JP2003052388A - Colon-specific gene and protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new human colon-specific gene polypeptide, a DNA (RNA) encoding the polypeptide and a method for producing the polypeptide by a recombinant technique. SOLUTION: A method for utilizing a polynucleotide as a diagnostic marker for colon cancer and as a reagent to determine if the colon cancer is metastasized is provided. An antibody specific for the colon-specific gene polypeptide which is used as a target cancer cell and used as a part of a colon cancer vaccine is provided. A method for screening for an agonist and an antagonist for the polypeptide and therapeutic uses of the antagonist are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] FIELD OF THE INVENTION The present invention relates to a newly identified
A polynucleotide, such a polynucleotide
Encoded polypeptides and such polynucleotides
It relates to the use of otides and polypeptides. The present invention is
Furthermore, it inhibits the product and function of the polypeptide of the present invention.
About things. [0002] BACKGROUND OF THE INVENTION The gastrointestinal tract is a new
Sites where both diagnosed and fatal cancers are common
And the cancer develops more in men than in women
High frequency. Increasing incidence of colon cancer in the United States
However, stomach cancer is decreasing and small bowel cancer is rare. stomach
Cancer is common in Japan and rare in the United States
You. On the other hand, colon cancer is rare in Japan and in the United States.
Is common. Environmental epidemiological factors are high risk
That those who move into the territory seem to be at high risk
This is strongly suggested by the statistical data presented. stomach cancer
Epidemiological factors suggested include aflatoxin (yellow asbestos).
Formed by Pergilus (aspergillus flavus)
Carcinogens present in dyed foods), smoked fish, sake
And vitamin A and magnesium deficiencies. High fat
Low in bulk food and sky
Degradation products of sterol metabolism are epidemiological factors of colon cancer.
May be. Certain disorders, such as pernicious anemia,
Untreated non-tropical sprue and immunocompromised gastric cancer
All for lymphoma and cancer, and ulcerative and granulomatous
Colitis is an isolated polyp and hereditary familial polyp
May be more susceptible to colon cancer. [0003] The most common colon tumors are adenomatous polyps
It is. Primary lymphoma is rare in the colon and small
It is most common in the intestine. Adenomatous polyps are the most
It is a common benign gastrointestinal tumor. The polyp is in the GI tract
It occurs everywhere, most commonly in the colon and
Stomach, more frequent in men than in women
Seen high. The polyp may be single or more commonly
Plural and may be sessile or pedunculated.
The polyps are familial polyposis and Gardner's
Hereditary diseases mainly related to the colon such as syndrome
You. Colon cancer progression is common in familial polyposis
Can be Polyps often have latent or heavy bleeding
Cause, but as long as the complexity does not continue
And does not cause pain. Papillary adenoma in the colon
A less common form that is only seen
It also causes losses and mucoid excretion. [0004] Malignant tumors may be invasive or
May be most commonly found in the sigmoid colon
You. Because the contents of the ascending colon are liquid,
Cancer usually does not cause disability, but the patient has anemia, abdominal pain
Or an abdominal mass or a palpable mass later in the disease
Tend to show. [0005] The prognosis of colon tumors depends on the degree of leaching into the visceral wall.
And regional lymph node association and metastasis to distant sites
Depends on the existence of. The prognosis of rectal and descending colon cancer is
Very unexpectedly good. Before bleeding into nodes
Initial healing can achieve a cure rate of 80-90%. This
In eliminating this disease for reasons of
Unexplained anemia, gastrointestinal tract in healthy patients
Where occult blood or changes in the nature of the internal organs occur
In that case, very great care must be taken. Rin
When the disease is completely removed before it reaches the nodes,
It offers a great chance of survival for colon cancer patients. For occult blood
Detection in asymptomatic patients, blood screening is 5
Annual survival rate is the highest result. [0006] SUMMARY OF THE INVENTION Clinically suspected malignancy
Lesions are usually detected by radioautography
be able to. Polyps smaller than 1 cm are easily missed
Easily, especially in the upper part of the sigmoid colon and
It is easily overlooked in the presence of chamber disease. Clinically suspect
Esophagus, stomach, and
Or lesions in the colon, direct biopsy and brush food
Histological diagnosis made by brush sitology
Can be confirmed by optical fiber in combination with
You. Colonoscopy is used to detect diseases of the colon
Another way. Benign and not visible by X-ray
Malignant polyps can be detected by colonoscopy
There is often. In addition, patients with one lesion on X-ray
May find additional lesions on colonoscopy
There are many. However, sigmoidoscopy shows that colon tumors
Only 50% is detected. The method of detecting colon cancer,
For example, small colon tumors are seen in all of the above methods.
It has the disadvantage that it may be missed. Colon cancer detection
Importance is also very important to prevent metastasis.
It is also important. [0007] According to one aspect of the present invention,
RNA transcribed from the human colon-specific gene of the present invention
Or specifically for DNA corresponding to such RNA.
Nucleic acids containing nucleic acid molecules long enough to hybridize
Provide a probe. According to another aspect of the present invention, a host-based
From the human colon-specific gene of the present invention in a subsequent sample
The presence of, or corresponding to, the transcribed RNA
For diagnosing colon cancer metastasis by determining DNA
Or provide a preparation. In accordance with yet another aspect of the present invention, there is provided a host-based system.
Corresponding to the colon-specific gene of the present invention in the coming sample
Colon by detecting changes in polypeptide levels
Methods for diagnosing cancer metastasis and preparations for diagnosing
Provided, thereby increasing the level of the polypeptide.
Suggests diagnosis of bowel cancer. According to another aspect of the present invention, mR
The present invention, including NA, DNA, cDNA, and genomic DNA
Polynucleotide encoding the polypeptide of claim
And even its antisense analogs and
Biologically active and diagnostically or therapeutically useful
Provide the fragment. According to a further aspect of the invention,
Novel polypeptides and encoded by leotide
Biologically active and diagnostically or therapeutically useful
Of fragments, analogs and derivatives of Book
According to a further aspect of the invention, expression of the protein and
Under conditions that promote continuous recovery, the polynuc of the present invention
Recombinant prokaryote and / or eukaryote containing leotide
Further by recombinant techniques, including culturing host cells.
And a method for producing such a polypeptide. According to yet another aspect of the present invention, such a method is provided.
Antibodies specific to the various polypeptides. Another of the present invention
According to embodiments of the present invention for treating colon cancer.
Methods of using peptides and, for example, polypeptides of the invention
Compounds that suppress or activate receptors for
Compounds that interact with the polypeptide
Methods for using polypeptides to perform
You. According to yet another aspect of the present invention, for example,
Compounds that inhibit or activate the polypeptide of the present invention
Compounds that interact with the polypeptide
Provide a way to According to yet another aspect of the invention,
Scientific research, DNA synthesis and DNA vector
Such for in vitro purposes related to manufacturing
Encoding a novel polypeptide or such a polypeptide
The present invention provides a method for utilizing a polynucleotide. Departure
These and other aspects of the disclosure are in accordance with the teachings herein.
Will be apparent to those skilled in the art. [0012] BEST MODE FOR CARRYING OUT THE INVENTION "Colon-specific gene"
Such genes are first expressed in colon-derived tissues,
Such genes are expressed in cells from tissues other than the colon
Means that you might However,
Una gene expression is derived from colon tissue more than non-colon tissue
Significantly higher in the tissues. According to one aspect of the invention
And the deduced amino acid sequence of FIGS.
Having a mature polypeptide, or April 28, 1995
Deposited with ATCC under accession number 97129
Mature polypeptide encoded by the loan cDNA
Provide an isolated nucleic acid (polynucleotide) encoding
Offer. [0013] The plasmid encoding the colon-specific gene of the present invention.
Renucleotides from human colon cancer cDNA library
Isolated. The polynucleotide has 158 amino acid residues
Open reading frame that encodes a protein
System. The polypeptide has a diamond-shaped mottle on the back
Rattlesnake (diamondback rattlesnake)
Exceeds 125 amino acids in galatose-specific lectin
36% identity and 54% similarity with human pancreas
30% identity and 52% similarity to stone protein precursor
Shows similarity. The polynucleotide of the present invention may be in the form of RNA.
Or in the form of DNA, which contains cD
NA, genomic DNA, and synthetic DNA. The
DNA can be double-stranded or single-stranded, and can be single-stranded.
If present, coding strand or non-coding (un
Chain). Encodes a mature polypeptide
The coding sequence to be used is shown in FIGS. 1 to 3 (SEQ ID NO: 1).
The coding sequence shown in
Coding sequence or the genetic coding
1 to 3 (sequence numbers)
No. 1) Same maturation as DNA or deposited cDNA
With different coding sequences encoding the polypeptide
There may be. The mature polypeptide of FIGS. 1-3 (SEQ ID NO: 2)
Components encoded by the peptide or the deposited cDNA
Polynucleotides encoding mature polypeptides include:
The following may be included: the coding polypeptide of the mature polypeptide
Coding sequence only; coding sequence for mature polypeptide,
And leader or secretory sequence or proprotein sequence
Additional coding sequences, such as sequences; mature polypeptides
Coding sequence of the peptide (and possibly additional coding
Coding sequence), and the coding of the mature polypeptide.
Intron of coding sequence or 5 'non-coding sequence
And / or non-coding sequences such as 3 '. Accordingly, the expression “polypeptide encoding a polypeptide
The term "nucleotide" refers to the polypeptide
A polynucleotide containing only the
Additional coding and / or non-coding
Includes polynucleotides containing sequences. The present invention
Furthermore, the deduced amino acid sequence shown in FIGS. 1 to 3 (SEQ ID NO: 2)
Polypeptide with the sequence or c of the deposited clone
Fragments of polypeptides encoded by DNA
Polynucleic acid encoding the analogs, analogs and derivatives
Related to variants of nucleotides. Polynucleotide mutation
The body is a naturally occurring allelic variant of a polynucleotide
Or a non-naturally occurring variant of a polynucleotide
possible. Accordingly, in the present invention, FIGS.
No .: 2) the same mature polypeptide or deposited
Same mature plasmid encoded by the cDNA of the clone
A polynucleotide encoding a repeptide, or even
In addition, variants of such polynucleotides are included
These mutants correspond to the polypeptides of FIGS. 1-3 (SEQ ID NO: 2).
The cDNA of the peptide or the deposited clone.
Fragments, derivatives or
Code the nalog. For such nucleotide variants
Are deletion mutants, substitution mutants and addition and insertion mutations
Body included. As indicated above, the polynucleotide
Indicates the coding sequence shown in FIGS. 1 to 3 (SEQ ID NO: 1).
Row of naturally occurring allelic variants or deposited black
Naturally occurring allelic variants of the coding sequence of
. Know in the art
As noted, one or more allelic variants
Another that may have a substitution, deletion or addition of the above nucleotide
Is a polynucleotide sequence in the form of
Does not substantially alter the function of the polypeptide to be made. [0019] The present invention also relates to the coding for the mature polypeptide.
The coding sequence is used to determine the expression of the polypeptide from the host cell.
And polynucleotide sequences that aid secretion, e.g., cells
Secretion sequences to control the transport of polypeptides from
Can be fused in the same reading frame to a leader sequence
Polynucleotides. Has a leader sequence
The polypeptide is a preprotein and is
Reasons that are more cleaved to form the mature polypeptide
In some cases. The polynucleotide is
And a mature protein with additional 5 'amino acid residues
Certain proproteins may also code. Has a pro sequence
The mature protein is a proprotein and the inactive form
Is a protein. Once the prosequence is cleaved,
Sex mature protein remains. Therefore, for example, the po
Renucleotides can be used to bind mature proteins, or prosequences.
Protein, or pro and presequences
(Protein sequence).
You. The polynucleotide of the present invention
To a marker sequence that allows purification of the polypeptide
-It may also have a coding sequence fused in frame. Fine
In the case of a bacterial host, the marker sequence is
PQ to provide for purification of the combined mature polypeptide
Hexa-histidine provided by the E-9 vector
Tag, or a mammalian host, e.g.
For example, when COS-7 cells are used, their markers
The sequence may be a hemagglutinin (HA) tag. HA TA
Obtained from influenza hemagglutinin protein
(Wilson, I.)
Et al., Cell, 37: 767 (1984)). "Gene"
The term DNA refers to the production of polypeptide chains.
Meaning segment: before the coding region and
Subsequent areas (leaders and trailers) and individual
Intervening sequences between various coding segments (exons)
(Intron). The full-length colon-specific gene fragment comprises the full-length
Has high similarity to the gene and the gene or
To isolate other genes with similar biological activity
CDNA library hybridization probe
May be used as a probe. This type of probe is
Preferably it has at least 30 bases, for example 50 or
May contain more bases. The probe is
In addition, full-length transcripts and genomic clones or regulatory regions
Region and promoter region, exons and introns
Clones containing a complete colon-specific gene containing
May be used to identify cDNA. Screeninin
Examples of synthesizing oligonucleotide probes include:
By using a known DNA sequence for
Isolating the coding region. Remains of the present invention
Labeled oligonucleotides with sequences complementary to gene sequences
Reotide is a human cDNA, genomic DNA or mRNA
Screen the library and let the probe live
Decide which members of the rally to hybridize to
Used to do. The present invention further provides that at least 70
%, And also preferably at least 90% and more preferred
Or at least 95% identity,
For polynucleotides that hybridize to a column. Book
The invention particularly relates to the above-described polynucleic acid under stringent conditions.
For polynucleotides that hybridize to leotide
You. As used herein, "stringent articles"
The term "case" refers to at least 95% between sequences,
Preferably only if there is at least 97% identity,
Means that hybridization will occur
You. In a preferred embodiment, the polynucleotide
The polynucleotide to be hybridized is shown in FIGS.
No. 1) or the deposited cDNA
Substantially the same biological as the encoded mature polypeptide
Encodes a polypeptide that retains function or activity
You. Alternatively, the polypeptide may be a polypeptide of the present invention.
Hybridizes to a nucleotide and the polynucleotide
Otides have identity as indicated above, and retain activity
At least 20 bases with or without, preferably
30 bases and more preferably at least 50 bases
I do. For example, such polypeptides are shown in FIGS.
The polynucleotide of SEQ ID NO: 1), such as the polynucleotide
As a probe for otide recovery or as a diagnostic
May be used as probes or PCR primers. Accordingly, the present invention relates to FIGS. 1 to 3 (SEQ ID NO:
The polynucleotide encoding the polypeptide of 2)
At least 70% identity, preferably at least 90%
Identity, and more preferably at least 95%
Unique polynucleotide and its fragment
(The fragment is at least 30 bases and preferably
Or at least 50 bases) and such
For polypeptides encoded by the oligonucleotides
You. [0025] The deposit referred to in this specification is a fine
Of the terms of the Budapest Treaty on the international recognition of the deposit of organisms
Will be kept below. These deposits are simply
Provided as a convenience to the
Approves what is required under U.S.C. §112
is not. Polynucleotide contained in the deposited material
Sequence of the code, and also the
The amino acid sequence of the peptide forms part of the present description.
And contradicts any of the sequences described herein.
Is preferred by the sequence in the deposited material. Deposited items
To make, use or sell quality, a license is required.
May be required, and such a license is granted here.
Not done. According to another aspect of the present invention, preferably less
The length is at least 10 base pairs, and is shown in FIGS.
No. 1) at least the coding sequence of the DNA sequence
Human inheritance with 90% identical coding sequence
RNA (or corresponding DNA) transcribed from the offspring
Can be hybridized and are at least 70% identical
A polynucleotide is provided. Therefore, as above
The polynucleotide sequences that hybridize to
Match for use in listed diagnostic assays
Used to hybridize to a human gene
Used to detect human gene expression. According to yet another aspect of the present invention, a host
Diagnosis to detect micrometastases in colon cancer
An assay is provided. Applicants may make any arguments for the present invention
I do not want to be limited to a particular scientific theory,
Colon-specific inheritance in non-colon cells among the main cells
The presence of offspring active transcripts is an indicator of colon cancer metastasis
Is believed. This means that colon-specific genes are
It is found in cells, but its transcription into mRNA, cDNA and
And expression products are mainly restricted to the colon of normal individuals. Only
However, if colon cancer is present, are colon cancer cells cancerous?
Move to other cells, and these other cells,
Normal individuals that transcribe colon-specific genes
At a much higher level than it is found in the body
It can be found in other tissues of the colon in normal individuals
Expressed at even higher levels. In cells other than the colon
Detection of enhanced transcription or transcript protein expression is conclusive.
It is an indicator of metastasis of intestinal cancer. In one example of such a diagnostic assay,
RNA sequences in samples from tissues other than the colon
Detection by hybridization to
You. The sample contains a nucleic acid or a mixture of nucleic acids,
Transfer from at least one human colon-specific gene of the invention
Includes transcribed RNA (or corresponding cDNA)
Including those that have been obtained. Thus, for example, features in cells
In the form of an assay to determine the presence of a foreign RNA
First, RNA is isolated from the cells. This is the sample
Blood, urine, saliva, tissues, but not limited to
Obtained from cells other than the colon, including biopsy and autopsy material
May be. MRN from human colon specific gene of the present invention
A. Detection of enhanced transcripts or fragments thereof
The use of such methods that emerges from the teachings herein.
Often done within the scope of the trader. For isolation of mRNA, cells are disrupted and fractionated.
By centrifuging, it is possible to isolate total cellular RNA.
Including. Once the total RNA is isolated, the mRNA is
At the 3 'end, the position substantially found in each eukaryotic mRNA molecule
Adenine nucleotide known to those skilled in the art as a rear
Isolate using the residue. Deoxythymidine [oligo
(DT)] consisting of only cellulose
Oligo (dT) -cellulose on a small column
Fill. Preparation of total cellular RNA requires such a column
When run through the mRNA molecule, the poly-A tail
To the oligo (dT) while the remaining RNA is
Go through. The bound mRNAs are then dissolved from the column.
Take out and collect. For example, the expression of the colon-specific gene of the present invention is reversed.
Transcribed and isolated mRNA or polypeptide of the invention
One example of detecting the fragment that encodes the code
Converts collected mRNAs to mRNA to be detected.
Specific orientations designed in a conventional manner to hybridize
And screening with oligonucleotides. Ori
The oligonucleotide probe is a colon-specific gene of the present invention.
Or transcribed from one or more of its fragments
MRNA (or produced from such RNA)
That hybridizes to at least a portion of the cDNA
Contains the nucleotide sequence. The polynucleotide sequence is
1 to 3 (SEQ ID NO: 1)
90%, preferably at least 95% and more preferred
Or DNA containing at least 97% identity.
Transcribed from the colon-specific gene of the present invention having xon
MRNA (or cDNA from such RNA)
At least 70% identical to mRNA and hybridized to mRNA
Is what you do. In addition, such a probe is
Labeled with analytically detectable reagents to facilitate probe identification
Has been recognized as preferred. Although useful,
However, non-limiting reagents include radioactivity,
Can catalyze the formation of photodye or detectable product
It is an enzyme that can be cut. Polynucleotide complementary to mRNA sequence
One example for detecting
-Utilize chain reaction (PCR). PC
R is very resistant to specific amplification of DNA or RNA extension
Powerful method (Saiki et al., Nature, 23)
4: 163-166 (1986)). One of the technologies
Applications are low copy number nuclei in nucleic acid probe technology.
To reduce acid sequences to detectable levels
You. Many diagnostic and scientific applications of this method are
PCR technology by HA Erlich (ed.)
ー -Principles and Applications
O DNA amplification (PCR Techno
logy-Principles and Applications for DNA Amp
lification), Stockton Press
s), USA, 1989, and Ainice (MA.
Inis) by PCR Protocols (PCR Protoco
ls), Academic Press, Sun
Diego, USA, 1990. RT-
PCR is a combination of reverse transcriptase and PCR. Reverse transcriptase
Element is an enzyme that produces a cDNA molecule from the corresponding mRNA molecule.
Is prime. This means that PCR amplifies nucleic acid molecules, especially DNA.
This is important, is this DNA a host-derived sample?
It is produced from mRNA isolated from such an mRNA. Specific Example of RT-PCR Diagnostic Assay
Relates to taking a sample from a host tissue. That
Samples from tissues other than the colon, such as blood
Would be. Therefore, examples of such diagnostic assays
Contains a whole blood gradient isolation of nucleated cells
(Whole gradient isolation), total RNA extraction, total RN
A-Agarose gel electrophoresis of RT-PCR and PCR products of A
Includes electrophoresis. The PCR product is a colon-specific
CDNA complementary to RNA transcribed from the gene or
Including its fragment. More specifically, blood samples
And then combine the whole blood with an equal volume of phosphate buffered saline
Mix and centrifuge, then the lymphocyte and granule cell layers
Carefully aerate and then dilute again in phosphate buffered saline
And centrifuge again. Discard supernatant, then contain nucleated cells
Pellet the RN Zor as described in the manufacturer's instructions.
Used for RNA extraction using the method
STINK, (Tel-Test Inc.), Friendswood
(Friendswood), Texas). Oligonucleotide primers and pro
Prepared with very high specificity for the DNA sequence of the present invention
I do. The probe is at least 10 base pairs in length.
50 base pairs, preferably at least 30 base pairs
May be longer or longer. Reverse transcriptase reaction
And the PCR amplification is subsequently carried out without interruption. Taq polymer
Is used during the PCR to concentrate the PCR product and then
The whole sample was subjected to Tris-Ho containing ethidium bromide.
Run on an acid-EDTA agarose gel. According to another aspect of the present invention, for example, colon cancer
Biological samples from tissues other than colon that cause colonic disorders
Changes in the level of a colon-specific polypeptide of the invention during
Were determined. Elevated levels of colon-specific genes of the present invention
Active transcription and expression of the corresponding colon-specific gene product
Is shown. Colon-specific gene poly in host-derived samples
The assay used to detect peptide levels was
Well known to those skilled in the art, radioimmunoassays, competition
Binding assay, Western blot analysis, ELISA
Assays and "sandwich" assays. Creature
Biological samples include, but are not limited to:
Contains tissue extracts, cell samples or biological fluids
However, according to the present invention, the biological sample is
Or, it does not specifically contain cells. ELISA assay (Coliga
n) et al.Current Protocols in Immunology, 1 (2),
Chapter 6, 1991) first describes the colon-specific polypeptides of the present invention.
Antibodies specific for peptides, preferably monoclonal antibodies
And preparing Furthermore, the reporter antibody is
Prepared against noclonal antibodies. Reporter antibody
Include radioactivity, fluorescence, or, in this example, horseradish
With a detectable reagent such as
You. The sample is removed from the host, e.g.,
A polystyrene dish that binds proteins in the sample
Incubate on any solid support. Any on the dish
Free protein binding sites, such as BSA
Incubation with non-specific proteins
Cover. Next, the monoclonal antibody is incubated in the dish.
Bait, during which the colon bound to a polystyrene dish
The monoclonal antibody binds to the specific polypeptide.
Rinse all unbound monoclonal antibodies with buffer
You. Reporter bound to horseradish peroxidase
When the antibody is placed on the dish, it becomes a colon-specific gene polypeptide.
Reporter antibody to any bound monoclonal antibody
Join. Wash off unbound reporter antibody.
The peroxidase substrate is then added to the dish, and then
When comparing the amount of color development over time against the standard curve,
Colon-specific polypep present in a given volume of sample
The amount of tide is measured. [0036] Competition assays may be used, in which case
An antibody specific for an intestine-specific polypeptide is attached to a solid support.
Combine. The colon-specific polypeptide is then labeled and labeled.
The polypeptide and host-derived sample
After passing through the support, the amount of detected label is
The sample was analyzed by
Can be correlated to the amount of colon-specific polypeptide in
Wear. "Sandwich" assay is an ELISA assay
Is the same as Colon-specific in "sandwich" assays
Target polypeptide through the solid support and onto the solid support.
Binds to the bound antibody. Second antibody then colon specific
Attached to the polypeptide. Labeled second antibody
A third antibody that is specific for
To bind to the second antibody and then quantify the amount.
it can. In another alternative, the colon specific polypeptide
Use the labeled antibody against. For one-step assays
If the target molecule is present,
And incubate with the labeled antibody. Sign
The antibody thus bound binds to the immobilized target molecule. Wash unbound molecules
After purification and removal, the sample is assayed for the presence of the label.
I will do it. In a two-step assay, the immobilized
Incubate the target molecule with the unlabeled antibody. That
The target molecule-labeled antibody complex, if present,
If so, then a second labeled, specific for unlabeled antibody
Binds to the antibody. The sample is washed and the presence of the label
Assay. The marker used to label the antibody
The choice will vary depending on the application. However,
The choice of marker can be readily determined by one skilled in the art. these
The labeled antibody was immunoassayed and
In histological applications to detect the presence of parkin
used. The labeled antibody can be polyclonal or
It is monoclonal. Colon-specific in cells other than the colon
Level of gene mRNA, cDNA or expression product
More active transcripts than normally found due to the presence of the change
Is that colon cancer cells move from the colon into the systemic circulation
Is an important indicator of the presence of colon cancer with metastases. Follow
Therefore, this phenomenon is a method of treating tumors that are localized to metastases.
Are quite different and have important clinical implications. The above assay is also preserved prior to chemotherapy.
Bone marrow is contaminated with colon cancer cell micrometastases
May be used to test for The assay
Blood cells from the bone marrow are isolated and then
The stored bone marrow is treated by chemotherapy with this method.
Can determine if it is still suitable for post-transplant transplantation
Noh. For example, colon specific such as monoclonal antibodies
Antibodies specific for the target polypeptide also include, for example, colon cancer
Interacting drugs that destroy cells when they come in contact with cells
Targeting colon cancer cells in a method of targeting
It may be used to do so. This is because the antibody is mainly expressed in the colon
True because it is specific for a colon-specific polypeptide
is there. Binding of the interacting agent to the antibody binds the interacting agent.
Will bring directly to the intestine. This type of antibody is also used in vivo
Used to perform
Labeling antibodies to facilitate colon scans
Done by One method of imaging includes
A marker that can detect any cancer cells in the colon to be imaged
With anti-colon-specific protein antibodies labeled with
Including The method is based on the fact that the labeled antibody is
Performed under conditions that bind to the gut-specific polypeptide.
You. In a specific example, the antibody is a colon, e.g., a colon cancer.
Interacts with cells and such contact causes colonic image
Enhanced aging and visualization to reduce colon morbidity
Or fluoresces to allow determination of unaffected states
You. The present invention further relates to FIGS. 1 to 3 (SEQ ID NO:
C having the deduced amino acid sequence of 2) or deposited
Colonic colony having an amino acid sequence encoded by DNA
Heterologous polypeptides, and also such polypeptides
For fragments, analogs and derivatives of
I do. 1 to 3 (SEQ ID NO: 2)
Is the polypeptide encoded by the deposited cDNA
Indicates the “fragment”, “derivative” and
The term "nalog" refers to such a polypeptide and its essence.
That retain the same biological function or activity
Means tide. Therefore, analog has no
Activated by cleavage of the active site
Includes protein capable of producing
I will. The polypeptide of the present invention is a recombinant polypeptide.
Tide, natural or synthetic polypeptides, preferably
Alternatively, it may be a recombinant polypeptide. 1 to 3
Polypeptide of (SEQ ID NO: 2) or deposited cD
A fragment of the polypeptide encoded by NA;
The derivative or analog may comprise (i) one or more
Amino acid residues are homologous or non-homologous amino acid residues (preferably
Or the same type of amino acid residue)
Such substituted amino acid residues are encoded by the genetic code
Or not coded
(Ii) one or more amino acid residues
A group containing a substituent, or (iii) the polypeptide
Compounds wherein the tide increases the half-life of the polypeptide
(E.g., polyethylene glycol)
(Iv) leader or
Used for purification of secretory sequences or mature polypeptides
Sequences, or additional, such as protein sequences
Target amino acid can be one fused to the polypeptide
You. Such fragments, derivatives and analogs
Is believed to be within the purview of those skilled in the art from the teachings herein.
It is. Polypeptides and Polynucleotides of the Invention
The tide is preferably provided in an isolated form, preferably
Alternatively, it is purified to homogeneity. "Isolated"
The term refers to the fact that a substance is in its original environment (e.g.,
If present in the natural environment)
Means For example, naturally occurring organisms found in living animals
The polynucleotide or polypeptide has not been isolated
But some or all of the coexisting substances in the natural system
The same polynucleotide or polypeptide isolated from
Has been isolated. Such polynucleotides are
And / or may be part of such a
The nucleotide or polypeptide becomes part of the composition
Obtained, and such a vector or composition
It is still isolated in that it is not part of the environment. The polypeptide of the present invention is shown in FIGS.
No. 2) and the polypeptide of SEQ ID No. 2
At least 70% similarity (preferably less
At least 70% identity) and more preferably at least
Also 90% similarity (more preferably at least 90% similarity)
Identity) and even more preferably 95%
Similarity (even more preferably, at least 95%
A) the polypeptide having
Such polypeptides also include portions of the polypeptides.
Is generally at least 30 amino acids and more
Preferably it contains at least 50 amino acids. As is known in the art
In turn, the "similarity" between two polypeptides is one
Amino acid sequence of the polypeptide and its conserved amino acids
Comparing the acid substituent to the sequence of the second polypeptide
Is determined by Flag of the polypeptide of the present invention
Or part of the corresponding complete
May be used to prepare long polypeptides;
The fragment produces a full-length polypeptide.
May be used as intermediates. Polynucle of the present invention
Otide fragments or portions may be used as the full-length polypeptides of the invention.
It may be used to synthesize oligonucleotides. The present invention also relates to the polynucleotide of the present invention.
Genetically engineered with the vector of the present invention
Host cells, and recombinant polypeptides of the invention
It also relates to manufacturing by technology. The host cell may be, for example,
The present invention, which can be a training vector or an expression vector
Genetically engineered with a vector (transduced
Or transformed or transfected
). The vector may be, for example, a plasmid, a virus particle,
It may be in the form of offspring, phages, etc. Engineered host cells
Activates the promoter and transformants
Suitable for selecting or amplifying colon-specific genes
Can be cultured in conventional nutrient media that has been modified
You. Culture conditions such as temperature, pH, etc.
The culture conditions previously used for the selected host cells,
It will be apparent to those skilled in the art. The polynucleotide of the present invention is a polypeptide
Can be used to produce
You. Thus, for example, the polynucleotide is
Any one of various expression vectors for expressing the tide
One can be included. Such vectors include:
Chromosomal, non-chromosomal and synthetic DNA sequences, eg, SV
40 derivatives; bacterial plasmids; phage DNA;
Urovirus; yeast plasmid; plasmid and phage
A vector obtained from combination with DNA; vaccinia;
Adenovirus, fowlpox virus, pseudorabies
Virus DNA. But any other
Vectors are also viable and replicable in the host.
It can be used as long as it can. The appropriate DNA sequence can be vectorized by various methods.
Can be inserted into the Generally, the DNA sequence
Appropriate restriction endonucleases by methods known in the art
Insert into the site. Such and other methods are
It is believed to be within the skill of the art. Expression Vector DN
The A sequence is activated by an appropriate expression control sequence (promoter).
Ligate and perform mRNA synthesis. Such a promo
Typical examples of the data include: LT
R or SV40 promoter, E. coli (E. FIG. coli),la
cOrtrpA phage lambda PL promoter, and
Inheritance in prokaryotic or eukaryotic cells or their viruses
Other promoters known to control offspring expression
- The expression vector also contains ribosomes for translation initiation.
It also includes the binding site and transcription termination. The vector also comprises
Sequences suitable for amplifying expression may also be included. Further, the expression vector is used for eukaryotic cell culture.
Dihydrofolate reductase or neomycin if appropriate
Such as resistance, or tetracycline in E. coli
Transformed, such as
To provide phenotypic characteristics for selection of isolated host cells
And one or more selectable marker genes
It is preferred to include. A suitable DNA sequence as described above,
They also include appropriate promoter or control sequences.
The vector is used to transform a suitable host.
To enable the host to express the protein.
Can be. Representative examples of suitable hosts include:
Examples include: E. coli, Streptomyces (Streptomyc
es), Salmonella typhimurium (Salmonella typ
himuriumBacterial cells such as yeast; fungi such as yeast
cell;Drosophila S2andSpodoptera Sf9Saying
Insect cells such as CHO, COS or Bowes melano
Animal cells; adenovirus; plant cells
Vesicles. Selection of the appropriate host is well-known in the art based on the teachings herein.
It seems to be within the range of the person. In particular, the present invention has also been broadly described above.
Also includes recombinant constructs containing one or more of the following sequences:
It is. The construct is a sequence according to the invention in a forward or reverse orientation.
With the inserted plasmid or viral vector
Such vectors are included. Preferred of this embodiment
In embodiments, the construct is further operable, for example, with the sequence.
It contains control sequences, including a promoter associated with the promoter. Suitable
Many suitable vectors and promoters are known to those skilled in the art.
And are commercially available. Using the following vector as an example
I will. For bacteria: pQE70, pQE60, pQE-9
(Qiagen), pBS, pD10, phage
Script (phagescript), psiX174, pbluescrip
tSK, pBSKS, pNH8A, pNH16a, pNH1
8A, pNH46A (Stratagen
e)); pTRC99a, pKK223-3, pKK233
-3, pDR540, pRIT5 (Pharmacia (Pharm
acia)). For eukaryotes: pWLNEO, pSV2CAT,
pOG44, pXT1, pSG (Stratagene), pSV
K3, pBPV, pMSG, pSVL (Pharmacia).
However, any other plasmid or vector
As long as they are replicable and viable in the host.
Can be used. The promoter region is CAT (chloramph
Enicol transferase) vector or selectable
Using another vector with a functional marker,
Can be selected from the desired genes. Two suitable
Vectors are PKK232-8 and PCM7.
You. Individually named bacterial promoters include lac
I, lacZ, T3, T7, gpt, lambda P_R, P_LAnd tr
p is included. Eukaryotic promoters include immediate early CMV (i
mmediate early), HSV thymidine kinase, early and
And late SV40, an LTR derived from a retrovirus, and
Includes mouse metallothionein-I. Suitable vector
Selection of the promoter and promoter is well determined by those skilled in the art.
Within the range of In a further aspect, the present invention relates to the above construction
Host cell containing the product. The host cell is a mammal
Higher eukaryotes such as cells, lower eukaryotes such as yeast cells
The cell may be a cell, or the host cell may be a bacterial cell.
Prokaryotic cells. Introduction of the construct into the host cell
Calcium phosphate transfection, DEAE Deki
Strand-mediated transfection or electroporation
It can be done by a translation. (Davis (Dav
is, L.), Dibner (M.), Battie
(Battey, I.), Basic Methods in More
Curative Biology (Basic Methods in Molecu)
lar Biology) (1986)). The construct in the host cell is used in a conventional manner.
To produce the gene product encoded by the recombinant sequence.
Can be Alternatively, a polypeptide of the invention
Can be produced synthetically using a conventional peptide synthesizer.
Can be. The protein is controlled by the appropriate promoter
Under mammalian cells, yeast, bacteria, or other cells
Can be manifested. Such a protein
Manufactured using RNA obtained from light DNA constructs
To this end, a cell-free translation system can also be used. original
Clonin suitable for use in nuclear and eukaryotic hosts
And expression vectors are available from Sambrook.
Et al., Molecular Cloning
g): A Laboratory Manual (A Laboratory)
Manual), 2nd edition, Cold Spring Harbor
(Cold Spring Harbor), New York, (198
9), the disclosure of which is incorporated herein by reference.
Make up the part. DNA encoding the polypeptide of the present invention
Transcription by higher eukaryotes vectors enhancer sequences
Increased by insertion into The enhancer is
Acts on a promoter to increase its transcription, usually
It is a cis-acting element of DNA of about 10-300 bp.
Examples include bp 100-270 on the late side of the replication origin.
SV40 enhancer, cytomegalovirus early stage
Motor enhancer, poly on late side of replication origin
Oma enhancer and adenovirus enhancer
Is included. Usually, the recombinant expression vector contains a replication origin.
Point and selectable to allow transformation of host cells
Markers such as the ampicillin resistance gene of E. coli
And Saccharomyces cerevisiae (S. cerevisiae) T
Causes transcription of the RP1 gene and downstream structural sequences
Derived from highly expressed genes for
Will be included. Such promoters are
In other words, 3-phosphoglycerate kinase (PGK)
Glycolytic enzymes, α-factors, acid phosphatases,
Or an operon that encodes a heat shock protein, etc.
Can be obtained from The heterologous structural sequence is
Constructed in appropriate phase, with start and stop sequences
It is. In some cases, the heterologous arrangement may have the desired characteristics.
For example, stabilization or purification of the expressed recombinant product
Including N-Terminal Identification Peptide That Gives Simplification
Can encode a protein. Expression vectors useful for use in bacteria
Is a structural DNA sequence encoding a desired protein,
A functional protocol with appropriate translation initiation and termination signals
Insert into the operable leading phase with the motor
It is built by doing. The vector is a vector
To ensure maintenance and, if desired, the host
One or more expressions to provide amplification within
Includes type selectable markers and origin of replication
U. Suitable prokaryotic hosts for transformation include E. coli, Bacillus
・ Sachiris (Bacillus subtilis), Salmonella Thi
Fimurium and pseudomonas (Pseudomona
sGenus, Streptomyces, and staphylococci
Cass (StaphylococcusA) contains various species within the genus
However, others may also be used as selective substances.
it can. As a representative, but non-limiting example,
Useful vectors for use in fungi are well-known clones.
Vector pBR322 (ATCC 3701)
7) obtained from a commercially available plasmid containing the genetic element of
It may include a selectable marker and a bacterial origin of replication.
Such commercially available vectors include, for example, pKK223
-3 (Pharmacia Fine Chemicals (Pharmac)
ia Fine Chemicals), Uppsala, Su
Eden) and GEM1 (Promega Biotech (P
romega Biotec), Madison, Wisconsin, rice
Country). These pBR322 "bone nuclei"
Appropriate promoter and pair with structural sequence to be expressed
Combine. Transformation of an appropriate host strain,
After growing the cells to the appropriate cell density, the selected promoter
The heater is applied in a suitable manner (eg, temperature shift or
The cells are cultured for an additional period. Fine
The vesicles are typically collected by centrifugation and
Is destroyed by chemical methods and the resulting crude
The extract is retained for further purification. Departure of protein
The currently used microbial cells are freeze-thaw cycles, ultra-thin
Including sonication, mechanical disruption, or use of cell lysing agents
And can be destroyed in any convenient way.
Various methods are well known to those skilled in the art. To express the recombinant protein,
Various mammalian cell culture systems can also be used.
Examples of mammalian expression systems include Gluzman, C
ell, 23: 175 (1981).
, Monkey kidney fibroblast COS-7 line, and adaptation
Other cell lines capable of expressing possible vectors,
For example, C127, 3T3, CHO, HeLa and BH
K cell lines are included. Mammalian expression vectors
Spots, suitable promoters and enhancers, no
Necessary ribosome binding site, polyadenylation site
Position, splice donor and acceptor sites, transcription termination
And the non-transcribed sequence adjacent to the 5 '
There will be. DNA obtained from SV40 splicing
Using sequence, and polyadenylation sites,
Non-transcribed genetic elements can be provided. The polypeptide of the colon-specific gene is sulfate
Ammonium or ethanol precipitation, acid extraction, anion
Or cation exchange chromatography, phosphocellulo
Chromatography, hydrophobic interaction chromatography
Fee, affinity chromatography, hydroxy
Silapatite chromatography and lecting
Recombinant cell culture can be performed by methods that include
It can be recovered from nutrients and purified. As needed
The regeneration process of the protein
Can be used to complete the installation. Finally, high sex
Liquid chromatography (HPLC) as the final purification step
Can be used for The polynucleotide of the present invention comprises the polynucleotide of the present invention.
Infection with a marker sequence that allows for purification of the repeptide
It may have the coding sequence fused at the frame. Bacteria inn
In the main case, the example of the marker sequence is
Vectors for providing purification of combined polypeptides
Preferably the hexagon provided by the pQE-9 vector
-A histidine tag, or a mammalian host, e.g.
For example, when COS-7 cells are used, their markers
The sequence may be a hemagglutinin (HA) tag. HA TA
Obtained from influenza hemagglutinin protein
(Wilson, I.)
Et al., Cell, 37: 767 (1984)). The polypeptide of the present invention can be purified naturally.
Product of a chemical synthesis method, or
From a prokaryotic or eukaryotic host (eg,
By fungi, yeast, higher plants, insects and mammalian cells.
T) can be produced by recombinant techniques. Recombinant
The polypeptide of the present invention depends on the host used in the production method.
Can be glycosylated or glucosylated
I can't get it. The polypeptides of the present invention may also include a first methionine.
Nin amino acid residues may be included. According to another aspect of the present invention, there is provided a colon characteristic of the present invention.
Inhibits the action of foreign genes or colon-specific proteins
Provide assays that can be used to screen for therapeutic agents
Offer. One assay is a reducer for these proteins.
Use the function. The present invention suppresses its biological effects.
Colon-specific lesions with sufficient affinity to control
Selecting therapeutic agents that form a complex with the gene
Disclose the law. The method includes a variety of assays.
Are immobilized on a support and in contact with natural substrates
Touch and label the therapeutic agent simultaneously or sequentially.
The therapeutic agent then binds the protein to its substrate.
Effectively competes with natural substrates in a manner sufficient to interfere
Competition assays to determine whether to do so. According to another embodiment, the substrate is immobilized on a support.
And then labeled colon-specific polypeptide and treatment
Agent (or unlabeled protein and labeled
Therapeutic agent), and then binds to the substrate.
Intestinal-specific polypeptide levels were measured without therapeutic agents.
Determine if it is decreasing compared to in
You. The colon-specific polypeptide is labeled with an antibody
Good. Another example of such a screening assay is
Mammal expressing a colon-specific polypeptide of the invention
For simultaneous oxidation and reduction of target cells or membrane preparations
Elements, for example hydrogen and oxygen, which together form water
(At this time, hydrogen is labeled with radioactivity, such as tritium.
Compounds to be screened
Reaction in which hydrogen and oxygen form water in the presence of hydrogen
Incubate under favorable conditions. Then this phase
The ability of the compound to inhibit the interaction is measured. The present invention relates to a receptor for the polypeptide of the present invention.
An identification method is provided. The gene encoding the receptor is
Numerous methods known to those skilled in the art, such as ligand panning
And FACS sorting (Coligan)
Et al., Current Protocols in Immun (Curre
nt Protocols in Immun. ), 1 (2), Chapter 5,
(1991)). Like
Alternatively, use expression cloning,
RNA is prepared from cells responsive to the polypeptide.
CDNA and a cDNA library created from this RNA.
The rally is divided into pools and COS cells or the polypeptide
Transfect other cells that are not responsive to
Use for Tran grown on glass slides
Exposing the transfected cells to the labeled polypeptide
You. The polypeptide may be iodinated or site-specific.
Diverse techniques, including including the recognition site for thetin kinase
It can be labeled by a step. Fixation and incubation
Slides after autoradiography
Perform analysis. Identify the positive pool and then subpool
Prepared, then the interactive sub-pools and
Re-transfect using the leaning method,
Eventually produces a single clone encoding the putative receptor
You. As an alternative to receptor identification, labeling
Extracted polypeptide expressing cell membrane or receptor molecule
The resulting preparation can be photoaffinity bound. Crosslinked
The material was separated by PAGE analysis and then
Exposed. A labeled complex containing a receptor for the polypeptide;
The coalescence is excised, separated into peptide fragments, and
Subject to protein microsequencing. micro
Determining the amino acid sequence obtained from sequencing
CDNA library to identify coding genes
Oligonucleotides for Screening DNA
Used to design sets of probe probes. Further, the colon-specific gene of the present invention and
Gene products are growth regulator agonists
Wherein the antagonist of the polypeptide is the polypeptide
To be screened with membrane preparations containing the receptor for
Combining compounds to determine the production of a signal from the receptor
Can be determined by an assay that includes determining
You. When determining antagonists, the polypeptides of the invention
Is added to the assay, and compounds that compete with the receptor site
Ability (ie, lack of production of signal from receptor)
Can then be determined. Possible colonic features
Examples of antagonists to the heterologous polypeptide include
Antibodies that bind to polypeptides, and anti-idio as described above
Type antibodies, and in some cases oligonucleotides
Is included. [0069] Another potential antagonist is
Also involved in colon-specific polynucleotides that interfere with transcription.
Antisense prepared by using antisense technology
Sense constructs are also included. Using antisense technology,
Triple helix formation or antisense DNA or RN
A. The gene expression can be controlled by A.
To both polynucleotide DNA or RNA
Based on the combination of For example, the mature polypeptide of the invention
Encoding, 5 'coding of a polynucleotide sequence
Using the moiety, an antisense of about 10-40 base pairs in length
Design a siRNA oligonucleotide. DNA oligo
Nucleotides correspond to gene regions involved in transcription.
Designed to be complementary (triple helix-Lee et al.,
Nucl. Acids Res., 6: 3073 (1979);
Cooney et al., Science, 241: 456 (19
88); and Dervan et al., Science, 2
51: 1360 (1991)).
Prevents the production of transcription and colon-specific polynucleotides
I'm sorry. Antisense RNA oligonucleotides
Hybridize to the mRNA in vivo,
Block translation of molecules into colon-specific gene polypeptides
(Antisense-Okano, J. Neuroch
em., 56: 560 (1991); oligodeoxynuc
Leoch's as Antisense Inhibitors of
・ Gene Expression (Oligodeoxynucleotid
es as Antisense Inhibitors of Gene Expressio
n), CRC Press, Boca Leighton
(Boca Raton), Florida (1988)). The above e
Since oligonucleotides are also delivered to cells,
Release antisense RNA or DNA in vivo
To inhibit the production of colon-specific polypeptides.
Can be. [0070] Potential antagonists also include
Binds and occupies the active site of the gut-specific peptide,
Substrates that interfere with normal biological activity
Includes small molecules that make them inaccessible. Examples of small molecules
Include, but are not limited to, small peptides
Alternatively, peptide-like molecules are included. The antagonist
Sufficient to suppress the natural functions required for colon cancer cell survival
Function and interaction of colon-specific polypeptides in a straightforward manner
It is used to treat colon cancer. The antago
Nist, for example, pharmaceutically acceptable as described below
May be used in compositions with a potential carrier. The polypeptide of the present invention and antagonis
Must be used in combination with a suitable pharmaceutical carrier.
Can be. Such compositions comprise a therapeutically effective amount of the po
Repeptide or antagonist and pharmaceutically acceptable
Carrier or excipient. Such carriers include:
Saline, buffered, but not limited to
Saline, dextrose, water, glycerol, eta
Knol, and combinations thereof. Made of that
The agent should suit the mode of administration. The invention also relates to a book
One or more ingredients of the pharmaceutical composition of the invention
A pharmaceutical pack containing one or more containers;
Also provides kits. Pharmaceuticals in connection with such containers
Regulate the production, use or sale of biological or biological products
Notices in the form prescribed by the government authorities
This notice does not cover production, use or administration for human administration.
Indicates the approval of the sales office by the relevant office. Further, the medicament
The composition can be used with other therapeutic compounds
You. The pharmaceutical composition may be administered orally, topically, intravenously,
Intracavity, intramuscular, subcutaneous, intranasal, intraanal or intradermal route
Such can be administered in any convenient manner. The
Pharmaceutical compositions may treat and / or prevent specific symptoms
Is administered in an amount effective to do so. In general, they
At least about 10 μg / kg (body weight)
In other cases, they exceed about 8 mg / kg (body weight) per day.
Will be administered in unpredictable amounts. Most often dosing
Taking into account the route and symptoms, etc., the dosage is about 1
0 μg / kg to about 1 mg / kg (body weight). Colon-specific gene polypeptide, polypep
Agonists and antagonists which are also
Such poly, often called "gene therapy"
The expression of the peptide in vivo allows the
May be used. Thus, for example, cells from a patient
And ex vivo polypeptides
Manipulate with the encoding polynucleotide (DNA or RNA)
After treatment, the patient whose engineered cells are to be treated with the peptide
Give to. Such methods are well known in the art.
Have been. For example, encoding a polypeptide of the invention
By using retroviral particles containing RNA, cells
Operating in a manner well known in the art.
Can be. Similarly, for example, those known in the art
The expression of the polypeptide in vivo.
Cells can be manipulated in vivo
You. As is known in the art, cells are
Manipulate polypeptides in vivo
To express the polypeptide of the present invention.
To produce retroviral particles containing RNA to be loaded
Producer cells can be administered to patients
You. Administering the polypeptide of the present invention by such a method
These and other methods for performing
It will be apparent to those skilled in the art from the illustration. For example, manipulate cells
Expression vehicles for use other than retroviruses,
For example, after combining with a suitable delivery vehicle, the cells are
Can be used to operate in vivo
Adenovirus. The retroviral plasmid vector is
The retroviruses derived are not limited to the following:
But Moloney mouse leukemia virus, spleen necrosis virus
Viruses, retroviruses such as Rous sarcoma virus, c
-Bay sarcoma virus, avian leukemia virus, gibbon
Leukemia virus, human immunodeficiency virus, adenovirus
, Myeloproliferative sarcoma virus and breast cancer virus.
In one embodiment, a retroviral plasmid vector
Is obtained from Moloney murine leukemia virus. The vector may comprise one or more promoters.
Data included. To a suitable promoter that may be used
Are, but are not limited to, retroviruses
LTR; SV40 promoter; and Miller
r) et al.BiotechniquesVol. 7, No. 9,980-
990 (1989).
(CMV) promoter or other promoter
(For example, but not limited to, histone, po
Eukaryote containing lIII and β-actin promoter
Cell promoters such as cell promoters)
You. Other viral promoters that may be used include:
Adenovirus promoter, including but not limited to
Thymidine kinase (TK) promoter and B19
Includes parvovirus promoter. The right promoter
The choice of key will be apparent to those skilled in the art from the teachings herein.
There will be. Nucleic acid sequence encoding the polypeptide of the present invention
The rows are under the control of a suitable promoter. Be used
Suitable promoters include, but are not limited to:
However, the adenovirus major late promoter (major la
te promoter) or other adenovirus promoters;
Or cytomegalovirus (CMV) promoter
Heterologous promoter; respiratory syncytial virus (RSV)
Promoter: MMT promoter, metallothionein
An inducible promoter, such as a promoter;
Promoter; albumin promoter; ApoAI promoter
Motor; human globulin promoter; herpes simplex
Virus thymidine such as the thymidine kinase promoter
Kinase promoter; retroviral LTRs (top
The modified retroviral LTRs described above);
Kuching promoter; and human growth hormone promoter
Included. The promoter may also be a polypeptide.
Is the original promoter that regulates the gene that encodes
May be. The retroviral plasmid vector is a professional
Packaging cell lines to form producer cell lines
May be used to transduce. Troff
Examples of packaging cells that may be used include:
, But not limited to PE501, PA317,
2, ψ-AM, PA12, T19-14X, VT-19
-17-H2, $ CRE, $ CRIP, GP + E-8
6, including GP + envAm12 and DAN cell lines
(mirror,Human Gene TherapyVol. 1, pages 5-14
(Described in (1990)) (the contents of which are incorporated herein by reference).
Use). The vector may be any of those known in the art.
Transduce the packaging cells by the method.
Such methods include, but are not limited to,
Tropoporation, use of liposomes, CaPO_FourSinking
Includes descending. In one alternative, the retrovirus
Rasmid vector encapsulated in liposome
Or combined with lipids and then administered to the host
May be. The producer cell line is the polypeptide
Retroviral vector containing a nucleic acid sequence encoding
Produce tar particles. Such retrovirus vector
-Particles, whether in vitro or in vivo, are eukaryotic
May be used to transduce the cells. Tiger
Induced eukaryotic cells encode the polypeptide.
The nucleic acid sequence to be expressed. Transduce
Eukaryotic cells that may be used include, but are not limited to:
But not fetal stem cells, fetal cancer cells, and hematopoietic stem cells
Vesicle, hepatocyte, fibroblast, myoblast B, keratinocyte
And endothelial cells and bronchial epithelial cells. The present invention also provides a colon of the present invention for diagnostic use.
It also relates to using specific genes. For example, how many
The disease results from a genetically defective gene. Colon of the present invention
Specific genes are overexpressed in colon cancer. DN
The colon-specific gene of the present invention at the A level can be
Can be detected. Diagnostic nucleic acids (genomic DNA, m
RNA, etc.) from cells other than the patient's colon, for example,
Obtained from blood, urine, saliva, tissue biopsy and autopsy material
It is. Genomic DNA may be used directly for detection,
PCR (Saiki et al.,Nature, 324:
163-166 (1986)).
Is also good. For similar purposes, RNA or cDNA is also
May be used. As an example, complementary to a nucleic acid of the invention
The PCR primer is a colon-specific polynucleotide of the present invention.
Can be used to identify and analyze mutations in the code.
For example, deletions and insertions can be
Detection by changes in the size of the amplified product
Can be. Point mutations use amplified DNA
Colon-specific RNA or alternatively radiolabeled
Hybridized to the isolated antisense DNA sequence.
And can be identified by Specific segments of DNA after PCR amplification
Other well-established methods for screening mutations in
The method is single-stranded DNA conformational polymorphism (SSCP) analysis.
You. PCR products for SSCP³²P-dCTP
Amplify again for 10 cycles to incorporate, appropriate restriction
200-300 bp fragment digested with enzyme
And then denatured by heating to 85 ° C. for 5 minutes,
Manufactured by pouring on ice. Then turn off electrophoresis.
In denaturing gel (5% glycerol, 5% acrylamide)
(Glavac, D.) and Dean
(Dean, M.), Human Mutation, 2: 404-41.
4 (1993)). Sequence differences between the reference gene and the “variant”
Revealed by direct DNA sequencing method
To be. In addition, the cloned DNA segment
Can be used as probes to detect specific DNA segments
Can be used. The sensitivity of this method is combined with PCR
It is greatly increased when combined. For example, sequencing
Primers can be used for double-stranded PCR products or modified PCR
Used with single-stranded template molecules produced from. Arrangement
Can be determined using conventional procedures with radiolabeled nucleotides or
Performed by automated sequencing procedures with fluorescent tags
It is. Genetic testing based on DNA sequence differences
DN in gels with or without denaturing agents
Detection of change in electrophoretic mobility of A fragment
Done by High deletions and insertions of small sequences
Visualization by high resolution gel electrophoresis
Can be DNA fragments of different sequences
Separate DNA fragments have their specific melting points or
Decelerated in gel at discrete locations according to partial melting point
May be distinguished on denaturing formamide gradient gels (eg.
For example, Myers et al.Science230: 12
42 (1985)). In addition, sequence changes, especially small
In the case of deletion, changes in the pattern of DNA migration
May be detected. Sequence changes at specific positions may also
And S1 protection or chemical cleavage methods (eg,
Cotton et al.PNAS USA, 85: 4397
-4401 (1985)).
May be revealed by Say. Therefore, the specific D
Detection of NA sequence includes hybridization, RN
Enzyme protection, chemical cleavage, direct DNA sequencing or
Indicates the use of restriction enzymes (eg, restriction fragment length polymorphism)
(RFLP)) and Southern blots of genomic DNA.
Any method may be used. The sequences of the present invention are also useful for chromosome identification.
It is. The sequence is assigned to a specific position on each human chromosome.
To specifically target and hybridize
it can. In addition, we now identify specific sites on the chromosome
There is a need to. Based on actual sequence data (repeated polymorphism)
Chromosome marking reagents that
Hardly available to use. DN according to the invention
A mapping to chromosomes maps their sequences to disease-related
This is an important first step in linking genes. [0086] Briefly, PCR primers from cDNA
To prepare an immermer (preferably 15-25 bp)
Thus, sequences can be mapped to chromosomes.
Using computer analysis of the 3 'untranslated region,
Ply that does not span more than one exon in DNA
The complexity of the amplification process by rapidly selecting
And These primers are then used for individual human staining.
PCR screening of somatic cell hybrids containing chromosomes
Used for C containing the human gene corresponding to the primer
Only hybrids give amplified fragments
There will be. PCR mapping of somatic cell hybrids
Is a quick way to assign specific DNA to specific chromosomes.
It is a quick method. The same oligonucleotide primer
Utilizing the invention with sublocalization
Is a pool of specific chromosomes or large genomic clones.
Similar method using a panel of fragments from
Can be achieved. To map to that chromosome
Other mapping methods that can be used as well include:
In situ hybridization, labeling flow
-Press using sorted (flow-sorted) chromosomes
Cleaning and chromosome-specific cDNA libraries
By hybridization to construct
Includes selection. Metaphase chromosome spread of cDNA clones
(Spread) fluorescence in situ hybridization
One-step accurate chromosome location using FISH
Can be given by This technology uses 50 or 60 salt
It can be used for short cDNAs. This technique
For an overview of the art, see Verma et al.
Human Chromosomes: A Manual
・ Basic Technics (a Manual of Basi)
c Techniques, Pergamon Press
s), New York (1988). A sequence maps once to a precise chromosomal location
The genetic position of the sequence on the chromosome
Data. Such data is
For example, McZick (V. McKusick), Mendelia
Mendelian Inheri
tance in Man) (Jones Hopkins Universi
Te Welch Medical Library (Johns
Via Hopkins University Welch Medical Library
And available online). Then
Between a gene mapped to the same chromosomal region and the disease
Linkage analysis (co-inheritance of physically adjacent genes (co
inheritance)). Next, affected individuals and unaffected individuals
Differences in the cDNA or genomic sequence between
It is necessary. The mutation affects some or all of the affected individuals
But in any normal individual
If not, the mutation is disease-causing
It seems certain. Current physical and genetic mapping
Analysis of the ping technique revealed that the chromosomal region associated with the disease was correct.
Definitely localized cDNA accounts for 50-500
It could be one of the possible genes. (this
Is 1 megabase mapping analysis and 1 per 20 kb
Assume two genes). Polypeptides, their fragments
Or other derivatives or their analogs or
Using cells expressing these as immunogens,
Antibodies can be produced. These antibodies are
For example, polyclonal or monoclonal antibodies.
You can. The invention also includes chimeric, single chain, and humanized
Antibodies, and also Fab fragments, or Fab fragments
The products of the current library are also included. Public in the art
Various methods of knowing such antibodies and fragments
Can be used in the manufacture of The polypeptide corresponding to the sequence of the present invention
Antibody is injected directly into the animal
Alternatively, the polypeptide can be converted to an animal, preferably
Can be obtained by administering to non-human animals.
You. The antibody so obtained is then
Will bind to the peptide itself. This method uses poly
Even sequences that encode only peptide fragments,
To produce antibodies that bind whole native polypeptides
Can be used for Then use such an antibody.
From a tissue that expresses the polypeptide
The tide can be isolated. To prepare a monoclonal antibody, a continuous
Any technique that provides antibodies produced by an effective cell line culture
Surgery can be used. Examples include the hybridoma method
(Kohler and Milstein
in), 1975, Nature, 256: 495-497),
Trioma method, human B cell hybridoma method
(Kozbor et al., 1983, Immunology T
oday 4:72), and producing human monoclonal antibodies
EBV-hybridoma method (Cole)
Et al., 1985, Monoclonal Antibody A
Cancer Therapy (Monoclonal Antibodie)
s and Cancer Therapy), Alan Earl Lisse, Lee
Alan R. Liss, Inc., pages 77-96.
T) is included. Techniques described for the production of single chain antibodies
Surgery (U.S. Pat. No. 4,946,778) is an immunogen of the present invention.
For the production of single-chain antibodies to a soluble polypeptide product
Can fit. In addition, transgenic mice use antibodies
It may be used to produce. The antibody may also be, for example,
Interacting drugs that destroy intestinal cancer cells when contacted
Targeting colon cancer cells in a method of homing
It may be used to perform This is because the antibody is the result of the present invention.
This is true because it is specific for gut-specific polypeptides.
The binding of the interacting agent to the antibody will
Will transport directly. This type of antibody can also be used in vivo
Used to perform
Labeling antibodies to facilitate colon scans
Done by One method of imaging includes
A marker that can detect any cancer cells in the colon to be imaged
With anti-colon-specific protein antibodies labeled with
Including In this method, the labeled antibody is colon-specific
Under conditions that bind to the target polypeptide. Ingredient
In a specific example, the antibody binds to the colon, eg, colon cancer cells.
Interacting and so contacting, the colon imager
Enhanced visualization and visualization of the affected or unaffected colon
It fluoresces to allow determination of the disease state. [0096] The invention is further described with reference to the following examples.
However, the invention is limited to such embodiments.
It should be understood that it is not specified. All parts or quantities
Unless otherwise specified, the units are by weight. The following fruit
Some frequently appear to facilitate understanding of the examples
Methods and / or terms are described. "Plasmid"
Is a lowercase p preceded and / or followed by uppercase
And / or numbers. Starting plastic
Sumid is commercially available or under an unlimited base
Publicly available or entered via published methods
Can be constructed from accessible plasmids. In addition,
Plasmid equivalents are known in the art
And will be apparent to those skilled in the art. "Digestion" of DNA involves the substitution of certain sequences of DNA.
Demonstrates catalytic cleavage of DNA with a restriction enzyme that acts only
You. The various restriction enzymes used herein are commercially available
And their reaction conditions, cofactors and other requirements
Was used as known to those skilled in the art. For analysis purposes
Is typically 1 μg of plasmid in about 20 μl of buffer solution.
DNA or DNA fragment with about 2 units of enzyme
Use. DNA fragment for plasmid construction
For isolation purposes, DNA 5 is generally used in larger volumes.
Digest ~ 50 μg with 20-250 units of enzyme. specific
Buffers and substrate amounts appropriate for certain restriction enzymes are determined by the manufacturer.
Specified. Incubation at 37 ℃ for about 1 hour
Is usually used, but can be changed according to the supplier's instructions.
You may get. After digestion, the reaction is
Electrophoresis directly to isolate the desired fragment
You. The size separation of the cleaved fragments
Goeddel, D. et al., Nucleic Acids Res.,
8: 4057 (1980) 8%
This is performed using a polyacrylamide gel. "Oligonucle
Otides are single-stranded polynucleotides that can be chemically synthesized.
Rideoxynucleotides or two complementary polydeides
2 shows an oxynucleotide chain. Such synthetic oligonucleotides
Because nucleotides do not have a 5 'phosphate,
Without adding phosphoric acid with ATP in the presence of
Do not ligate to another oligonucleotide
There will be. Synthetic oligonucleotides are dephosphorylated
Will ligate to the missing fragment. "Ligation" refers to two double-stranded nucleic acids
A process that forms a phosphodiester bond between fragments
(Maniatis, T. et al., Ibid., 14)
6). Unless otherwise noted, ligation is
Almost equimolar amount of DNA fragment to be ligated
10 units of T4 DNA ligase per 0.5 μg of
With known buffers and conditions.
You can do it. Transformation unless otherwise specified
Are Graham, F. and Van der E.
Van der Eb, A., Virology, 52: 456.
457 (1973)
went. [0100]Example 1 Determination of transcription of colon-specific genes Presence or absence of an active transcript of colon-specific gene RNA
Approximately 6 ml of venous blood was heparinized to
Obtained by standard venipuncture technique using a closed tube. Equal volume of whole blood
Mix with phosphate buffered saline, then add 15 ml
Ficoll in ren tube (Pharmacia, Upsa
La, Sweden). The gradient
Centrifuge at 1800 × g for 20 minutes at 5 ° C. Lymphocyte cells
And carefully aerate the granulocyte layer (about 5 ml), then
Again in phosphate buffered saline to 50 ml in a 50 ml tube
Dilute and centrifuge at 1800 × g for 20 minutes at 5 ° C. The
Discard the supernatant and remove the pellet containing nucleated cells.
RNazole B method as described by the manufacturer
Used for RNA extraction (Tel-Testin)
(Tel-Test, Inc.), Friendswood (Friends)
wood), Texas). Determine the amount of mRNA from the gene of interest
The coding site of the probe is
MRN transcribed from a human gene containing DNA sequence 3
Designed to be identical to the A sequence. This probe is
Mixed with the released RNA, then mixed DNA and
RNA is ethanol precipitated at -70 ° C for 15 minutes. That
Resuspend pellet in hybridization buffer
And dissolved. Tube containing the mixture is heated at 72 ° C.
Incubate in water bath for 10-15 minutes.
Rapidly heat the tube to the desired hybridization temperature.
Transfer to a water bath. Hybridization temperature
The degree depends on the G┼C content of the DNA. Hybrida
The incubation is performed for 3 hours. 0.3 ml nuclease
-Add S1 buffer and mix well. 50 μl
4.0 M ammonium acetate and 0.1 M EDTA
In addition, the reaction is stopped. Phenol / c
Loroform extracted and 20 μg carrier t
Add RNA and precipitate with an equal volume of isopropanol. So
Was dissolved in 40 μl of TE (pH 7.4), and
Run on a Lucaria agarose gel. Following electrophoresis,
Microsequencing of RNA
Confirm the sequence (for a more detailed overview, see Fabololo (Fav
aloro, J.) et al., Methods Enzymol., 65: 718.
(1980)). Using two oligonucleotide primers
To amplify the sequence isolated by the above method. That
The 5 'primer is 20 nucleotides in length and the 3' primer
Is the complementary sequence at the 3 'end of the isolated mRNA.
You. Primers are prepared by a conventional method according to the isolated mRNA.
Designed. Continue the reverse transcriptase reaction and PCR amplification
And Perkin-Elmer 9600 PCR Machine (Emeribi
In Emeryville, California
I went there. 20 μl of diethyl pyrocarbonate treatment
400 ng of total RNA in purified water for 5 minutes in a 65 ° C. water bath
And then immediately cool on ice.
Added. A total PCR volume of 50 μl is 2.5 units of Taq
Limerase (Perkin Elmer), 2 units of avian bone marrow
Blastosis virus reverse transcriptase (Boehringer Mannheim,
(Boehringer Mannheim), Indianapolis, I
Indiana); 200 μM each of dCTP, dATP, dG
TP and dTTP (Perkin Elmer); 18 pM each
Primers, 10 mM Tris-HCl; 50 mM K
Cl; and 2 mM MgCl_Two(Perkin Elmer)
Become. The conditions for the PCR are as follows:
Vehicle 1 is at 42 ° C. for 15 minutes, then at 97 ° C. for 15 seconds (1
Cycle); cycle 2 is 95 ° C for 1 minute, 60 ° C for 1 minute
Then 30 seconds at 72 ° C. (15 cycles); cycle 3
95 ° C for 1 minute, 60 ° C for 1 minute, then 72 ° C for 1 minute (10
Cycle 4) Cycle 4 is 95 ° C for 1 minute, 60 ° C for 1 minute
Then at 72 ° C. for 2 minutes (8 cycles);
15 minutes (1 cycle);
Maintain at 4 ° C. until the pull is removed from the machine. Part 50
μl PCR product is concentrated to 10μl by vacuum centrifugation
The whole sample is then diluted with a thin plate containing ethidium bromide.
On a 1.2% Tris-borate-EDTA agarose gel
Flow at The band of the expected size is
Indicates that it is present in the sacrificed tissue. R in the pellet
The amount of NA is quantified in a number of ways, for example, by weight. Proof of the nucleotide sequence of the PCR product
It is performed by microsequencing. PCR production
The product should be purchased according to the manufacturer's instructions.
Alification Kit (Qiagen PCR Product)
Purification Kit) (Qiagen, Chatsworth (C
hatsworth, CA). The PCR
1 μg of the product is applied to Applied Biosystems
Biosystems) (Foster, California)
Perkin-Elmer 96 as described by a)
Taq Dideoxy Terminator in 00PCR Machine
Tar Cycle Sequencing Kit (Taq Dy
Using eDeoxy Terminator Cycle Sequencing Kit)
To perform PCR sequencing. The sequence
Product sent as described by the company.
Columns (Centri-Sep colums) (Princeton Sepa
Rations (Princeton Separations), Adelph
(Adelphia, New Jersey)
are doing. This product is then transferred to a Macintosh IIci con
ABI model 373A DNA system integrated with computer
Sequencing system (Applied Biosystems)
Analysis). [0105]Example 2 Bacterial expression and purification of colon-specific gene proteins and
Of monoclonal antibodies First, a DNA sequence encoding the polypeptide of the present invention
Column, ATCC Accession No. 97129, processing
Protein (without signal peptide sequence)
Corresponds to the 5 'end of the sequence and the 3' end of the vector sequence of that gene
Using PCR oligonucleotide primers
Width. Another nucleotide corresponding to the DNA sequence
Add to the 5 'and 3' sequences, respectively. 5 'oligonucleotid
Deprimer: GCAGGATCCTGGCTTCCAGAAGCATG (BAMHI) (SEQ ID NO: 3) shows that the sequence has, for example, a restriction enzyme site.
Followed by the putative terminal amino acid of the processing protein.
Contains the nucleotides of the coding sequence starting from
No. 3 'oligonucleotide primer sequence: TACGGGTACCTTGCTCTATGGTCGGTAC (ASP718) (SEQ ID NO: 4) is, for example, a sequence complementary to a restriction site.
Nucleic acid sequences, including and encoding proteins of interest
Followed by a nucleotide of The restriction enzyme site is, for example,
Bacterial expression vector pQE-32 (Qiagen, Inc.
(Jatsworth, California)
I do. pQE-32 is an antibiotic resistant (Ampr), bacterial
Origin of replication (ori), IPTG-regulatable promoter /
Operator (P / O), ribosome binding site (RBS),
Encodes a 6-His tag and a restriction enzyme site. Next, pQE-9 was included in the primer sequence.
Digest with the restriction enzyme corresponding to the restriction enzyme site. amplification
The ligated sequence was ligated to pQE-9, and histidine was ligated.
Inflation with tag coding sequence and RSB
Insert the Then use the ligation mixture.
For example, M15 / rep4 (Qiagen, ink)
E. coli strain was transformed into Sambrook, J. et al.
Molecular cloning
g): A Laboratory Manual (A Laboratory)
Manual), Cold Spring Laboratory Laboratory
(Spring Laboratory Press), (198
Transformation was performed by the method described in 9). M15 /
rep4 contains multiple copies of plasmid pREP4,
Expresses the lacI repressor and also expresses kanamycin
It also provides resistance (Kanr). Transformant, it
Identified by their ability to grow on LB plates,
Select ampicillin / kanamycin resistant colonies.
Plasmid DNA is isolated and confirmed by restriction analysis. A clone containing the desired construct was designated Amp (1
00 μg / ml) and Kan (25 μg / ml).
And grown overnight in liquid culture in LB medium (O /
N). Use the O / N culture to create a large culture
Seed at a ratio of 1: 100 to 1: 250. Cells
Optical density 600 between 0.4 and 0.6 (OD⁶⁰⁰)
Let them breed. Then, IPTG (“isopropyl-BD”
-Thiogalactopyranoside ") at a final concentration of 1 mM.
Until it has been added. IPTG inactivates lacI repressor
To clear P / O and increase gene expression
To induce. Proliferate cells for an additional 3-4 hours
I do. The cells were then collected by centrifugation. Cell
Lett is a chaotropic agent, 6 moles of guanidine H
Solubilized in Cl. After clarification, 6-His
That enable strong binding by proteins containing
Below, for chromatography on a nickel chelate column
From the solubilized protein (Hotchuri (H
ochuli, E.) et al. Chromatography 411: 17
7-184 (1984)). The protein was converted to pH 5.0.
Eluted from a 6 mole guanidine HCl column
Guanidine HCl, 100 mM sodium phosphate,
10 mmol of glutathione (reduced) and 2 mmol
Glutathione (oxidized form). 1 in this solution
After incubation for 2 hours, the protein was
Dialyzed against molar sodium phosphate. The protein purified by this method is
Produce monoclonal antibodies specific for proteins such as
May be used as an epitope for The polypep
Pride, Monoc Produced Against Isolated Protein
Lonal antibodies can be used to direct injection of the polypeptide into animals.
Or by administering the polypeptide to an animal.
Wear. The antibody thus obtained is the protein itself.
Will bind to himself. Then such antibodies, for example,
For example, the polypeptide may be used by using an ELISA assay or the like.
To isolate the protein from tissues expressing the peptide
Can be used for [0109]Example 3 Expression via gene therapy Fibroblasts are obtained from the subject by skin biopsy. Got
The tissue is placed in tissue culture medium and then divided into small pieces. So
Place a small chunk of tissue on the wet surface of a tissue culture flask
(Place about 10 chunks per flask). The flask
Turn over, close tightly and leave at room temperature overnight
You. After 24 hours at room temperature, the flask was inverted and then
The mass of tissue remains fixed at the bottom of the flask,
10% FBS, penicillin and streptomycin
Containing fresh medium (for example, Ham's F1 medium)
2 media)). Then put it at 37 ℃ for about 1 week
Incubate for At this time, add fresh medium and pull
Change every few days. After another two weeks, the culture
A monolayer of fibroblasts appears. Trypsinize the monolayer
Then adjust to a larger flask. The Moloney murine sarcoma virus long terminal fragment
PMV-7 (Kirsch) flanked by rearrangement
Meir (Kirschmeier, PT) et al., DNA, 7:
219-25 (1988)) with EcoRI and HindI.
Digestion followed by treatment with calf intestinal phosphatase
You. The linear vector is fractionated on an agarose gel and
Purify using beads. CDN encoding the polypeptide of the present invention
A correspond to the PCR primers corresponding to the 5 ′ and 3 ′ end sequences, respectively.
Amplify using a primer. 5 'primer is Eco R
The 3 'primer contains an I site and a Hind III site. Mo
Linear scaffold and Eco RI of Ronnie mouse sarcoma virus
Equivalent amounts of the Hind III fragment and T4 DNA
Are added together in the presence of the enzyme. Two of the resulting mixture
Maintain conditions suitable for ligation of fragments
I do. Transform the ligation mixture into bacteria HE101
And then transforming the bacterium into a suitable vector as desired.
To confirm that it has the gene inserted into
Seed on agar containing isine. Amphoteric pA317 or Gp + am12
The packaging cells were treated with 10% calf serum (CS),
Dulbecco with nicillin and streptomycin
Modified Eagle medium (Dulbecco's Modified Eagles M)
edium) (DMEM) for tissue culture to full density
Proliferate at An MSV vector having the gene
And packaging cells with the vector.
Transduce. This time the packaging cells
Producing infectious virus particles containing the gene (package
Aging cells are hereinafter referred to as producer cells). Produced by transducing a fresh medium
Medium and then add the medium to the entire 10 cm plate.
Harvest from producer cells on the surface. Infectious virus
Filter the spent medium containing the particles with a Millipore filter.
Remove the isolated producer cells by filtration and then
This medium is used to infect fibroblasts. Culture medium
Is removed from the fibroblast sub-full-surface plate and the production
Quickly replace the medium from the source cells. This medium
Remove and replace with fresh medium. High virus titer
If not, essentially all fibroblasts are infected and the selection is
No need at all. If the titer is very low, neo
Or retrograde with a selectable marker such as his
It is necessary to use an ills vector. Manipulated fibers
Blast cells alone or with Cytodex-3 microcapsules
Rear beads (cytodex 3 microcarrier beads)
And then injected into the host. The fibroblast is a tan
Produces protein products. [0114]Example 4 Colon-specific lesions using the baculovirus expression system
Cloning and expression of genes DNA sequence encoding full-length protein, ATCC
Accession No. 97129, the 5 'and 3' sequences of the gene
Uses PCR oligonucleotide primers corresponding to
And amplify. The 5 'oligonucleotide primer has the sequence: 5 'ATCGGGATCCGCCATCATGGCTTCCAGAAGCATGCG 3' (SEQ ID NO: 5), wherein the sequence is a Bam HI restriction enzyme.
Site (bold), followed by an efficient translation initiation in eukaryotes
Contains 6 nucleotides similar to the signal. 3 'oligonucleotide primer 5 'TACGGGTACCTTGCTCTATGGTCGGTAC 3' (SEQ ID NO: 6) is a fragment of the endonuclease Asp718.
Cleavage site and 3 'untranslated sequence of colon-specific gene
Contains 5 complementary nucleotides. Amplified sequence is commercially available
Kits available and available (Gene Clean (G
eneclean) ", BIO 101Inc., La Jolla (La J
ola), California) using 1% agarose sedge
Isolate from Next, the fragment is
1% after digestion with Rease BamHI and Asp718
Purified on agarose gel. This fragment is called F2
Name it. The vector pA2 (pVL941 vector
Using the baculovirus expression system
Used for the expression of colon-specific proteins
Some include Summers, MD and Smith, S.
mith, GE) 1987, Manual of methods for ba
culovirus vectors and insct cell culture procedure
s, Texas Agricultural Experimental Station Bu
lletin No. 1555). This expression vector is
Tographa californica nuclear polyhedrosis virus (A
utographa californica nuclear polyhedrosis virus)
(AcMNPV) powerful polyhedrin
Motor followed by a restriction endonuclease BamH
Includes recognition sites for I and Asp718. Efficient poly
For adenylation, the simian virus (SV) 40
A polyadenylation site is used. Selection of recombinant virus
Β-galactosidase from E. coli to simplify
Gene is polyadenylation signal of polyhydrin gene
Inserts in the same direction as the polyhydrin promoter preceding
Is done. At both ends of the polyhydrin sequence,
Cell-mediated transmission of wild-type viral DNA to be transfected
Flanking the same homologous recombination sequence. p
Instead of RG1, pAc373, pVL941 and
pAcIM1 (Luckow, VA) and
Mars, Virology, 179: 31-39)
Use many other baculovirus vectors
Can be. After digesting the plasmid with restriction enzymes,
Known in the art using intestinal phosphatase
Dephosphorylation by the method described in The DNA is then marketed
Available kits ("Gene Clean" BIO 101
Inc., La Jolla, CA
From a 1% agarose gel. This vector
The DNA is named V2. Fragment F2 and elimination
Ligated plasmid V2 was ligated with T4 DNA ligase.
To The DH5α cells were then transformed into the colon
Plasmids containing specific genes (pBac-colon specific
Bacteria containing the enzymes BamHI and Asp71.
8 for identification. Cloned fragment
Is confirmed using DNA sequencing. Lipofection method (Felgner)
ner) et al., Proc. Natl. Acad. Sci. USA, 84:74.
13-7417 (1987)).
5 μg of pBac colon-specific gene was obtained from a commercially available linearized baculo.
Virus ("BaculoGoldTM Baculovirus DN
A ", Pharmingen, St. Die
San Diego, California) with 1.0 μg
When transfecting. BaculoGold^TM1 μg of viral DNA
5 μg of plasmid and plasmid pBac colon-specific
Grace's medium (Life Technologies
Inc. (Life Technologies Inc.), Gaithersburg
(Gaithersburg, MD) containing 50 μl
Mix in sterile wells of a microtiter plate.
Then, 10 μl of Lipofectin and gray
90 μl of the culture medium, mix and incubate at room temperature for 15 minutes.
Cubate. Then the transfection mixture
For 35 mm tissue culture containing 1 ml of serum-free Grace's medium
Sf9 insect cells (ATCC CRL 1) seeded on a plate
711). Rock the plate back and forth
And mix the newly added solution. Then the play
Incubate at 27 ° C. for 27 hours. After 5 hours,
Remove the transfection solution from the plate
1m Grace insect medium supplemented with 10% fetal bovine serum
Add l. Return the plate to the incubator
And continue culturing at 27 ° C. for 4 days. After 4 days, the supernatant was collected and collected in Summers and
Plaque backup as described by mistake (above)
Do Say. As a variant, "Blue Gal" (Life Te
Aga including (Knology, Inc., Gaithersburg)
Loin gel was used.
The isolated plaque can be easily isolated.
(A detailed description of the "plaque assay"
User guide on culture and life techno
Geese Inc., a bar distributed by Gaithersburg
Curovirology, also found on pages 9-10
). Four days later, serially diluted virus was added to the cells and
Colored plaque with Eppendorf pipette tip
Collect at the edge. Then, agar containing the recombinant virus,
Eppendorf tube containing 200 μl of Grace's medium
Resuspend in The agar is centrifuged briefly
The supernatant containing the recombinant baculovirus was removed and removed.
Used to infect Sf9 cells seeded in mm dishes
You. Four days later, the supernatants of these culture dishes were collected,
Save with. Sf9 cells were treated with 10% heat-inactivated FBS.
Grow in supplemented Grace's medium. Infected cells
Recombinant baculovirus V-colon with severe (MOI) 2
Infects foreign genes. After 6 hours, remove the medium
Methionine and cysteine free SF900
 II Medium (Life Technologies, Inc., Gaiser
Zberg). 42 hours later, 5 μCi³⁵S-meth
Onin and 5 μCi³⁵S Cysteine 5μCi (Amashi
(Amersham). Its colon-specific protein
Infected by cells lysed in hypotonic phosphate buffer 7
After 2 hours, purified from infected cells,
Chromatography, size exclusion chromatography and
Purify by reverse phase chromatography. From the previous teaching
See, that numerous modifications and variations of the present invention are possible.
From within the scope of the appended claims, other than those described in detail
Then, the present invention can be carried out. [0122] SEQUENCE LISTING <110> Human Genome Sciences, Inc. <120> Colon Specific Gene and Protein <130> 184029 <160> 6 <210> 1 <211> 1114 <212> DNA <213> Homo Sapiens <400> 1 gcacgaggcc aaacagattt gcagatcaag gagaacccag gagtttccaaa gaagcgctag 60 taaggtctct gagatccttg cactagctac atcctcaggg taggaggaag atggcttcca 120 gaagcatgcg gctgctccta ttgctgagct gcctggccaa aacaggagtc ctgggtgata 180 tcatcatgag acccagctgt gctcctggat ggttttacca caagtccaat tgctatggtt 240 acttcaggaa gctgaggaac tggtctgatg ccgagctcga gtgtcagtct tacggaaacg 300 gagcccacct ggcatctatc ctgagtttaa aggaagccag caccatagca gagtacataa 360 gtggctatca gagaagccag ccgatatgga ttggcctgca cgacccacag aagaggcagc 420 agtggcagtg gattgatggg gccatgtatc tgtacagatc ctggtctggc aagtccatgg 480 gtgggaacaa gcactgtgct gagatgagct ccaataacaa ctttttaact tggagcagca 540 acgaatgcaa caagcgccaa cacttcctgt gcaagtaccg accatagagc aagaatcaag 600 attctgctaa ctcctgcaca gccccgtcct cttcctttct gctagcctgg ctaaatctgc 660 tcattatttc agaggggaaa cctagcaaac taagagtgat aagggcccta ctacactggc 720 ttttttaggc ttagagacag aaactttagc attggcccag tagtggcttc tagctctaaa 780 tgtttgcccc gccatccctt tccacagtat ccttcttccc tcctcccctg tctctggctg 840 tctcgagcag tctagaagag tgcatctcca gcctatgaaa cagctgggtc tttggccata 900 agaagtaaag atttgaagac agaaggaaga aactcaggag taagcttcta gaccccttca 960 gcttctacac ccttctgccc tctctccatt gcctgcaccc caccccagcc actcaactcc 1020 tgcttgtttt tcctttggcc ataggaaggt ttaccagtag aatccttgct aggttgatgt 1080 gggccataca ttcctttaat aaaccattgt gtac 1114 <210> 2 <211> 158 <212> PRT <213> Homo Sapiens <400> 2 Met Ala Ser Arg Ser Met Arg Leu Leu Leu Leu Leu Ser Cys Leu                   5 10 15 Ala Lys Thr Gly Val Leu Gly Asp Ile Ile Met Arg Pro Ser Cys                  20 25 30 Ala Pro Gly Trp Phe Tyr His Lys Ser Asn Cys Tyr Gly Tyr Phe                  35 40 45 Arg Lys Leu Arg Asn Trp Ser Asp Ala Glu Leu Glu Cys Gln Ser                  50 55 60 Tyr Gly Asn Gly Ala His Leu Ala Ser Ile Leu Ser Leu Lys Glu                  65 70 75 Ala Ser Thr Ile Ala Glu Tyr Ile Ser Gly Tyr Gln Arg Ser Gln                  80 85 90 Pro Ile Trp Ile Gly Leu His Asp Pro Gln Lys Arg Gln Gln Trp                  95 100 105 Gln Trp Ile Asp Gly Ala Met Tyr Leu Tyr Arg Ser Trp Ser Gly                 110 115 120 Lys Ser Met Gly Gly Asn Lys His Cys Ala Glu Met Ser Ser Asn                 125 130 135 Asn Asn Phe Leu Thr Trp Ser Ser Asn Glu Cys Asn Lys Arg Gln                 140 145 150 His Phe Leu Cys Lys Tyr Arg Pro                 155 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 5 'Primer used for PCR for amplification of the DNA sequence encod ing a polypeptide of the present invention <400> 3 gcaggatcct ggcttccaga agcatg 26 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 3 'Primer used for PCR for amplification of the DNA sequence encod ing a polypeptide of the present invention <400> 4 tacgggtacc ttgctctatg gtcggtac 28 <210> 5 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 5 'Primer used for PCR for amplification of the DNA sequence encod ing the full-length protein of the present invention <400> 5 atcgggatcc gccatcatgg cttccagaag catgcg 36 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 3 'Primer used for PCR for amplification of the DNA sequence encod ing the full-length protein of the present invention <400> 6 tacgggtacc ttgctctatg gtcggtac 28

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the cDNA sequence of the human colon-specific gene disclosed in this application and the corresponding deduced amino acid sequence.
Standard single letter abbreviations for amino acids are used. FIG. 2 shows the cDNA sequence of the human colon-specific gene disclosed in the present application and the corresponding deduced amino acid sequence.
Standard single letter abbreviations for amino acids are used. FIG. 3 shows the cDNA sequence of the human colon-specific gene disclosed in this application and the corresponding deduced amino acid sequence.
Standard single letter abbreviations for amino acids are used.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) C12Q 1/02 C12Q 1/68 A 4C086 1/68 A61K 39/395 E 4H045 // A61K 38/00 T 39 / 395 45/00 48/00 45/00 A61P 35/00 48/00 35/04 A61P 35/00 C12N 15/00 ZNAA 35/04 A61K 37/02 (72) Inventor Daniel R. Soppet United States 22020 Virginia Stillfield Place, Centerville 15050 (72) Inventor Li Y United States 20878 Gay Saarsburg, Maryland Howard Landing Drive 16125 (72) Inventor Patrick Jay Dillon United States 20879 Gay Saarsburg, Maryland , Boxberry Las 7508 No.F term (reference) 4B024 AA01 AA11 BA80 CA04 DA02 DA06 EA02 EA04 GA13 HA01 HA14 HA17 4B063 QA01 QA05 QA18 QQ20 QQ79 QR48 QR51 QR56 QR77 QS28 QS34 QS36 QX07 4B064 AG01 AG26 CA02 CA10 AA1CA19 ACA13A19 CC AA17 BA01 BA08 BA22 BA23 CA17 MA01 NA14 ZB262 4C085 AA13 AA14 CC32 DD62 EE01 GG01 4C086 AA02 AA03 AA04 EA16 NA14 ZB26 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA75 EA20 GA22 GA23 GA25 GA26

Claims (1)

[Claims] 1. A colon-specific gene as described in the description.