JP2001133453A - Method for manufacturing organism macromolecular alignment thin piece - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a thin piece with the fiber section of an organism macromolecule immobilization hollow fiber alignment body or a porous hollow fiber alignment body where an organism macromolecule has been arbitrarily, densely, and accurately aligned efficiently with improved reproducibility to use the organism macromolecular alignment thin piece to examine the type and the amount of organism macromolecule in the specimen. SOLUTION: In the method for manufacturing organism macromolecular alignment thin piece, a plurality of hollow fibers or porous hollow fibers are bundled as an alignment body, an organism macromolecule is immobilized into the inner wall part, hollow part, the porous part or the like of each fiber for composing the alignment body, and then the organism macromolecule immobilization alignment body is sliced in a direction for orthogonally crossing a fiber axis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for producing a polymer material on which biopolymers such as nucleic acids, proteins, and polysaccharides are immobilized, which can be used in fields such as clinical tests and food tests. More specifically, the present invention relates to a method for producing a biopolymer array slice using hollow fibers or porous hollow fibers, in which the biopolymers are regularly arranged and immobilized.

[0002]

2. Description of the Related Art In recent years, genome projects for various organisms have been promoted, and a large number of genes including human genes and their base sequences have been rapidly identified. The function of a gene whose sequence has been clarified can be examined by various methods. As one of the promising methods, gene expression analysis using the clarified nucleotide sequence information is known. For example, methods using various nucleic acid: nucleic acid hybridization reactions and various PCR reactions, such as Northern hybridizations, have been developed, and the relationship between various genes and their biological function expression should be examined by the method. Can be. However, these methods have limitations on the number of genes that can be applied. Therefore, in view of the entire complex reaction system consisting of a large number of genes at the individual level, which is being revealed through today's genome project, comprehensive and systematic analysis of genes by the above method is necessary. It is difficult.

[0003] Recently, a new analysis method or methodology called a DNA microarray method (DNA chip method) that enables simultaneous expression analysis of a large number of genes has been developed and attracted attention.

[0004] These methods are basically the same as the conventional methods in that they are nucleic acid detection and quantification methods based on a nucleic acid: nucleic acid hybridization reaction, but they are mounted on a flat substrate called a microarray or chip. There is a great feature that a large number of DNA fragments are arranged and fixed at a high density. As a specific use of the microarray method, for example, a sample obtained by labeling an expression gene or the like of a cell to be studied with a fluorescent dye or the like is hybridized on a flat base piece, and nucleic acids (DN
A or RNA), a label is labeled with a fluorescent dye or the like, and then read at high speed by a high-resolution analyzer. Thus, the amount of each gene in the sample can be quickly estimated. In other words, the essence of this new method is basically the integration of the miniaturization of the reaction sample and the technology to sequence and align the reaction sample in a form that can be analyzed and quantified in a reproducible manner in a large, rapid and systematic manner. It is understood that there is.

Techniques for immobilizing nucleic acids on a substrate include, as in the Northern method described above, a method of immobilizing a nucleic acid on a nylon sheet or the like at a high density, and a technique of immobilizing a nucleic acid on a substrate such as a glass to further increase the density. And immobilized by coating with polylysine or the like, or a method of directly solid-phase synthesizing short-chain nucleic acids on a substrate such as silicon.

However, for example, the method of spotting and immobilizing nucleic acids on a substrate obtained by chemically or physically modifying a solid surface of glass or the like [Science 270, 467-470 (1995)] uses a spot density rather than a sheet method. Although excellent in spot density and the amount of nucleic acid that can be fixed per spot, the direct synthesis method on a silicon substrate (US Patent 5,445,934, US Patent
t 5,774,305), and it is pointed out that it is difficult to reproduce. On the other hand, a method of regularly solid-phase synthesizing various kinds of short-chain nucleic acids in situ using a photolithography technique on a substrate such as silicon has been studied in terms of the number of nucleic acid species that can be synthesized per unit area (spot density) and Although the amount of immobilization per spot (the amount of synthesis) and the reproducibility are said to be superior to the spotting method, the types of compounds that can be immobilized are limited to relatively short-chain nucleic acids that can be controlled by photolithography. further,
Due to the expensive manufacturing equipment and the multi-stage manufacturing process, it is difficult to greatly reduce the cost per chip. In addition, as a technique for solid-phase synthesis of a nucleic acid on a small carrier to form a library, a method using minute beads is known.
This method is considered to be capable of synthesizing many kinds of long-chain nucleic acids at a lower cost than the chip method, and also capable of immobilizing longer-chain nucleic acids than cDNA and the like. However, unlike the chip method, it is difficult to produce a compound in which specified compounds are aligned with high reproducibility based on specified sequence criteria.

[0007]

Under these circumstances, biomolecules such as nucleic acids, proteins, and polysaccharides can be immobilized at a predetermined concentration regardless of the size of the molecule, and can be measured in a highly measurable form. The establishment of a new systematic methodology that can be sequenced with good reproducibility in density and that can be adapted to inexpensive mass production is strongly required for genetic analysis, which is expected to become more important in the future.

[0008] Specifically, as compared with a method of producing a biopolymer array by a small amount of spotting or microdispensing on a two-dimensional carrier such as a nylon sheet or a glass substrate, the amount of immobilized biopolymer is higher and the unit area is larger. It is possible to densify the molecular species of the biopolymer arranged per unit, and it is more suitable for mass production, that is, a two-dimensional (planar) array in which the biopolymer is immobilized (immobilized biopolymer) It is an object of the present invention to establish a method for producing a two-dimensional array).

[0009] The problem to be solved by the present invention is as follows.
For example, when the biopolymer is a nucleic acid, it is applicable to a long-chain nucleic acid including cDNA, compared to a method for producing a high-density oligonucleic acid array by a combination of photolithography and solid-phase synthesis on a silicon substrate, It is an establishment of a method for producing an immobilized nucleic acid two-dimensional array having a lower production cost.

[0010] The present invention relates to nucleic acids, proteins, polypeptides,
It is an object of the present invention to provide a method for efficiently producing a slice in which biopolymers such as polysaccharides are regularly arranged and immobilized.

[0011]

Means for Solving the Problems The inventors of the present invention have conducted intensive studies to solve the above-mentioned problems, and as a result, have conducted a biopolymer alignment process and an immobilization process on the same two-dimensional carrier. Revising the idea of the conventional method to be performed, first, a three-dimensional array of hollow fibers is produced by fiber shaping technology, and the biopolymer is efficiently introduced and immobilized in this array, thereby aligning the biopolymers To obtain an immobilized biopolymer two-dimensional high-density array slice by obtaining a three-dimensional structure arrayed by cutting and cutting the structure into slices to complete the present invention. Reached.

That is, according to the present invention, a plurality of hollow fibers are bundled to form an array, and then the biopolymer is immobilized on the inner wall and / or hollow of each hollow fiber constituting the array. A method for producing a biopolymer array slice, comprising slicing the biopolymer-immobilized array in a direction intersecting the fiber axis.

The immobilization of the biopolymer on the inner wall portion and / or the hollow portion of each hollow fiber constituting the above-mentioned array is performed by, for example,
This can be carried out by immersing the tip of the extended portion of each hollow fiber constituting the array in a liquid containing a biopolymer, and introducing the liquid into the hollow portion of each hollow fiber constituting the array.

[0014] The present invention also relates to a method of bundling a plurality of porous hollow fibers into an array, and then forming a biopolymer on the inner wall, hollow and / or porous portion of each porous hollow fiber constituting the array. Is immobilized, and then the biopolymer-immobilized array is sliced in a direction intersecting the fiber axis.

The immobilization of the biopolymer on the inner wall, the hollow portion and / or the porous portion of each of the porous hollow fibers constituting the array may be performed, for example, by fixing the porous hollow fibers constituting the array. The tip of the extended portion is immersed in a liquid containing a biopolymer, and the liquid is immersed in the hollow portion of each porous hollow fiber constituting the array and / or
Alternatively, it can be performed by introducing into a porous portion.

Further, according to the present invention, a plurality of hollow fibers are bundled to form an array, and then the hollow portion of each hollow fiber constituting the array is filled with a gel containing a biopolymer, and then the biopolymer is fixed. A method for producing a biopolymer array slice, comprising slicing the arrayed array in a direction intersecting the fiber axis.

The filling of the hollow portion of each hollow fiber constituting the array with the gel containing the biopolymer into the hollow portion may be performed by adding the biopolymer to the tip of the extended portion of each hollow fiber constituting the array. It can be carried out by immersing in a monomer solution containing the solution, introducing the solution into the hollow portion of each hollow fiber constituting the array, and then polymerizing to form a gel in the hollow portion.

Further, the present invention relates to a method in which a plurality of porous hollow fibers are bundled to form an array, and then a biopolymer is provided on the inner wall, hollow and / or porous portion of each porous hollow fiber constituting the array. A method for producing a biopolymer array slice, comprising: filling a gel containing the same; and slicing the biopolymer-immobilized array in a direction crossing a fiber axis.

The filling of the hollow portion and / or the porous wall of each porous hollow fiber constituting the array with the gel containing the biopolymer is an extension of each of the porous hollow fibers constituting the array. Dipped in a monomer solution containing biopolymer,
It can be carried out by introducing the liquid into the hollow part and / or the porous part of each porous hollow fiber constituting the array and then polymerizing to form a gel in the hollow part.

As these arrangements, for example, those in which hollow fibers or porous hollow fibers are regularly arranged, or those perpendicular to the axial direction of the hollow fibers or porous hollow fibers constituting the arrangement, are used. Examples include those containing 100 or more hollow fibers or porous hollow fibers per 1 cm ^{2 in} cross section.

[0021] Examples of the biopolymer include nucleic acids.

The kind of the nucleic acid may be different in all or a part of each hollow fiber or each porous hollow fiber constituting the array.

[0023]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.

In the present invention, biomolecules to be immobilized on hollow fibers or porous hollow fibers include:
Deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), oxypeptide nucleic acid (OPN)
Nucleic acids such as A), or proteins, polysaccharides and the like. The biopolymer used in the present invention may be a commercially available product or a product obtained from living cells or the like.

For example, when a nucleic acid is used as a biopolymer, a known method for preparing DNA or RNA from living cells, for example, a method for extracting DNA by the method of Blin et al. (Blin et al., Nucleic Acids Res. 3: 2303 (197
6)), and for extraction of RNA, Favalo
ro et al. (Favaloro et al., Methods Enzymol. 65: 7
18 (1980)). Further, a linear or circular plasmid DNA or chromosomal DNA, a DNA fragment obtained by cleaving them with a restriction enzyme or chemically, DNA synthesized by an enzyme or the like in a test tube, or a chemically synthesized oligonucleotide is used. Can also.

In the present invention, a biopolymer may be directly immobilized on a hollow fiber or the like, or a derivative obtained by chemically modifying a biopolymer or a biopolymer modified as necessary may be immobilized. You may.

For example, when a nucleic acid is used as a biopolymer, amination, biotinylation, digoxigenation and the like are known as chemical modifications of the nucleic acid [Current Protocols
InMolecular Biology, Ed .; Frederick M. Ausubel et
al. (1990), De-isotope experiment protocol (1) DI
G Hybridization (Shujunsha)] In the present invention, these modification methods can also be adopted.

In the present invention, examples of hollow fibers that can be used for immobilizing biopolymers include synthetic fibers, semi-synthetic fibers, regenerated fibers, and natural fibers.

As typical examples of synthetic fibers, nylon 6,
Nylon 66, various polyamide-based fibers such as aromatic polyamide, polyethylene terephthalate, polybutylene terephthalate, polylactic acid, polyglycolic acid and other polyester-based fibers, polyacrylonitrile and other acrylic-based fibers, polyethylene and polypropylene and the like. Various fibers of polyolefin, various fibers of polyvinyl alcohol, various fibers of polyvinylidene chloride, various fibers of polyvinyl chloride, various fibers of polyurethane, phenolic fiber, fluorine based on polyvinylidene fluoride, polytetrafluoroethylene, etc. Fibers and various kinds of polyalkylene paraoxybenzoate fibers are exemplified.

Typical examples of the semi-synthetic fibers include various cellulose-based fibers made from diacetate, triacetate, chitin, chitosan and the like, and various protein-based fibers called promix.

Representative examples of the regenerated fibers include various cellulosic regenerated fibers (rayon, cupra, and the like) obtained by a viscose method, a copper-ammonia method, or an organic solvent method.
Polynosic, etc.).

Typical examples of natural fibers are flax, ramie,
Burlap and the like. Since these plant fibers show a hollow fiber form, they can be used in the present invention.

Hollow fibers other than natural fibers can be produced by a known method using a special nozzle. For polyamide, polyester, polyolefin, etc., a melt spinning method is preferable, and as a nozzle, a horseshoe type, a C type nozzle, a double tube nozzle or the like can be used. In the present invention,
The point that a continuous and uniform hollow portion can be formed is 2
It is preferable to use a double tube nozzle.

Solvent spinning is preferably used for spinning a synthetic polymer which cannot be melt-spun, a semi-synthetic fiber or a polymer used for regenerated fiber. In this case, too, as in melt spinning, 2
A hollow fiber having a continuous hollow portion can be obtained by spinning using a double tube nozzle while filling the hollow portion with an appropriate liquid as a core material.

The form of the hollow fiber or the porous hollow fiber used in the present invention is not particularly limited. Further, it may be a monofilament or a multifilament.

The porous fiber used in the present invention can be obtained by combining a known spinning technique such as a drawing method, a microphase separation method and an extraction method with a melt spinning method or a solution spinning method.

Although the porosity of the porous fiber material used in the present invention is not particularly limited, the specific surface area is large from the viewpoint of increasing the density of the biopolymer fixed per unit length of the fiber material. High porosity is desirable.

A commercially available porous hollow fiber membrane for microfiltration and ultrafiltration, a reverse osmosis membrane in which the outer surface of a porous hollow fiber membrane is coated with a nonporous homogeneous membrane, a gas separation membrane, A membrane or the like in which a nonporous homogeneous layer is interposed between porous layers can be used.

The hollow fiber or porous hollow fiber used in the present invention may be used as it is in an untreated state, but may be one having a reactive functional group introduced therein if necessary. It may have been subjected to a treatment or a radiation treatment such as γ-ray or electron beam.

In the array of the present invention, hollow fibers or porous hollow fibers are regularly arranged and bonded with a resin adhesive or the like. An arrayed three-dimensional array can be obtained. Although the shape of the three-dimensional array is not particularly limited, it is usually formed into a square or a rectangle by regularly arranging the fibers.

"Regularly" means that the fibers are arranged in order so that the number of fibers contained in a frame of a certain size is constant. For example, when fibers of 1 mm in diameter are bundled and arranged to form a square having a cross section of 10 mm in length and 10 mm in width, the inside of the square frame (1 cm
² ) The number of fibers included in one side in 10) is set to 10, and the 10 fibers are bundled in one row to form a one-layer sheet.
The sheets are stacked so that they have 10 layers. As a result, a total of 100 fibers can be arranged, that is, 10 fibers vertically and 10 horizontally. However, the method of regularly arranging the fibers is not limited to the method of stacking the sheets as described above.

In the present invention, the number of hollow fibers or porous hollow fibers to be a three-dimensional array is 100 or more, preferably 1,000 to 10,000,000, and is set appropriately according to the purpose. be able to. However, the density of the fibers in the array is, 1 cm ² per 100
It is preferable to prepare so that the number becomes 1,000,000. In order to arrange the fibers so as to obtain a thin piece of the fiber array in which the biopolymer is immobilized at a high density, the thickness of the fibers is preferably thin. In a preferred embodiment of the present invention, the array includes 100 or more hollow fibers or porous hollow fibers per 1 cm ^{2 in} a cross section perpendicular to the fiber axis direction. In order to achieve this, the outer diameter of a single hollow fiber or a porous hollow fiber is 1 m.
m.

For example, when a hollow fiber or a porous hollow fiber monofilament having an outer diameter of about 500 μm is used, a three-dimensional structure in which 400 or more hollow fibers or porous hollow fibers are arranged per 1 cm ² of the cross section of the immobilized array. Can be obtained. Further, hollow fibers having an outer diameter of about 30 μm or porous hollow fibers are manufactured by applying the hollow fiber spinning technology, and if this is used, the cross section of the immobilized array is 1 cm.
It is possible to obtain a three-dimensional structure in which 100,000 or more hollow fibers or porous hollow fibers are arranged per ^two .

In the present invention, each hollow fiber or each porous hollow fiber constituting the array is provided with an extended portion which is not fixed with a resin, and the tip portion is immersed in a liquid tank containing a biopolymer. The liquid can be introduced into each fiber constituting the array.

As a method of immobilizing a biopolymer on a hollow fiber or a porous hollow fiber, a liquid containing the biopolymer is introduced into the hollow portion of each hollow fiber or the porous hollow fiber constituting the array, and Various chemical or physical interactions between the inner wall surface of the hollow fiber or the porous hollow fiber and the biopolymer, i.e., the functional groups present on the inner wall surface of the hollow fiber or the porous hollow fiber and the biological height Chemical or physical interactions between the constituents of the molecule can be used.

For example, when nucleic acid modified with an amino group is immobilized on a hollow fiber, a crosslinking agent such as glutaraldehyde or 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) is used. With the functional group of the fiber.

The biopolymer can be immobilized on hollow fibers or the like by immobilizing the biopolymer on a gel and using the gel. The type of gel that can be used here is not particularly limited. For example, acrylamide, N, N-
Dimethylacrylamide, N-isopropylacrylamide, N-acryloylaminoethoxyethanol, N
One or two or more monomers such as acryloylaminopropanol, N-methylolacrylamide, N-vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, allyldextrin, and methylenebis (meth) acrylamide; A gel obtained by copolymerizing a polyfunctional monomer with polyethylene glycol di (meth) acrylate or the like can be used.

In this case, the immobilization can be performed by introducing a solution containing a biopolymer, the above-mentioned monomer and a polymerization initiator into a hollow portion such as a hollow fiber and then polymerizing the solution.

The extension not fixed with resin to each hollow fiber or each porous hollow fiber constituting the array is provided at one end, preferably both ends, of the array to introduce a liquid containing a biopolymer. In addition to the above, various processes can be performed as needed. For example, heat treatment, alkali treatment,
By performing surfactant treatment, etc., the biopolymers immobilized on the inner wall surface of the hollow fibers or porous hollow fibers constituting the array are denatured, or obtained from raw materials such as cells and bacterial cells. When the obtained biopolymer is used, unnecessary cell components and the like can be removed. Note that these processes may be performed separately or simultaneously. Before immobilizing the sample containing the biopolymer on the hollow fibers or the porous hollow fibers constituting the array, it may be appropriately performed.

The types of biopolymers immobilized on each hollow fiber or porous hollow fiber in the three-dimensional array are as follows:
Different types of biopolymers can be used. That is, according to the present invention, the type and sequence of the immobilized biopolymer can be arbitrarily set according to the purpose.

In the present invention, the biopolymer-immobilized hollow fiber array is arbitrarily arranged by cutting the three-dimensional array in a direction crossing the fiber axis, preferably in a direction perpendicular to the fiber axis. A flake having a cross section or a cross section of a porous hollow fiber array having a biopolymer fixed thereon, that is, a biopolymer array flake can be obtained. As a cutting method at this time, for example, a method of cutting a thin section from the array using a microtome and the like can be mentioned. The thickness of the flakes can be arbitrarily adjusted, but is usually 1 to 5,000 μm.
m, preferably 10 to 2,000 μm.

The flakes having the cross section of the biopolymer-immobilized hollow fiber array or the cross section of the biopolymer-immobilized porous hollow fiber array (biopolymer array lamella) are provided with the hollow fibers constituting the array. Alternatively, biopolymers corresponding to the number of porous hollow fibers exist. With respect to the number of biopolymers per cross-sectional area of the flake, 100 or more biopolymers per 1 cm ^{2 of} flake cross-section are immobilized by appropriately selecting the outer diameter of the hollow fiber or the porous hollow fiber to be used. In addition, it is possible to produce thin slices on which 1000 or more biopolymers are immobilized per 1 cm ^{2 of} the slice cross-sectional area.

Further, since the positional arrangements of the biopolymers of the slices obtained from the same array are all the same, the positional arrangement of the biopolymers of all the slices obtained from the same array can be known.

The obtained thin section having the cross section of the biopolymer-immobilized hollow fiber array or the cross section of the biopolymer-immobilized porous hollow fiber array, that is, the biopolymer array thin section is, for example, the immobilized biopolymer. In the case of a nucleic acid, the nucleic acid can be used as a probe to detect the base sequence of a specific polynucleotide in the sample by reacting with the sample and performing hybridization.

The probe referred to in the present invention broadly refers to an immobilized biopolymer that can specifically bind to a sample sample biopolymer such as a protein or a low molecular compound present in a sample. Therefore, the method of using these slices is not limited to the use for detecting a sample sample-side biopolymer that forms a hybrid with the immobilized biopolymer (probe), but also for the immobilized biopolymer. Use for detecting various samples such as a protein or a low molecular compound that specifically binds is exemplified.

When the immobilized biopolymer is a nucleic acid, hybridization is carried out by reacting the biopolymer sequence slice according to the present invention with the sample, and the probe is complementary to the nucleic acid present in the sample. Form a hybrid,
By detecting this hybrid, it is possible to detect a nucleic acid in a sample having a target base sequence.

In the case of detecting a hybrid, known means capable of specifically recognizing the hybrid can be used. For example, a labeled substance such as a fluorescent substance, a luminescent substance, or a radioisotope is allowed to act on a biopolymer in a sample, and the labeled substance can be detected. There is no particular limitation on the type of the label or the method for introducing the label, and various conventionally known means can be used.

[0058]

The present invention will be described in more detail with reference to the following examples. However, the technical scope of the present invention is not limited by these examples.

Example 1 Production of Hollow Fiber Array (1): ^Two fiber guide plates, each having a regular square arrangement of 20 holes, each of which is 20 in length and width in a square of 1 cm ² , were used. Nylon hollow fiber (outer diameter about 300 μm, length about 50 c)
m) A hollow fiber array was obtained by passing through 400 fibers.

The interval between the two fiber guide plates was set to 20 cm, and the space between the two fiber guide plates was fixed with a polyurethane resin, whereby a hollow fiber array having portions that were not fixed with resin at both ends was obtained.

Example 2 Production of Hollow Fiber Array (2): Instead of nylon hollow fibers, polyethylene hollow fibers whose inner surfaces were hydrophilized with a polyethylene-vinyl alcohol copolymer (outer diameter of about 300 μm) , About 50 cm in length), and in the same manner as in Example 1, a hollow fiber array having portions not fixed with resin at both ends was obtained.

Example 3 Preparation of Porous Hollow Fiber Array: Instead of nylon hollow fibers, a polyethylene porous hollow fiber membrane MHF200TL having a non-porous intermediate layer (manufactured by Mitsubishi Rayon Co., Ltd.
Example 1 was repeated except that an outer diameter of 290 μm, an inner diameter of 200 μm, and a length of about 50 cm) were used to obtain a porous hollow fiber array having portions that were not fixed with resin at both ends.

Example 4 Inner Surface Treatment of Hollow Fiber (1): From the fiber portion not fixed with one resin to the hollow portion of each hollow fiber constituting the hollow fiber array obtained in Example 1. Formic acid was introduced and held for 1 minute. Next, a large amount of room-temperature water was introduced into the hollow portion to sufficiently wash it, and then dried to perform a pretreatment of the nylon hollow fiber.

Example 5 Inner Surface Treatment of Hollow Fiber (2): Instead of formic acid, sulfuric acid
A nylon hollow fiber was pretreated in the same manner as in Example 4 except that a 0% ethanol solution was used.

Reference Example 1 Synthesis of Oligonucleotide Having Amino Group at 5 ′ Terminal: The following oligonucleotides (probe A and probe B) were synthesized.

Probe A: GCGATCGAAACCTTGCTGTACGAGCGAGGGCTC (SEQ ID NO: 1) Probe B: GATGAGGTGGAGGTCAGGGTTTGGGACAGCAG (SEQ ID NO: 2) Oligonucleotide synthesis was performed using an automatic synthesizer DNA / RNA synthesizer (model 394) of PE Biosystems, and final DNA synthesis was performed. At the step, NH ₂ (CH ₂ ) ₆ was added to the 5 ′ end of each oligonucleotide using Aminolink II (trade name) (Applied Biosystems).
-Was introduced, deprotected and purified by a general method, and used.

Example 6 Introduction and Immobilization of Biopolymer into Hollow Fiber Array (1): The hollow fiber array produced in Example 1 was replaced with hollow fibers of each component according to Example 4 or 5. After the inner surface treatment, the oligonucleotide having an amino group synthesized in Reference Example 1 (probe A
And the probe B) were introduced and fixed inside each hollow fiber constituting the hollow fiber array by the following method.

A solution obtained by adding the oligonucleotide having an amino group synthesized in Reference Example 1 to the potassium phosphate solution buffer from one end of the hollow fiber array was introduced, and the mixture was kept at 20 ° C. overnight.

Thereafter, the inside of the hollow fiber was washed with a potassium phosphate solution buffer, a potassium chloride solution and water to obtain a nucleic acid-immobilized hollow fiber array having oligonucleotides immobilized on the inner wall surface of the hollow fiber.

At this time, the oligonucleotides of the probe A and the probe B were introduced and immobilized so that the sequence in the hollow fiber array was as shown in FIG.

In FIG. 2, a white circle (○) indicates a probe A
Is a hollow fiber in which the probe B is fixed, and a black circle (●) represents a hollow fiber in which the probe B is fixed.

Example 7 Introduction and Immobilization of Biopolymer into Hollow Fiber Array (2): Using the hollow fiber array produced in Example 2,
In the same manner as in Example 6, a nucleic acid-immobilized hollow fiber array having oligonucleotides immobilized on the inner wall surface of the hollow fiber was obtained.

At this time, the oligonucleotide sequences of the probe A and the probe B in the hollow fiber array were
This is similar to the sixth embodiment.

Example 8 Introduction and Immobilization of Biopolymer into Hollow Fiber Array (3): As an example of the biopolymer, an oligonucleotide having an amino group synthesized in Reference Example 1 (probe A and probe An aqueous solution containing B) and having the following composition was prepared.

Acrylamide 3.7 parts by mass Methylenebisacrylamide 0.3 parts by mass 2,2′-azobis (2-amidinopropane) dihydrochloride 0.1 parts by mass Aminated oligonucleotide (probe A or probe B) 0.005 parts by mass After the hollow fiber array produced in Example 1 was injected into the hollow portion of the hollow fiber obtained by treating the inner surface of each hollow fiber according to Example 4 or 5 in a hollow glass container, the inside of the hollow glass container was saturated with water vapor. The polymerization reaction was performed by transferring and leaving at 80 ° C. for 4 hours.

As a result, a hollow fiber array was obtained in which the gel on which the oligonucleotide (probe A or probe B) was immobilized was retained.

The oligonucleotide sequences of probe A and probe B in the hollow fiber array are the same as in Example 6.

Example 9 Introduction and Immobilization of Biopolymer into Hollow Fiber Array (4): Instead of nylon hollow fiber, polyethylene obtained by hydrophilizing the inner surface obtained in Example 2 Using the hollow fiber array, a hollow fiber array having a gel on which an oligonucleotide (probe A or probe B) was immobilized was obtained in the same manner as in Example 8.

The oligonucleotide sequences of the probe A and the probe B in the hollow fiber array are the same as in Example 6. Example 10 Introduction and Immobilization of Biopolymer into Porous Hollow Fiber Array (1): Using the porous hollow fiber array produced in Example 3, a method similar to that of Example 6 was used. A nucleic acid-immobilized porous hollow fiber array having oligonucleotides immobilized on the inner wall surface of the porous hollow fiber was obtained.

At this time, the arrangement of the oligonucleotides of the probe A and the probe B in the porous hollow fiber array is the same as in Example 6.

Example 11 Introduction and Immobilization of Biopolymer into Porous Hollow Fiber Array (2): The same procedure as in Example 8 was carried out using the porous hollow fiber array produced in Example 3. According to the method, a porous hollow fiber array having a gel on which an oligonucleotide (probe A or probe B) was immobilized was obtained.

The oligonucleotide sequences of probe A and probe B in the hollow fiber array are the same as in Example 6. [Example 12] Preparation of biopolymer array thin section: biopolymer-immobilized hollow fiber array obtained in Examples 6 to 9, and Examples 10 and 1
The biopolymer-immobilized porous hollow fiber array obtained in 1 was sliced into a thickness of about 100 μm using a microtome in a direction perpendicular to each fiber axis, thereby obtaining a total of 20 pieces each in a length and width direction of a total of 400 pieces. A biopolymer array slice in which oligonucleotides were regularly arranged in a square was obtained. (FIG. 3) [Reference Example 2] Labeling of sample nucleic acid: As a model of sample nucleic acid, an oligonucleotide (C, C) complementary to a part of the sequence of the oligonucleotide (probe A, probe B) synthesized in Reference Example 1
D) was synthesized.

Oligonucleotide C: GAGCCCTCGCTCGTACAGCAAGGTTTCG (SEQ ID NO: 3) Oligonucleotide D: CTGCTGTCCCAAACCCTGACCTCCACC (SEQ ID NO: 4) The 5 ′ end of these oligonucleotides was replaced with aminolink II (trade name) (PE Bio After introducing NH ₂ (CH ₂ ) ₆ − to the 5 ′ end of each oligonucleotide using Systems Japan Co., Ltd.
Labeling was performed with digoxigenin (Roche Diagnostics, Inc.) as follows.

Each of the terminally aminated oligonucleotides was dissolved in 100 mM borate buffer (pH 8.5) to a final concentration of 2 mM. Equivalent amount of Digoxigenin-3-O-methylcarb
onyl-ε-aminocapronic acid-N-hydroxy-succinimide e
ster (26 mg / ml dimethylformamide solution) was added, and the mixture was allowed to stand at room temperature overnight.

The volume was adjusted to 100 μl, and 2 μl of glycogen (Roche Diagnostics, Inc.)
10 μl of 3M sodium acetate (pH 5.2), 300
Add 1 μl of cold ethanol and add 15,000 rpm
The precipitate was collected by centrifugation for 1 minute. 500 μl of 7 for precipitation
The precipitate was collected again at the bottom of the tube by adding 0% ethanol and centrifuging at 15,000 rpm for 5 minutes. The precipitate was air dried and 100 μl of 10 mM Tris-HCl (pH
7.5) Dissolved in 1 mM EDTA.

The DIG-labeled oligonucleotide thus obtained was used as a model of the sample nucleic acid.

[Reference Example 3] Hybridization: A biopolymer sequence slice in which the respective oligonucleotides prepared in Example 12 were regularly arranged in a square was placed in a hybridization bag, and a hybrid having the following composition was prepared. The hybridization solution was poured, and prehybridization was performed at 45 ° C. for 30 minutes.

The DIG-labeled DNA obtained in Reference Example 2 was added, and hybridization was performed at 45 ° C. for 15 hours.

Hybridization solution composition: 5 × SSC (0.75 M sodium chloride, 0.075 M
(Sodium citrate, pH 7.0) 5% blocking reagent (Roche Diagnostics Co., Ltd.) 0.1% N-lauroyl sarcosine sodium 0.02% SDS (sodium lauryl sulfate) 50% formamide [Reference Example 4] Detection: After the hybridization is completed, a biopolymer sequence slice in which oligonucleotides are regularly arranged in a square is placed in a 50-ml 0.1 × SS pre-warmed.
C, transferred to a 0.1% SDS solution, and washed for 20 minutes with shaking at 45 ° C. three times.

DIG buffer 1 was added, and SDS was removed while shaking at room temperature. After repeating this again, D
IG buffer 2 was added and shaken for 1 hour. After removing the buffer, a solution obtained by adding 1 / 10,000 volume of anti-DIG alkaline phosphatase-labeled antibody solution to DIG buffer 2 was added.
Then, the antigen-antibody reaction was performed by slowly shaking for 30 minutes. Next, 0.2% Tween20
Was washed by shaking twice in DIG buffer 1 containing 15 minutes, and then immersed in DIG buffer 3 for 3 minutes. D
After removing IG buffer 3, 3 ml of DIG buffer containing AMPPD was added, and the mixture was equilibrated for 10 minutes.

After draining the water, the mixture was transferred to a new hybridization bag, and kept at 37 ° C. for 1 hour.

As a result, any of the biopolymer array slices
It was confirmed that the oligonucleotide C was bound to the place where the probe A was placed, and the oligonucleotide D was bound to the place where the probe B was placed.

DIG buffer 1: 0.1 M maleic acid,
0.15 M sodium chloride (pH 7.5) DIG buffer 2: DIG buffer 1 with 0.5% concentration of blocking reagent added DIG buffer 3: 0.1 M Tris-HCl (pH 9.
5) 0.1M sodium chloride, 0.05M magnesium chloride Blocking reagent: Anti-DIG alkaline phosphatase-labeled antibody solution and AMPPD are DIG Detect
reagents in the Tion kit (Roche Diagnostics, Inc.).

[0094]

According to the present invention, a biopolymer-immobilized hollow fiber array or a porous hollow fiber array having a fiber cross section in which biopolymers are arranged arbitrarily at a high density and precisely, ie, a thin section having a fiber cross section, High molecular sequence slices can be efficiently obtained with good reproducibility. Using this biopolymer array slice, the type and amount of the biopolymer in the sample can be examined.

[0095]

[Sequence list]

SEQUENCE LISTING <110> Mitsubishi Rayon Co., Ltd. <120> Process for producing a slice of an array o
f biopolymer-fixed fibers <130> P1 <1> P120435000 <160> 4 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 1 gcgatcgaaa ccttgctgta cgagcgaggg ctc <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 2 gatgaggtgg aggtcagggt ttgggacagc ag <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 3 gagccctcgc tcgtacagca aggtttcg <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 4 ctgctgtccc aaaccctgac ctccacc

[0096]

[Free text of Sequence Listing]

 SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA

[Brief description of the drawings]

FIG. 1 is a schematic view of a method for producing a hollow fiber array according to the present invention. (1) is a hollow fiber array (fixed with resin),
(2) indicates a hollow fiber (unfixed), (3) indicates a container containing a biopolymer, and (4) indicates a continuous surface.

FIG. 2 is a schematic view of a cross-sectional view of the hollow fiber array of the present invention.

FIG. 3 is a schematic view of a biopolymer array slice obtained by slicing the hollow fiber array of the present invention in a direction perpendicular to the fiber axis.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 37/00 102 C12N 15/00 ZNAF (72) Inventor Yoko Miyauchi 20-1 Miyukicho, Otake City, Hiroshima Prefecture Mitsubishi Rayon Co., Ltd. Central Research Laboratory (72) Inventor Kei Murase 20-1 Miyukicho, Otake City, Hiroshima Prefecture Mitsubishi Rayon Co., Ltd. 1 Mitsubishi Rayon Co., Ltd. Central Research Laboratory (72) Inventor Toshinori Sumi 20-1 Miyukicho, Otake City, Hiroshima Prefecture Mitsubishi Rayon Co., Ltd. Central Technology Research Laboratory (72) Inventor Osamu Maehara Miyukicho, Otake City, Hiroshima Prefecture 20-1 Mitsubishi Rayon Co., Ltd. Central Research Laboratory (72) Inventor Tadanobu 20-1 Miyukicho, Otake City, Hiroshima Prefecture Mitsubishi Ray Emissions Co., Ltd. Central Technical Institute in

Claims (12)

[Claims] 1. A method in which a plurality of hollow fibers are bundled to form an array, and then the biopolymer is immobilized on the inner wall and / or hollow of each hollow fiber constituting the array. A method for producing a biopolymer array slice, comprising slicing the arrayed array in a direction intersecting the fiber axis. 2. A method in which a plurality of porous hollow fibers are bundled to form an array, and a biopolymer is then immobilized on the inner wall, hollow and / or porous portion of each porous hollow fiber constituting the array. And then slicing the biopolymer-immobilized array in a direction intersecting the fiber axis. 3. A method comprising bundling a plurality of hollow fibers into an array, filling the hollow portion of each hollow fiber constituting the array with a gel containing a biopolymer, and then removing the biopolymer-immobilized array. A method for producing a biopolymer array slice, comprising slicing in a direction crossing a fiber axis. 4. A method in which a plurality of porous hollow fibers are bundled to form an array, and a gel containing a biopolymer is contained in the inner wall portion, hollow portion and / or porous portion of each of the porous hollow fibers constituting the array. A method for producing a biopolymer array slice, comprising, after filling, slicing the biopolymer-immobilized array in a direction crossing a fiber axis. 5. The method for immobilizing a biopolymer on the inner wall portion and / or the hollow portion of each hollow fiber constituting the array, and applying the biopolymer to the tip of the extended portion of each hollow fiber constituting the array. 2. The method for producing a biopolymer array slice according to claim 1, wherein the method is performed by immersing the array in a liquid containing the solution and introducing the liquid into the hollow portion of each hollow fiber constituting the array. 6. The method of immobilizing a biopolymer on an inner wall, a hollow portion, and / or a porous wall portion of each porous hollow fiber constituting an array, comprises the steps of: 3. The living body according to claim 2, wherein the tip of the extended portion is immersed in a liquid containing a biopolymer, and the liquid is introduced into the hollow part and / or the porous part of each porous hollow fiber constituting the array. A method for producing a polymer array flake. 7. Filling the hollow portion of each hollow fiber constituting the array with the gel containing the biopolymer into the hollow portion, and applying the tip of the extended portion of each hollow fiber constituting the array to the biopolymer. 4. The biopolymer array slice according to claim 3, wherein the biopolymer array slice is immersed in a monomer solution containing, and introduced into the hollow portion of each hollow fiber constituting the array, followed by polymerization to form a gel in the hollow portion. Manufacturing method. 8. Filling the hollow portion and / or the porous wall of each porous hollow fiber constituting the array with a gel containing a biopolymer by extending the porous hollow fiber constituting the array. The tip of the portion is immersed in a monomer solution containing a biopolymer, and the solution is introduced into the hollow portion and / or the porous portion of each porous hollow fiber constituting the array, and then polymerized to form a gel in the hollow portion. The method for producing a biopolymer array slice according to claim 4, which is performed by forming. 9. The method for producing a biopolymer array slice according to claim 1, wherein the hollow fibers or the porous hollow fibers in the array are regularly arranged. 10. An array having a cross section of 1 cm perpendicular to the axial direction of hollow fibers or porous hollow fibers constituting the array.
^The method for producing a biopolymer array slice according to any one of claims 1 to 9, wherein the method comprises 100 or more hollow fibers or porous hollow fibers per ² fibers. 11. The method according to claim 1, wherein the biopolymer is a nucleic acid.
0. The method for producing a biopolymer array slice according to any one of items 0 to 10. 12. The method for producing a biopolymer sequence slice according to claim 11, wherein the nucleic acid is of a different type in all or a part of each hollow fiber or each porous hollow fiber constituting the array.