JP2003009895A - Endodermal monocyte-active polypeptide iii - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide human EMAP III polypeptide, the DNA (or RNA) encoding the polypeptide and a procedure for producing such polypeptide through the recombinant techniques. SOLUTION: The isolated polypeptide includes the members selected from the group consisting of (a) the polynucleotide that encoding the polypeptide including the human EMAP III; (b) the polynucleotide that encodes the matured polypeptide bearing the amino acid sequence expressed by the DNA included in the ATCC number; (c) the polynucleotide that can hybridize with (a) or (b) and is homologous in at least 70% of the sequence and (d) the polynucleotide fragment of the polynucleotides (a), (b) or (C).

Description

Description: BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a newly identified
A polynucleotide, such a polynucleotide
Polypeptides, such polynucleotides and
And the use of such polypeptides
For the production of leotide and polypeptides. More details
First, the polypeptide of the present invention is an endothelial monocyte-active polypeptide.
Has been putatively identified as Pide III and is hereinafter referred to as
Sometimes referred to as "EMAP III". The present invention also provides
And inhibiting the action of polypeptides such as 2. Description of the Related Art Mouse meth A fibrosarcoma
Immunogenic tumors such as chronic inflammatory infiltrates (chronic)
infrastructure (including infiltration)
(Dvorak,
H. , New Engl. J. Med. , 31
5: 1650-1658 (1986)). These inflammations
Sex cells (these are often found throughout the tumor stroma)
Presence of a spreadable fibrin network)
Can be considered a non-healing lesion of the tumor
Helps with the concept (Id.). Initiate host response (pri
me) alters the properties of the endothelium and is inflammatory to tumors
Tumor-derived mediators that attract cells have been identified
ing. Empa I is a trypsin-sensitive, other protein.
Approximately 40 kda PO different from Itokine and growth factors
Is a repeptide and activates endothelial cells and monocytes
I can do it. Another polypeptide has been identified,
Is a mouse homolog of vpf / vegf. vpf
/ Vegf enhances vascular permeability and induces endothelial cells
Has previously been shown to be mitogenic
Is a factor. Recently, another polypeptide has been identified as a Meto A tumor cell.
Vesicle supernatant (EMAP II).
EMAP II, when injected into the toes of mice,
Activates skin cells (EC) and mononuclear cells,
Induction increases the involvement of these cells in the agglutination response
To promote the migration of monocytes and polymorphonuclear leukocytes, and
Leads to an inflammatory response. [0003] The polypeptide of the present invention
Indicates the amino acid sequence homology to EMAP II.
As a result, it has been putatively identified as EMAP III.
You. According to one aspect of the present invention, a novel mature
Polypeptides and biologically active and diagnostic or
Are therapeutically useful fragments, analogs and derivatives
A body is provided. The polypeptides of the present invention are of human origin.
You. [0005] According to another aspect of the present invention, the polyether of the present invention is provided.
Provided are isolated nucleic acid molecules encoding the peptide;
Nucleic acid molecules include mRNA, DNA, cDNA, genomic DN
A and analog and biologically active, and
Includes fragments thereof useful for diagnosis or therapy. According to a still further aspect of the present invention,
Expression of the protein and subsequent recovery of said protein
Encoding a polypeptide of the invention under conditions that promote
And / or a recombinant prokaryotic host cell comprising the nucleic acid sequence
A recombinant technique comprising the step of culturing a recombinant eukaryotic host cell
Techniques to produce such polypeptides
The process is provided. According to a still further aspect of the present invention, for example,
For the purpose of treating neoplasms such as tumors in cancer,
Such polypeptides encoding such polypeptides
A process for utilizing peptides or polynucleotides
Provided. According to a still further aspect of the present invention,
Antibodies to such polypeptides are provided. According to another aspect of the present invention, EMAP I
Mimics II and binds to the EMAP III receptor
To elicit a response. According to a still further aspect of the present invention, the invention
Long enough to specifically hybridize to a defined nucleic acid sequence
A nucleic acid probe comprising the nucleic acid molecule of the present invention is also provided. [0011] According to another aspect of the present invention, there is provided a method for producing a poly-
Associated with mutations in the nucleic acid sequence encoding the peptide
Diagnostics to detect disease or susceptibility to this disease
A shear assay is provided. According to a still further aspect of the present invention, this
Such a polypeptide, or such a polypeptide
Encoding polynucleotides can be used in scientific studies (eg,
DNA synthesis and production of DNA vectors)
Steps are provided for utilizing for in vitro purposes.
You. [0013] These and other aspects of the present invention are described herein.
It should be apparent to those skilled in the art from the teachings herein. Means for Solving the Problems In one aspect, the present invention
The invention provides an isolated polynucleotide, comprising: (a) amino acids 1 to 168 of SEQ ID NO: 2;
(B) by the DNA contained in the ATCC accession number
A mature polypeptide having the expressed amino acid sequence
(C) a polynucleotide comprising the polynucleotide (a) or (b) and
Can be hybridized and at least 70% identical to them
And (d) the polynucleotide (a), (b) or
The polynucleotide fragment of (c);
Isolated polynucleotide containing a member selected from
Provide, [0015] In one embodiment, the present invention provides an EM
By the DNA contained in the APIII deposited clone
Polypeptide having an amino acid sequence expressed by
Can be provided. [0016] In one embodiment, the present invention provides a method comprising:
Providing a polynucleotide whose polynucleotide is DNA
Can be offered. In one embodiment, the present invention provides an array comprising:
A polypeptide comprising amino acids 1-168 of No. 2
A polynucleotide to be loaded. In one embodiment, the present invention provides an array comprising:
Nucleotide 1 to nucleotide 63 of the sequence shown in No. 1
6 is provided. In one embodiment, the present invention provides an array comprising:
Nucleotide 94 to nucleotide 6 of the sequence shown in No. 1
36 is provided. In one embodiment, the present invention provides an array comprising:
Nucleotide 94 to nucleotide 6 of the sequence shown in No. 1
00 is provided. In one aspect, the present invention relates to the aforementioned D
A vector comprising NA is provided. In one aspect, the present invention relates to the above-described vehicle.
A host cell that has been genetically engineered with the vector. [0023] In one aspect, the present invention relates to the aforementioned inn
From the main cell, a polypeptide encoded by the DNA
Producing a polypeptide, comprising the step of expressing a tide
Provide a process to do. In one aspect, the present invention relates to the above-described vehicle.
Polypep, comprising the step of genetically manipulating cells with a
A process for producing a cell capable of expressing a tide is provided. [0025] In one aspect, the present invention relates to polypep
A peptide comprising (i) the deduced amino acid sequence of SEQ ID NO: 2
Polypeptide, and fragments thereof,
Logs and derivatives; and (ii) ATCC accession numbers
The polypeptide encoded by the cDNA of
And fragments, analogs, and
Derivatives comprising a member selected from the group consisting of:
Provide a repeptide. In one embodiment, the present invention provides a method comprising:
The polypeptide is amino acid 1 to amino acid 16 of SEQ ID NO: 2;
8 is provided. In one aspect, the present invention relates to the above
Provided are compounds that activate a receptor for a peptide. In one aspect, the present invention relates to the above-mentioned
Antibodies to the repeptide are provided. [0029] In one aspect, the present invention provides an EMAP
A method for treating a patient in need of III
13. The polypeptide of claim 12 in a therapeutically effective amount for said patient.
A method comprising administering a peptide is provided. In one embodiment, the present invention provides a method comprising:
A therapeutically effective amount of the polypeptide,
Provide the encoding DNA with the DNA and provide it to the patient.
Administered by expressing the polypeptide at
Provide a way to In one aspect, the present invention relates to the above-mentioned
For diseases or disorders associated with underexpression of the repeptide
A process for diagnosing susceptibility, comprising:
Determining the mutation in the nucleic acid sequence encoding the
Provide a process to include. In one aspect, the present invention provides a diagnostic
13. The method of claim 12, wherein the sample is in a host-derived sample.
Diagnostic assay, including the step of analyzing for the presence of
Provide process. In one aspect, the present invention relates to the above-mentioned
Binds and activates the receptor for the repeptide
A method for identifying a compound that
Cells expressing the receptor for the repeptide on its surface
Wherein the receptor is a compound of the type
A second, capable of providing a detectable signal in response to the binding.
The cells associated with the components and their detectability by analysis
Compound under conditions that allow binding to the receptor.
Contacting; and detecting the presence of the signal.
The compound binds to the receptor and
Deciding whether to activate the receptor.
A method is provided. [0034] According to one aspect of the present invention, FIG.
1 (SEQ ID NO: 2)
Ripeptide or ATCC on May 26, 1995
The cDNA of the clone deposited as accession number
Isolated encoding the mature encoded polypeptide
Nucleic acids (polynucleotides) are provided. The polypeptide of the present invention is derived from resting T cells.
CDNA library. this is,
Open coding for a protein of 168 amino acid residues
Includes reading frame. The 168 amino acid sequence
EM from proteolytically cleaved prosequence
1 shows the active domain of AP III. This protein
Has 60% identity over a 150 amino acid extension, and
And high homology to EMAP II with 75% similarity
Shows sex. The coding sequence of FIG. 1 (SEQ ID NO: 2)
The active domain of the polypeptide is illustrated and the polypeptide
The peptides may include additional amino acid residues. The present invention
Ripeptides are not considered to have leader sequences
However, this is a secretory sequence. The polynucleotide of the present invention may be in the form of RNA.
Or DNA (this DNA is cDNA, genomic DN
A, and synthetic DNA). DN
A can be double-stranded or single-stranded, and if single-stranded
Contains the coding or non-coding (antisense) strand.
You can. The coding sequence encoding the mature polypeptide is:
The coding sequence shown in FIG.
Can be identical to the loan coding sequence or
The coding sequence is the result of duplication or degeneracy of the genetic code
The DNA of FIG. 1 (SEQ ID NO: 1) or the deposited cDN
A different coding sequence encoding the same mature polypeptide as A
Can be a column. The mature polypeptide of FIG. 1 (SEQ ID NO: 2)
Or the mature polypeptide encoded by the deposited cDNA
The polynucleotide encoding the tide may include:
But not limited to: mature polypeptide coding
Coding sequence of the mature polypeptide, and
Secretory sequences, or additional components such as proprotein sequences
Coding sequence of the mature polypeptide (and required
Additional coding sequences) and non-coding sequences (e.g.
Coding sequences for introns or mature polypeptides
5 'and / or 3' non-coding sequences). Thus, the term "encoding a polypeptide"
"Polynucleotide" refers to the polypeptide coding sequence only.
A polynucleotide comprising, and an additional coding sequence,
And / or a polynucleotide comprising a non-coding sequence
Including. The present invention further relates to FIG. 1 (SEQ ID NO: 2).
A polypeptide having a constant amino acid sequence, or
Of the polypeptide encoded by the cloned cDNA
The invention encoding fragments, analogs and derivatives
The specification relates to variants of the above polynucleotides. Poly
Nucleotide variants are naturally occurring variants of the polynucleotide.
Existing allelic variant or polynucleotide
It may be a mutant that does not exist. Accordingly, the present invention provides a method as shown in FIG.
The same mature polypeptide as indicated, or
Mature polypeptide encoded by the cDNA of the
Polynucleotides encoding the same, as well as such
Includes variants of the polynucleotide. This variant is
The polypeptide of FIG. 1 (SEQ ID NO: 2) or the deposited
Of the polypeptide encoded by the
Fragment, derivative or analog. This
Such nucleotide variants include deletion variants, substitution variants,
And addition or insertion variants. As indicated hereinabove, polynucleic acid
Leotide has the coding sequence shown in Figure 1 (SEQ ID NO: 1), or
Or naturally occurring coding sequence of the deposited clone
It may have a coding sequence that is an allelic variant. The minute
As is known in the art, an allelic variant can have one or more
Polynucleotides that may have nucleotide substitutions, deletions or additions
Another form of the reotide sequence, which is
Does not substantially alter the function of the repeptide. The present invention also includes a polynucleotide,
Here, the coding sequence for the mature polypeptide is the same as
In one reading frame, the
Polynucleotides that support expression and secretion of repeptides
Sequence (eg, regulates the transport of polypeptides from cells)
To a secretory sequence). These polynu
Nucleotides are also synthesized with additional 5 'amino acid residues.
It may encode a proprotein which is a mature protein. Step
A mature protein having a B sequence is a proprotein
And an inactive form of the protein. Once professional
When the sequence is cleaved, the active mature protein remains. Subordinate
Thus, for example, the polynucleotides of the present invention
Encodes protein or protein with prosequence
I can do it. The polynucleotide of the present invention
To a marker sequence that allows for purification of the polypeptide
It may have the coding sequence fused in frame. marker
The sequence may be, in the case of a bacterial host, a sequence fused to a marker.
A pQE-9 vector that provides for purification of a mature polypeptide
Hex histidine tag supplied by Ah
Alternatively, for example, the marker sequence may be a mammalian host (eg,
If COS-7 cells are used, hemagglutinin
(HA) tags. HA tag is for influenza
For epitopes derived from hemagglutinin protein
(Wilson, I. et al., Cell, 37: 767.
(1984)). The present invention further provides that at least 70
%, Preferably at least 90%, and more preferably
Here means that at least 95% identity is present
In the polynucleotide that hybridizes to the above sequence
Related. The invention particularly relates to the polynucleotides described herein above.
Hybridizes under stringent conditions
Related to polynucleotides. For use herein
The term "stringent conditions" is used for hybridization.
At least 95% between sequences, and preferably
Only occurs when at least 97% identity is present
Means that. In a preferred embodiment,
A polynucleotide hybridizing to the above polynucleotide
The nucleotide was obtained from the cDNA of FIG.
Encoded by the committed cDNA (s)
A biological function or activity substantially the same as that of the mature polypeptide.
Encodes a polypeptide that retains either sex. Ah
Alternatively, the polynucleotide has at least 20 salts.
Groups, preferably 30 bases, and more preferably less
Both may have 50 bases. These are the polynucleic acids of the present invention.
Hybridized to leotide, and
Have identity to it, and retain activity
It may or may not be. For example, such a port
The oligonucleotide is a polynucleotide of SEQ ID NO: 1.
As a lobe, for example, for recovery of the polynucleotide
Or as a diagnostic probe or a PCR probe
Can be used as a primer. Accordingly, the present invention relates to the polypeptide of SEQ ID NO: 2
And its fragments (this fragment is
At least 30 bases, and preferably 50 bases)
At least 70% the same as the polynucleotide encoding
Unisex, preferably at least 90%, and more preferred
Or polynucleotides having at least 95% identity
And encoded by such a polynucleotide.
Polypeptide. The deposit (single or plural) referred to in this specification
Number) relates to the international recognition of deposits of microorganisms in patent procedures.
Maintained under the Budapest Treaty. These deposits
Is provided only as a convenience to those skilled in the art, and
That a deposit is required under 35 U.S.C. 112
I did not admit that. Polynuclei contained in the deposit
Otide sequences and polypeptides encoded thereby
The amino acid sequence of the peptide is incorporated herein by reference.
And any description of the sequences herein
It also controls the conflict event. Produce deposits,
A license is required to use or sell
And such a license is granted hereby
Not necessarily. The present invention further relates to FIG. 1 (SEQ ID NO: 2).
CDNA having a defined amino acid sequence or deposited
Having an amino acid sequence encoded by
And fragments of such polypeptides,
For analogs and derivatives. The terms “fragment”, “derivative”, and
And "analog" are the polypeptides of FIG. 1 (SEQ ID NO: 2)
Or the polypeptide encoded by the deposited cDNA
When referring to an organism that is essentially the same as such a polypeptide.
Polypeptide that retains a biological function or activity
You. Thus, analogs can be used for cleavage of the proprotein part.
Can be more activated to produce active mature polypeptide
Includes proprotein. The polypeptide of the present invention is a recombinant polypeptide.
Tide, a natural polypeptide or a synthetic polypeptide.
And preferably a recombinant polypeptide. The polypeptide of FIG. 1 (SEQ ID NO: 2)
Phage of the polypeptide encoded by the deposited cDNA
A fragment, derivative or analog is (i) one or more
Upper amino acid residue is conservative or non-conservative
Substitution with amino acid residues (preferably conservative amino acid residues)
And such substituted amino acid residues are
May be an amino acid residue encoded by the code
Or not, or (ii)
One or more amino acid residues include a substituent, or
(Iii) the mature polypeptide has a half-life of the polypeptide;
(Eg, polyethylene glycol
Or fused with another compound such as
Is (iv) additional amino acids (eg, a secretory sequence, or
For purification of mature polypeptide or proprotein sequences
Used) is fused to the mature polypeptide.
Can be Such fragments, derivatives,
And analogs, based on the teachings herein, will be within the purview of those skilled in the art.
It is considered to be in the enclosure. [0051] Polypeptides and Polynucleotides of the Invention
The tide is preferably provided in an isolated form, and
And preferably uniformly purified. The term “isolated” means that a substance is
The environment (for example, if it occurs naturally, the natural ring
From the border). For example, living
Naturally occurring polynucleotide present in an animal
Or the polypeptide has not been isolated, but
Separated from some or all of the coexisting
Identical polynucleotides or polypeptides
Separated. Such a polynucleotide may be a vector
And / or such polynuclei
The leotide or polypeptide can be part of a composition,
And still, such vectors or compositions are
It is isolated in that it is not part of its natural environment. The present invention also relates to the polynucleotide of the present invention.
, A vector containing the gene of the present invention,
Host cells and polypeptides of the invention by recombinant technology
Related to the generation of code. The host cell is a vector of the present invention, which comprises
For example, a cloning vector or an expression vector.
Genetically engineered (transduced)
Or transformed or transfected
Is done). Vectors include, for example, plasmids, viruses
It can be in the form of particles, phages, and the like. Manipulated host
Cells activate the promoter or select transformants.
Selected or suitable for amplifying the gene of the invention.
And can be cultured in conventional nutrient media modified to: Culture
Nutrient conditions (eg, temperature, pH, etc.) are selected for expression.
Conditions previously used for the selected host cell, and
It will be clear to those skilled in the art. The polynucleotide of the present invention can be obtained by a recombinant technique.
Can be used to produce a polypeptide. Subordinate
Thus, for example, the polynucleotide is a polypeptide
Any one of various expression vectors for expressing
May be included. Such vectors contain chromosomal DNA sequences.
Includes sequences, non-chromosomal DNA sequences, and synthetic DNA sequences
I do. Such vectors are, for example, derived from SV40.
Body; bacterial plasmid; phage DNA;
Ruth; yeast plasmid; plasmid and phage DN
Vector and viral DNA derived from the combination of A
(Eg vaccinia, adenovirus, fowlpox virus
Rabies, and pseudorabies). But replicate in the host
Any other vector as long as it is possible and viable
Can also be used. The appropriate DNA sequence may be identified by various procedures.
Can be inserted into the reactor. Generally, the DNA sequence
Appropriate restriction endonuclease sites by procedures known in the art
Inserted at the position (s). Such a procedure
And other procedures are considered to be within the purview of those skilled in the art. The DNA sequence in the expression vector is
Acts on the current regulatory sequence (s) (promoter)
It is operably linked and directs mRNA synthesis. like this
Representative examples of such promoters include:
Obtain: LTR or SV40 promoter, E. coli. col
i lac or trp, λ phage P _L Promoter
And prokaryotic or eukaryotic cells or their will
Other promoters known to control gene expression in
Data. Expression vectors also provide a ribosomal vector for translation initiation.
And a transcriptional terminator. That ba
The vector also contains appropriate sequences for amplifying expression.
obtain. Furthermore, the expression vector is preferably of the form
Phenotypic traits for selection of transformed host cells (eg,
For eukaryotic cell cultures, dihydrofolate reductor
Ze or neomycin resistance, or col
In i, tetracycline resistance or ampicillin
Including one or more selectable marker genes that provide
No. A suitable DNA sequence as described herein above
And contains appropriate promoter or control sequences
Vectors transform a suitable host into
It can be used to express quality. Representative examples of suitable hosts include:
Mention may be made: bacterial cells such as E. coli, St.
reptomyces, Salmonella type
fungus cells (eg, yeast); insect cells
Vesicles (eg, Drosophila S2 and Spo
doptera Sf9); animal cells (eg, CH
O, COS or Bowes melanoma); adenovirus
And plant cells. Selection of an appropriate host is described herein.
It is considered within the skill of the art from the teachings. More specifically, the present invention also relates to
A recombinant construct comprising one or more of the sequences described in the Examples.
No. The construct is a vector (eg, a plasmid vector).
Or viral vectors) within this vector
The sequence of the present invention is inserted in the forward or reverse direction.
You. In a preferred aspect of this embodiment, the construct is
In addition, a regulatory sequence operably linked to the sequence (eg,
Enclosing the promoter). Very many suitable vectors
Promoters and promoters are known to those of skill in the art, and
It is commercially available. The following vectors are provided as examples
You. Bacterial: pQE70, pQE60, pQE-9 (Q
iagen), pBS, pD10, phaescri
pt, psiX174, pbluescript S
K, pbsks, pNH8A, pNH16a, pNH1
8A, pNH46A (Stratagene); ptr
c99a, pKK223-3, pKK233-3, pD
R540, pRIT5 (Pharmacia). Eukaryotic
Sex: pWLNEO, pSV2CAT, pOG44, pX
T1, pSG (Stratagene), pSVK3,
pBPV, pMSG, pSVL (Pharmaci
a). However, any other plasmid or vector
Are also replicable and viable in the host
As long as it can be used. The promoter region is CAT (chloramph
Enicol transferase) vector or selection
Any other desired vector using other vectors with
It can be selected from genes. Two suitable vectors are p
KK232-8 and pCM7. Especially well-known
As bacterial promoters, lacI, lacZ, T
3, T7, gpt, λP _R , P _L And trp
You. Eukaryotic promoters include immediate CMV, HSV
Mididine kinase, early SV40 and late SV40,
LTR from Torovirus and Mouse Metallothione
In I. Appropriate vector and promoter
The choice of is well within the level of ordinary skill in the art. In a further embodiment, the invention relates to the above structure.
The present invention relates to host cells containing structures. The host cell is higher
Nuclear cells (eg, mammalian cells) or lower eukaryotic cells
(Eg, a yeast cell) or a host cell
Can be a prokaryotic cell (eg, a bacterial cell). Construct
For introduction into host cells, use calcium phosphate transfection.
DEAE-dextran mediated transfection
Can be achieved by electroporation or electroporation.
(Davis, L., Dibner, M., Bat)
ey, I .; , Basic Methods in
Molecular Biology, 1986). Using constructs in host cells,
To produce the gene product encoded by the recombinant sequence.
You. Alternatively, the polypeptides of the present invention can
It can be produced synthetically by a synthesizer. [0065] Mature proteins include mammalian cells, yeast,
Under control of an appropriate promoter in bacteria or other cells
Can be expressed. The cell-free translation system is also a DNA of the present invention.
Using RNA from the construct,
It can be used to produce proteins. Prokaryotic hosts and
Cloning vectors for use in eukaryotic hosts
And expression vectors are described in Sambrook et al., Mol.
eco Cloning: A Laborat
ory Manual, 2nd edition, ColdSpri
ng Harbor, N.M. Y. , (1989)
Indications are incorporated herein by reference).
ing. DNA encoding the polypeptide of the present invention
Transcription by higher eukaryotes is enhanced in the vector.
Augmented by inserting sequences. Enhancer
Is a cis-acting element of DNA, usually about 10
300 bp, which act on the promoter and
Increase transcription. As an example, bp100 to
270 late-stage SV40 enhancer, cytomegalo
Virus early promoter enhancer, replication origin
Late-stage polyoma enhancers and adenovirus
Suenhancer is mentioned. Generally, a recombinant expression vector has an origin of replication.
And selectable markers that allow transformation of host cells
(Eg, the ampicillin resistance gene of E. coli,
And S.A. cerevisiae TRP1 gene)
From highly expressed genes that direct transcription of downstream structural sequences
Including the original promoter. Such promoters
Glycolytic enzymes (eg, 3-phosphoglycerate kinase)
(PGK)), α-factor, acid phosphatase, or heat
Derived from operons that encode shock proteins
obtain. The heterologous structural sequence includes a translation initiation sequence and a translation termination sequence.
Sequence and preferably translated protein periplasm
That are capable of directing secretion into the cerebral space or extracellular media
Assembly in the appropriate phase with the hanger arrangement. If necessary,
Heterologous sequences have the desired characteristics (eg, expressed recombinant products).
N-terminus to provide product stabilization or simplified purification).
A fusion protein comprising a constant peptide may be encoded. Expression vectors useful for bacterial use are functional
Operable readout phase with a unique promoter
Together with a clear translation start signal and a translation stop signal.
Insert a structural DNA sequence that encodes the desired protein
It is built by. Vectors have one or more phenotypes
Ensure the maintenance of selectable markers and vectors, and
Optionally, an origin of replication to provide for amplification in the host.
Including. Prokaryotic hosts suitable for transformation include E. coli. c
oli, Bacillus subtilis, Sal
monella typhimurium, and P
genus pseudomonas, Streptomyces
And various species within the genus Staphylococcus
Species, but other species may also be used for selection.
obtain. As a representative, but not limiting, example,
Expression vectors useful for use in fungi include the well-known clonin
Of the vector pBR322 (ATCC 37017)
Selection from commercially available plasmids containing gene elements
Markers and bacterial origins of replication may be included. like this
A commercially available vector is, for example, pKK223-3 (Ph
armasia Fine Chemicals, U
ppsala, Sweden) and GEM1 (Pr
omega Biotec, Madison, W
I, USA). These pBR322 "bones"
The "case" portion should be expressed with the appropriate promoter and
Combined with the structural sequence. Transformation of a suitable host strain and suitable cells
Following growth of the host strain to density, the selected promoter
The light source is controlled by appropriate means (eg, temperature shift or chemical
Induction), and the cells are cultured for a further period of time.
Is done. [0071] Cells are typically collected by centrifugation.
Crushed by physical or chemical means, and
The crude extract obtained is retained for further purification.
You. Microbes used in protein expression
Cells are subjected to freeze-thaw cycles, sonication, mechanical disruption
Any convenient method including disruption or use of cell lysing agents
Can be crushed by the method. Such methods are well known to those skilled in the art.
It is. Various mammalian cell culture systems are also recombinant.
And can be used to express proteins. Mammal
Examples of expression systems include Gluzman, Cell, 2
3: 175 (1981).
Expressing the cell's COS-7 strain, and a compatible vector
Other cell lines to obtain (eg, C127, 3T3, CHO,
HeLa, and BHK cell lines). Mammal
The expression vector contains an origin of replication, a suitable promoter and
Enhancer, and also any necessary ribosome binding
Site, polyadenylation site, splice donor site and
And splice acceptor sites, transcription termination sequences, and
And 5 'flanking non-transcribed sequences. SV40 Supra
DNA derived from chair and polyadenylation sites
Sequences provide the necessary non-transcribed genetic elements
Can be used for The polypeptide is prepared by ammonium sulfate precipitation or ethanol
Precipitation, acid extraction, anion or cation exchange chromatography
Chromatography, phosphocellulose chromatography, sparse
Aqueous interaction chromatography, affinity chromatography
Chromatography, hydroxylapatite chromatography
Fees and lectin chromatography
Recovered from recombinant cell culture by methods and purified
Can be done. Protein refolders, if needed
Process is used to complete the placement of the mature protein
Can be Finally, high performance liquid chromatography (HP
LC) can be used for the final purification step. [0075] The polypeptides of the present invention may be naturally occurring purified
Product or product of a chemical synthesis procedure
Or a prokaryotic or eukaryotic host (eg, cultured
Bacteria, yeast, higher plants, insects, and mammalian cells
) By recombinant techniques. Recombinant
Depending on the host used in the production procedure, the polypeptides of the invention
The peptide can be glycosylated or glycosylated
Can not be converted. The polypeptides of the present invention also
It may contain a thionin amino acid residue. EMAP III polypeptides of the invention
To regress neoplasms like tumors in cancer
Can be used. The polynucleotide and the polypep of the present invention
Pide is the discovery of treatment and diagnosis for human diseases.
Used as research reagents and materials. The present invention relates to a receptor for EMAP III.
And a method for identifying This receptor
Genes to be loaded include, for example, ligand panning, and
FACS sorting (Coligan et al., Curre)
nt Protocolsin Immun. , 1
(2), Chapter 5 (1991))
Can be identified by a number of methods. Preferably, expression
Using cloning, where the polyadenylation
RNA is prepared from cells responsive to EMAP III,
The cDNA library created from this RNA is pooled.
And use this for COS cells or EM
Transfect other cells that do not respond to AP III
I do. Transfected cells on a glass slide
And exposed to labeled EMAP III.
EMAP III is a site-specific protein kinase
By various means, including iodination or encapsulation of the recognition site.
Can be labeled. Following fixation and incubation
And subject the slides to autoradiographic analysis.
Identify positive pools and subpool and rescue
Prepare subpools using an iterative process with leaning
And re-transfected and finally putative
Generate a single clone, encoding the puter.
As another approach to receptor identification, labeled
The ligands to cell membranes expressing the receptor molecule or
Can be photoaffinity bound to the extract preparation. Crosslinked material
Is decomposed by PAGE and exposed to X-ray film.
You. Disconnect the labeled complex containing the ligand-receptor
Can be broken down into peptide fragments, and
It can be subjected to protein microsequencing. Obtained from microsequencing
Using the amino acid sequence to screen a cDNA library
Lean and search for genes encoding putative receptors
A set of degenerate oligonucleotide probes to identify
Design The present invention relates to the biological production of EMAP III.
To identify compounds (agonists) that enhance drug use
Methods for screening compounds are provided. As an example,
Mammalian cells expressing EMAP III receptor
Or membrane preparations are incubated with labeled compounds
I do. It then binds to the EMAP III receptor
The ability of this compound is measured. Ability to bind to receptor
The force is applied to a known cell following the interaction of the compound with the receptor.
It is measured by the response of the kand messenger system. this
As such a second messenger system, cAMP guar
Nilate cyclase, ion channel, or phosphoino
Including, but not limited to, citide hydrolysis.
No. The polypeptides and agonists of the present invention
Can be used in combination with a suitable pharmaceutical carrier
You. Such compositions comprise a therapeutically effective amount of the polypeptide
Or an agonist, and a pharmaceutically acceptable carrier
Or contain excipients. As such a carrier,
Saline, buffered saline, dextrose, water,
Glycerol, ethanol, and combinations thereof are listed.
But not limited thereto. The formulation is
It must conform to the form. The present invention also relates to one of the pharmaceutical compositions of the present invention.
A pharmaceutical comprising one or more containers filled with one or more ingredients
Provide a target pack or kit. Such a container (simply
Affixed to the pharmaceutical product or raw
A government machine that regulates the manufacture, use, or sale of physical products
It can be a notice of the form specified by the Seki, this notice
Are manufactured, used, or sold by human
To reflect approval. Further, the polypeptide of the present invention or
Agonists are used in connection with other therapeutic compounds
obtain. Pharmaceutical compositions can be administered orally, by direct injection, by parenteral administration.
Oral, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or skin
Can be administered in a convenient manner, such as by an internal route.
You. The pharmaceutical composition may be used to treat certain conditions and / or
It is administered in a prophylactically effective amount. Generally, this
They are administered in an amount of at least about 10 μg / kg body weight.
And in most cases about 8 mg / kg body weight / day
Dosage is not exceeded. In most cases, administration
The dose is about 10μ / day, taking into account
g / kg to about 1 mg / kg body weight. EMAP III polypeptides and polypeptides
Agonists that are repeptides also recognize such polypeptides.
Use according to the invention by expressing the peptide in vivo
And this is often referred to as “gene therapy”
You. Thus, for example, cells from a patient
Polynucleotides encoding polypeptides ex vivo
(DNA or RNA) and then manipulated
Cells to patients to be treated with this polypeptide
I do. Such methods are well known in the art and
It is clear from the teachings in the textbook. For example, cells
Retrovirus containing RNA encoding a light polypeptide
It can be manipulated by the use of a lus plasmid vector. Similarly, cells may be, for example, those known in the art.
For expression of the polypeptide in vivo
Can be manipulated in vivo. For example, packaging details
Vesicle containing RNA encoding the polypeptide of the present invention.
Transduction using retroviral plasmid vector
And, consequently, this packaging cell
Produce infectious retroviral particles containing
These producer cells manipulate cells in vivo
And expression of the polypeptide in vivo
May be administered to the patient. The method of the present invention by such a method
These and other methods for administering polypeptides
Should be apparent to those skilled in the art from the teachings of the present invention.
You. The retroviral plasmid vector described above
Moloney is a retrovirus from which
Mouse leukemia virus, spleen necrosis virus, rous sarcoma
Retrovirus like virus, Harvey sarcoma virus
Avian leukemia virus, gibbon ape leukemia virus,
Human immunodeficiency virus, adenovirus, myeloproliferative meat
Tumor virus, breast cancer virus, and the like,
It is not limited to these. In one embodiment, the leto
Rovirus plasmid vector, Moloney mouse leukemia
It is derived from the disease virus. The vector contains one or more promoters.
No. As a suitable promoter that can be used,
Ils LTR; SV40 promoter and human rhinoceros
Tomegalovirus (CMV) promoter (Mille
et al., Biotechniques, Vol.
9, 980-990 (1989)),
Or any other promoter (eg, a eukaryotic cell promoter).
Cell-like promoters (Histone, pol
III and β actin promoters
)), But are not limited to these.
Not. With other viral promoters that can be used
Adenovirus promoter, thymidine kinase
(TK) promoter and B19 parvovirus pump
Motor, but is not limited thereto. Suitable
The selection of a sharp promoter is based on the teachings contained herein.
It is clear to a person skilled in the art from Nucleic acid sequence encoding the polypeptide of the present invention
The rows are under the control of a suitable promoter. Can be used
Adenovirus major late
Adenovirus promoters, such as promoters;
Or the cytomegalovirus (CMV) promoter
Heterologous promoter; respiratory syncytial virus
(RSV) promoter; MMT promoter, metallo
An inducible promoter such as the thionein promoter;
Heat shock promoter; albumin promoter; A
poAI promoter; human globin promoter;
Wipes such as the pure herpes thymidine kinase promoter
Rustymidine kinase promoter; retrovirus L
TR (including the modified retrovirus LTR described above);
Kuching promoter; and human growth hormone promoter
But not limited thereto. Promo
Also regulates the gene encoding the polypeptide.
Be a natural promoter. The retroviral plasmid vector is
Packaging to form a reducer cell line
Can be used to transduce cell lines. Troff
Examples of packaging cell lines that can be
501, PA317, ψ-2, ψ-AM, PA12, T
19-14X, VT-19-17-H2, {CRE,}
CRIP, GP + E-86, GP + envAm12,
And DAN cell lines (Miller, Human G)
ene Therapy, Vol. 1, pp. 5-14 (19
90)), but are not limited thereto.
And these are incorporated herein in their entirety.
Used. The vector may be any vector known in the art.
The steps can transduce the packaging cells. This
Such as electroporation, liposome
Use of CaPO _Four Precipitation.
It is not limited to. In another alternative, retrovirus
Rasmid vectors can be encapsulated in liposomes.
Or can be combined with a lipid and then administered to the host.
obtain. The producer cell line uses this polypeptide.
Infections containing the nucleic acid sequence (s) encoding the
Produces retroviral vector particles. Then,
Retroviral vector particles such as
To transduce a eukaryotic cell, either in vivo or in vivo.
Can be used for The transduced eukaryotic cells
Nucleic acid sequence (s) encoding the repeptide
Express. As eukaryotic cells that can be transduced, embryonic stem cells
Blastocysts, embryonic cancer cells, and hematopoietic stem cells, hepatocytes, fibroblasts
Cells, myoblasts, keratinocytes, endothelial cells, and
But not limited to bronchial epithelial cells
No. The present invention also relates to the present invention as a diagnostic method.
Concerning the use of genes. Detection of mutant forms of this gene
Thus, diseases or diseases caused by the under-expression of EMAP III
Allows the diagnosis of susceptibility to disease. An individual having a mutation in the gene of the present invention
Can be detected at the DNA level by various techniques. Examination
Nucleic acids for disruption may be obtained from patient cells (eg, blood, urine, saliva).
Fluids, tissue biopsies, and autopsy material, including
(Not limited). Genomic DNA is detected
Can be used directly for PCR or prior to analysis
(Saiki et al., Nature, 324: 163-1
66 (1986)).
RNA or cDNA may also be used for the same purpose.
Can be By way of example, nucleic acids encoding EMAP III
PCR primers that are complementary to
Can be used to analyze. For example, deletions and insertions
Is the size of the amplified product in comparison with the normal genotype.
It can be detected by a change. Point mutations release amplified DNA.
Radiolabeled RNA or radiolabeled antiserum.
By hybridizing with the DNA sequence
Can be done. Perfectly matched sequences are ready for RNase A digestion.
Or mismatched double strands due to differences in melting points
Can be distinguished. Between the control gene and the gene having the mutation
Sequence differences can be indicated by direct DNA sequencing.
You. In addition, cloned DNA segments are
Used as a probe to detect specific DNA segments
obtain. The sensitivity of this method, when combined with PCR,
Notably enhanced. For example, the sequencing primer
Double-stranded PCR product or single-stranded produced by modified PCR
Use with template molecules. Sequencing is radioactive
By conventional procedures using labeled nucleotides,
Or automated sequencing procedures using fluorescent tags
Is done. Genetic testing based on DNA sequence differences
DNA gels in gels, with or without denaturing reagents
Achieved by detecting changes in electrophoretic mobility of fragments
Can be done. Small sequence deletions and insertions in high resolution gels
It can be visualized by electrophoresis. DNA of different sequence
Fragments have different DNA fragment mobility
Their specific melting temperature or partial melting in gels
Denatured formua, delayed to different positions according to temperature
Can be identified on a mid-gradient gel (eg, Myers
Et al., Science, 230: 1242 (1985).
checking). A sequence change at a particular position may also
nuclease defense assays such as se and S1 defenses
A, or a chemical cleavage method (eg, Cotton et al.,
PNAS, USA, 85: 4397-4401 (1
985)). Therefore, detection of a specific DNA sequence is high.
Hybridization, RNase protection, chemical cleavage, direct
Indirect DNA sequencing or the use of restriction enzymes (eg,
Restriction fragment length polymorphism analysis (RFLP))
Achieved by methods such as Southern blot of DNA
Can be More convenient gel electrophoresis and DNA sequencing
In addition to decisions, mutations can also be determined by in situ analysis.
Can be detected. The present invention also relates to a normal control tissue
EMAP II overexpression of protein compared to pull
I of the present invention in various tissues because the presence of
Diagnostic methods to detect changes in the levels of
About sei. Polypeptide of the invention in a sample derived from a host
Assays used to detect peptide levels
Are well known to those of skill in the art, and
Radioimmunoassay, competitive binding assay, Wester
Blot analysis, and preferably an ELISA assay
Is mentioned. The ELISA assay is based on
An antibody specific to the PIII antigen (preferably monoclonal
(Null antibody). In addition, the reporter
Antibodies are prepared against monoclonal antibodies. Reporter
-The antibody may be radioactive, fluorescent, or, in this example,
Detectable assays such as horseradish peroxidase enzyme
Combined with drugs. Here, a sample is taken from the host.
Out and bind to proteins in the sample
Incubate on a support (for example, a polystyrene dish).
Beate. Then, any free tan on the dish
Non-specific proteins such as bovine serum albumin
By incubating with the target protein
U. Next, incubate the monoclonal antibody in the dish.
During which the monoclonal antibody becomes polystyrene.
Any polypeptide of the present invention bound to a dish
Join. All unbound monoclonal antibodies
Is removed by washing with a buffer. Where horseradish
Reporter antibody conjugated to oxidase
Placed in the menu, so that the reporter antibody is
Binds to any monoclonal antibody conjugated to the repeptide
I do. The unbound reporter antibody is then washed
To remove. The peroxidase substrate is then dissected.
And the amount of color development within a given time
Within a given dose of a patient sample when compared to the line.
It is a measure of the amount of the polypeptide of the invention present. A competition assay may be used, where
An antibody specific for the light polypeptide is bound to a solid support.
And labeled EMAP III and host derived
Sample passes through the solid support, and
The amount of the detected label bound is determined by the amount of the present invention in the sample.
It can be correlated to the amount of the polypeptide. The sequences of the present invention may also be used for chromosome identification.
Useful for This sequence is specific to each human chromosome
Specifically targeted to the position of
Can be Furthermore, at present, specific sites on the chromosome
Need to be identified. For actual sequence data (repeated polymorphism)
Based chromosome marking reagents currently map chromosome locations.
Hardly used for working. Departure
DNA mapping to light chromosomes is
Important in linking genes to disease-related genes
This is the first stage. [0101] Briefly, the sequence is the P
Preparation of CR primer (preferably 15-25 base pairs)
Can map to a chromosome. 3 'non-gene
Using computer analysis of translation regions, genomic DNA
Less than one or more exons in the
Quickly select primers that complicate Next
In these primers, the body containing individual human chromosomes
Used for PCR screening of cell hybrids
Is done. C containing the human gene corresponding to this primer
Only hybrids yield amplified fragments. PCR mapping of somatic cell hybrids
To quickly assign specific DNA to specific chromosomes
This is a quick procedure. Identical oligonucleotide primer
Using the present invention with subloca
ligation) in a similar fashion
Flags from pools of chromosomes or large genomic clones
This can be achieved using a panel of statements. To the chromosome
Other mappings that can also be used to map
As a ping strategy, in situ hybridization
Preparatory step using labeled flow-sorted chromosomes
Cleaning and live chromosome-specific cDNA live
Preliminary selection by hybridization with rally
I can do it. Metaphase chromosome spray of cDNA clones
Fluorescence in situ hybridization (F
ISH) provides accurate chromosomal localization in one step
Can be used to provide protection. This technology is less
Used with cDNA having both 50 or 60 bases
Can be done. For a review of this technology, see Verma et al.
Human Chromosomes: a Manu
al of Basic Technologies, P
ergamon Press, New York
(1988). Once the sequence maps to the exact chromosomal location
The physical location of the sequence on the chromosome
Data. Such data, for example,
If V. McKusick, Mendelian
Inheritance inMan (Johns H
opkins University WelchM
available online from electronic Library
A) is found. Then, map to the same chromosome region.
The relationship between the pinged gene and the disease was determined by linkage analysis (physical analysis).
Co-inheritance of closely adjacent genes). Next, the cD between affected and unaffected individuals
Need to determine differences in NA or genomic sequence
There is. Mutations found in some or all affected individuals
If not found in normal individuals,
The mutation appears to be responsible for the disease. The current physical mapping and the genetic mapping
Using the resolution of the ping technique, the chromosome region
The cDNAs located exactly in the region are 50 and 500
May be one of the potential causative genes during
Is 1 megabase mapping resolution and 20 kb
One gene). The polypeptides, their fragments
Or other derivatives or their analogs or
Cells that express them produce antibodies against them
Can be used as an immunogen to These antibodies
Are, for example, polyclonal antibodies or polyclonal
It can be an antibody. The invention also relates to chimeric, single-stranded,
And humanized antibodies and Fab fragments
Or the product of a Fab expression library. This
Various procedures known in the art can be used to construct such antibodies and antibodies.
It can be used for the production of fragments. For polypeptides corresponding to the sequences of the present invention,
Antibodies produced by this method direct the production of this polypeptide into animals.
By indirect injection, or in animals (preferably
Or non-human animals). Next
Thus, the antibody obtained in this way is
Be combined. In this manner, the polypeptide of this polypeptide
Even sequences encoding only fragments can be
Can be used to produce antibodies that bind to the entire peptide
You. Such antibodies then express the polypeptide.
Used to isolate this polypeptide from different tissues.
obtain. For preparation of monoclonal antibodies, serial
To provide antibodies produced by a typical cell line culture
Techniques may be used. As an example, hybridoma technology
(Kohler and Milstein, 1975,
Nature, 256: 495-497), Trio
Trioma technology, human B cell hybridoma technology
Surgery (Kozbor et al., 1983, Immunolog)
y Today 4:72), and human monochroma
EBV hybridoma technology (C
ole et al., 1985, in Monoclonal.
Antibodies and Cancer The
rapy, Alan R .; Liss, Inc. ,
77-96). The techniques described for the production of single-chain antibodies
(US Pat. No. 4,946,778) is a license of the present invention.
Produce single-chain antibodies to epidemiological polypeptide products
Can be adapted for Also, transgenic mice
Are humanized against the immunogenic polypeptide product of the invention.
It can be used to express antibodies. The present invention is described with reference to the following examples.
Both are further described; however, the present invention does not
It should be understood that the invention is not limited to the examples. all
Parts or amounts are by weight unless otherwise indicated
Things. To facilitate understanding of the following examples,
Describe certain frequently occurring methods and / or terms
You. “Plasmids” are capitalized and / or
A lowercase p preceded and / or followed by a digit
Is shown. Any of the starting plasmids herein
Are also commercially available and publicly available on unrestricted standards.
Available or publicly available from available plasmids
It can be built with the procedure shown. Further described
Plasmid equivalents to plasmids are known in the art.
And will be apparent to those skilled in the art. “Digestion” of DNA refers to specific arrangements in the DNA.
Catalytic cleavage of DNA using restriction enzymes that act only on sequences
Say. The various restriction enzymes used herein are commercially available
And its reaction conditions, cofactors, and other
The requirements were used as known to those skilled in the art. Analytical
For purposes, typically 1 μg of plasmid or D
The NA fragment is approximately 2 units in approximately 20 μl of buffer.
Used with enzymes. DN for plasmid construction
For the purpose of isolating the A fragment, typically
5 to 50 μg of DNA at higher doses
Digested with 250 units of enzyme. For certain restriction enzymes
The appropriate buffer and substrate amounts are determined by the manufacturer.
Specified. About 1 hour, 37 ° C incubation time
Usually used, but can vary depending on the orientation of the supplier. Extinction
After the reaction, the reaction was electrophoresed directly on a polyacrylamide gel.
And the desired fragment is isolated. The size separation of the cleaved fragments
Goeddel, D.A. Et al., Nucleic Acid
s Res. , 8: 4057 (1980).
This is performed using a polyacrylamide gel. "Oligonucleotides" are chemically synthesized
A single-stranded polydeoxynucleotide, or 2
One of the two complementary polydeoxynucleotide chains
Say. Such synthetic oligonucleotides are 5 'phosphorous
It has no acid and therefore is released with ATP in the presence of the kinase.
Binds to another oligonucleotide if no phosphate is added
do not do. Synthetic oligonucleotides are dephosphorylated
With the missing fragment. "Ligation" refers to a double-stranded nucleic acid fragment
A step of forming a phosphodiester bond between (M
aniatis, T .; Et al., Ibid., Page 146). other
If not provided, ligation reaction was performed with 0.5 μg of ligation
10 units per equimolar amount of DNA fragment to be
Using T4 DNA ligase ("ligase")
This can be achieved using known buffers and conditions. Unless otherwise stated, transformation was performed using Gra
ham, F .; And Van der Eb. ,
A. , Virology, 52: 456-457.
(1973). The following drawings are illustrative of embodiments of the present invention.
And the scope of the present invention, which is intended to be
It does not mean to limit the enclosure. The human EMAP III polypeptide and
And DNA encoding such a polypeptide (RN
A), as well as such polypeptides by recombinant techniques.
Disclosed are procedures for producing the compounds. Also, such a polype
Peptides are useful for the prevention and / or treatment of neoplasms.
The method of use is disclosed. Also detects diseases, such as cancer
The nucleic acid sequence encoding the polypeptide of the present invention.
To identify mutations in a sequence
Diagnostic assays to detect changes in peptide levels
Disclose a. EXAMPLES Example 1 Bacterial Expression and Purification of EMAP III EMAP
III encoding DNA sequence (ATCC accession no.
No.), processed EMAP III protein
Corresponding to the 5 'sequence (excluding the signal peptide sequence)
PCR oligonucleotide primers and EMAP
First using the vector 3 'sequence for the III gene
Amplify. More Nucles for EMAP III
Otides were added to the 5 'and 3' sequences, respectively.
5 'oligonucleotide primers are BamHI restricted
Sequence 5 'GATCGGATCCGAGG containing enzyme site
AGGTCATCCCATCAT3 ′ (SEQ ID NO: 3)
And the first amino acid of the processed protein
EMAP III coding sequence beginning with noic acid (Glu)
Followed by 3 'sequence, 5'GATCAAGCTTCTA
GATAATGTTCCCCCCC3 '(SEQ ID NO: 4)
Contains a sequence complementary to the HindIII site, and
And the EMAPIII coding sequence starting from the terminal amino acid
A row of nucleotides follows. This restriction enzyme site is
The current vector pQE-9 (Qiagen, Inc. C
hatsworth, CA, 91311)
Corresponds to the elementary part. pQE-9 is resistant to antibiotics (Am
p ^r ), Bacterial origin of replication (ori), IPTG regulated
Promoter operator (P / O), ribosome binding
Site (RBS), 6-His tag, and restriction enzyme site
Code. Next, pQE-9 was transferred to BamH1 and BamH1.
And HindIII. The amplified sequence was converted into pQE-
9 and histidine tag and RBS
In frame with the sequence to be loaded. Then,
Using the compound, coli strain M15 / rep4
(Qiagen, Inc.) to Sambrook,
J. Et al., Molecular Cloning: A
Laboratory Manual, Cold S
spring Laboratory Press,
(1989). M15
/ Rep4 contains multiple copies of plasmid pREP4
Which expresses the lacI repressor and
Kanamycin resistance (Kan ^r ). Transformation
Identify bodies by their ability to grow on LB plates
And clone ampicillin / kanamycin resistant colonies
Selected. Isolate plasmid DNA and use restriction enzymes
Confirmed by analysis. Clones containing the desired construct are
Amp (100 μg / ml) and Kan (25 μg / m
l) overnight in liquid culture in LB medium supplemented with both
(O / N) was propagated. 1: 1 using O / N culture
Large cultures were inoculated at a ratio of 00 to 1: 250. cell
With an optical density (O.D.) of 600 between 0.4 and 0.6.
D. ⁶⁰⁰ ). Then, IPTG ("Isop
Ropyl-BD-thiogalactopyranoside ")
Final concentration was 1 mM. IPTG is a lacI replay
To increase gene expression by inactivating
Clear and guide the leading P / O. Cells
Propagated for an additional 3-4 hours. The cells are then centrifuged
Collected by The cell pellet is transferred to the chaotropic agent 6
Solubilized in M guanidine HCl. After clarification, solubilization
The isolated EMAPIII as a protein containing 6-histag
Under conditions that allow for a firm bond by quality,
This solution was chromatographed on a rate column.
(Hochuli, E. et al., J. Chr.
omatography 411: 177-184
(1984)). EMAP III protein (> 90
% Purity) was eluted from the column at pH 5.0 and
And dialysis against decreasing concentrations of GnHCl
And finally 20 mM Tris HCl (pH 8.
0); 59 mM NaCl; 0.1% w / v octyl
Dialysis was performed in a buffer containing -β-glycoside. Soluble
Protein concentration was determined using the BioRad assay.
And assayed for bacterial LPS contamination. Example 2 (EMAP III Using Baculovirus Expression System)
Cloning and Expression) Full Length EMAP III Tan
DNA sequence encoding the protein (ATCC Accession No.
Symbol) with the P's corresponding to the 5 'and 3' sequences of this gene.
Amplify using CR oligonucleotide primers:
The 5 'primer has the sequence (SEQ ID NO: 5) and a BamHI restriction enzyme site
(Bold), the first 18 nucleotides of the EMAP III gene
Including otide. The 3 'primer had the sequence 5' GATCGG
ATCCCTTAGATAATGTTCCCCCCC3 '
(SEQ ID NO: 6) and the restriction endonuclease Bam
HI cleavage site and 3 'of EMAP III gene
Contains 18 nucleotides complementary to the sequence. The amplified sequence,
A commercially available kit (“Geneclean” BIO 10
1 Inc. , La Jolla, Ca. )
And isolate from a 1% agarose gel. Then the flag
Is digested with the endonuclease BamHI.
And purified again with a 1% agarose gel. This flag
This is referred to as F2. The vector pRG1 (pVL941 vector
Using a baculovirus expression system
Used for expression of EMAP III protein (total
On the theory: Summers, M .; D. And Smi
th, G. E. FIG. 1987, A manual
f methods for baculovirus
vectors and insect cell
culture procedures, Texas
Agricultural Experimenta
l Station Bulletin No. Fifteen
55). This expression vector is Autog
rapha californica nuclear polyhedrosis virus
(AcMNPV) strong polyhedrin promoter,
Subsequent recognition of the restriction endonuclease BamHI
Including position. Simian virus (SV) 40 polyadenylate
Site is used for efficient polyadenylation.
For easy selection of recombinant viruses, E. coli was used. col
i-derived β-galactosidase gene into polyhedrin
Polyhedrin pro followed by the gene polyadenylation signal.
Insert in the same direction as the motor. Polyhedrin sequence
Cell-mediated phase of transfected wild-type viral DNA
Flanked at both ends by viral sequences for the same recombination
You. Many other baculovirus vectors contain pRG1
Can be used instead of For example, pAc373, pV
L941, and pAcIM1 (Luckow,
V. A. And Summers, M.A. D. , Vir
ology, 170: 31-39). Digestion of plasmid with restriction enzyme BamHI
And calf intestinal phosphatase by procedures known in the art.
Dephosphorylate using a vatase. Next, a commercially available kit
("Geneclean" BIO 101 Inc.
DNA was purified using La Jolla, Ca).
% Agarose gel. This vector DNA
V2. Fragment F2 and dephosphorylation plus
Mid V2 is ligated using T4 DNA ligase.
Then, E. E. coli HB101 cells
And EMAP III using the enzyme BamHI.
Plasmid containing the gene (pBac EMAP II
Bacteria containing I) are identified. Of the cloned fragment
The sequence is confirmed by DNA sequencing. 5 μg of plasmid pBac EMAP
III by the lipofection method (Felgner et al.
rc. Natl. Acad. Sci. US
A, 84: 7413-7417 (1987)).
1.0 μg of commercially available linearized baculovirus
("BaculoGold ^TM baculovirus
DNA ", Pharmingen, San Die
go, CA. ) And co-transfect. 1 μg of BaculoGold ^TM Virus
DNA and 5 μg of plasmid pBac EMAP
III in 50 μl serum-free Grace's medium (Lif
eTechnologies Inc. , Gaith
ersburg, MD)
Mix in sterile wells of the plate. After that, 10μl liposome
Add fectin and 90 μl Grace's medium and mix.
And incubate at room temperature for 15 minutes. Next
The transfection mixture is serum-free
35 mm tissue culture plate with 1 ml Grace's medium
Sf9 insect cells (ATCC CRL 1
711). Add a new plate
Shake back and forth to mix the solution. Then
Plates are incubated at 27 ° C. for 5 hours. 5 o'clock
After a while, remove the transfection solution from the plate
And 1 ml of gray supplemented with 10% fetal calf serum.
Add the source insect medium. Plate in incubator
And continue the culture at 27 ° C. for 4 days. After four days, the supernatant was collected and the Summe
rs and Smith (supra)
Perform a work assay. As a modification, blue stained
"Blue Ga" allows for easy isolation of larks.
l ”(Life Technologies In
c. , Agarose containing (Gaithersburg)
Use gel. (Detailed description of “plaque assay”
In addition, Life Technologies In
c. Insects distributed by Gaithersburg
User Guide for Cell Culture and Baculovirology (9
10 to 10)). 4 days after serial dilution, virus was added to cells
And plaque stained blue with Eppendorf
Pick up with pet chips. Then contains the recombinant virus
Add agar to Eppendorf containing 200 μl Grace's medium
Resuspend in tube. The agar is removed by simple centrifugation.
And remove the supernatant containing the recombinant baculovirus.
Sf9 cells seeded on a 35 mm dish using
Infect. Four days later, the supernatant of these culture dishes was
Collect and then store at 4 ° C. Sf9 cells were supplemented with 10% heat-inactivated FBS.
Grow in filled Grace's medium. Multiply cells by infection
Recombinant baculovirus V-EMAP at a degree (MOI) of 2
Infect with III. Six hours later, the medium is removed,
And SF900 excluding methionine and cysteine
II medium (Life TechnologiesIn
c. , Gaithersburg). 4
2 hours later, 5 μCi ³⁵ S-methionine and 5 μCi
of ³⁵ S-cysteine (Amersham) is added. Fine
The cells are incubated for a further 16 hours, after which the cells are
Collect by centrifugation and remove labeled protein
By SDS-PAGE and autoradiography
Visualize. (Example 3) (Expression of recombinant EMAP III in COS cells)
Expression of plasmid, EMAP III HA, vector
-From pcDNAI / Amp (Invitrogen)
Induce. The vector pcDNAI / Amp contains:
1) SV40 origin of replication, 2) Ampicillin resistance inheritance
Child, 3) E. E. coli origin of replication, 4) Polylinker domain
Followed by the SV40 intron and polyadenylation site
CMV promoter. Complete EMAP III precursor
And the H fused in frame to its 3 'end
The DNA fragment encoding the A tag is
Clone into the polylinker region. Therefore, recombination
Protein expression is directed under the CMV promoter.
The HA tag is for influenza red blood as described above.
Corresponds to an epitope from the hemagglutinin protein (I.
Wilson, H .; Niman, R .; Height
en, A Cherenson, M .; Connoll
y, and R.I. Lerner, 1984, Cell
37, 767). HA tag fusion to target protein
Using an antibody that recognizes the HA epitope
Easy detection of proteins becomes possible. The plasmid construction strategy is described below:
DNA sequence encoding MAP III (ATCC contract)
No.) was obtained by PCR using two primers.
Construct: 5 'primer Starts with a BamHI site followed by a start codon
Contains 18 nucleotides of the EMAP III coding sequence
MU; 3 'sequence 5' GATCAAGCTTCTAGAT
AATGTTCCCCC3 'is the BamHI site,
Translation stop codon, HA tag, and EMAP III
Sequence complementary to the last 18 nucleotides of the
No. Therefore, the PCR product has a BamHI site,
EMAP III code followed by a frame-fused HA tag
Sequence and a translation termination stop codon adjacent to the HA tag.
Including. PCR amplified DNA fragments and vectors
(PcDNAI / Amp) with BamHI restriction enzyme
Digest and ligate. The ligation mixture is co
li SURE strain (Stratagene Cloni
ngSystems, La Jolla, CA 9
2307) and transformant culture is
Plate and select resistant colonies
You. Isolating the plasmid DNA from the transformant; and
The presence of the correct fragment is tested by restriction analysis. Recombination
For expression of EMAP III, COS cells were
Transformation with expression vector by AE-DEXTRAN method
(J. Sambrook, E. Fri)
tsch, T .; Maniatis, Molecula
r Cloning: A Laboratory M
annual, Cold Spring Labora
tory Press, (1989)). EMAP
III. Expression of HA protein is determined by radiolabeling and
Detection by the epidemic sedimentation method (E. Harlow,
D. Lane, Antibodies: A La
laboratory Manual, Cold Spr
ing Harbor Laboratory Pre
ss, (1988)). Transfect cells
Two days after ³⁵ Label with S-cysteine for 8 hours. Next
The culture medium is harvested with and the cells are washed with a detergent (RIP
A buffer (150 mM NaCl, 1% NP-40,
0.1% SDS, 1% NP-40, 0.5% DO
C, dissolve in 50 mM Tris (pH 7.5)
(Wilson, I. et al., Supra, 37: 767 (1.
984)). Both cell lysate and culture medium were
Precipitate with specific monoclonal antibody. Sank
Analyze proteins by 15% SDS-PAGE gel
I do. Example 5 (Expression via Gene Therapy) Fibroblasts were obtained from a subject.
Obtained by skin biopsy. The resulting tissue is placed in tissue culture medium
And cut into small sections. Small section of tissue
Place on a wet surface of a tissue culture flask and
Place about 10 sections in the tube. Turn the flask upside down
Keep tightly closed and leave at room temperature overnight. 2 at room temperature
After 4 hours, the flask is inverted and the tissue mass is flashed.
Keep on the bottom of the cocoon and add fresh medium (e.g.,
For example, 10% FBS, penicillin, streptomycin
(Fam medium containing ham F12). Then, change this to 3
Incubate at 7 ° C for about 1 week. At this point, fresh
Fresh medium is added and subsequently changed every few days. Sa
After an additional two weeks of culture, a monolayer of fibroblasts results. Single layer
Trypsinized and expanded to a larger flask
(Scale). Moloney murine sarcoma virus long terminal repeat
PMV-7 (Kirschmeier,
P. T. Et al., DNA, 7: 219-25 (198
8) digestion with EcoRI and HindIII
Followed by treatment with calf intestinal phosphatase. Linear
The vector is separated on an agarose gel and
Purify using a column. CDN encoding the polypeptide of the present invention
A is the PR corresponding to the 5 'and 3' terminal sequences, respectively.
Amplify using C primer. The 5 'primer is E
A coRI site and the 3 'primer was Hin
It contains a dIII site. Equivalent amount of Moloney mouse sarcoma virus
Linear backbone and amplified EcoRI and Hin
The dIII fragment was converted to the presence of T4 DNA ligase.
Add together below. The resulting mixture is
Are maintained under conditions appropriate for ligation of components. Use concatenated mixture
To transform the bacterium HB101,
Has the target gene into which the vector has been properly inserted.
Agar plates containing kanamycin
Plating on rates. Amphoteric pA317 or GP + am12
Packaging cells were transferred to 10% calf serum (CS)
Dulbecco's Modifications Including Nicillin and Streptomycin
In tissue culture in modified Eagle's medium (DMEM)
Grow to confluent density. Then, this genetic
The MSV vector containing the vector is added to the medium, and the
The soaking cells are transduced with the vector. Here is the package
Gingival cells are infectious viruses containing this gene
Produce particles (where the packaging cells are
Suppressor cells). The fresh medium was transformed with the transduced product.
The confluent product.
Collect medium from 10 cm plate of donor cells. Feeling
The spent medium containing the infectious virus particles is
Producer that was filtered through a pore filter and peeled off
The cells are removed and then the fibroblasts are
Infect vesicles. Culture medium is subconfluent for fibroblasts.
Removed from the fresh plate and immediately
-Replace with medium from cells. Remove this medium and remove
And replace with fresh medium. High virus titer
In effect, virtually all fibroblasts are infected and the selection is
Not necessary. If the titer is very low, select the marker
Retrovirus having (eg, neo or his)
It is necessary to use a vector. The engineered fibroblasts were then used alone,
Alternatively, on Cytodex 3 microcarrier beads
After confluent growth at
inject. Here, fibroblasts produce protein products.
Live. Many modifications and variations of the present invention are described above.
It is possible in light of the teachings and, therefore,
If so, the present invention can be practiced within the scope of the appended claims.
You. Since the present invention has the above-described structure,
The stated task is achieved. [Table 1A] [Table 1B] [Table 1C]

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A shows the cDNA sequence and the corresponding deduced amino acid sequence of the polypeptide of the invention. Sequencing was performed using a 373 automated DNA sequencer (Applied
Biosystems, Inc. ). FIG. 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of a polypeptide of the invention. Sequencing was performed using a 373 automated DNA sequencer (Applied
Biosystems, Inc. ). FIG. 2 shows polypeptides of the present invention (top row) and EM
Amino acid sequence comparison with AP III (lower row).

Continuation of front page    (71) Applicant 597018381             9410 Key West Avenue,               Rockville, Marylan             d 20850, United State             s of America (72) Inventor Timothy A. Coleman             United States Maryland 20879,               Geysersburg, Boxberry             Terrace 7512 (72) Inventor Henrik S. Allsen             United States Maryland 20878,               Geysersburg, Kendrick P             Wraith 182 (72) Inventor Craig A. Rosen             United States Maryland 20882,               Layton'sville, Rolling Hill             Road 22400 F term (reference) 4B024 AA01 AA12 BA80 CA02 CA07                       CA20 DA02 DA06 EA02 EA04                       GA11 GA18 GA19 GA27 HA03                       HA17                 4H045 AA10 AA20 BA10 BA41 CA40                       EA20 FA74 GA26

Claims (1)

Claims 1. An isolated polynucleotide, comprising:
The following: (a) a polynucleotide encoding a polypeptide comprising amino acids 1 to 168 of FIGS. 1A-B; (b) a polynucleotide encoding a mature polypeptide having an amino acid sequence expressed by the DNA contained in ATCC Accession No. (C) a polynucleotide capable of hybridizing with the polynucleotide (a) or (b) and at least 70% identical thereto; and (d) the polynucleotide (a), (b) or ( An isolated polynucleotide comprising a member selected from the group consisting of: a polynucleotide fragment of c).