JP2008178390A - Method of evaluating skin condition and application of the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for evaluating skin condition which is low in invasiveness and imparting an evaluation result with high objectivity. <P>SOLUTION: The method evaluates the skin condition on the results obtained by carrying out a gene expression analysis using keratin collected from the skin of test subjects. The mRNA extracted from the keratin is used as the sample in a preferable embodiment. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a method and application for evaluating skin condition.

  Accurately grasping the skin condition is important for skin care for maintaining healthy skin. When performing skin care with cosmetics, the skin quality of cosmetic users has been evaluated, for example, through visual interviews. Recently, in order to more objectively evaluate the skin condition or function, various types of measuring devices are used to indicate the skin quality with device-specific parameters, the expression level of proteins involved in the skin quality, Biochemical and molecular biological methods for measuring enzyme activity are also incorporated. Genetic studies are also being conducted. As an example, there has been proposed a method for evaluating a customer's skin condition / feature by conducting a genetic test for genes involved in the skin and providing cosmetics suitable for the customer (Patent Documents 1 and 2). In these methods, attention is paid to skin-related genes (or skin-related gene groups), and skin conditions and the like are evaluated based on the information (DNA sequence information). Certainly, the genetic information of skin-related genes is an important factor that characterizes skin properties. However, the expression of genes is necessary for DNA sequence information to contribute to or affect skin function, and some genes are expressed for lifetime due to internal factors such as individual lifestyle and external factors such as climate. In consideration of the possibility of failure, the skin condition formed as a result of entanglement of various factors cannot be accurately grasped only by the DNA sequence information of skin-related genes. It is impossible to understand skin condition changes due to various factors.

  By the way, the epithelial tissue of the skin (ie, the epidermis) consists of several cell layers. The stratum corneum cell layer is located in the outermost layer in the epidermis. A keratinocyte is formed in the process in which a basal cell in the basal part repeats cell division and a part thereof leaves the basal cell layer and moves to the upper layer. This process is called keratinization. Through keratinization, cells lose cellular components such as nuclei and change mainly into keratin fiber masses. In general, it takes about 4 weeks from division of basal cells to differentiation into keratinocytes. In addition, when the stratum corneum that has finished its role is peeled off from the surface of the stratum corneum, it is called “body stain”, but it takes about two weeks for the stratum corneum to form and peel off.

  As an examination focusing on the epidermis of the skin, gene expression analysis on epidermis constituent cells has been performed for the purpose of analyzing the function of the epidermis and identifying genetic markers involved in the function of the epidermis (for example, Patent Document 3, non-patent document). Reference 1). In the methods disclosed in Patent Document 3 and Non-Patent Document 1, RNA extracted from living cells existing under the stratum corneum is used. Therefore, it is necessary to extract the skin tissue to a relatively deep layer in the implementation, and there is a risk that the test subject suffers and the wound remains.

On the other hand, studies focusing on the stratum corneum constituting the outermost layer of the epidermis have also been conducted. That is, as a method for evaluating the state of the skin, a method for evaluating the barrier function of the skin by measuring the expression of involucrin protein in the keratin exfoliated from the skin (Patent Document 4), and the activity of the desmosome degrading enzyme are measured. Thus, a method for evaluating the degree of rough skin (Patent Document 5) has been devised. Since the method for evaluating the skin condition using such a specific protein as an index is an approach based on the phenotype of the skin, the root cause of the skin condition change is investigated, and the skin condition according to the cause is examined. It is not always effective to find treatment methods and drugs.
JP 2003-260031 A JP 2003-271728 A Special Table 2002-523145 International Publication No. WO2002 / 025272 Pamphlet JP-A-8-68791 Kirsten Paludan and Kristian Thestrup-Pedersen: Use of the Polymerase Chain Reaction in Quantification of Interleukin 8 mRNA in Minute Epidermal Samples.The Journal of Investigative Dermatology Vol.99, No. 6 December: 830-835, 1992

Since cells in the stratum corneum of the skin are enucleated, nascent mRNA was not synthesized there, and it was thought that mRNA was not present. In fact, there is no report of gene expression analysis using mRNA present in the stratum corneum. On the other hand, gene expression analysis of nucleated cell tissues other than keratin has been performed (Patent Document 3, Non-Patent Document 1, etc.). However, as described above, gene expression analysis using nucleated cell tissues other than keratin is accompanied by invasive problems and cosmetic problems. In addition, considering that doctors must perform tissue resection, gene expression analysis using nucleated cell tissue other than stratum corneum is an appropriate method for evaluating skin conditions for skin care or cosmetic purposes. I can't say that. In addition, although there are some research reports as described above, the research for elucidating the skin state change from the approach at the gene level or gene expression level has not been sufficiently performed.
In view of the above background, it is a main object of the present invention to provide a method for evaluating the state of the skin, which is minimally invasive and obtains highly objective evaluation results.

Under the above problems, the present inventors have intensively studied paying attention to the keratin. As a result, it has been found that a sufficient amount of mRNA can be extracted from the stratum corneum. On the other hand, as a result of gene expression analysis using the extracted mRNA, a plurality of genes related to the skin condition were found. In this way, knowledge that gene expression analysis using mRNA extracted from keratin is effective as a method for evaluating skin condition is obtained, and specific genes to be noted in gene expression analysis are identified. It was also successful. The present invention is mainly based on the findings and results, and provides a method for evaluating the skin condition and the like listed below.
[1] A method for evaluating a skin condition, characterized in that gene expression analysis is performed using keratin collected from the skin of a test subject and the skin condition is evaluated based on the result.
[2] The method according to [1], wherein the gene expression analysis is a gene expression analysis using mRNA extracted from the keratin as a sample.
[3] (1) A step of preparing keratin collected from the skin of a specific site of a test subject,
(2) performing gene expression analysis using mRNA extracted from the stratum corneum as a sample, and calculating the expression level of a gene related to the skin condition; and (3) skin using the expression level calculated in step (2). Evaluating the condition of the
The method according to [2], comprising:
[4] The method according to [3], wherein in step (3), the expression level calculated in step (2) is collated with a reference expression level to evaluate the skin condition.
[5] The method according to [3] or [4], wherein the specific part is a face part.
[6] The method according to any one of [3] to [5], wherein the gene expression analysis is performed by a microarray method or a PCR method.
[7] The gene is UNC5CL, KIAA0251, ECOP, PTGES2, ZNF135, SYT3, C12orf25, FOXA3, TMEM14C, PHF13, CLNS1A, RHOT2, FLG, NUP155, SLC7A6, CYHR1, SRP4R4 Any one of [3] to [6], which is one or more genes selected from the group consisting of SERGEF, HVCN1, FGFR1, GRK7, TP53I3, RPUSD4, F7, MFHAS1, BOLL, RNF20, and CYP2S1 The method of crab.
[8] The gene is TMEM47, SCAND2, SCML2, RFX4, GM2A, ZNF10, ABCD3, C13orf7, MICB, MPP1LC3C, PARP14, TMEM163, KIAA1467, SLC25A16, YARS2, FAM60A, CGNL1, SGN3S4 , ARSD, PITX2, TUBGCP5, RPL36, SMYD4, C3orf39, KBBTBD6, MGC4655, PLK1, APOLD1, DDX47, DENND1C, ABTB1, GORASP1, TRERF1, PKMYT1, ACAP9, AKAP9, FZ , MLZE, FUT , MR1, NBPF11, RPL36AL, DFFB, MFAP3L, RDH16, NSF, HLA-DMA, ARHGEF6, RNF38, U2AF1L4, CTBP2, CDK6, GNG10, WDR73, MTMR11, C16orf51, IL6, C21orf58, EP3, C21orf58 , MAP6, AFF3, EBP, ATM, AQP4, CRNKL1, ZFP91, SARDH, TMEM16H, UNKL, TXNDC1, AKT2, BAG1, GATAD2A, and USP54, and one or more genes selected from [ 3]-The method in any one of [6].
[9] The gene is ADAMTLS4, ADFP, ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5I, ATP5J, CKS1B, COX7C, CRCT1, DCTD, TST, DST3, PST, TST , HIST2H2AA3, NHNRNPA1, JMJD1A, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUFV2, NIT1, NOL7 , NOTCH2NL, NR4A2, NT5 One or more genes selected from the group consisting of PDGFB, POLG, POLR2B, POLR2C, POLR2F, PSMB7, RPL37A, RPS23, S100A13, S100A2, SHC1, TPM3, TUFT1, UPP1, and VEGF Item 7. The method according to any one of Items 3 to 6.
[10] The method according to any one of [1] to [9], wherein the keratin is keratin collected from the skin of a test subject using an adhesive tape.
[11] The skin condition is aging, wrinkle, sagging, elasticity, inflammation, pigmentation, dryness, barrier function, sebum amount, skin metabolism, roughness, transparency, dullness, blood circulation, sunburn, The method according to any one of [1] to [10], wherein the state is related to one or more indicators selected from the group consisting of conspicuous pores, hypersensitivity, and acne.
[12] The method according to any one of [1] to [11], wherein the skin condition is a degree of aging.
[13] Before and after the treatment means is applied to the test subject, the method according to any one of [1] to [12] is performed, and the evaluation results obtained are compared to determine the effectiveness of the treatment means. A method for evaluating a treatment means for skin, characterized by evaluating sex.

The first aspect of the present invention provides a method for evaluating skin conditions (hereinafter also referred to as “skin condition evaluation method”). In the skin condition evaluation method of the present invention, gene expression analysis is performed using keratin collected from the skin of a test subject, and the skin condition is evaluated based on the result. Since the stratum corneum existing in the outermost layer in the skin is used as a sample for gene expression analysis, the skin condition evaluation method of the present invention is minimally invasive and can be easily performed.
The test subject is typically a human. However, an animal that is a subject of skin care or skin treatment, such as a pet animal such as a dog or a cat, may be a test subject. That is, the skin condition evaluation method of the present invention can be applied to a human or non-human animal having a stratum corneum as long as it is a target for skin care or the like. Specific examples of animals other than humans include monkeys, dogs, cats, mice, rats, guinea pigs, rabbits and the like.

  The method for collecting keratin from the skin is not particularly limited, but it is preferable to adopt a non-invasive collection method as much as possible. In other words, it is desired that the portions other than the stratum corneum such as the granule layer and the spinous cell layer are not damaged as much as possible when collecting the stratum corneum. For example, the stratum corneum can be collected by a method in which an adhesive tape, an adhesive, or the like is attached to the skin and then peeled off, or a method in which the skin surface is rubbed with a rough surface material (for example, a nonwoven fabric). The former method is particularly preferable in that it can be carried out very simply. In addition, as long as it does not affect the gene expression analysis implemented after that, the material (adhesive component) used for an adhesive tape or an adhesive agent is not specifically limited.

The site | part which extract | collects keratin is not specifically limited. For example, daily exposed parts such as face, neck, back of hand, and fingers (also referred to as “exposed part” in this specification), upper arm inner part, forearm inner part, back part, buttocks part, and upper thigh inner part For example, keratin can be collected from a site that is routinely covered with clothes (also referred to herein as a “coating site”). In principle, the skin is taken from the site where the skin condition is to be evaluated. For example, in order to evaluate the condition of the skin on the face, it is preferable to collect the horny substance from the face. However, it does not preclude the use of keratin collected from another part when evaluating the skin condition of a certain part.
Since the face is the most important skin care target among various parts, the keratin is collected from the face in a preferred embodiment of the present invention.

  In general, “gene expression analysis” refers to examining the expression state of a gene. In the “gene expression analysis” in the present invention, the amount of mRNA that is a transcription product of a gene or the amount of protein that is an expression product of a gene is measured. In this way, the amount of protein may be analyzed.

  For the measurement of the amount of mRNA, microarray analysis, a method of performing a polymerase chain reaction method (PCR method) after performing a reverse transcription reaction, or the like can be used. These methods may be carried out according to conventional methods. Various protocols have been reported for each method, and those skilled in the art can construct and implement an appropriate measurement system according to a known protocol or according to a protocol obtained by appropriately modifying or changing a known protocol. Details of the gene expression analysis by measuring the amount of mRNA will be described later.

  On the other hand, when measuring the amount of protein, for example, an immunostaining method using a fluorescent substance, a dye, an enzyme or the like, a Western blot method, an immunoassay method (for example, ELISA method, EIA method) or the like can be used. These methods may be carried out according to a conventional method. Various protocols have been reported for each method, and those skilled in the art can construct and implement an appropriate measurement system according to a known protocol or according to a protocol obtained by appropriately modifying or changing a known protocol.

  In the present invention, `` skin condition '' refers to aging, wrinkles, sagging, elasticity, inflammation, pigmentation, dryness, barrier function, sebum amount, skin metabolism, roughness, transparency, dullness, blood circulation, The degree of indicators related to skin function, such as sunburn, pore conspicuity, hypersensitivity, and acne. In the skin condition evaluation method of the present invention, one or more of these are evaluated. Preferably, the evaluation is performed with respect to one or more indicators selected from the group consisting of aging, wrinkles, elasticity, inflammation, pigmentation, dryness, barrier function, and sebum amount. Most preferably, the degree of aging will be evaluated as the skin condition.

The skin evaluation method of the present invention is preferably carried out by the following series of steps (1) to (3).
(1) a step of preparing keratin collected from the skin of a specific site of a test subject;
(2) performing gene expression analysis using mRNA extracted from the stratum corneum as a sample, and calculating an expression level of a gene related to the skin condition; and (3) skin using the expression level calculated in step (2). Evaluating the state of the.

In step (1), the keratin collected from the specific site of the test subject is prepared. As described above, the keratin collection site is not particularly limited. Preferably, the keratin is collected from the face. Hereinafter, specific examples of the corneum collection method and RNA extraction method are shown.
(A) A part of the outermost stratum corneum is peeled off so as not to damage the granule layer or the spinous cell layer. For example, an adhesive tape is attached to the skin and then peeled off (repeated several times as necessary), and the keratin is collected.
(B) The collected stratum corneum is immersed in a soluble buffer solution containing SDS, β-mercaptoethanol, guanidine isothiocyanate, etc., and then reacted with a proteolytic enzyme.
(C) After completion of the reaction, the keratin is crushed by physical force such as an ultrasonic crusher.
(D) An ethanol solution is added to the supernatant, and RNA is extracted by a method according to a known nucleic acid extraction method or a method using a commercially available kit. For example, RNA is extracted by an RNA extraction method using guanidine isothiocyanate, phenol and chloroform, a method using ISOGEN of Nippon Gene, TRISOL Reagent of Invitrogen, RNeasy Kit of QIAGEN, or RNAqueous Kit of Ambion.
(E) If necessary, mixed DNA is removed by using a nucleolytic enzyme such as a DNA degrading enzyme.
(F) Concentrate RNA using a nucleic acid concentration method such as ethanol precipitation.

  In step (2) following step (1), gene expression analysis is performed using mRNA extracted from the collected corneum as a sample. Then, the expression level of a specific gene is calculated by the gene expression analysis. Thus, in one embodiment of the present invention, gene expression analysis is performed using the amount of mRNA remaining in the keratin as an index. By the way, in the outermost layer of the skin, there are keratins in which cells in the basal layer of the epidermis have lost cellular components such as nuclei and changed mainly into keratin fiber masses. The outermost stratum corneum is a cluster of dead cells and normally no nascent RNA is produced. One of the greatest features of the present invention is the use of RNA that remains in the outermost skin layer (ie, the stratum corneum) without being degraded. In gene expression analysis, the “gene expression level” is calculated as an absolute value or a relative value (such as a ratio or difference from the comparison target or standard expression level).

The “specific gene” whose expression level is examined by gene expression analysis is a gene related to the skin condition. As long as it is a gene related to the skin condition, any gene (for example, cells constituting the skin such as keratinocytes, melanocytes, Langerhans cells, Merkel cells, and the immune system that infiltrates from the blood during inflammation, etc.) Genes expressed by cells and the like) can be analyzed. Genes related to the skin condition can be identified by experiments using a macroarray or the like, as shown in Examples described later. The inventors have found that genes that are particularly effective in assessing the degree of aging, namely UNC5CL, KIAA0251, ECOP, PTGES2, ZNF135, SYT3, C12orf25, FOXA3, TMEM14C, PHF13, CLNS1A, RHOT2, FLG, NUP155, SLC7A6 , CYHR1, ZNF304, FGFR4, RNF6, EIF3S7, RPS15, MRPS2, SERGEF, HVCN1, FGFR1, GRK7, TP53I3, RPUSD4, F7, MFHAS1, BOLL, RNF20, and the upper part of the CYP2S1 gene Gene group in which a positive correlation was found between age and age (also referred to as “first gene group”), and TMEM47, SCAND2, SCML2, RFX4, G 2A, ZNF10, ABCD3, C13orf7, MICB, MPP1LC3C, PARP14, TMEM163, KIAA1467, SLC25A16, YARS2, FAM60A, CGNL1, CLN3, HSFY1, PLSCR3, LRRC37A3, C18orF4AR3, C18orT4 MGC4655, PLK1, APOLD1, DDX47, DENND1C, ABTB1, GORASP1, TRERF1, PKMYT1, AKAP9, FZD7, DENND1B, HEL308, PIGO, DCAKD, SEPW1, RTCD1, FBXO21F RDH 6, NSF, HLA-DMA, ARHGEF6, RNF38, U2AF1L4, CTBP2, CDK6, GNG10, WDR73, MTMR11, C16orf51, IL6, C21orf58, REP4, TMEM107, FCHO2, NCAPG2, BAG3, MAP6, P3 CRNKL1, ZFP91, SARDH, TMEM16H, UNKL, TXNDC1, AKT2, BAG1, GATAD2A, and USP54 (a gene group in which a negative correlation was observed between the gene expression ratio of the facial part relative to the inner part of the upper arm and aging. Succeeded in identifying (also referred to as "second gene group") (see Example section). Furthermore, ADAMTLS4, ADFP, ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5I, ATP5J, CKS1B, COX7C, CRCT1, CRTC1, NHTP1, DST3, DCTD, TDSP, DCTD, TDSP JMJD1A, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUFV2, NIT1, NOL7, NOTCH2NL, NR4A2, NT5E, PDGF , POLG, POLR2B, POLR2C, POLR2F, PSMB7, RPL37A, RPS23, S100A13, S100A2, SHC1, TPM3, TUFT1, UPP1, and VEGF (a gene group in which a negative correlation was observed between gene expression level and age Succeeded in identifying the “third gene group”.
In the present invention, preferably, the amount of mRNA of one or more genes selected from the first gene group, the amount of mRNA of one or more genes selected from the second gene group, or the third The amount of mRNA of one or more genes selected from the gene group is measured. More preferably, a gene group (ADAMTSL4, CKS1B, CRCT1, CRTC2, DAP3, ECM1, HIST2H2AA3, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NIT100N, NSCH2N, NSCH2N, NSCH2 , S100A2, SHC1, TPM3, TUFT1, and PSMB4), genes that increase in hypoxia (ADFP, DUSP1, HNRPA1, JMJD1A, PDGFB, and VEGF), NADH dehydrogenase genes (NDUFA1, NDUFB10, NUFFB1, NUFFB1, NUFFB1, NUFFB1, , NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDU S5, NDUFS6 and NDUVV2), genes related to pyrimidine metabolism (DCTD, DUT, ENTPD1, NT5E, POLG, POLR2B, POLR2C, POLR2F and UPP1), PML signal transduction gene groups (ATP5I, COX7C, CST6, CST6, NOL7) , RPL37A, RPS23 and NDUFA1), F-TYPE ATPase gene group (ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H and ATP5J) are measured for the amount of mRNA in one or more gene groups .
In general, it can be said that a more reliable evaluation can be obtained as the number of genes to be analyzed increases. On the other hand, an increase in the number of genes to be analyzed complicates data processing and may impair convenience and speed. It also causes an increase in the cost required for analysis. Therefore, the number of genes to be analyzed is preferably 1-30, more preferably 3-20, and still more preferably 5-10.
The number and description of each of the above genes in RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) and GenBank (http://www.ncbi.nlm.nih.gov/Genbank) An accession number (Accession number) at /index.html is shown in FIGS. Further, a gene group involved in keratinocyte differentiation is defined as an epidermal differentiation complex in Marenholz I, et al, Genomics, 37, 295, 1996, and a gene group whose expression increases in hypoxia is Leonard MO, et al, J Biol Chem, 2003, 278 (41), 40296, the NADH dehydrogenase gene group is described in Hatefi Y, et al, The Enzymes of Biological Members, 2nd ed, vol. 4, Plenum Press, New York, 1985, p. 1-70, gene groups involved in pyrimidine metabolism are described in Jeremy Berg, et al, In Biochemistry 5th ed, W. et al. H. Freeman and Company, USA, 2002, PML signal transduction gene groups are described in Appella E, et al, Eur. J. et al. Biochem, 2001, 268, 2764, F-TYPE ATPase gene group is described in Sachs G, et al, Biochim. Biophys. Acta. , 162, 1968, 210.

Here, a specific example of a gene expression analysis method using mRNA extracted from keratin is shown below. 1. Method using microarray (a) In order to prepare a microarray target or sample probe from a minute amount of keratin RNA, RNA is amplified by a method based on the PCR method or the T7 linear amplification method. For example, it can be carried out using an Express Art Aminoally mRNA amplification kit (Artus, Germany) using a T7 linear amplification method. Amplification reaction of reference RNA (reference RNA) and horny trace RNA as a comparative control is also performed in parallel. As the reference RNA, commercially available RNA for microarray reference can be used.
(B) The amplified RNA obtained from the target skin site and the reference RNA or comparative control RNA are labeled with two fluorescent dyes and then fragmented under alkaline conditions. The fluorescent dye can be used in any combination as long as it emits a fluorescence wavelength capable of discriminating two types of targets, but a combination such as Cy3 and Cy5, Alexa555 and Alexa647 is preferable.
(C) The fragmented fluorescently labeled RNA is hybridized to the microarray.
(D) After washing the microarray, scanning is performed and the expression level of each spot is measured.

2. Method using RT-PCR (a) cDNA is prepared from extracted RNA using reverse transcriptase.
(B) A PCR (polymerase chain reaction) reaction is performed using cDNA as a template and a primer corresponding to the target gene to obtain a DNA fragment corresponding to the target gene.
(C) The reaction of a gene (GAPDH, β-actin, etc.) as an internal standard is also performed in parallel.
(D) After electrophoresis of the obtained DNA fragment, it is stained with ethidium bromide and the intensity of the band is measured to obtain the expression level of the gene.
(E) If necessary, quantitative PCR reaction is performed using a fluorescent dye such as Syber green or a fluorescent probe such as Taqman probe to quantify the expression level.
(F) The ratio of the expression level of the target gene to the expression level of the gene serving as an internal standard is calculated.

In step (3), the skin condition is evaluated using the expression level calculated in step (2). For example, the calculated expression level is compared with a preset reference expression level to evaluate the skin state. Specifically, for example, a plurality of categories are set in which an evaluation relating to the state of the skin and an expression level range corresponding to the evaluation are associated, and the calculated expression level corresponds to which category. . Specific examples regarding the setting of categories (examples in the case of evaluating “degree of aging” as an index of skin condition) are shown below.
(Example 1: Example of using a gene whose increase in gene expression correlates with the progress of aging)
Aging degree 1 (low): expression level <a, aging degree 2 (moderate): a ≦ expression level <b, aging level 3 (high): b ≦ expression level (Example 2: decrease in gene expression level is aging) Example of using a gene that correlates with progression
Aging degree 1 (equivalent to 20s): a <expression level, aging degree 2 (equivalent to 30s) b <expression level ≦ a, aging degree 3 (equivalent to 40s): c <expression level ≦ b, aging degree 4 (50 Equivalent): d <expression level ≦ c, aging degree 5 (equivalent to 60s): expression level ≦ d

In one embodiment of the present invention, keratin is collected from two sites, and gene expression analysis of each keratin is performed. And the expression level calculated regarding each keratin is compared, and the state of skin is evaluated based on a comparison result. That is, in the skin condition evaluation method of this aspect, the following series of steps (i) to (iii) are performed.
(I) Step of preparing keratin collected from the first site of the test subject and keratin collected from the second site of the test subject (ii) Gene expression using the mRNA extracted from each keratin as a sample Analyzing, calculating an expression level of a gene related to the skin condition, and (iii) comparing the two expression levels calculated in step (ii) to evaluate the skin condition of the first site.

In step (iii), the two calculated expression levels are compared. For example, the ratio of the first expression level to the second expression level or the difference between the first expression level and the second expression level (first expression level−second expression level) is calculated. Then, it is checked which of the plurality of categories the evaluation value relating to the skin condition is associated with. A specific example regarding the setting of the category (an example in which “the degree of aging” is evaluated as an index of the skin condition using the ratio of the first expression level to the second expression level) is shown below.
(Example 3: Example of using a gene whose increase in expression ratio correlates with the progress of aging)
Aging degree 1 (low): Ratio <a, Aging degree 2 (medium): a ≦ Ratio <b, Aging degree 3 (high): b ≦ Ratio (Example 4: The decrease in the ratio of the expression level is the progress of aging) Example of using a gene that correlates with
Aging degree 1 (equivalent to 20s): a <ratio, aging degree 2 (equivalent to 30s) b <ratio ≦ a, aging degree 3 (equivalent to 40s): c <ratio ≦ b, aging degree 4 (equivalent to 50s) : D <ratio ≦ c, degree of aging 5 (equivalent to 60s): ratio ≦ d

  In Examples 1 to 4 above, the number of divisions is 3 (Examples 1 and 3) or 5 (Examples 2 and 4), but the number of divisions is not particularly limited. For example, the number of sections can be any of 2-10. The number of sections and the range of reference values associated with each section can be arbitrarily set based on the results of preliminary experiments.

  By the way, the skin covering portion is rarely exposed to the outside world, and compared with the exposed portion, the change in the state (the degree of aging, the amount of wrinkles, etc.) with aging and the difference between individuals are remarkably small. Therefore, if the exposed part is evaluated by comparison using the covered part as a reference (control), the state of the exposed part can be grasped more appropriately and accurately. Therefore, in the present invention, it is preferable to use the exposed part as the first part and the covering part as the second part. More preferably, the facial part is adopted as the first part in the exposed part, while the horny substance such as the inner part of the upper arm or the inner part of the forearm is relatively easy to collect in the covering part and changes with age and between individuals. A part having a relatively small difference is adopted as the second part. This simplifies the operation and improves the accuracy of evaluation.

  There are individual differences in skin condition due to the influence of the external environment and daily lifestyle habits. Therefore, wrinkles, sagging, elasticity, inflammation, pigmentation, dryness, barrier function, amount of sebum, skin metabolism, roughness, transparency, dullness, blood circulation, sunburn, pores By measuring the gene expression level, which is an index of the conspicuousness, hypersensitivity, and acne, the skin characteristics of the subject can be evaluated. Based on these characteristics, it is possible to select skin care or treatment methods such as selection of cosmetics / skin preparations suitable for the customer's skin and usage thereof.

As a second aspect, the present invention provides a method for evaluating treatment means for skin (hereinafter also referred to as “treatment means evaluation method”).
In the treatment means evaluation method of the present invention, the skin condition evaluation method of the present invention is used. Specifically, the effectiveness of the treatment means is evaluated by performing the skin condition evaluation method of the present invention before and after the treatment means is applied to the test subject, and comparing the obtained evaluation results. . The treatment means evaluation method of the present invention is highly objective and reliable because it evaluates based on the scientific basis of the expression level of genes related to the skin condition.
“Treatment means” refers to means applied to the skin for the purpose of improving or restoring the skin condition, and a typical example thereof is the use of cosmetics. The concept represented by the term “treatment means” includes skin care methods and treatment methods.

1. Extraction of RNA contained in the stratum corneum A circular tape (3M, Blenderm) with a radius of 1 cm was applied to the skin of the subject's cheeks, and after confirming that the tape was sufficiently adhered, the tape was peeled off to remove the stratum corneum. A tape containing was obtained. RNA contained in the obtained keratin was extracted using an RNA extraction kit (manufactured by Ambion, RNAqueous-4PCR Kit). Specifically, the keratin-attached tape was placed in 350 μL of Lysis / Binding Solution together with proteinase K (manufactured by Invitrogen), and incubated at 56 ° C. for 1 hour. Then, after making it disperse | distribute using an ultrasonic crusher, 350 microliters 64% ethanol was added and stirred, the tape was removed, and the keratin extract was obtained. After adsorbing RNA to the attached Filter Cartridge, RNA was eluted with 100 μL of eluate. DNase I was added to the obtained eluate to completely remove the remaining DNA, and then RNA was precipitated using ethanol to concentrate the RNA. The obtained RNA pellet was dissolved in a necessary amount of water to obtain residual RNA contained in the stratum corneum.

2. Microarray analysis of RNA contained in keratin (1) Material and method From the horny skin of cheek and inner skin of upper arm of three subjects in their 20s and 3 subjects in their 50s. Thus, residual RNA was obtained. Each RNA was amplified with Express Art Aminoally mRNA amplification kit (Artus, Germany), labeled with Cy3 and Cy5 fluorescent dyes, and then fragmented under alkaline conditions. Next, the fragmented target was hybridized with human oligonucleotide microarray Human 35K (Filgen, Nagoya) at 42 ° C. overnight, washed, and image data was read with a microarray scanner scan array Gx (Perkin Elmer). . From the image data, the signal intensity of each spot was digitized by Scan Array Express, which is microarray analysis software. Analyzing microarray data for 6 tape strip samples of the face and inner arm, and the gene expression ratio of the face to the inner arm (log (expression value of the face) / (expression value of the inner part of the upper arm)) Calculated. Then, genes with differential expression between the 20s and 50s were tested by t test. From the genes that passed the t-test, genes for which annotation information was obtained in the database were further selected. Selected genes were classified by the k-mean clustering method according to the expression pattern.

(2) Analysis results As a result of clustering, the gene expression ratio of the facial part to the inner part of the upper arm is low in the 20s and high in the 50s (that is, the gene expression ratio of the facial part to the inner part of the upper arm and aging 33 genes with a positive correlation between them, the gene expression ratio of the facial part to the inner part of the upper arm is high in the 20s and low in the 50s (ie, the gene expression of the facial part to the inner part of the upper arm) 88 genes) in which a negative correlation was observed between the ratio and aging could be identified (FIGS. 6 to 8). As described above, the inventors have succeeded in finding a gene useful for evaluating the degree of aging of the skin (degree of aging, progression of aging). It can be said that the degree of skin aging can be evaluated by paying attention to the expression levels of these genes. Moreover, it can be said that the progress of aging can be evaluated by paying attention to the increase and decrease of the expression levels of these genes.

  The gene expression ratio of the facial part to the medial part of the upper arm is low in the 20s and high in the 50s (first gene group) include UNC5CL, KIAA0251, ECOP, PTGES2, ZNF135, SYT3, C12orf25, FOXA3 , TMEM14C, PHF13, CLNS1A, RHOT2, FLG, NUP155, SLC7A6, CYHR1, ZNF304, FGFR4, RNF6, EIF3S7, RPS15, MRPS2, SERGEF, HVCN1, FGFR1, GRK7, TP533, GRK7, TP533 (See FIG. 1). In addition, the gene expression ratio of the facial part to the medial part of the upper arm is high in the 20s and low in the 50s (second gene group) includes TMEM47, SCAND2, SCML2, RFX4, GM2A, ZNF10, ABCD3. , C13orf7, MICB, MPP1LC3C, PARP14, TMEM163, KIAA1467, SLC25A16, YARS2, FAM60A, CGNL1, CLN3, HSFY1, PLSCR3, LRRC37A3, C18orf4, ARSD, PITX2, TBT36T , DDX47, DENND1C, ABTB1, GORASP1, TRERF1, PKMYT1, AKAP9, FZD7, DENND1B HEL308, PIGO, DCAKD, SEPW1, RTCD1, FBXO21, MLZE, FUT4, MR1, NBPF11, RPL36AL, DFFB, MFAP3L, RDH16, NSF, HLA-DMA, ARHGEF6, RNF38, U6DR2CD, U2AF1L4 C16orf51, IL6, C21orf58, REP4, TMEM107, FCHO2, NCAPG2, BAG3, MAP6, AFF3, EBP, ATM, AQP4, CRNKL1, ZFP91, SARDH, TMEM16H, UNKL, TXNDC1, AGT2, GAT (See Figures 2-4).

In general, the amount of wrinkles, sagging, pigmentation, etc. increases with age, and elasticity, moisture content, moisturizing power, etc. decrease. As described above, some of the indices representing the skin condition are correlated with aging. Based on this fact, each of the genes identified by comparison between subjects in their 20s and those in their 50s is not only used as an index for evaluating the degree of aging, but also various indexes correlated with aging. Also considered useful.
Skin is an organ in the outermost layer of the living body, and there are individual differences and temporal changes in the skin state due to the influence of the external environment and daily lifestyle habits. Therefore, wrinkles, sagging, elasticity, inflammation, pigmentation, dryness, barrier function, amount of sebum, skin metabolism, roughness, transparency, dullness, blood circulation, sunburn, pores By measuring the gene expression level, which is an index of the conspicuousness, hypersensitivity, and acne, the skin characteristics of the subject can be evaluated.

3. PCR analysis of RNA contained in keratin 1
From the skin keratin of cheek and inner arm of 3 subjects in 20s and 3 subjects in 50s, the above 1. Thus, residual RNA was obtained. Each RNA was subjected to a quantitative PCR reaction using RT-PCR kit (Superscript III Platinum SYBR Green Two-step qRT-PCR kit manufactured by Invitrogen), and the expression levels of FLG, FGFR1 and ZNF10 were quantified. The expression levels of all genes were normalized (normalized) with the expression levels of β-actin. The primers used for measuring the expression of each gene are as follows.

Primer set for FLG
AGCCTGGCCAACTTAGTGAAAC (SEQ ID NO: 1)
GTGCCACCATGCCTGGATA (SEQ ID NO: 2)
Primer set for FGFR1
GGAGTCCCGGAAGTGTATCCA (SEQ ID NO: 3)
CCAGCCCAAAGTCAGCAATC (SEQ ID NO: 4)
Primer set for ZNF10
ACACCATGCCCACATACAACA (SEQ ID NO: 5)
GAGCCCCAGTTAAGTGACTATTCTACTC (SEQ ID NO: 6)
Primer set for β-actin
CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 7)
GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 8)

Quantification was performed by the ΔΔCt method, and the gene expression level of facial keratin relative to the expression level of arm keratin was calculated. The result is shown in FIG. As shown, FLG and FGFR1 have a low gene expression ratio of the facial part to the medial part of the upper arm in the 20s and high in the 50s. Moreover, about ZNF10, the gene expression ratio of the face part with respect to a medial part of the upper arm is high in the 20s and low in the 50s. Thus, it was shown that the gene expression levels of FLG, FGFR1, and ZNF10 are useful for evaluating and predicting the degree of aging.
As described above, the results of PCR analysis showed the same tendency as the results of microarray analysis. This confirms the usefulness of the genes found by microarray analysis, and at the same time proves that the knowledge of microarray analysis does not depend on the type of analysis method.

4). PCR analysis of RNA contained in keratin 2
From the skin stratum corneum of the cheeks of 7 subjects in the 20s and 4 subjects in the 50s, the above 1. Thus, residual RNA was obtained. In addition, Human skin RNA (Cat. No. R1234218-P, Cosmo Bio) was used as a reference. When collecting stratum corneum, the texture of the subject's cheeks was evaluated by a replica using a six-step evaluation, and the lightness was set to L value using Spectrophotometer (Konica Minolta, CM-2600d), and the elasticity was measured using a skin viscoelasticity meter (Courage + Khazaka, CW- E & S-001). The evaluation score of the texture indicates that the smaller the texture, the rougher the texture, and the greater the texture, the finer the texture. Further, the lightness indicates that the lower the degree of pigmentation, the higher the brightness, and the lower the degree of pigmentation. The less elastic, the less elastic the skin, and the degree of pigmentation indicates that the skin is elastic.
Each RNA was amplified using an Express Art mRNA amplification kit (Artus, Germany), and subjected to RT-PCR kit (Invitrogen, SuperScript III Platinum SYBR Two-step qRT-PCR). ADAMTLS4, ADFP, ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5I, ATP5J, CKS1B, COX7C, CRCT1, CRTC2, CST6, DAP3, DCTD, TDSP3D, DCTD, DUSP3 LCE1C, LCE2A, LCE3A, LC 3E, LCE5A, LMNA, NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS5 The expression levels of POLR2C, POLR2F, PSMB7, RPL37A, RPS23, S100A13, S100A2, SHC1, TPM3, TUFT1, UPP1, and VEGF were quantified. The expression levels of all genes were normalized (normalized) with the expression levels of the reference KRT6B gene. In addition, the primer used for the measurement of the expression of each gene is shown in FIG.

Quantification was performed by the ΔΔCt method, and the gene expression level was calculated as the ratio of the gene expression level of the facial keratin to the reference gene expression level.
ΔΔCt = (sample target gene Ct value−reference target gene Ct value) − (sample KRT6B gene Ct value−reference KRT6B gene Ct value)
Gene expression level = 2− ^ΔΔCt
The result is shown in FIG. As shown, ADAMTLS4, ADFP, ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5I, ATP5J, CKS1B, COX7C, CRCT1, CRTC2, CST6, DST3, DCTD, TUS, DCTD, TUS NHNRNPA1, JMJD1A, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUFV2, NIT1, NOL7, NOTCH2NL, NR4A2, NT5E, PD FB, POLG, POLR2B, POLR2C, POLR2F, PSMB7, RPL37A, RPS23, S100A13, S100A2, SHC1, TPM3, TUFT1, UPP1, and VEGF are high in the 20s and low in the 50s . Thus, it was shown that these gene expression levels are useful for evaluating and predicting the degree of aging.

5. Evaluation of skin properties by PCR analysis of RNA contained in keratin. The ΔΔCt value obtained from the PCR analysis results of the residual RNA from the skin tissue of the cheeks of seven 20-year-old subjects and 4 50-year-old subjects measured by the above method was used to determine the gene group (ADAMTSL4, CKS1B, CRCT1, CRTC2, DAP3, ECM1, HIST2H2AA3, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NIT1, NOTCH2NL, S100A13, S100A2, SHC1, TPM3, TUFT1, and oxygen are increased in PSMB4. ADFP, DUSP1, HNRPA1, JMJD1A, PDGFB, VEGF), NADH dehydrogenase gene group (NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9) , NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUVV2), gene groups involved in pyrimidine metabolism (DCTD, DUT, ENTPD1, NT5E, POLG, POLR2B, POLR2B, POLPM2) Group (ATP5I, COX7C, CST6, NOL7, NR4A2, RPL37A, RPS23, NDUFA1), F-TYPE ATPase gene group (ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5J, ATP5H, ATP5J, standard 0) Standard deviation = 1). There was a negative correlation between the ΔΔCt value of the gene group involved in keratinocyte differentiation and the skin brightness and texture of the subject. Similarly, ΔΔCt value and skin elasticity of the gene group whose expression increases in hypoxia, ΔΔCt value and skin elasticity of the NADH dehydrogenase gene group, ΔΔCt value and skin lightness of the gene group involved in pyrimidine metabolism, A negative correlation was observed between the ΔΔCt value of the PML signal transduction gene group and the degree of skin texture, and the ΔΔCt value of the F-TYPE ATPase gene group and the degree of skin texture (FIGS. 12 to 17). The lower ΔΔCt, the larger the gene expression level. The larger the texture evaluation score, the finer the texture. The higher the lightness, the lower the degree of pigmentation. The higher the elasticity, the more elastic the skin. It shows that there is. That is, it was found that the gene expression of each gene group is higher as the texture is finer, the pigmentation is less, and the elasticity is higher. Therefore, genes related to keratinocyte differentiation contained in the horny RNA of subjects (ADAMTSL4, CKS1B, CRCT1, CRTC2, DAP3, ECM1, HIST2H2AA3, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NIT1, NOTCH2L, NOTA13S SHC1, TPM3, TUFT1, PSMB4), PML signaling system gene group (ATP5I, COX7C, CST6, NOL7, NR4A2, RPL37A, RPS23, NDUFA1), F-TYPE ATPase gene group (ATP5A1, ATP5C1, ATP5DA, TP5DA, TP5D ATP5G2, ATP5H, ATP5J) are measured to evaluate the texture of the subject. It becomes possible to predict. Furthermore, genes related to keratinocyte differentiation (ADAMTSL4, CKS1B, CRCT1, CRTC2, DAP3, ECM1, HIST2H2AA3, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NIT1, NOTCH2NL, TP100T13T, A100M13 ), By measuring the expression of genes involved in pyrimidine metabolism (DCTD, DUT, ENTPD1, NT5E, POLG, POLR2B, POLR2C, POLR2F, UPP1), the degree of pigmentation in the subject increased in hypoxia Gene groups (ADFP, DUSP1, HNRPA1, JMJD1A, PDGFB, VEGF), NADH dehydrogenase gene group (NDUFA1) NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUV2) . From the result, it is possible to select a skin care or treatment method suitable for the skin characteristics of the subject.

  According to the skin condition evaluation method of the present invention, the skin condition can be evaluated minimally invasively. In addition, highly objective evaluation results can be obtained. The present invention makes it possible to select a skin care or treatment method, such as selection of cosmetics / external skin preparations suitable for the skin of the customer and usage thereof.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

A gene group identified by microarray analysis, the gene expression ratio of the facial part to the inner side of the upper arm is low in the 20s and high in the 50s. A gene group identified by microarray analysis, wherein the gene expression ratio of the facial part to the inner side of the upper arm is high in the 20s and low in the 50s. Continuation of FIG. Continuation of FIG. Genes with a negative correlation between the expression level of genes identified by PCR analysis and age The result of the microarray analysis about the gene group whose gene expression ratio of the face part with respect to the inner part of the upper arm is low in the 20s and high in the 50s. The result of the microarray analysis about the gene group whose gene expression ratio of the face part with respect to the medial part of the upper arm is high in the 20s and low in the 50s. Continuation of FIG. Results of PCR analysis using three genes identified by microarray analysis. Primer sequences used for PCR analysis Results of PCR analysis of genes in which a negative correlation was found between gene expression level and age Relationship between expression of genes involved in keratinocyte differentiation, skin brightness and texture state Relationship between the expression of genes whose expression increases in the oxygen state and skin elasticity Relationship between NADH dehydrogenase gene group expression and skin elasticity Relationship between expression of genes involved in pyrimidine metabolism and skin brightness Relationship between expression of PML signal transduction system genes and skin texture Relationship between expression of F-TYPE ATPase genes and skin texture

Claims (13)

  A method for evaluating skin condition, characterized in that gene expression analysis is performed using keratin collected from the skin of a test subject, and the skin condition is evaluated based on the result.   The method according to claim 1, wherein the gene expression analysis is gene expression analysis using mRNA extracted from the keratin as a sample. (1) a step of preparing keratin collected from the skin of a specific site of a test subject;
(2) performing gene expression analysis using mRNA extracted from the stratum corneum as a sample, and calculating an expression level of a gene related to the skin condition; and (3) skin using the expression level calculated in step (2). Evaluating the condition of the
The method of claim 2 comprising:   The method according to claim 3, wherein in step (3), the expression level calculated in step (2) is collated with a reference expression level to evaluate the skin condition.   The method according to claim 3 or 4, wherein the specific part is a face part.   The method according to claim 3, wherein the gene expression analysis is performed by a microarray method or a PCR method.   The genes are UNC5CL, KIAA0251, ECOP, PTGES2, ZNF135, SYT3, C12orf25, FOXA3, TMEM14C, PHF13, CLNS1A, RHOT2, FLG, NUP155, SLC7A6, CYHR1, NFFR4R, ZNF3, FGFR4 The method according to any one of claims 3 to 6, which is one or more genes selected from the group consisting of HVCN1, FGFR1, GRK7, TP53I3, RPUSD4, F7, MFHAS1, BOLL, RNF20, and CYP2S1. .   The genes are TMEM47, SCAND2, SCML2, RFX4, GM2A, ZNF10, ABCD3, C13orf7, MICB, MPP1LC3C, PARP14, TMEM163, KIAA1467, SLC25A16, YARS2, FAM60A, CGNL3, CLN3, HS4 PITX2, TUBGCP5, RPL36, SMYD4, C3orf39, KBBTBD6, MGC4655, PLK1, APOLD1, DDX47, DENND1C, ABTB1, GORASP1, TRERF1, PKMYT1, AKAP9, FZD7, FZD7 FUT4, M 1, NBPF11, RPL36AL, DFFB, MFAP3L, RDH16, NSF, HLA-DMA, ARHGEF6, RNF38, U2AF1L4, CTBP2, CDK6, GNG10, WDR73, MTMR11, C16orf51, IL6, C21orTM58, REP4PG The gene is one or more genes selected from the group consisting of MAP6, AFF3, EBP, ATM, AQP4, CRNKL1, ZFP91, SARDH, TMEM16H, UNKL, TXNDC1, AKT2, BAG1, GATAD2A, and USP54. The method in any one of 3-6.   The gene is ADAMTLS4, ADFP, ATP5A1, ATP5C1, ATP5D, ATP5E, ATP5G1, ATP5G2, ATP5H, ATP5I, ATP5J, CKS1B, COX7C, CRCT1, CRTC2, CST6, DST3, DCTD3, DCTD3 NHNRNPA1, JMJD1A, LCE1C, LCE2A, LCE3A, LCE3E, LCE5A, LMNA, NDUFA1, NDUFA13, NDUFB1, NDUFB10, NDUFB7, NDUFB9, NDUFC1, NDUFC2, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUFV2, NIT1, NOL7, NOTCH2NL, NR4A2, NT5E, P The gene is one or more genes selected from the group consisting of GFB, POLG, POLR2B, POLR2C, POLR2F, PSMB7, RPL37A, RPS23, S100A13, S100A2, SHC1, TPM3, TUFT1, UPP1, and VEGF. The method in any one of 3-6.   The method according to claim 1, wherein the keratin is keratin collected from the skin of a test subject using an adhesive tape.   The skin condition is aging, wrinkles, sagging, elasticity, inflammation, pigmentation, dryness, barrier function, sebum amount, skin metabolism, texture, transparency, dullness, blood circulation, sunburn, conspicuous pores The method according to any one of claims 1 to 10, wherein the state is related to one or more indicators selected from the group consisting of: perception, hypersensitivity, and acne.   The method according to claim 1, wherein the skin condition is a degree of aging.   The method according to any one of claims 1 to 12 is performed before and after the treatment means is applied to the test subject, and the effectiveness of the treatment means is evaluated by comparing the obtained evaluation results. A method for evaluating a means of treatment for skin, characterized by:

Images