample can be easily obtained from a skin disease site or a test site to be inspected and poly. Nucleotide samples can be prepared and genetic information can be analyzed by next-generation sequencers, real-time PCR, and the like. Since various analyzes such as expression profile, mutation accumulation, and epigenetics have been proposed and established for the analysis of current genetic information, by using these methods in combination, the function of cells in the skin and It is possible to collect a large amount of information related to aging status, effects of test factors on cell function, and the like.

According to the method for preparing a polynucleotide sample according to the present invention, a polynucleotide sample derived from skin cells can be obtained with less invasiveness. In addition, the obtained polynucleotide sample can be used to collect information derived from the skin necessary for the medical field or the cosmetic field.

The outline of the processing of the analysis program 1042 is shown. An example of a polynucleotide analysis information database is shown. The hardware configuration of the analysis device 10 is shown. The functional configuration of the analyzer 10 is shown. A part of the processing of the analysis program 1042 is shown. A part of the processing of the analysis program 1042 is shown. A part of the processing of the analysis program 1042 is shown. A part of the processing of the analysis program 1042 is shown. A part of the processing of the analysis program 1042 is shown. A display example of the DNA mutation analysis result and the mutation analysis result of a male in his 50s is shown. The sequence in which heteroplasmy was found at the position of the mutation shown in FIG. 10 is shown. "Position" indicates the position number attached to the reference sequence. "Ref. Seq." Indicates the nucleotide sequence of the reference sequence. "Sub. Seq." Shows the sequence of subjects corresponding to the reference sequence. "Frequency" indicates the frequency of leads. "Dept" indicates the sequence Dept of each read. A display example of the DNA mutation analysis result and the mutation analysis result of a male in his twenties is shown. The sequence in which heteroplasmy was found at the position of the mutation shown in FIG. 12 is shown. “Position”, “Ref. Seq.”, “Sub. Seq.”, “Frequency”, and “Dept” are the same as in FIG. FIG. 14 (A) shows the amplification curve of each gene when cDNA samples having different concentrations were used. FIG. 14B shows a melting curve. FIG. 14 (C) shows the relative expression level of IL-1α mRNA. FIG. 14 (D) shows the relative expression level of β-actin mRNA. The relative expression levels of GAPDH, IL-33, IL-23, IL-17, and TNF-α are shown. (A ) shows the relative expression level of HMGB-1 mRNA. And ( B ) indicate the relative expression level of TNFα mRNA.

1. 1. Explanation of Terms First, the meanings of the main terms used in the present specification will be explained.

"Subject" is intended for an individual from whom a hair sample is to be collected. The "individual" is not particularly limited, and examples thereof include mammals such as humans, mice, rats, dogs, cats, rabbits, cows, horses, goats, sheep and pigs, and birds such as chickens. Mammals such as humans, mice, dogs, cats, cows, horses and pigs are preferable, humans, mice, dogs or cats are more preferable, humans or mice are more preferable, and humans are most preferable. Is.

"Body hair" is intended for hair produced on the skin tissue of an individual's body surface. When the individual is human, body hair may include raw hair and hard hair. Hair may include hair, eyebrows, armpit hair, pubic hair, whiskers and the like. Preferably, if the individual is human, the hair does not include hair. If the individual is a bird, the hair includes feathers.

In the present specification, the body hair preferably includes a part or all of the hair bulb. This is because the hair that does not contain hair bulbs is likely to be torn off at the time of collection and does not contain cellular components. Therefore, the "hair sample" is taken directly from the subject's skin tissue and contains peri-root cells. Peri-root cells can include cells derived from peri-root tissues such as hair follicle cells, hair papilla cells, ductal cells, vascular epithelial cells, red blood cells, leukocytes, and platelets. In addition, leukocytes may include lymphocytes, neutrophils, monocytes, eosinophils, basophils. In addition, peri-root cells may include microorganisms and cells infected with microorganisms. Microorganisms can include pathogens and indigenous skin microorganisms. Microorganisms can include bacteria, fungi, viruses, mites and the like.

"Direct collection" of a hair sample is intended to remove and collect the hair that is bound to the dermal papilla. That is, the hair is not intended to be recovered, preferably those that have fallen off the skin. Body hair can be collected by a known method such as fingers, tweezers (including hair removal), depilatory tape, and depilatory wax. Hair can be collected from the site where the polynucleotide sample is to be collected (hereinafter referred to as the "region of interest"). The hair sample may be collected by the subject himself or by an individual other than the subject. Individuals other than the subject are preferably humans. Humans from whom hair samples are taken may include doctors, nurses, hairdressers, and estheticians. When the subject is a human, it is preferable to collect the hair sample by the subject himself.

The number of hairs required to prepare a polynucleotide sample is about 1 to 10, preferably about 3 to 5. Since the analysis result of the polynucleotide described later varies depending on the collection site of the hair sample, when repeatedly collecting the hair sample from the region of interest, it is preferable to collect the hair sample from the site as close as possible to the previous collection site. ..

Polynucleotides can include DNA and RNA. DNA may include genomic DNA and mitochondrial DNA. RNA may include messenger RNA (mRNA), untranslated RNA, microRNA, ribosomal RNA (rRNA), transfer RNA (tRNA) and the like. The RNA is preferably mRNA, untranslated RNA, and microRNA.

Polynucleotide samples are not limited as long as they contain polynucleotides derived from hair samples. It may be in a dry state or may be dissolved in a buffer or the like. Further, the polynucleotide contained in the polynucleotide sample may be purified, crudely purified, or unpurified.

The polynucleotide sample may contain ethylenediaminetetraacetic acid, β-mercaptoethanol (or dithiothreitol), bovine serum albumin, sodium chloride and the like.

Individuals include individuals exposed to the test factor.
The test factor is intended to be a factor for which the effect on the subject is evaluated. In addition, the test factor is a factor to which the area of interest for collecting the hair sample is exposed. The test factors include compounds; nucleic acids; sugars; lipids; glycoproteins; glycolipids; lipoproteins; amino acids; peptides; proteins; polyphenols; chemokines; terminal metabolites, intermediate metabolites, and synthetic raw materials of the substances. Can include at least one metabolite selected from the group; metal ions; or substances such as microorganisms. Further, the substance may be a simple substance or a mixture of a plurality of kinds of substances. Preferably, the substance includes pharmaceuticals, quasi-drugs, medicated cosmetics, foods, foods for specified health use, foods with functional claims, and candidate products thereof. In addition, the test factor may include factors other than the substance. For example, as test factors other than substances, environmental factors such as light, radiation, and atmosphere; and physiological factors such as hormonal status can be mentioned. The light may include ultraviolet rays, infrared rays, visible light and the like. Radiation may include α-rays, β-rays, γ-rays, X-rays and the like. The atmosphere may include indoor or outdoor humidity, temperature and the like. Physiological factors can include age (aging), sleep time, weight control, the presence or absence of menstruation, and stress.

The test factor may cause at least one of poor skin health, signs of skin disease and skin disease in the subject. Estimates of whether poor skin health, signs of skin disease or skin disease have been induced due to the test factors are indicators of poor skin health, signs of skin disease, or skin disease. It is done by determining whether or not it suggests the onset of.

The test factor may improve or maintain good skin health in the subject, or reduce or suppress signs of skin disease or skin disease. Estimates of whether skin health has improved or remained in good condition due to the test factors, or signs of skin disease or estimation of whether skin disease has been reduced or suppressed, are evaluated. Indicators are made by determining whether the indicators suggest improvement or maintenance of good skin health, or signs of skin disease, or reduction or suppression of skin disease.

Here, the skin disease may include an inflammatory disease, a neoplastic disease and the like. Inflammatory diseases may include folliculitis (folliculitis), dermatitis. Dermatitis may include non-allergic diseases, allergic diseases and the like. Allergic diseases may include atopic dermatitis, contact dermatitis, psoriasis and the like. Neoplastic diseases may include benign tumors and malignant tumors. Malignant tumors may include skin cancers (particularly squamous cell carcinomas), malignant melanomas and the like.

The signs of dermatitis are macroscopic, and although there are no subjective symptoms on the skin of the subject, infiltration of leukocytes etc. is observed in the tissue around the hair follicle, and the expression of inflammatory markers in the tissue around the hair follicle is observed. The state of rising.

The health condition of the skin may include the condition of the skin such as the elasticity of the skin, the texture of the skin, the amount of water in the skin, and the amount of mitochondria per cell. Evaluation of skin health is also called "skin diagnosis".
The index of evaluation is not limited as long as it suggests skin health, signs of skin disease, or skin disease.

Indicators of evaluation include the expression of genes capable of assessing skin health, signs of skin disease or skin disease when the polynucleotide is RNA. For example, the expression of genes whose expression is increased during inflammation such as TNF-α and interleukin-1 can be mentioned. Interleukin-33, interleukin-17, interleukin-23, etc. are genes expressed during inflammation in lymphocytes, antigen-presenting cells, etc., but they are used to evaluate the presence or absence or amount of inflammatory cells infiltrating the tissue around the hair root. Can be used. Matrix metalloproteinase-1, neutral endopeptidase, hyaluronicidase-1, etc. are genes whose expression increases with UV irradiation, and proteins and skin necessary for maintaining skin elasticity such as collagen fibers and elastin fibers. It is known to decompose hyaluronic acid, which maintains the texture and water content. Therefore, these genes can be used as an index of deterioration of skin health. Since the expression of type I collagen gene, elastin gene, and hyaluronic acid synthase gene is a gene necessary for maintaining skin elasticity, skin texture, and skin water content, the expression of these genes is the health condition of the skin. It can be used as an index for improving the condition of the skin or maintaining the health of the skin.

When the polynucleotide is DNA, it comprises at least one of DNA mutations, copy counts or DNA methylation capable of assessing skin health, signs of skin disease or skin disease. Mutations in DNA may include, as indicators, the number of mutations in the entire genomic DNA and / or mitochondrial DNA, or in a particular gene, and the presence or absence of a particular mutation within a particular gene. The number of copies may include the number of copies of a specific gene and the number of copies of mitochondrial DNA. DNA methylation includes the presence or absence of methylation in genomic DNA and / or mitochondrial DNA as a whole, or in specific genes, and the degree of methylation within the polynucleotide sample.

In addition, the number of copies in the polynucleotide sample such as ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene present in mitochondrial DNA can be converted into the number of mitochondria per cell. Mitochondrial counts can be used to assess skin age.

2. 2. Method for preparing polynucleotide sample, reagent for storing body hair sample, and kit for collecting body hair sample (1) Method for preparing polynucleotide sample The preparation of a polynucleotide sample from a body hair sample can be performed according to a known method.

When the polynucleotide is DNA, for example, a hair sample collected from skin tissue is added to a predetermined lysate, treated with a proteolytic enzyme such as proteinase K, and then subjected to phenol / chloroform extraction and ethanol precipitation. DNA can be extracted.

When the polynucleotide is RNA, for example, RNA is extracted by adding a hair sample collected from skin tissue to a lysing solution containing guanidine and the like, dissolving the polynucleotide, and then performing phenol / chloroform extraction and isopropyl alcohol precipitation. Can be done.

When the polynucleotide is subjected to ethanol precipitation or isopropyl alcohol precipitation, a co-precipitating substance such as salmon sperm-derived DNA, yeast-derived tRNA, or glycogen may be added.

The polynucleotide may be column-purified using a silica membrane or the like instead of purification by phenol / chloroform purification and ethanol precipitation or isopropyl alcohol precipitation.
Further, a commercially available nucleic acid extraction reagent or a nucleic acid extraction kit may be used for the extraction of the polynucleotide.
Here, the polynucleotide extracted is mainly derived from peri-root cells.

(2) Storage reagent for hair sample The storage reagent for body hair sample is not limited as long as the quality of the polynucleotide can be maintained. The quality of a polynucleotide can be evaluated using the fragmentation and degradation of the polynucleotide as an index. Since the amount of polynucleotide extracted from the hair sample is very small, the fragmentation or degradation of the polynucleotide can be performed, for example, using the extracted polynucleotide as a template for the DNA sequence or RNA sequence encoding the housekeeping gene described later. , PCR or RT-PCR can be performed, amplified, and evaluated in the presence of a constant size amplification product. The constant size can be exemplified by, for example, 200 bp or more, preferably 500 bp or more.

When the polynucleotide is DNA, for example, a predetermined lysate or the like can be used as a storage reagent for storing a hair sample collected from a skin tissue until DNA extraction. The lysate includes a buffer solution for adjusting the pH (for example, a Tris HCl buffer having a final concentration of about 10 mM to 100 mM, and a pH of about 7.0 to 8.5), and a chelating agent (at a final concentration of 0. Ethylenediamine tetraacetic acid of about 5 mM to 2 mM), salt (for example, NaCl of about 150 mM), surfactant (for example, 0.1% by volume / volume% to 1% by volume / volume of sodium lauryl sulfate at the final concentration), solvent. May include water and the like. Further, the storage reagent may contain phenol.

When the polynucleotide is RNA, for example, a predetermined lysate or the like can be used as a storage reagent for storing a hair sample collected from skin tissue until RNA extraction. The lysate may contain a protein denaturing agent (for example, a guanidine thiocyanate solution having a final concentration of about 4 M), water as a solvent, and the like. Further, the storage reagent may contain dithiothreitol or β-mercaptoethanol (about 1 mM to 2 mM), sodium acetate (final concentration of about 200 mM), and phenol.

Here, as the storage reagent, a commercially available DNA or RNA extraction reagent may be used. Further, a reagent capable of extracting both DNA and RNA such as ISOGEN (Nippon Gene) and TRI reagent ™ (Molecular Research Center, Inc.) may be used as a storage reagent.

(3) Hair sample collection kit For the hair sample collection kit, for example, the above 2. It may include the storage reagent described in (2) and a collection product for collecting a hair sample. Examples of the collection product include tweezers (hair removal), depilatory tape, and depilatory wax. The collection kit may further contain a phenol reagent, a chloroform reagent (including isoamyl alcohol) for extracting the polynucleotide, and a mixture thereof. It may also contain a proteolytic enzyme such as Proteinase K, ethanol or isopropyl alcohol, glycogen and the like.

Further, the collection kit may be attached with a paper containing a URL, a QR code (trademark), etc. for accessing the instruction manual of the kit and the instruction manual of the kit via the Internet.
3. 3. RNA Expression Analysis Method This embodiment relates to an RNA analysis method.

3-1. Acquisition of RNA measurement values 2. The polynucleotide sample containing RNA prepared in 1 can be used for RNA expression analysis. RNA that is the target of expression analysis is called "interested RNA".

RNA expression analysis can be performed according to a known method. It is preferable that the RNA expression analysis method can quantitatively evaluate the expression level. For example, as a method for quantitatively evaluating the expression level of RNA, real-time RT-PCR, microarray, digital PCR, RNA-Seq and the like can be mentioned.

For quantification by real-time RT-PCR, first, RNA extracted from a hair sample is used as a template for reverse transcription reaction to obtain cDNA. It can be carried out by using the obtained cDNA as a template and analyzing it by a real-time PCR method or the like using a primer specific to the target RNA. The expression level of the RNA of interest by real-time RT-PCR may be expressed by a Thrashold Cycle (Ct) value, a ΔCt value, or the like. The Ct value is the number of cycles when the PCR amplification product reaches a certain amount. The ΔCt value is the difference between the Ct value of the RNA of interest and the Ct value of the housekeeping gene described later.

In the analysis by microarray, first, RNA extracted from a hair sample is used as a template for reverse transcription reaction, and a template DNA is prepared by tagging the obtained cDNA with a primer site or the like. The tagged cDNA is amplified while being fluorescently labeled, and the fluorescently labeled amplification product is hybridized to the probe on the microarray. RNA can be quantified by measuring the fluorescence intensity on the microarray.

RNA-Seq fragmentes RNA extracted from a hair sample and uses it as a template to synthesize cDNA by reverse transcription reaction and create a library. The nucleotide sequence of the fragment contained in each library was determined by a next-generation sequencer, and the information was mapped to a known Reference genome sequence registered in National Center for Biotechnology Information (NCBI) or the like, and each sequence obtained by sequencing was performed. The number of gene reads is expressed as RPKM (Reads Per Kilobases per Million). RPKM may be expressed as the intensity of a signal such as a heat map. Next-generation sequencers include, for example, Illumina (San Diego, CA) MiSeq ™, HiSeq ™, NextSeq ™, MiniSeq ™, NovaSeq ™; Thermo Fisher (Walsom, MA). Ion Proton ™, Ion PGM ™; GS FLX + ™, GS Junior ™, etc. from Roche (Basel, Switzerland).

A value that reflects the expression level of RNA acquired by real-time RT-PCR, microarray, RNA-Seq, etc. is also referred to as "measured value of RNA". The measured value of RNA may be expressed by the number of copies (absolute amount) of RNA of interest present in a certain amount of sample. Further, the measured value of RNA may be a value reflecting the relative expression level with respect to the expression level of the housekeeping gene such as β2-microglobulin mRNA, GAPDH mRNA, Maea mRNA and β-actin mRNA. Alternatively, the measured value of RNA may be expressed by the intensity of a signal such as fluorescence or luminescence.

Further, the measured value of the RNA of interest may be expressed as a relative value of the expression level of RNA obtained from the hair sample of the subject to the expression level of the RNA of interest obtained from the hair sample of the positive control or the negative control, for example. good.

Examples of the positive control include individuals exposed to the test factor, individuals having a disease, and the like. Examples of the negative control include individuals who have not been exposed to the test factor and individuals who do not have a disease (for example, healthy individuals). At this time, it is preferable that the hair sample of the positive control or the negative control and the hair sample of the subject are collected from the same site. This is because the expression level of RNA may change depending on the collection site of the hair sample.

In addition, a positive control hair sample and a negative control hair sample may be collected from one individual. For example, in the left and right regions sandwiching the sagittal plane on the back of an individual, one region is exposed to the test factor to collect a positive hair sample, and the body side of the site exposed to the test factor is used as the test sample. An unexposed negative control hair sample may be taken. This combination may be, for example, instead of the sagittal plane, a dorsal region and an abdominal region sandwiching a coronal plane, and an upper and lower region sandwiching a cross section (transverse plane). Furthermore, this is because the expression level of RNA may change depending on the collection site of the hair sample.

3-2. Evaluation of the effect of the test factor on the subject using the measured value of RNA The measured value of RNA obtained from the hair sample collected from the individual exposed to the test factor is the safety evaluation or usefulness of the test factor. Can be used for evaluation. In this case, the measured RNA used is a measure of RNA expressed from a gene that is a sign of skin disease in the subject due to the test factor or an indicator of evaluation indicating skin disease. The genes that serve as evaluation indicators are as described in 1. above. As mentioned in.

When conducting safety tests, subjects are generally healthy individuals, at least for the skin, and exposed to test factors. Then, for example, when the measured value of the RNA of interest, which is a sign of a skin disease or an index of evaluation indicating the skin disease, changes depending on the contact between the subject and the test factor, the test factor is applied to the subject. Can be determined to suggest a lack of safety.

Whether or not the measured value of interest RNA changes in the body hair sample of the subject exposed to the test factor is determined by, for example, the measurement value of interest RNA derived from the body hair sample of the subject, and the measurement value of the same RNA as the interest RNA. It can be determined by comparing with the reference value of.

For example, in the case of RNA whose expression increases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a negative control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample becomes higher than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.

For example, in the case of RNA whose expression increases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a positive control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample approaches the reference value or becomes higher than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.

For example, in the case of RNA whose expression decreases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a negative control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample becomes lower than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.

For example, in the case of RNA whose expression decreases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a positive control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample approaches the reference value or becomes lower than the reference value, it can be determined that the measured value of the RNA of interest has fluctuated.
Further, the reference value may be a measured value of RNA of interest derived from a hair sample collected from a subject before being exposed to the test factor, instead of being a positive control or a negative control.

When conducting a usefulness test, generally, an individual with a sign of skin disease or a skin disease is taken as a subject and exposed to a test factor. Then, for example, when the measured value of the RNA of interest, which is a sign of a skin disease or an index of evaluation indicating the skin disease, is improved depending on the contact between the subject and the test factor, the test factor is used by the subject. It can be determined that it is a sign of a skin disease that it has, or suggests that it is useful for a skin disease.

Whether or not the measured value of interest RNA is improved in the body hair sample of the subject exposed to the test factor is determined by, for example, the measurement value of interest RNA derived from the body hair sample of the subject, and the measurement value of the same RNA as the interest RNA. It can be determined by comparing with the reference value of.

For example, in the case of RNA whose expression increases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a negative control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample approaches the reference value or becomes lower than the reference value, it can be determined that the measured value of the RNA of interest has improved.

For example, in the case of RNA whose expression increases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a positive control hair sample is used as a reference value, the body hair of the subject. When the measured value of the interesting RNA derived from the sample becomes lower than the reference value, it can be determined that the measured value of the interesting RNA has improved.

For example, in the case of RNA whose expression decreases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a negative control hair sample is used as a reference value, the body hair of the subject. When the measured value of the RNA of interest derived from the sample approaches the reference value or becomes higher than the reference value, it can be determined that the measured value of the RNA of interest has improved.

For example, in the case of RNA whose expression decreases when exposed to a test factor or depending on a disease, and when the measured value of RNA derived from a positive control hair sample is used as a reference value, the body hair of the subject. When the measured value of the interesting RNA derived from the sample becomes higher than the reference value, it can be determined that the measured value of the interesting RNA has improved.

As a reference value, a measured value of RNA of interest derived from a hair sample taken from the same subject before exposure to the test factor may be used instead of the negative control. Furthermore, the reference value is derived from the hair sample collected from the part not exposed to the test factor instead of the negative control when there is a part exposed to the test factor and a part not exposed to the test factor in the same subject. Measurements of RNA of interest may be used.

As a reference value, a measured value of RNA of interest derived from a hair sample collected from the same subject after being exposed to the test factor may be used instead of the positive control. Furthermore, the reference value is an interest derived from the hair sample collected from the part exposed to the test factor instead of the positive control when there is a part exposed to the test factor and a part not exposed to the test factor in the same subject. RNA measurements may be used.

Further, as the reference value, the average value, the mode value, the median value, the minimum value, the maximum value, the first quartile, the third quartile, and the like of the positive control group or the negative control group may be adopted. Further, a value that can discriminate between the positive control group and the negative control group with the highest accuracy may be used as a reference value. The value that can be discriminated most accurately can be determined based on, for example, sensitivity, specificity, positive predictive value, negative predictive value, and the like.

Here, "higher than the reference value" means that the measured value of the RNA of interest derived from the hair sample of the subject is, for example, 115% or more, preferably 130% or more, more preferably 150% or more of the reference value. Intended for the case.

Further, it is lower than the reference value when the measured value of the RNA of interest derived from the hair sample of the subject is, for example, less than 85%, preferably less than 70%, more preferably less than 50% of the reference value. Intended.
The term "approaching the reference value" is intended, for example, when the measured value of the RNA of interest derived from the hair sample of the subject is in the range of 85% or more and less than 115% of the reference value.
4. DNA Analysis Method This embodiment relates to a DNA analysis method.

4-1. Acquisition of measured DNA values 2. The polynucleotide sample containing DNA prepared in 1 can be used for at least one of DNA mutation analysis, copy number analysis, and DNA methylation analysis.

DNA mutation analysis, copy number analysis, or DNA methylation analysis can be performed according to a known method.

(1) DNA Mutation Analysis As a method for analyzing DNA mutations, for example, DNA sequencing can be mentioned. In DNA sequencing, for example, first, DNA extracted from a subject's hair sample is fragmented, and a DNA library tagged with a primer site or the like is prepared. This library is amplified by PCR or the like and used for sequencing. Sequencing can be performed using, for example, a next-generation sequencer. The nucleotide sequence of the obtained DNA of the subject can be mapped to a known Reference genome sequence and the average Japanese mitochondrial sequence AF346990, and the presence or absence of mutation, the number of mutations, and the location of mutation can be detected. The next-generation sequencer is described in 3-1. As illustrated in. DNA mutation analysis may be performed on the entire DNA contained in the polynucleotide sample, but it may also be performed on a specific gene, a region of a specific locus such as a microsatellite, and only on that region. good.

(2) Analysis of the number of copies of the locus As a method of analyzing the number of copies of the locus, real-time PCR, microarray, DNA sequencing and the like can be mentioned.

The number of copies of a locus can be quantified by real-time PCR by using the DNA contained in the polynucleotide sample as a template and analyzing it by a real-time PCR method or the like using a primer specific to the target locus. The number of copies of DNA may be represented by a Ct value, a ΔCt value, or the like.

To quantify the number of copies of the locus by microarray, first, a template DNA is prepared by tagging the DNA extracted from the hair sample with a primer site or the like. The tagged DNA is amplified while being fluorescently labeled, and the fluorescently labeled amplification product is hybridized to the probe on the microarray. DNA can be quantified by measuring the fluorescence intensity on the microarray.

To quantify the number of copies of loci by DNA sequencing, first, DNA extracted from a hair sample is synthesized and a library is created. The nucleotide sequence of the fragment contained in each library is determined by a next-generation sequencer, the information is sequenced in a known Reference genome, and the number of reads at each locus is expressed as RPKM. RPKM may be expressed as the intensity of a signal such as a heat map.

The copy number analysis of a locus may be performed on the entire DNA contained in the polynucleotide sample, or may be performed only on a region of a specific locus by amplifying the region. Further, the copy number analysis of the locus may be performed on genomic DNA or mitochondrial DNA. In particular, it has been reported that the number of copies of mitochondrial DNA correlates with the condition of the skin. The number of copies of mitochondrial DNA is determined from the Ct values of the ND1 gene, SLCO2B1 gene, ND5 gene, SERPINA1 gene, etc. in the entire DNA contained in the polynucleotide sample at https: // www. Takara-bio. co. It can be calculated using a program such as jp / research / r / mtdna_mountoring_tool /.

(3) DNA methylation analysis As a method for analyzing DNA methylation, for example, DNA contained in a polynucleotide sample is subjected to bisulfite treatment to convert unmethylated cytosine into uracil, and then a nucleotide at a specific locus. Methods of analyzing sequences by PCR, real-time PCR or sequencing can be mentioned. In addition, whether or not the region of the specific gene locus was cleaved by PCR or real-time PCR after the methylation site of the DNA contained in the polynucleotide sample was cleaved by the methylation susceptibility restriction enzyme. By determining, methylation can be detected.

(4) Measured value of DNA of interest The value representing the number of mutations obtained by DNA mutation analysis, the value of the number of copies of gene loci obtained by copy number analysis, and the degree of methylation obtained by DNA methylation analysis. The represented values are collectively referred to as "measured values of DNA". In addition, a specific locus to be analyzed is also referred to as an "interest locus".

The measured value of the DNA of interest may be expressed, for example, as a relative value of the measured value of the DNA obtained from the hair sample of the subject to the measured value of the DNA of interest obtained from the hair sample of the positive control or the negative control.

Examples of the positive control include individuals exposed to the test factor, individuals having a disease, and the like. Examples of the negative control include individuals who have not been exposed to the test factor and individuals who do not have a disease (for example, healthy individuals). At this time, it is preferable that the hair sample of the positive control or the negative control and the hair sample of the subject are collected from the same site. This is because the expression level of RNA may change depending on the collection site of the hair sample. This is because the way of mutation of DNA, the number of copies, and the degree of methylation may change depending on the collection site of the hair sample.

In addition, a positive control hair sample and a negative control hair sample may be collected from one individual. For example, in the left and right regions sandwiching the sagittal plane on the back of an individual, one region is exposed to the test factor to collect a positive hair sample, and the body side of the site exposed to the test factor is used as the test sample. An unexposed negative control hair sample may be taken. This combination may be, for example, instead of the sagittal plane, a dorsal region and an abdominal region sandwiching a coronal plane, and an upper and lower region sandwiching a cross section (transverse plane). Furthermore, this is because the expression level of RNA may change depending on the collection site of the hair sample.
4-2. Evaluation of the effect of test factors on subjects using DNA measurements

The measured value of DNA obtained from the hair sample collected from the individual exposed to the test factor can be used for the safety evaluation or the usefulness evaluation of the test factor. In this case, the measured value of the DNA used is a measured value of DNA at a locus that is a sign of skin disease in the subject due to the test factor or an index of evaluation indicating the skin disease. The genes that serve as evaluation indicators are as described in 1. above. As mentioned in.

When conducting safety tests, subjects are generally healthy individuals, at least for the skin, and exposed to test factors. Then, for example, when the measured value of the DNA of interest, which is a sign of a skin disease or an index of evaluation indicating the skin disease, changes depending on the contact between the subject and the test factor, the test factor is applied to the subject. Can be determined to suggest a lack of safety.

Whether or not the measured value of the DNA of interest changes in the hair sample of the subject exposed to the test factor is determined by, for example, the measured value of the DNA of interest derived from the hair sample of the subject and the measured value of the same DNA as the DNA of interest. It can be determined by comparing with the reference value of.

For example, in the case of DNA in which the measured value of DNA increases when exposed to a test factor or depending on the disease, and the measured value of DNA derived from a negative control hair sample is used as a reference value, the test is performed. When the measured value of the interest DNA derived from the body hair sample becomes higher than the reference value, it can be determined that the measurement value of the interest DNA has fluctuated.

For example, in the case of DNA whose measured value of DNA increases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a positive control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body approaches the reference value or becomes higher than the reference value, it can be determined that the measurement value of the interest DNA has fluctuated.

For example, in the case of DNA whose measured value of DNA decreases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a negative control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body becomes lower than the reference value, it can be determined that the measurement value of the interest DNA has fluctuated.

For example, in the case of DNA whose measured value of DNA decreases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a positive control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body approaches the reference value or becomes lower than the reference value, it can be determined that the measurement value of the interest DNA has fluctuated.
Further, the reference value may be a measured value of DNA of interest derived from a hair sample collected from a subject before being exposed to the test factor, instead of being a positive control or a negative control.

When conducting a usefulness test, generally, an individual with a sign of skin disease or a skin disease is taken as a subject and exposed to a test factor. Then, for example, when the measured value of the DNA of interest, which is a sign of a skin disease or an index of evaluation indicating the skin disease, is improved depending on the contact between the subject and the test factor, the test factor is used by the subject. It can be determined that it is a sign of a skin disease that it has, or suggests that it is useful for a skin disease.

Whether or not the measured value of the interest DNA is improved in the hair sample of the subject exposed to the test factor is determined by, for example, the measurement value of the interest DNA derived from the body hair sample of the subject is the measurement value of the same DNA as the interest DNA. It can be determined by comparing with the reference value of.

For example, in the case of DNA in which the measured value of DNA increases when exposed to a test factor or depending on the disease, and the measured value of DNA derived from a negative control hair sample is used as a reference value, the test is performed. When the measured value of the interest DNA derived from the hair sample of the body approaches the reference value or becomes lower than the reference value, it can be determined that the measurement value of the interest DNA has improved.

For example, in the case of DNA whose measured value of DNA increases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a positive control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body becomes lower than the reference value, it can be determined that the measurement value of the interest DNA has improved.

For example, in the case of DNA whose measured value of DNA decreases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a negative control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body approaches the reference value or becomes higher than the reference value, it can be determined that the measurement value of the interest DNA has improved.

For example, in the case of DNA whose measured value of DNA decreases when exposed to a test factor or depending on a disease, and when the measured value of DNA derived from a positive control hair sample is used as a reference value, a test is performed. When the measured value of the interest DNA derived from the hair sample of the body becomes higher than the reference value, it can be determined that the measurement value of the interest DNA has improved.

As the reference value, instead of the negative control, the measured value of the DNA of interest derived from the hair sample collected from the same subject before being exposed to the test factor may be used. Furthermore, the reference value is derived from the hair sample collected from the part not exposed to the test factor instead of the negative control when there is a part exposed to the test factor and a part not exposed to the test factor in the same subject. Measurements of RNA of interest may be used.

As the reference value, the measured value of the DNA of interest derived from the hair sample collected from the same subject after being exposed to the test factor may be used instead of the positive control. Furthermore, the reference value is an interest derived from the hair sample collected from the part exposed to the test factor instead of the positive control when there is a part exposed to the test factor and a part not exposed to the test factor in the same subject. DNA measurements may be used.

Further, as the reference value, the average value, the mode value, the median value, the minimum value, the maximum value, the first quartile, the third quartile, and the like of the positive control group or the negative control group may be adopted. Further, a value that can discriminate between the positive control group and the negative control group with the highest accuracy may be used as a reference value. The value that can be discriminated most accurately can be determined based on, for example, sensitivity, specificity, positive predictive value, negative predictive value, and the like.

Here, "higher than the reference value" means that the measured value of the DNA of interest derived from the hair sample of the subject is, for example, 115% or more, preferably 130% or more, more preferably 150% or more of the reference value. Intended for the case.

Further, it is lower than the reference value when the measured value of the DNA of interest derived from the hair sample of the subject is, for example, less than 85%, preferably less than 70%, more preferably less than 50% of the reference value. Intended.
The term "approaching the reference value" is intended, for example, when the measured value of the DNA of interest derived from the hair sample of the subject is in the range of 85% or more and less than 115% of the reference value.

5. Evaluation of Accumulation or Reduction of Skin Damage Caused by Test Factors The present embodiment relates to evaluating the accumulation or reduction of skin damage caused by test factors in the same subject.

5-1. Outline of Evaluation of Accumulation or Reduction of Skin Damage The measured value of the polynucleotide can evaluate whether or not the damage is accumulated on the skin by the test factor. Hair samples include peri-root cells, and peri-root cells can include cutaneous epithelial cells, glandular cells, ductal cells, hair papilla cells and stem cells thereof. Generally, it is said that the turnover of cells differentiated from stem cells such as cutaneous epithelial cells is about 6 weeks. That is, epithelial cells and the like that have begun to mature from stem cells differentiate and mature over about 6 weeks and die. However, this cycle can be influenced by various environmental factors, physiological factors, etc. exemplified as test factors. In addition, if the test factor causes damage to the stem cells, the effect will persist beyond the turnover period of the cutaneous epithelium.

This embodiment is a method for analyzing a polynucleotide derived from peri-root cells, and how much skin damage is accumulated or reduced by test factors such as environmental factors and physiological factors. To evaluate.
The flow of this embodiment is shown in FIG.

Specifically, the above 2. Tested with analysis information of polynucleotides derived from peridermal cells collected from areas of interest in the skin tissue of subjects exposed to the test factor, analyzed using polynucleotide samples prepared by the preparation method described in. The step of acquiring information as information (step S1), the step of acquiring reference information including the reference value corresponding to the measured value of the polynucleotide included in the test information (step S2), and the measured value of the polynucleotide included in the test information. Can include a step of comparing with the corresponding reference value and a step of evaluating the amount of accumulation or reduction of skin damage caused by the test factor in the subject in the region of interest of the subject's skin (step S3). .. These steps may be performed by a human or a computer. When the computer performs the above steps, step S4 may include a step of outputting a result.

In step S1, the above 2. Using the polynucleotide sample prepared by the preparation method described in 3. above. And 4. The measured value of RNA or the measured value of DNA is obtained as the measured value of the polynucleotide according to the method described in 1. The measured value of the polynucleotide is associated with, for example, information for identifying the subject who acquired the measured value and information such as the collection date of the hair sample, and constitutes the analysis information of the polynucleotide. The information for identifying the subject may include the identifier of each subject and / or the name of the subject and the like. In addition, the information for identifying the subject may be associated with the biological type of each subject, the sex of each subject, the age, the age of the moon, the age of the week, and the like. Further, the information for identifying the subject may be associated with the underlying disease of the subject and the like.

The analysis information of the polynucleotide may be associated with information for identifying the test factor to which the subject is exposed. The information for identifying the test factor may be associated with the name and / or identifier of the test factor, the exposure amount, the exposure period, and the like. The analysis information of the polynucleotide may include the sampling site of the sample and the type of the extracted polynucleotide.

The analysis information of one polynucleotide can be purified for each hair sample collected at one point and stored in a database. FIG. 2 illustrates a table of analysis information of polynucleotides stored as a database. This table corresponds to the polynucleotide analysis information database DB1 described later. The first line of FIG. 2 shows an identifier (for example, an identification ID) for identifying each polynucleotide analysis information. The identifier for identifying the polynucleotide analysis information is associated with the measured value of the polynucleotide contained in each polynucleotide analysis information and / or the sequence information. The second line represents the organism type of the subject from which each polynucleotide analysis information is derived. In FIG. 2, "human" is shown as an organism type. The third line shows the identifier (identification ID) of the subject. Since the polynucleotide analysis information represented by the polynucleotide analysis information IDs "1" and "2" is collected from the same subject, the subject ID is the same "1". Since the polynucleotide analysis information represented by the polynucleotide analysis information IDs "3" and "4" is collected from the same subject, the subject ID is the same "2". The fourth line represents the name of the subject. The subject's name corresponds to the subject ID. If the subject is not human, the subject's name may not be present. The fifth line shows the gender of each subject. The sixth line shows the age of each subject. The seventh line shows the underlying disease of the subject. The subject represented by subject ID "1" has xeroderma pigmentosum as an underlying disease. The subject indicated by subject ID "2" has no underlying disease. The eighth line shows the collection site such as a hair sample. The ninth line shows the sampling date of the sample. Line 10 shows the test factors to which the subject was exposed. The test factor is a factor that exposes the area of interest of the skin. The eleventh line shows the period during which the area of interest of the skin was exposed to the test factor.

In the present embodiment, the test information is a hair sample obtained from an area of interest exposed to the test factor, and is at the timing desired to be evaluated for the purpose of evaluating the amount of accumulation or reduction of skin damage caused by the test factor. It is intended for analysis information of polynucleotides obtained from collected hair samples.

In the present embodiment, the reference information is analysis information of a reference polynucleotide used for evaluating the amount of accumulation or reduction of skin damage caused by a test factor based on the test information. The analysis information of the polynucleotide used as the reference information may be obtained from a body hair sample or may be obtained from a sample other than body hair. Further, the polynucleotide analysis information used as the reference information may be the polynucleotide analysis information obtained from the reference sequence registered in a known database. For example, when assessing the accumulated or reduced amount of damage inflicted on the skin by a test factor at a point in time, the reference information is the skin not exposed to the test factor, or tissue other than the skin (eg, oral mucosa, etc.). It can be obtained from the nasal mucosa, etc.). Further, when evaluating the accumulated amount or the reduced amount of damage caused by the test factor to the skin at a certain point in time, as reference information, a known Reference genome sequence registered in the National Center for Biotechnology Information (NCBI) or the like, etc. Can be used.

In addition, when evaluating the accumulated amount or reduction amount of damage caused by the test factor on the skin over time, the reference information is the same interest area of the same subject, and the hair sample for which the test information is acquired is used. It can be obtained from a hair sample collected from the area of interest before collection. For example, 1 week, 2 weeks, 4 weeks, 6 weeks, 3 months, 6 months, 1 year, 2 years, 3 years, 5 years before collecting the hair sample for which test information is to be obtained. Analysis of polynucleotides from hair samples taken from the same area of interest of the same individual as the individual for which the test information was obtained at least at one point selected from 0, 8 years, 10 years, 15 years, and 20 years ago. Information can be acquired and used as reference information. When the individual is an animal such as a mouse from which a nearby individual can be obtained, the same individual may be a population of the same strain or a separate body of the same strain.

5-2. Polynucleotide Analyst Instrument In this embodiment, the above-mentioned 5-1. The present invention relates to an analysis device 10 for realizing the method for analyzing a polynucleotide described in the outline of the above. Hereinafter, the hardware configuration and the functional configuration of the analysis device 10 will be described with reference to FIGS. 3 and 3.

(1) Hardware configuration FIG. 3 shows the hardware configuration of the analysis device 10. The analysis device 10 can be a general-purpose computer. The analysis device 10 is communicably connected to the input device 111, the output device 112, and the media drive 113. Further, the analysis device 10 can communicate with the reference sequence database (reference sequence DB) 500 and the measurement device 30 via the network.

The analysis device 10 includes a CPU 101, a memory 102, a ROM (read only memory) 103, a storage device 104, a communication interface (I / F) 105, an input interface (I / F) 106, and an output interface (I). A / F) 107 and a media interface (I / F) 108 are provided. Each configuration in the analyzer 10 is connected to each other by a bus 109 so as to be capable of data communication.

The storage device 104 is composed of a hard disk, a semiconductor memory element such as a flash memory, an optical disk, or the like. The storage device 104 stores an operating system (OS) 1041, an analysis program 1042 described later, and a polynucleotide analysis information database (DB) DB1. The analysis program 1042 works with the operating system 1041 to make the computer function as the analysis device 10. Windows ™ and Linux ™ can be exemplified as the operating system 1041.
The CPU 101 is also referred to as a processing unit 101 in the present embodiment.

The polynucleotide analysis information database DB1 is described in the above-mentioned 5-1. Stores the analysis information of the polynucleotide obtained in. Each information other than the measured value of the target polynucleotide included in the analysis information of the polynucleotide may be input by the operator or may reflect the information input at the time of requesting the inspection. The measured value of the target polynucleotide may be input by the operator, but the CPU 101 may record the measured value of the target polynucleotide in the polynucleotide analysis information database DB1.

The input device 111 is composed of a touch panel, a keyboard, a mouse, a pen tablet, a microphone, and the like, and inputs characters or voices to the analysis device 10. The input device 111 may be connected from the outside of the processing unit 10 or may be integrated with the analysis device 10.
The output device 112 is composed of, for example, a display device such as a display, a printer, or the like, and outputs various operation windows, analysis results, and the like.
The media drive 113 may be a USB drive, a flexible disk drive, a CD-ROM drive, a DVD-ROM drive, or the like.
The reference sequence database 500 is intended to be the various databases described in 1-1 above.
The measuring device 30 is a terminal used by the requester requesting the inspection, and may be a general-purpose computer.

That is, the analysis device 10 can construct an analysis system 1000 to which the reference sequence database 500 and the measurement device 30 are connected. The measuring device 30 may be a sequencer for performing sequence analysis, a real-time PCR device, or a PCR device.

(2) Functional configuration FIG. 4 shows the functional configuration of the analysis device 10.
The analysis device 10 includes measurement data acquisition means M1, mapping means M2, test information acquisition means M3, reference information acquisition means M4, test information acquisition / reference information comparison means M5, evaluation means M6, and result output means. It is equipped with M7. The measurement data acquisition means M1 corresponds to step S11a, step S11b, step S11c, or step S11d, which will be described later. The mapping means corresponds to step S12a, step S12b, step S12c, or step S12d described later. The test information acquisition means M3 corresponds to step S14a, step S14b, step S14c, or step S13d, which will be described later. The reference information acquisition means M4 corresponds to step S2 described later. The test information acquisition / reference information comparison means M5 corresponds to step S31 described later. The evaluation means M6 corresponds to step S32, step S34, or step S35 described later. The evaluation result output means M7 corresponds to step S4 described later.

5-3. Processing of the analysis program 1042 The processing of the analysis program 1042 to be executed by the CPU 101 will be described with reference to FIGS. 1 and 5 to 9.

The CPU 101 receives an input for starting processing from the operator and starts processing.

In step S1 of FIG. 1, the CPU 101 has the above-mentioned 5-1. As described in the above, the analysis information of the polynucleotide derived from the peri-root cells collected from the area of interest of the skin tissue of the subject exposed to the test factor is acquired as the test information. The process in step S1 will be described in more detail with reference to FIGS. 5 to 8.

FIG. 5 shows the process of acquiring test information when the polynucleotide is RNA. The CPU 101 receives the processing start request input by the operator from the input device 111, and acquires the sequence information of the polynucleotide sample from the measuring device 30 in step S11a shown in FIG. Next, in step S12a, the CPU 101 receives the mapping start request input from the input device 111 by the operator, maps the acquired sequence information to the known Reference genome sequence stored in the reference sequence database 500, and performs the mapping of each RNA. Get the number of reads. Mapping can be performed using mapping software Bowtie2 or the like. Therefore, the mapping software Bowtie2 and the like can form a part of the analysis program 1042. Next, in step S13a, the CPU 101 receives the measured value acquisition request input by the operator from the input device 111, and acquires the measured value of the target RNA from the number of reads of the target RNA. The measured value of the target RNA can be obtained by using the mapping software Bowtie2 or the like. Further, the CPU 101 receives, for example, a measurement value recording request input by the operator from the input device 111, and stores the measurement value of the target RNA acquired in step S12a in the polynucleotide analysis information database DB1 in the storage device 104 as the measurement value of the target RNA. Stored in association with analysis information of polynucleotides other than. Then, in step S14a, the CPU 101 accepts the test information acquisition request input by the operator from the input device 111, and calls the polynucleotide analysis information to be the test information from the polynucleotide analysis information database DB 1 to the memory 102, thereby causing the test information. To get. The CPU 101 proceeds to step S2 shown in FIG. 1 after step S14a shown in FIG.

FIG. 6 shows the process of acquiring test information when the polynucleotide is DNA and the measured value of DNA is the measured value based on the mutation analysis. The CPU 101 receives the processing start request input by the operator from the input device 111, and acquires the sequence information of the polynucleotide sample from the measuring device 30 in step S11b shown in FIG. Next, in step S12b, the CPU 101 receives the mapping start request input by the operator from the input device 111, maps the sequence information acquired in step S11b to the known Reference genome sequence stored in the reference sequence database 500, and then maps it. The information of the gene locus corresponding to each sequence information is acquired. Mapping can be performed using mapping software Bowtie2, BWA, or the like. Therefore, the mapping software Bowtie2, BWA, etc. can form a part of the analysis program 1042. Next, in step S13b, the CPU 101 receives the measurement value acquisition request input by the operator from the input device 111, and determines the measurement value of the target DNA indicating which part of each target sequence information has a sequence different from the reference sequence. get. The mutation information can be acquired by using, for example, GATK (Genome Analysis Toolkit; Broad Institute), Basic Local Alignment Search Tool (BLAST), or the like. Further, for the analysis of mitochondrial DNA, Mutoseek, MtDNA-Server (Cloudgene) and the like can be used to obtain mutation information. Further, the CPU 101 receives, for example, a measurement value recording request input by the operator from the input device 111, and stores the measurement value of the target DNA acquired in step S12b in the polynucleotide analysis information database DB1 in the storage device 104. Stored in association with analysis information of polynucleotides other than. Then, in step S14b, the CPU 101 receives the test information acquisition request input by the operator from the input device 111, and calls the polynucleotide analysis information to be the test information from the polynucleotide analysis information database DB 1 to the memory 102, whereby the test information To get. The CPU 101 proceeds to step S2 shown in FIG. 1 after step S14b shown in FIG.

FIG. 7 shows the process of acquiring test information when the polynucleotide is DNA and the measured value of DNA is copy number analysis. The CPU 101 receives the processing start request input by the operator from the input device 111, and acquires the sequence information of the polynucleotide sample from the measuring device 30 in step S11c shown in FIG. 7. Next, in step S12c, the CPU 101 receives the mapping start request input from the input device 111 by the operator, maps the acquired sequence information to the known Reference genome sequence stored in the reference sequence database 500, and performs each locus. Get the number of reads. Mapping can be performed using mapping software Bowtie2 or the like. Therefore, the mapping software Bowtie2 and the like can form a part of the analysis program 1042. Next, in step S13c, the CPU 101 receives the measurement value acquisition request input by the operator from the input device 111, and acquires the measurement value of the target DNA from the number of reads of the locus containing the target DNA. The measured value of the target DNA can be obtained by using mapping software Bowtie2 or the like. Further, the CPU 101 receives, for example, a measurement value recording request input by the operator from the input device 111, and stores the measurement value of the target DNA acquired in step S12c in the polynucleotide analysis information database DB1 in the storage device 104. Stored in association with analysis information of polynucleotides other than. Then, in step S14c, the CPU 101 receives the test information acquisition request input by the operator from the input device 111, and calls the polynucleotide analysis information to be the test information from the polynucleotide analysis information database DB 1 to the memory 102, whereby the test information To get. The CPU 101 proceeds to step S2 shown in FIG. 1 after step S14c shown in FIG. 7.

FIG. 8 shows the process of acquiring test information when the polynucleotide is DNA and the measured value of DNA is the measured value based on the analysis of methylation. In step S11d shown in FIG. 8, the CPU 101 accepts the input of the processing start request input by the operator from the input device 111 and the information on the methylation of the target locus. Next, in step S12d, for example, the CPU 101 receives a recording request input by the operator from the input device 111, and stores the information acquired in step S11d in the polynucleotide analysis information database DB1 in the storage device 104, which is a polynucleotide other than sequence information. It is stored in association with the analysis information of. Then, in step S13d, the CPU 101 receives the test information acquisition request input by the operator from the input device 111, and calls the polynucleotide analysis information to be the test information from the polynucleotide analysis information database DB 1 to the memory 102, whereby the test information To get. The CPU 101 proceeds to step S2 shown in FIG. 1 after step S13d shown in FIG.

Returning to FIG. 1, step S2 will be described. In step S2, the reference information including the reference value corresponding to the measured value of the polynucleotide contained in each test information is acquired. Above 5-1. As mentioned in the above, the reference information may be selected depending on whether the accumulated or reduced amount of damage caused by the test factor to the skin is evaluated at one point or over time.

For example, when the accumulated amount or the reduced amount of damage caused by the test factor to the skin is evaluated at a temporary point, the analysis information of the polynucleotide indicated by the polynucleotide analysis information ID1 in FIG. 2 becomes the test information, and this test information. The reference information including the reference value corresponding to the measured value of RNA contained in is the polynucleotide indicated by the polynucleotide analysis information ID2, which is the analysis information of the polynucleotide obtained from the sample collected from the site not exposed to the test factor. Analysis information of. Further, a known Reference genome sequence may be used as the reference information instead of the polynucleotide analysis information ID2.

For example, when the amount of accumulation or reduction of damage caused by a test factor to the skin is evaluated over time, the analysis information of the polynucleotide represented by the polynucleotide analysis information ID 3 in FIG. 2 becomes the test information, and this test information. The reference information including the reference value corresponding to the measured value of the DNA contained in is the polynucleotide analysis information indicated by the polynucleotide analysis information ID4 obtained from the hair sample collected from the same region of interest two years later.

In step S2, the CPU 101 receives the reference information acquisition request input by the operator from the input device 111, and transfers the analysis information of the polynucleotide as the reference information from the polynucleotide analysis information database DB1 or from the reference sequence database 500 to the memory 102. Get the reference information by calling. Reference information such as the Reference genome sequence may be downloaded from the reference sequence database 500 in advance and stored in the storage device 104.
The CPU 101 proceeds to step S3 after step S2 shown in FIG.

In step S3, the CPU 101 compares the measured value of the polynucleotide contained in the test information with the corresponding reference value, and the accumulated amount of skin damage caused by the test factor in the subject in the area of interest of the subject's skin, or. Evaluate the amount of reduction.
The detailed processing of step S3 is shown in FIG.

In step S31, the CPU 101 receives the evaluation processing request input by the operator from the input device 111, and in step S14a shown in FIG. 5, step S14b shown in FIG. 6, step S14c shown in FIG. 7, and step S13d shown in FIG. The measured values of the polynucleotide contained in the acquired test information are compared with the corresponding reference values. Subsequently, the CPU 101 determines whether or not the measured value of the polynucleotide contained in the test information is within the reference range. The reference range is intended to be a range of 85% or more and less than 115% of the reference value included in the reference information acquired in step S2 shown in FIG. 1, for example.

In step S31, if the measured value of the polynucleotide contained in the test information is within the reference range (in the case of "YES"), the CPU 101 proceeds to step S32 and determines that there is no skin damage.

If the measured value of the polynucleotide included in the test information is out of the reference range in step S31 (in the case of “NO”), the CPU 101 proceeds to step S33. In step S33, the CPU 101 determines whether or not the measured value of the polynucleotide contained in the test information indicates "exacerbation". "Indicating exacerbation" can exemplify the following patterns. For example, in the case where the polynucleotide is RNA and the expression level of RNA increases with the accumulation of skin damage, the exacerbation occurred when the measured value of RNA contained in the test information exceeded the reference range. Can be determined. For example, in the case where the polynucleotide is RNA and the expression level of RNA decreases with the accumulation of skin damage, it was exacerbated when the measured value of RNA contained in the test information was below the reference range. Can be determined. For example, when the polynucleotide is DNA and the number of DNA mutations, copies, and degree of methylation increase with the accumulation of skin damage, the measured value of DNA contained in the test information is used as a reference. When the range is exceeded, it can be determined that the exacerbation has occurred. If the measured value of the polynucleotide contained in the test information does not indicate "exacerbation" (in the case of "NO") in step S33, the CPU 101 proceeds to step S34, and the skin damage is reduced. Decide that you are. If the measured value of the polynucleotide contained in the test information indicates "exacerbation" (in the case of "YES") in step S33, the CPU 101 proceeds to step S35, and the skin damage is accumulated. Decide that you are.
Next, the CPU 101 proceeds to step S4 shown in FIG. 1 and outputs the evaluation result to the output device 112.

For example, to explain using the example shown in FIG. 2, the subject represented by subject ID 1 has xeroderma pigmentosum as an underlying disease. Patients with xeroderma pigmentosum have extremely low ability to repair DNA damage caused by UV light, which is a test factor, so that DNA damage becomes DNA mutations, accumulates, and eventually develops skin cancer. From the time of birth, patients with xeroderma pigmentosum are careful not to be exposed to UV rays even in normal life, but it is difficult to evaluate whether the skin is sufficiently protected from UV rays. Also, it is difficult to make frequent invasive assessments in early childhood. This analysis method is useful for the examination using hair because it is possible to easily collect a sample from a child and evaluate the accumulation of mutations.

Further, it has been reported that matrix metalloprotease-1, neutral endopeptidase, hyaluronidase-1, and the like are increased by irradiation with ultraviolet rays. The expression levels of these genes can also be used to assess UV exposure.

It is also known that mitochondrial DNA mutations increase with light-induced skin aging. In other words, the accumulation of mutations in mitochondrial DNA is a biomarker for skin age. As shown in Examples described later, the number of mutations was analyzed between mitochondrial DNA in a sample collected from the oral mucosa, mitochondrial DNA collected from the face of the same subject, and mitochondrial DNA collected from the arm of the same subject. Then, the mitochondrial DNA derived from the hair sample collected from the face has more mutations than the oral cavity, and the mitochondrial DNA derived from the hair sample collected from the arm tends to have more mutations than the face. Is shown. Although UV rays are blocked to some extent by sunscreen and foundation, it is thought that the arms are easily exposed to UV rays in daily life. From this, it is possible to evaluate the skin age by this analysis method.

In addition, the evaluation of skin age can also be evaluated by the decrease in the expression levels of type I collagen, elastin, and hyaluronan synthase with aging. In the subject represented by subject ID2, for example, when evaluating the skin age, the type I collagen gene, the elastin gene, and the hyaluronic acid synthase included in the analysis information of the polynucleotide represented by the polynucleotide analysis information ID3. The measured value of at least one RNA selected from the gene is selected from the type I collagen gene, the elastin gene, and the hyaluronic acid synthase gene contained in the analysis information of the polynucleotide indicated by the polynucleotide analysis information ID3. When the measured value of at least one RNA is low, it can be evaluated that the skin age is increasing.

5-4. Recording medium in which the analysis program 1042 is stored The analysis program 1042 that performs the processes from steps S1 to S4 may be stored in the recording medium. That is, the computer program is stored in a hard disk, a semiconductor memory element such as a flash memory, or a recording medium such as an optical disk. Further, the computer program may be stored in a recording medium that can be connected to a network such as a cloud server. The computer program may be a program product in download format or recorded on a recording medium.

The storage format of the program on the recording medium is not limited as long as the presenting device can read the program. The storage in the recording medium is preferably non-volatile.

5-5. Modification Example (1) Between step S11a and step S12a, between step S11b and step S12b, or between step S11c and step S12c, the CPU 101 may perform a polynucleotide pretreatment. Polynucleotide pretreatment includes sequence length trimming; conversion of file formats that record sequence information; used to tag library DNA and polynucleotide fragments that are not originally included in polynucleotide samples, for example. Processing to remove adapter sequences and primer sequences derived from tags; removal of removal sequences such as PCR duplicates due to PCR errors in the wet treatment of next-generation sequencers; removal of low-quality reads, etc. are included. For the trimming process of the array length, for example, trimming software SolexaQA or the like can be used. Software such as Samtools can be used for file format conversion. For example, Samtools converts the data in the sam file format output from BWA or the like into the data in the bum file format. The data in the bum file format can be analyzed by GATK or the like, and PCR duplicate can be removed. The removal of the adapter sequence and the primer sequence can be performed using software such as fastx_clipper. Further, the removal of low quality leads can be performed by using, for example, FastQC or the like. Therefore, these software can also form part of the analysis program 1042.

(2) In the case of DNA mutation analysis, Integrated Genomics Viewer (Broad Institute) or the like is used for output processing of the evaluation result, and the information on the mutation position of the polynucleotide included in the test information and the reference information are included. The location information of the mutation may be displayed on one screen as shown in FIG. 10 or FIG. 12, which will be described later. At this time, the analysis device 10 also functions as a presentation device. By displaying in this way, it can be determined whether the mutation detected in the DNA contained in the polynucleotide sample of the subject is the same mutation as the mutation of the DNA contained in the reference information or the mutation at a different position. It will be easier for the operator to understand. It also makes it easier to understand changes in the number of mutations. In the Integrative Genomics Viewer, for example, an evaluation result including mutation position data can be generated in a vcf file format by GATK or the like, and the generated data can be input.

(3) 5-1. And 5-4. The analysis process for performing the processes from step S1 to step S4 shown in FIG. 1 is shown. However, step S3 does not necessarily have to be performed by the CPU 101. That is, the CPU 101 performs steps S1, S2, and S4, and the human looks at the result output by the CPU 101 to the output device 112, compares the measured value included in the test information corresponding to step S3 with the reference value, and the test factor. The amount of accumulated damage or the amount of reduction due to the damage may be evaluated.

(4) In steps S11a to S13a, steps S11b to S13b, and steps S11c to S13c, an example is shown in which an operator inputs a request for starting processing of each step, and the CPU 101 accepts this input and starts processing. However, instead of inputting each request by the operator, the CPU 101 may start the processing of the next step with the end of the previous step as a trigger.
(5) In the present specification, the same reference numerals are intended to have the same site and the same function.

Hereinafter, embodiments of the present invention will be described in more detail with reference to examples. However, the present invention is not limited to the examples.

The animal experiments in this example were carried out with the approval of the Nagahama Institute of Biosciences Experimental Facility Steering Committee.

1. 1. Example 1
In order to confirm the effectiveness of DNA analysis using hair samples, we performed mutation analysis of mitochondrial DNA using hair samples collected from the skin.

<Sample preparation and next-generation sequencer analysis>
A total of two subjects, one male in their 50s and one male in their 20s, applied depilatory wax to the skin on the cheeks and upper arms of their faces, left them to stand for about 10 seconds, and then peeled them off. , Hair loss. Total DNA including genomic DNA and mitochondrial DNA was extracted from this wax sheet using a DNA extractor FM kit (Wako). As a control DNA sample, the oral mucosa was scraped with a cotton swab to collect oral mucosal cells, and the entire DNA was extracted and used in the same manner.

PCR amplification with PrimeSTAR GXL DNA Polymerase (Takara) was performed using a part of the extracted DNA.

Amplification was performed on the full-length sequence of human mitochondrial DNA using the following primer set.
Mitochondrial Genome Primer Set I:
AAAGCACACATACCAAGGCCAC (SEQ ID NO: 1)
TTGGCTCTCCTTGCAAAGTTT (SEQ ID NO: 2)
Mitochondrial Genome Primer Set II:
TATCCGCCATCCCATACATT (SEQ ID NO: 3)
AATGTTGAGCCGTAGATGCC (SEQ ID NO: 4)

For amplification, two steps of [98 ° C. 10 seconds-68 ° C. 600 seconds] were performed for 30 cycles. The reaction solution after completion of the amplification reaction was applied to a 1.2% agarose gel and electrophoresed in a TBE buffer to confirm the size of the amplified DNA. DNA samples for next-generation sequencer analysis were prepared by performing 20 cycles of similar amplification steps. The prepared DNA sample was made into a library using the Illumina Nextra XT Library Prep kit, and this library was used for the next-generation sequencer Illumina Miniseq to sequence the nucleotide sequences.

<Measurement data analysis>
The sequence length was trimmed using SolexaQA for the sequence data obtained from the next-generation sequencer, and the trimmed sequence data was mapped to AF346990, which is the average Japanese mitochondrial sequence, using the mapping software BWA. After converting from sam file to bam file by Picard and finally rewriting to vcf (variant call format), SNPs were detected and frequency measurement analysis was performed by GATK. Integrative Genomics Viewer was used to compare and display the analysis results.

<Measurement result>
In the nucleotide sequence of mitochondrial DNA contained in the DNA derived from oral mucosal cells collected from each subject as a control DNA sample, a sequence different from AF346990 is considered to be a congenital (personal) polymorphism or a generic polymorphism. .. In addition, in each subject, the mutation that is different from AF346990 and is commonly found in the oral cavity, cheek, and upper arm is considered to be a congenital polymorphism, and other than that, it is considered to be an acquired polymorphism. Acquired polymorphisms are thought to be due to some factor. In the subjects in their 50s analyzed this time, there was no congenital polymorphism in the nucleotide sequence of mitochondrial DNA derived from oral mucosal cells at the locus NC_012920 of the reference sequence. In addition, in mitochondrial DNA derived from cheek hair growth, three sequences different from AF346990 were found. Furthermore, in the mitochondrial DNA derived from the hair growth on the upper arm, four sequences different from AF346990 and different from the mitochondrial DNA derived from the hair growth on the cheek were found. The results are shown in FIGS. 10 and 11. FIG. 10 shows the mutation position at the locus. In FIG. 10, gray bars indicate all mutation positions where they are mutated from the reference sequence. White bars indicate the location of mutations from congenital reference sequences, that is, mutations that appear to be individual or ethnic gene polymorphisms, because homoplasmy is 100% mutated. Since the black bar is heteroplasmy, it indicates a mutation position that is likely to be an acquired mutation. Figure 11 shows the mutation sites where heteroplasmy was found in the sequences different from the mitochondrial DNA derived from the hair growth of the cheeks and the mitochondrial DNA derived from the hair growth of the upper arm skin, and the sequence depth of each sequence. Is shown. The results of another subject in his twenties are shown in FIGS. 12 and 13. In subjects in their 20s, there were four congenital polymorphisms in the nucleotide sequence of oral mucosal cell-derived mitochondrial DNA. In addition, FIG. 13 shows the mutation sites where heteroplasmy was found in the detected sequences and the sequence depth of each sequence. In the mitochondrial DNA derived from the hair growth on the cheek, four sequences different from AF346990 were found in addition to the polymorphism that was present in the oral mucosal cells. Furthermore, in the mitochondrial DNA derived from the hair growth on the upper arm skin, 36 sequences different from AF346990 were found in addition to the one polymorphism that was present in the oral mucosal cells. Mutations in the face were relatively few, and there was a tendency for mutations to accumulate in the skin of the arms. The face is often guarded with a hat or sunscreen, but it is thought that this is because the arms are often exposed. In addition, since men in their 20s were more sunburned than men in their 50s, it is probable that mutations had accumulated in the mitochondrial DNA derived from the hair growth on the upper arm skin.

2. 2. Example 2
In order to confirm the effectiveness of RNA analysis using body hair samples, RNA samples were prepared from body hair samples collected from the skin, and real-time PCR was performed using these RNA samples to analyze the expression of target genes.

<Sample preparation and real-time RT-PCR analysis>
Three eyebrows and three lower arm hairs were collected, and total RNA was extracted using the Nucleo Spin RNA XS kit. A part of the extracted RNA was synthesized by cDNA and PCR amplified using SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara). cDNA for total RNA was synthesized, and the reverse transcription reaction solution after the reaction was diluted 600-fold with ultrapure water, and this diluted solution was used as a real-time PCR sample. For real-time PCR, Thunderbird SYBR reagent was used, and 18 cycles of 2-step amplification after initial knitting at 94 ° C for 1 minute [94 ° C for 15 seconds and 60 ° C for 30 seconds] were performed. After amplification, the amplification curve was confirmed, the melting curve was created, and the Ct value was quantified. The genes to be amplified were IL-1α, GAPDH, and β-actin.

<Measurement result>
Figure 14 shows the analysis results. FIG. 14 (A) shows the amplification curve of each gene when cDNA samples having different concentrations were used. The amplification curve was distributed according to the concentration and was considered to reflect the expression level of RNA. In addition, Fig. 14 (B) shows the melting curve. The peak of the melting curve of each amplification product was one peak at the set temperature, indicating that the amplification curve was the amplification product of the gene of interest. From this, it was considered that RNA expression could be evaluated using the RNA sample extracted from the hair sample.

FIG. 14 (C) shows the relative expression level of IL-1α mRNA using the expression level of GAPDH as an internal standard. FIG. 14 (D) shows the relative expression level of β-actin mRNA using the expression level of GAPDH as an internal standard. IL-1α mRNA in the eyebrows was expressed about 7 times more than the cells around the arm hair. The β-actin mRNA of the eyebrows was about half the expression of the cells around the hair growth of the arm. From these data, it was shown that comparative analysis of the expression of each gene is possible.

3. 3. Example 3
In order to confirm the effectiveness of symptom diagnosis of skin diseases using body hair samples, RNA samples were prepared from body hair samples collected from the skin of disease model mice, and real-time PCR was performed using these RNA samples to express biomarker genes. Analysis was performed.

<Preparation of disease model mice, hair collection, and real-time RT-PCR analysis>
A hair clipper was used to trim the hair on the back half of the C57 / BL6 mouse shortly, and 100 mg of 2% Bethelna cream was applied daily to the trimmed area to create a psoriasis model. In addition, the half-body part to which the Beselna cream was not applied was defined as the "non-applied part" without cutting the body hair. Before application, 1 day after application, 3 days after application, and 5 days after application, 5 hairs were collected from the applied part and the non-applied part. Total RNA was extracted from hair samples using the Nucleo Spin RNA XS kit. Real-time RT-PCR was performed in the same manner as in Example 2 to quantify the expression of IL-33, IL-23, IL-17, and TNF-α mRNA, and GAPDH mRNA.

<Measurement result>
Figure 15 shows the results. Relative expression levels of IL-33, IL-23, IL-17, and TNF-α were evaluated using GAPDH mRNA as an internal standard. The site of application of Bethelna cream developed psoriasis. With the onset of psoriasis and the progression of symptoms, the relative expression levels of IL-33, IL-23, IL-17, and TNF-α mRNAs increased over time. This result was consistent with the severity of the visual symptoms. In addition, IL-33 is a cytokine expressed not in the cells constituting the skin tissue but in the lymphocytes infiltrated into the tissue. IL-23 is a cytokine produced by antigen-presenting cells such as dendritic cells. IL-17 is a cytokine produced only by memory T cells and natural killer cells. Therefore, the fact that the expression of IL-33, IL-23, and IL-17 mRNA could be evaluated from the hair sample reflects the activation state of inflammatory cells such as leukocytes infiltrated around the hair root of the hair sample. It shows that there is.

4. Example 4
An RNA sample was prepared from a hair sample collected from the skin of a disease model mouse by changing the psoriasis model mouse to a contact dermatitis model mouse, and real-time PCR was performed using this RNA sample to analyze the expression of a biomarker gene. ..

<Preparation of disease model mice, hair collection, and real-time RT-PCR analysis>
The hair on the abdomen and back of the C57 / BL6 mice was cut short with hair clippers, and 100 μl of 0.3% dinitrofluorobenzene (DNFB) solution was applied to the cut hair on the abdomen or back. In addition, the half-body part to which the DNFB solution was not applied was designated as the "non-applied part" without cutting the body hair. For the abdomen, 5 hairs were collected from the coated part and the non-applied part 3 hours after the application. As for the back part, 5 hairs were collected from the coated part and the non-applied part 6 days after the application. Total RNA was extracted from each hair sample using the Nucleo Spin RNA XS kit. Real-time RT-PCR was performed in the same manner as in Example 2 to quantify the expression of HMGB-1 mRNA, β-actin mRNA, and TNFα mRNA.

<Measurement result>
FIG. 16 shows the relative expression level of each gene using β-actin mRNA as an internal standard. (A) in FIG. 16 shows the expression of HMGB-1 mRNA 3 hours after application of the DNFB solution. (B) shows the expression of TNFα mRNA 6 days after application of the DNFB solution. The expression of TNFα mRNA was increased by the application of DNFB. On the other hand, the expression of HMGB-1 mRNA was not changed by the application of DNFB.
<RNA-seq analysis measurement method and results>

After trimming the results of the next-generation sequencer, Tophat2 was used to map to the Mm10 mouse sequence, and the expression level of each RNA was compared and analyzed based on the RPMK value.
IL-1 was the most altered by the induction of contact dermatitis, and IL-33 and others were also greatly induced.

5. Example 5
In order to confirm the effectiveness of DNA analysis using hair samples, the number of mitochondrial DNA mitochondria was measured using hair samples collected from the skin.

<Sample preparation and real-time PCR analysis>
Five hairs were collected from the upper arm of the subject with tweezers. Total DNA including genomic DNA and mitochondrial DNA was extracted from the hair sample using DNA extractor reagent FM (WAKO), and the obtained DNA was dissolved in TE buffer. Real-time PCR analysis of ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene using 1/100 of the obtained DNA solution as a sample for real-time PCR and using Human Mitochondrial DNA (mtDNA) Monitoring Primer Set. The Ct value of each gene was obtained. From the obtained Ct value, the number of mitochondria per cell was calculated as https://www.takara-bio.co.jp/research/r/mtdna_monitoring_tool/ (provided by Takara Sake Brewery Co., Ltd.).

<Measurement result>
In real-time PCR, the Ct values of the ND1 gene, ND5 gene, SLCO2B1 gene, and SERPINA1 gene were 22.99, 32.12, 22.51, and 31.94, respectively, and the number of mitochondrial copies converted from these values was 625.
It was shown that the number of mitochondrial copies per cell can be calculated from the hair-growth DNA by this method.

The present invention assists in the diagnosis of skin diseases, searches for active ingredient candidates for skin diseases, cosmetic analysis of skin, aptitude test of tailor-made cosmetics and pharmaceuticals, skin aging analysis, safety analysis and usefulness analysis of administered substances, disease model. It can be used for symptom analysis of mice and the like.

10 Analytical device 101 Processing unit

Claims (3)

It involves preparing an RNA sample from a hair sample containing the subject's own cells attached to the hair root, taken by removing the hair attached to the dermal papilla in the area of interest on the subject's skin surface .
Here, the region of interest is a portion of the skin surface to which the test factor is directly applied , the subject is a human, and the hair sample does not include the hair sample.
A method for preparing an RNA sample for evaluating a sign of a skin disease in the subject or a skin disease caused by the test factor from the subject's own cells attached to the hair root . To prepare an RNA sample from a hair sample containing the subject's own cells attached to the hair root, which was collected by removing the hair attached to the dermal papilla in the area of interest on the skin surface of the subject.
The prepared RNA sample was used to analyze the expression of RNA in the subject's own cells attached to the hair root .
Here, the region of interest is a portion of the skin surface to which the test factor is directly applied , the subject is a human, and the hair sample does not include the hair sample.
A method for analyzing RNA expression from the subject's own cells attached to the hair root to evaluate a sign of skin disease in the subject due to the test factor or a skin disease . The method for analyzing RNA expression according to claim 2 , which is used for evaluating the safety of the test factor.

Images