JP2001228148A - Organism-associated substance microarray and detecting method using it - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an organism-associated substance-immobilized gel-retaining fiber alignment body thin piece improved in visual confirmability so that a defect of a gel or the like in manufacture can be easily detected, and the adhesion of bubbles or the deformation or falling of the gel in hybridization operation can be easily detected, and a detection method using it. SOLUTION: This organism-associated substance- and pigment-immobilized gel-retaining fiber alignment body thin piece can be obtained by cutting a fiber alignment body containing a bundle of fibers on which the gel having an organism-associated substance and a pigment immobilized thereon is retained in the direction crossing the fiber axis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a biomaterial microarray composed of a fiber array thin section holding a gel containing a biomaterial and a dye, and a detection method using the same. The microarray can be used for clinical tests, food tests, and the like.

[0002]

2. Description of the Related Art In recent years, genome projects for various organisms have been promoted, and a large number of genes including human genes and their base sequences have been rapidly identified. The function of the sequenced gene can be examined by various methods. As one of the promising methods, gene expression analysis using the revealed base sequence information is known. For example, methods using various nucleic acid: nucleic acid hybridization reactions and various PCR reactions, such as Northern hybridizations, have been developed, and the method is used to examine the relationship between various genes and their biological function expression. Can be. Although these methods have limitations on the number of genes that can be applied, the synthesis of a very large number of genes at the individual level, as revealed through today's genomic projects,
DNA microarray method (DNA chip method) that enables simultaneous expression analysis of many genes for systematic analysis
A new analytical method, called methodology, has been developed.

The present inventors have previously developed a novel microarray (JP-A-2000-270877, JP-A-2000-270878,
JP-A-2000-270879). In these inventions, a nucleic acid-immobilized gel holding fiber array for holding a nucleic acid-immobilized gel on the surface or a void portion of a fiber is produced, and a slice is obtained by cutting the fiber array in a direction intersecting the fiber axis of the array. Things. This slice is used as a nucleic acid-immobilized two-dimensional high-density array, that is, a DNA microarray.

[0004]

However, since the fiber array flakes are microarrays using a transparent gel, the gel may fall off, shrink, or shrink during the microarray manufacturing process or during an inspection using the microarray. Even if deformation occurs, it is not easy to detect visually. In the method for detecting the formation of a hybrid between a capture probe and a sample, the capture probe forms a hybrid with a fluorescently labeled sample, and then detects the amount of fluorescence with a fluorescence measurement device such as a fluorescence laser scanner or a fluorescence microscope. However, it is difficult to accurately recognize the fluorescence corresponding to each section position divided by the fiber in the case of a sample with low fluorescent label intensity or a microarray with low alignment accuracy. And it was difficult to detect accurately. Further, unevenness of the intensity of the excitation light in the irradiation area of the fluorescence detection device and unevenness of the fluorescence intensity due to the configuration of the optical system occur, and there has been a problem that the detection of hybridization cannot be accurately performed.

The present invention relates to a biomaterial having improved visibility, which can easily detect gel detachment or the like in a manufacturing process, and can easily detect adhesion of bubbles, deformation or detachment of gel in a hybridization operation. An object of the present invention is to provide an immobilized gel holding fiber array flake. At the same time, it is possible to provide a bio-related substance-immobilized gel-holding fiber array thin section that can accurately recognize fluorescence corresponding to each section position divided by fibers and can easily and accurately detect fluorescence intensity. With the goal.

[0006]

Means for Solving the Problems As a result of intensive studies to solve the above problems, the present inventors have previously immobilized a dye, for example, a fluorescent dye, on a gel arranged in each section divided by fibers. As a result, the present inventors have found that filling, deformation, and falling off of the gel during production and hybridization can be easily detected using a fluorescence microscope. In addition, in the detection method for detecting the formation of a hybrid between a biological substance and a specimen immobilized on a microarray, the position (coordinates) of each section divided by the fiber can be accurately recognized, and the position (coordinates) of each section It has been found that the fluorescence intensity corresponding to ()) can be accurately detected. Further, in a detection method for detecting hybridization between a biological substance immobilized on a microarray and a specimen, a fluorescence detection device, for example, a fluorescence intensity spot caused by a light source can be easily detected and corrected, so that hybridization can be performed. The present inventors have found that the detection of can be performed quantitatively, and have reached the present invention.

[0007] That is, the present invention can be obtained by [1] cutting a fiber array formed by converging a plurality of fibers holding a gel containing a biological substance and a dye in a direction intersecting the fiber axis. It is a bio-related substance microarray.
Examples of the biological substance include nucleic acids, and examples of the dye to be immobilized include those having a fluorescence wavelength of 350 nm to 500 nm. Examples of such a fluorescent dye include a fluorescein derivative and a coumarin derivative. Examples of the gel include those made of a water-soluble monomer. An example of such a monomer is an acrylamide monomer. Examples of the fiber include a hollow fiber, a porous fiber, and a porous hollow fiber. Further, the present invention relates to [2]
A method for detecting hybridization between a capture probe and a sample held in each section of the biologically relevant substance microarray, comprising the following steps. (1) A microarray is exposed to light having a wavelength that can excite a dye previously immobilized on a gel, and the fluorescence emitted from the dye is detected. (2) Obtain positional information of each section divided by the fibers constituting the microarray. (3) Using the obtained position information, a capture probe and a sample hybrid are detected. [3] A method for detecting the generation of a hybrid between a capture probe held in each section of the biologically relevant substance microarray and a fluorescently labeled specimen, comprising the following steps: (1) A microarray is exposed to light of a first wavelength capable of exciting a dye immobilized on a gel in advance and detecting fluorescence emitted from the dye. (2) Obtain information on the intensity and / or intensity distribution of the fluorescence in the first step. (3) A hybridization reaction between the capture probe and the fluorescent-labeled sample is performed, and the generation of a hybrid is detected by light having a second wavelength at which the fluorescent-labeled sample can be excited. (4) The obtained fluorescence intensity is corrected based on the information on the fluorescence intensity and / or intensity distribution obtained in the second step. [4] In the method for inspecting a biological-related substance microarray, the gel immobilized on the gel is exposed to light having a wavelength excitable to the microarray, and the emitted fluorescence is detected. A method for inspecting a microarray of a biologically relevant substance, characterized by evaluating the shape of the microarray.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION As biologically relevant substances to be immobilized on a gel, nucleic acids such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), oxypeptide nucleic acid (OPNA) and the like are used. And polysaccharides. These may be any of commercially available products or those obtained from living cells. For example, when a nucleic acid is used as a biological substance, preparation of DNA or RNA from living cells can be performed by a known method. For example,
For DNA extraction, the method of Blin et al. (Nucleic Acids
Res.3.2303 (1976)), and for extraction of RNA, the method of Favaloro et al. (Methods.Enzymol.65.718 (19
80)). Furthermore, a linear or circular plasmid DNA or chromosomal DNA can also be used. The DNA may be a restriction enzyme or a chemically cut DNA fragment, a DNA synthesized by an enzyme or the like in a test tube.
Alternatively, a chemically synthesized oligonucleotide or the like can be used.

The gel which can be used in the present invention is not particularly limited. Examples thereof include acrylamide, N, N-dimethylacrylamide, N-isopropylacrylamide, N-acryloylaminoethoxyethanol, N-
At least one or more monomers selected from acryloylaminopropanol, N-methylolacrylamide, N-vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, allyldextrin, and methylene bis (meth) acrylamide, polyethylene glycol A gel obtained by copolymerizing a polyfunctional monomer such as (meth) acrylate in an aqueous medium can be used. In addition, agarose, alginic acid, dextran,
Gels such as polyvinyl alcohol and polyethylene glycol or gels obtained by crosslinking these gels can be used.

In the present invention, the bio-related substance may be immobilized on the gel as it is, or a derivative obtained by chemically modifying the bio-related substance or a bio-related substance denatured as necessary may be immobilized. Good. For immobilization of the bio-related substance on the gel, a method of physically enclosing the gel or direct binding to the gel component may be used. May be covalently or non-covalently bonded to the carrier, and the carrier may be immobilized on a gel.

For example, in order to bind a nucleic acid directly as a biological substance to a gel component, a vinyl group is introduced into a terminal group of the nucleic acid (see WO98 / 39351), and the gel component such as acrylamide is used. It can be carried out by copolymerization. When a vinyl group is introduced into a terminal group of a nucleic acid via a glycidyl group, it is necessary to modify the nucleic acid in advance, but the modification is not particularly limited as long as it reacts with the glycidyl group. For example, those having an amino group introduced can be used.

Regarding the method of introducing an amino group, for example, in the case of deoxyribonucleic acid (DNA), an amino group and a single-stranded D
The binding site of NA may be at the 5 'end, 3' end of the DNA, a phosphodiester site or a base site in the chain, but is preferably bonded at the 5 'end or 3' end of the DNA. The single-stranded DNA derivative is Japanese Patent Publication No. 3-74239,
It can be prepared according to the methods described in each gazette such as US Pat. No. 4,667,025 and US Pat. No. 4,789,737. In addition to the above method, for example, a commercially available reagent for introducing an amino group, for example, aminolink II (manufactured by PE Biosystems Japan),
A well-known method of introducing an aliphatic hydrocarbon chain having an amino group into the 5′-terminal phosphate of DNA using Amino Modifiers (manufactured by Clontech) or the like (Nucleic Acids Re
s., 11 (18), 6513- (1983)).

The dyes usable in the present invention are mainly classified into natural dyes and synthetic dyes. Representative examples of natural pigments include flavone derivatives, chalcone derivatives, anthraquinone derivatives, indigo derivatives and the like. Representative examples of synthetic dyes include azo dyes, anthraquinone dyes, indigoid dyes, diphenylmethane dyes, triphenyl dyes, xanthene dyes, and acridine dyes.
In particular, some of the above dyes and dyes have fluorescence. The type of fluorescent dye that can be used in the present invention is not particularly limited as long as it emits fluorescence,
For example, Rhodamine, Texas Red, Fluorescein, fluorescein isothiocyanate (FITC), Oregon Green,
Pacific Blue, R-Phycoerythrin, Rhodol Green, Couma
rin derivatives, Amino Methyl Coumarin and the like.

The method for immobilizing the dye used in the present invention is as follows.
Examples thereof include a method of immobilizing a dye directly on a gel, a method of chemically modifying a dye, and a method of immobilizing a denatured dye as necessary. The dye may be immobilized on the gel by a method of physically encapsulating the dye in the gel or by direct binding to the gel component. Alternatively, the dye may be once bound to a carrier such as polymer particles or inorganic particles by a covalent bond or a non-covalent bond, and the carrier may be immobilized on a gel.

For direct attachment of the dye to the gel component, for example, Fluorecein Dimethacac (Polyscience) is used.
A method in which rylate or 1-Pyrenylmethyl Methacrylate is used to copolymerize with a gel component such as acrylamide, and a dye derivative having an amino group is glycidyl methacrylate (G
MA) to introduce a polymerizable vinyl group and then copolymerize with a gel component such as acrylamide, or a method of introducing an anionic monomer into the gel and ionically bonding a cationic dye. Can be mentioned.

According to the present invention, when a sample using a fluorescent label is subjected to hybridization to detect a hybrid, a fluorescent dye having a specific wavelength is immobilized on the gel in advance, thereby improving the visibility of the gel. It is possible to provide a biologically relevant substance microarray including a gel having a high degree of transparency provided. The fluorescent label of the specimen is less susceptible to the autofluorescence of members constituting the microarray (in the present invention, a support for immobilizing a biological substance as a capture probe, ie, a gel, a fiber, an adhesive, etc.) Since it is preferable to use fluorescence having a long wavelength of at least nm, the fluorescence wavelength of the fluorescent dye immobilized on the gel in advance should be within the visible light range.
Preferably, it has a short wavelength of 0 nm to 500 nm. Preferred examples of the fluorescent dye to be immobilized on a gel in advance include Fluoresc
Preferred are fluorescein derivatives such as ein, fluorescein isothiocyanate (FITC) and coumarin derivatives such as Amino Methyl Coumarin. In the present invention, the amount of the dye to be immobilized is not particularly limited, and can be arbitrarily adjusted. Usually, it is 100 fmol to 10 atmol for each fiber fragment constituting each section of the microarray. The amount of the dye to be immobilized is determined independently of the amount of the bio-related substance to be immobilized, and need not be equal to or proportional to the bio-related substance, but in all the fiber fragments included in the array, Preferably, the amounts are equal. In particular, for the purpose of correcting the light intensity distribution based on the optical system of the detection device, it is necessary that each fiber fragment contains an equal amount of dye.

The fibers that can be used in the present invention include synthetic fibers, semi-synthetic fibers, regenerated fibers, chemical fibers such as inorganic fibers, and natural fibers. Representative examples of synthetic fibers include polyamide-based fibers such as nylon 6, nylon 66, and aromatic polyamide; polyester-based fibers such as polyethylene terephthalate, polybutylene terephthalate, polylactic acid, and polyglycolic acid; and polyacrylonitrile. Various acrylic fibers, various polyolefin fibers such as polyethylene and polypropylene,
Various kinds of polyvinyl alcohol fiber fibers, various kinds of polyvinylidene chloride fibers, polyvinyl chloride fibers, various kinds of polyurethane fibers, phenol fibers, fluorine fibers made of polyvinylidene fluoride, polytetrafluoroethylene, etc., polyalkylene paraoxyl Various benzoate-based fibers and the like can be mentioned. Also, other than for clothing, for example,
Optical fibers or the like mainly composed of a transparent amorphous polymer such as polymethyl methacrylate or polystyrene can also be used. Representative examples of the semi-synthetic fibers include various cellulose-based fibers made from cellulose diacetate, cellulose triacetate, chitin, chitosan, and the like, and various protein-based fibers called promix. Representative examples of the regenerated fiber include various cellulose-based regenerated fibers (rayon, cupra, polynosic, etc.) obtained by a viscose method, a copper-ammonia method, or an organic solvent method. Representative examples of the inorganic fibers include glass fibers and carbon fibers. Representative examples of natural fibers include cotton,
Plant fibers such as flax, ramie and jute; animal fibers such as wool and silk; and mineral fibers such as asbestos.

The structure of the fiber used in the present invention is not particularly limited, and may be a monofilament or a multifilament. Further, a spun yarn obtained by spinning short fibers may be used. In addition, when using the fiber of a multifilament or a spun yarn, it is also possible to utilize the space | interval etc. between single fibers for holding the bio-related substance fixed gel. The fibers used in the present invention may have a porous structure. The cross-sectional shape may be not only a circular cross-section but also an irregular cross-section such as a flat cross-section or a hollow cross-section. In particular, it is preferably hollow from the viewpoint of uniformly fixing the gel.

In order to hold the gel on the fiber, a monomer such as acrylamide as a gel constituent, a polyfunctional monomer,
The fibers may be immersed in a liquid containing a polymerization initiator, a dye, and a bio-related substance component to polymerize and gel. At this time, the dye and / or
Alternatively, as described above, it is preferable that the bio-related substance is bound to a carrier such as a monomer such as acrylamide which is a gel component, polymer particles, and inorganic particles. Gelation is a method of copolymerizing in the presence of a polyfunctional monomer,
The copolymerization may be carried out in the absence of a polyfunctional monomer, and then using a crosslinking agent. In addition, a method of heating and dissolving agarose or the like on which a bio-related substance is immobilized, immersing the fiber, and cooling and gelling may be mentioned.

When the fiber is a hollow fiber or a porous hollow fiber, instead of immersing the fiber in a liquid containing each of the above-mentioned components, the liquid is injected or sucked into the hollow part and / or the porous part of the fiber. After filling by doing, gelation may be performed. The procedure for holding the gel in the hollow portion and / or the porous portion of the hollow fiber or the porous hollow fiber may be before or after forming a fiber array described later.

[0021] The bio-related substance and the dye-fixed gel-holding fiber prepared as described above can be converged and closely adhered to form a bio-related substance and the dye-fixed gel-holding fiber array. At this time, by regularly arranging the fibers and bonding them with a resin adhesive or the like, for example, it is possible to obtain a fiber array in which the fibers are regularly and regularly arranged vertically and horizontally.

The thin slice of the present invention can be obtained by cutting the above-described bio-related substance and dye-fixed gel-holding fiber array in a direction intersecting with the fiber axis, preferably in a direction perpendicular to the fiber axis. As a cutting method at this time,
For example, there is a method of cutting a slice from the array using a microtome. The thickness of the flakes can be arbitrarily adjusted, but is usually 1 to 5,000 μm,
0 to 2,000 μm. By observing the slice obtained in this manner with, for example, a fluorescence microscope, it is possible to easily observe the shape of the gel such as deformation and dropping.

These slices can be used for detection of a specific biological substance in a specimen by reacting with a specimen using a biological substance immobilized on a gel as a capture probe to form a hybrid. The capture probe mentioned here refers to a biologically relevant substance immobilized on a gel capable of specifically binding to a biologically relevant substance on the sample side such as a protein or a low molecular compound present in the sample in a broad sense. When the biological substance immobilized on the gel is a nucleic acid, the slice is reacted with a sample to perform hybridization, and a capture probe and a complementary nucleic acid present in the sample are formed to form a hybrid. By detecting, a nucleic acid in a sample having a target base sequence can be detected.

For the detection of the hybrid, known means capable of specifically recognizing the hybrid can be used. For example, a labeled substance such as a fluorescent substance, a luminescent substance, or a radioisotope is allowed to act on a biological substance in a sample, and the labeled substance can be detected. There is no particular limitation on the type of the label or the method for introducing the label, and various conventionally known means can be used.

In the hybrid detection step, first, the microarray is exposed to light of the first wavelength capable of exciting the dye immobilized on the gel, and the dye is immobilized on the gel held in the section divided by each fiber. By detecting the fluorescence emitted from the dye, the position information (coordinates) of the section can be obtained. According to the obtained position information, the section divided by each fiber is, for example, X on the XY plane of the array.
It is represented by the Y coordinate. Using the obtained position information, the detection of the hybrid can be detected for each position of the section divided by each fiber. For example, when the label is a fluorescent dye, the fluorescent dye can be excited, and the microarray is exposed to light different from the first wavelength, and the fluorescent light hybridized to the biomaterial immobilized on each fiber fragment. Detect the labeled sample. At this time, the position (coordinates) of the section is specified by the position information, and the hybrid amount at that position can be detected. Also, the intensity distribution of the fluorescence intensity on the microarray is detected in advance, and using the above-described position information,
The amount of hybrid at the position of each fiber fragment can be quantified. The above method is particularly effective when the fluorescence intensity of the label is low and the fluorescence intensity is accurately detected, and is also effective when the alignment accuracy of the microarray is low.

In the step of detecting a hybrid using the microarray of the present invention, when the sample is fluorescently labeled, the microarray is exposed to light having a first wavelength capable of exciting the dye immobilized on the gel. By detecting the fluorescence emitted from the dye immobilized on the gel held in the section separated by each fiber, the intensity distribution of the excitation light on the microarray and the detection efficiency of the fluorescence caused by the detection device are reduced. It is possible to obtain information such as distribution information and time-dependent changes in excitation light intensity. After obtaining the information, the microarray is exposed to light at a second wavelength that can excite the fluorescent dye that has labeled the specimen, and the fluorescence of the specimen hybridized to the biological substance immobilized in each compartment is detected. By performing the correction based on the information, the fluorescence detection can be accurately performed. For example, when a xenon lamp or the like is used as the excitation light source, the excitation light intensity distribution occurs when the front surface of the microarray is irradiated with the excitation light. Therefore, when excited at a first wavelength, the fluorescence intensity of the position of a fiber fragments S1 (X 1, _{Y 1),} when excited at a second wavelength,
Assuming that the fluorescence intensity at the same position is S2 (X ₁ , Y ₁ ), S
By taking the ratio of 1 and S2, it is possible to obtain a corrected hybrid fluorescence intensity in which the distribution unevenness of the fluorescence intensity has been corrected. Similarly, the time change of the excitation light can be corrected.

The microarray of the present invention is obtained by cutting a fiber array including a bundle of fibers holding a gel on which a biological substance and a dye are immobilized, in a direction crossing the fiber axis. In particular, when the fiber is a hollow fiber, holding the gel in the hollow portion of the fiber is preferable because a large number of capture probes can be held. However, when the fiber bundle is cut to obtain a thin piece, there is a risk that the fiber or the gel may fall off. Therefore, it is necessary to check whether the microarray is complete. In this case, if the gel is stained with a dye, the slice is irradiated with light having a wavelength that excites the dye, and the fluorescence emitted from the dye is detected to form the gel, that is, the gel is dropped or missing. Can be easily checked. In the above description, the hybridization in the present invention has been described with reference to complementary binding of base pairs of nucleic acids as an example. However, when the biological substance is a substance other than a nucleic acid, for example, a protein exhibiting an antigen-antibody reaction, a microarray using an antibody as a capture probe specifically binds to the antigen. Such a bond also means the formation of a hybrid of the present invention, and a hydrophobic bond other than a hydrogen bond, a complex formation, a bond by electrostatic interaction, and the like are defined as a hybrid in the present invention.

[0028]

The present invention will be described in more detail with reference to the following examples. However, the technical scope of the present invention is not limited by these examples.

Reference Example 1 (a) Preparation of Oligonucleotide Capture Probe Having Methacrylate Group The following oligonucleotides (capture probe A and capture probe B) were synthesized. Capture probe A: GCGATCGAAACCTTGCTGTACGAGCGAGGGCTC
(SEQ ID NO: 1) Capture probe B: GATGAGGTGGAGGTCAGGGTTTGGGACAGCAG
(SEQ ID NO: 2) Oligonucleotide synthesis was performed using an automatic synthesizer DNA / RNA synthesizer (model 394) manufactured by PE Biosystems. In the final step of DNA synthesis, aminolink II (trade name) (Applied Biosystems) At the 5 'end of each oligonucleotide using NH ₂ (CH ₂ )
_6- was introduced and an aminated capture probe was prepared. These were used after deprotection and purification by a general method. The obtained capture probe A or B (500 nmol /
ml) 5 μl and glycidyl methacrylate (GMA)
0.5 μl was mixed and reacted at 70 ° C. for 2 hours, an oligonucleotide capture probe having a methacrylate group was prepared, and 190 μl of water was added thereto to prepare 100 nmol / ml.
A solution of capture probes having a methacrylate group (GMA-denatured capture probe A and GMA-denatured capture probe B) was obtained.

B) Preparation of sample nucleic acid model As a sample nucleic acid model, oligonucleotides (C, D) complementary to part of the sequence of the oligonucleotides (capture probe A, capture probe B) synthesized in (a) Was synthesized. Oligonucleotide C: GAGCCCTCGCTCGTACAGCAAGGTTTC
G (SEQ ID NO: 3) Oligonucleotide D: CTGCTGTCCCAAACCCTGACCTCCACC
(SEQ ID NO: 4) Synthesis of the oligonucleotide was performed in the same manner as in (a), and a model of a fluorescently labeled sample nucleic acid in which Cy3 was introduced at the 5 ′ end of oligonucleotide C and Cy5 was introduced at the 5 ′ end of oligonucleotide D was prepared. These were used after deprotection and purification by a general method.

(C) Preparation of Fiber Array Five polyethylene porous hollow fiber membranes MHF200TL (manufactured by Mitsubishi Rayon Co., Ltd., 290 μm in outer diameter, 200 μm in inner diameter) are closely adhered to a Teflon (registered trademark) plate without overlapping each other. They were arranged and fixed at both ends. This is a polyurethane resin adhesive
(Nippon Polyurethane Industry Co., Ltd.Coronate 4403, Nipporan
4223) was applied thinly, and the hollow fibers were bonded. After the polyurethane resin was sufficiently hardened, it was peeled off from the Teflon plate to obtain a sheet having porous hollow fibers arranged in a line. Five of these sheet materials were laminated and bonded with the above-mentioned adhesive to obtain a porous hollow fiber array in which 25 hollow fibers were arranged regularly in a square manner, five in each of the vertical and horizontal directions.

Example 1 (1) Synthesis of Fluorescently Labeled Oligonucleotide In the same manner as in Reference Example (a), an oligonucleotide having a GCAT sequence with fluorescein isothiocyanate (FITC) introduced at the 5 ′ end was synthesized.

(2) Preparation of Fluorescent Dye Having Methacrylate Group 50 μl of the oligonucleotide (500 nmol / ml) having FITC at the 5 ′ end obtained in (1), 5 μl of glycidyl methacrylate, and 5 μl of dimethylformamide (DMF) are mixed. And reacted at 70 ° C. for 2 hours to prepare a fluorescent dye having a methacrylate group.
90 μl was added to obtain a 100 nmol / ml solution of a fluorescent dye having a methacrylate group (GMA-modified FITC).

(3) Preparation of Gel-Retaining Fiber Array Immobilized with Bio-Related Substance

<Preparation of Monomer Solution and Polymerization Initiator Solution> A monomer solution and an initiator solution were prepared by mixing at the following mass ratios. a) Monomer solution acrylamide 0.76 parts by mass methylenebisacrylamide 0.04 parts by mass water 4.2 parts by mass b) Initiator solution 2,2'-azobis (2-amidinopropane) dihydrochloride 0.01 parts by mass water 4.99 parts by mass

<Preparation of Polymerization Solution> The above-mentioned monomer solution a),
Initiator solution b) and GMA-modified capture probe A or GMA-modified capture probe B prepared in Reference Example 1 (a), (2)
The polymerization liquids 1 to 3 were prepared by mixing the GMA-modified FITC prepared in the above at a volume ratio shown in Table 1. The obtained polymerization solution was filled in the hollow portion of a predetermined row of hollow fibers of the hollow fiber array obtained in Reference Example (c), and transferred to a sealed glass container whose inside was saturated with steam, and was heated at 80 ° C. for 4 hours. The polymerization reaction was performed by leaving it to stand.

[0037]

[Table 1]

(4) Observation of the state of filling of slices and gels From the array obtained in (3), 5
00 μm slices were cut out. The thin section was subjected to a FITC filter (excitation wavelength range: 465 to 495 nm, fluorescence wavelength range: 515) using a fluorescence microscope (Nikon fluorescence microscope E400).
(555 nm), the state of filling of the gel could be easily observed.

(5) Hybridization The slice obtained in (4) was put in a hybridization bag, a hybridization solution having the following composition was poured, and prehybridization was performed at 45 ° C. for 30 minutes.

<Composition of hybridization solution> 5xSSC (0.75 mol / l sodium chloride, 0.075 mol / l sodium citrate, Ph7.0) 5% blocking reagent (Roche Diagnostics Co., Ltd.) 0.1% N-lauroyl monkey Cosin sodium 0.02% SDS (sodium lauryl sulfate) 50% formamide

Subsequently, the fluorescence-labeled sample nucleic acid model prepared in Reference Example (b) was added to a concentration of 50 pmol / ml, and hybridization was performed at 45 ° C. for 15 hours. After the hybridization is completed, the nucleic acid-immobilized slice is pre-incubated in 50 ml of 0.1 x SSC, 0.1% SDS.
Transfer to solution and wash at 45 ° C. for 20 minutes with shaking for 3 minutes.
I went there.

(6) Detection The post-hybridization chip obtained in (5) is filtered with a CY3 filter (excitation wavelength peak area 535 nm, half width 50 nm, fluorescence wavelength peak 610 nm, half width 75).
nm), an image was obtained in which only the sequence No. 2 emitted fluorescence without being hindered by the fluorescence of the GMA-modified FITC. Next, observation was performed using a FITC filter with a fluorescence microscope in the same manner as in (4), and it was confirmed that the gel was filled in all the hollow fibers for the column numbers in which fluorescence was not observed with the CY3 filter. . Similarly, a CY5 filter (excitation wavelength peak range 620 nm, half width 60 nm, fluorescence wavelength peak 700 nm, half width 75
nm), an image was obtained in which only the sequence No. 4 emitted fluorescence without being hindered by the fluorescence of the GMA-modified FITC. From the above results, it can be seen that the oligonucleotide C specifically hybridizes to the cross-section where the capture probe A was immobilized and the oligonucleotide D only to the cross-section where the capture probe B was immobilized in the slice. It was confirmed that the gel did not fall off or deformed in the course of the hybridization operation.

Example 2 The GMA-modified FITC in Example 1 was replaced with Polyscience
Thin sections of the fiber array were obtained under the same conditions except that Fluorescein Dimethacrylate manufactured by s, Inc. was used. When the thin section was observed with a fluorescence microscope, the state of filling of the gel could be easily observed. Hybridization was carried out in the same manner as in Example 1, and CY3 and CY5 were detected by fluorescence of Fluorescein.
It was confirmed that the fluorescence detection was not hindered and that the gel did not fall off or deformed during the hybridization operation.

Example 3 (1) Acquisition of position information of sections divided by fibers and measurement of fluorescence intensity distribution of immobilized dye The hybridization reaction was completed in the same manner as in (1) to (5) of Example 1. . Next, a CCD camera was connected to the fluorescence microscope described in Example 1, and a fluorescence image was captured using a FITC filter. The captured image is a 16-bit TI
Saved in FF format. The obtained image was processed using image processing software, and the position of each fiber fragment on the microarray was measured. Subsequently, the fluorescence intensity of the immobilized fluorescent dye at each position on each fiber fragment was quantified. The obtained fluorescence intensity includes a distribution due to the intensity distribution of the excitation light and the intensity distribution of the fluorescence caused by the optical system of the microscope, and the value was high at the center and low at the periphery.

(2) Detection of Hybrid The fluorescence intensity was measured using a CY3 filter in the same manner as in (1). Next, using the position on the microarray of each fiber fragment obtained in (1), the fluorescence intensity of the fluorescently labeled specimen present in each fiber fragment was quantified.

(3) Correction of Hybrid Intensity By dividing the fluorescence intensity of the fluorescence-labeled sample obtained in (2) by the fluorescence intensity of each fiber fragment obtained in (1),
The corrected hybrid intensity distribution could be obtained.

Comparative Example 1 A slice was obtained in the same manner as in Example 1 without using GMA-modified FITC. Hybridization was carried out in the same manner as in Example 1. When the thin section was observed with a microscope using a CY3 filter, an image in which only the sequence number 2 emitted fluorescence was obtained. It was difficult to observe the packed state such as the missing gel in the row, and it was not possible to easily determine whether the row that did not generate fluorescence did not form a hybrid or the gel was missing.

[0048]

According to the present invention, the state of packing of the gel present in the microarray can be easily confirmed. This allows
The efficiency of microarray inspection work is significantly improved. Further, since the gel filling state can be easily confirmed after the hybridization, it is easy to determine whether a hybrid is not formed or the gel is missing. Further, according to the present invention, it is possible to easily and accurately detect the fluorescence intensity even in a sample having a low fluorescence intensity or an array having a low sequence accuracy. Furthermore, the intensity unevenness of the excitation light in the irradiation area of the fluorescence detection device and the fluorescent intensity unevenness caused by the configuration of the optical system can be easily corrected, and the hybridization can be accurately detected.

[0049]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi Rayon Co., Ltd. <120> A slice of an array of fibers holding biopo
lymer- and chromogen-fixed gel <130> P120632000 <160> 4 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 1 gcgatcgaaa ccttgctgta cgagcgaggg ctc <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 2 gatgaggtgg aggtcagggt ttgggacagc ag <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 3 gagccctcgc tcgtacagca aggtttcg <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 4 ctgctgtccc aaaccctgac ctccacc

[0050]

[Free text of Sequence Listing] SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/566 G01N 37/00 102 37/00 102 C12M 1/34 Z // C12M 1/34 C12N 15 / 00 ZNAF (72) Inventor Kei Murase 20-1, Miyukicho, Otake City, Hiroshima Prefecture Inside Mitsubishi Rayon Co., Ltd. Central Research Laboratory

Claims (10)

[Claims] 1. A bio-related substance microarray obtained by cutting a fiber array formed by converging a plurality of fibers holding a gel containing a bio-related substance and a dye in a direction intersecting with a fiber axis. 2. The microarray according to claim 1, wherein the biomaterial is a nucleic acid. 3. The microarray according to claim 1, wherein the dye has a fluorescence wavelength of 350 nm to 500 nm. 4. The biologically relevant substance microarray according to claim 3, wherein the substance having a fluorescence wavelength of 350 nm to 500 nm is a fluorescein derivative or a coumarin derivative. 5. The bio-related substance microarray according to claim 1, wherein the gel comprises a water-soluble monomer. 6. The microarray according to claim 5, wherein the water-soluble monomer is acrylamide. 7. The microarray according to claim 1, wherein the fiber is a hollow fiber, a porous fiber, or a porous hollow fiber. 8. The method for detecting hybridization between a capture probe and a sample held in each compartment of a biologically relevant substance microarray according to claim 1, which comprises the following steps. (1) A microarray is exposed to light having a wavelength that can excite a dye previously immobilized on a gel, and the fluorescence emitted from the dye is detected. (2) Obtain positional information of each section divided by the fibers constituting the microarray. (3) Using the obtained position information, a capture probe and a sample hybrid are detected. 9. The method for detecting the hybrid production of a capture probe and a fluorescently-labeled sample held in each compartment of the biologically relevant substance microarray according to claim 1, comprising the following steps: (1) A microarray is exposed to light of a first wavelength capable of exciting a dye immobilized on a gel in advance and detecting fluorescence emitted from the dye. (2) Obtain information on the intensity and / or intensity distribution of the fluorescence in the first step. (3) A hybridization reaction between the capture probe and the fluorescent-labeled sample is performed, and the generation of a hybrid is detected by light having a second wavelength at which the fluorescent-labeled sample can be excited. (4) The obtained fluorescence intensity is corrected based on the information on the fluorescence intensity and / or intensity distribution obtained in the second step. 10. The method for inspecting a biologically relevant substance microarray according to claim 1, wherein the microarray is exposed to light having a wavelength at which a dye immobilized on a gel can be excited, and emitted. By detecting fluorescence,
A method for inspecting a bio-related substance micro array, comprising evaluating a shape of a gel in each section of the micro array.