JP2001136968A - Biopolymer-immobilized film laminate and thin film thereof, and method for producing them - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a thin film on which biopolymers are immobilized. SOLUTION: A laminate of a biopolymer-immobilized film on which two biopolymers or more were immobilized in lines or strips, and a thin film having a biopolymer-immobilized film cross-section obtained by cutting the laminate to the direction crossing the oriented direction in lines or strips of the biopolymer are obtained, and a method for producing them is provided. This method allows reproducibly and efficiently obtaining a thin film on which biopolymers are arbitrarily, densely, accurately, two-dimensionally oriented. This thin film allows assaying the kind and amount of biopolymers in a specimen.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a polymer material on which biopolymers such as nucleic acids, proteins, and polysaccharides are immobilized, which can be used in fields such as clinical tests and food tests, and a method for producing the same. More specifically, the present invention relates to a biopolymer-immobilized film laminate, a slice thereof, and a method for producing the same.

[0002]

2. Description of the Related Art In recent years, genome projects for various organisms have been promoted, and a large number of genes including human genes and their base sequences have been rapidly identified. The function of a gene whose sequence has been clarified can be examined by various methods. As one of the promising methods, gene expression analysis using the clarified nucleotide sequence information is known. For example, methods using various nucleic acid: nucleic acid hybridization reactions and various PCR reactions, such as Northern hybridizations, have been developed, and the method is used to examine the relationship between various genes and their biological function expression. Can be. However, these methods have limitations on the number of genes that can be applied. Therefore, in view of the entire complex reaction system consisting of a large number of genes at the individual level, which is being revealed through today's genome project, comprehensive and systematic analysis of genes by the above method is necessary. It is difficult.

[0003] Recently, a new analysis method or methodology called a DNA microarray method (DNA chip method) that enables simultaneous expression analysis of a large number of genes has been developed and attracted attention. These methods are basically the same as the conventional methods in that they are nucleic acid: nucleic acid detection and quantification methods based on a nucleic acid-nucleic acid hybridization reaction. There is a great feature in that a DNA fragment in which DNA fragments are aligned and fixed at high density is used. As a specific method of using the microarray method, for example, a sample in which an expression gene or the like of a cell to be studied is labeled with a fluorescent dye or the like is hybridized on a flat substrate, and mutually complementary nucleic acids (DNA or RNA) are bound to each other. A method of labeling the portion with a fluorescent dye or the like, and then reading the portion at high speed with a high-resolution analyzer. Thus, the amount of each gene in the sample can be quickly estimated. In other words, the essence of this new method is basically the integration of the miniaturization of the reaction sample and the technology to sequence and align the reaction sample in a form that can be analyzed and quantified in a reproducible manner in a large, rapid and systematic manner. It is understood that there is.

[0004] As a technique for immobilizing nucleic acids on a substrate, similar to the Northern method described above, other than a method of immobilizing nucleic acids on a nylon sheet or the like at a high density, a technique for immobilizing nucleic acids on a substrate such as glass is used to further increase the density. And immobilized by coating with polylysine or the like, or a method of directly solid-phase synthesizing short-chain nucleic acids on a substrate such as silicon.

[0005] However, for example, a method of spotting and immobilizing nucleic acids on a substrate obtained by chemically or physically modifying a solid surface such as glass [Science 270, 467-
470 (1995)], although the spot density is superior to the sheet method, the spot density and the amount of nucleic acid that can be fixed per spot are directly synthesized on a silicon substrate (U.
S. Patent 5,445,934; S. Pa
(tent 5, 774, 305), and it is pointed out that reproduction is difficult. On the other hand, using photolithography technology on a substrate such as silicon,
Regarding the method for regularly synthesizing various kinds of short-chain nucleic acids in situ, the number of nucleic acid species that can be synthesized per unit area (spot density), the amount of immobilization per spot (synthesis amount), reproducibility, etc. However, although it is said to be superior to the spotting method, the types of compounds that can be immobilized are limited to relatively short-chain nucleic acids that can be controlled by photolithography. Further, it is difficult to greatly reduce the cost per chip due to the expensive manufacturing apparatus and the multi-stage manufacturing process. In addition, as a technique for solid-phase synthesis of a nucleic acid on a small carrier to form a library, a method using minute beads is known. This method is capable of synthesizing many kinds of long-chain nucleic acids at lower cost than the chip method,
It is thought that nucleic acids longer than NA or the like can be immobilized. However, unlike the chip method, it is difficult to produce a compound in which specified compounds are aligned with high reproducibility based on specified sequence criteria.

As a method of manufacturing an array of biopolymers, a biopolymer is fixed on a linear support, arranged in a line, wound up, filled with a filler in a gap, and formed into a rod. Although a method of obtaining an array of biopolymers by slicing the rod thinly (see Japanese Patent Application Laid-Open No. H11-108929) is disclosed, a sheet is used after immobilizing the biopolymer on a linear support. Since they are arranged in a pattern, it is difficult to arrange them industrially at high density with good reproducibility.

[0007]

Under these circumstances, biopolymers such as nucleic acids, proteins, and polysaccharides can be immobilized at a predetermined concentration regardless of the size of the molecule, and can be measured at a high density in a measurable form. The establishment of a new systematic methodology that can be sequenced with good reproducibility and that can be adapted to inexpensive mass production is strongly required for genetic analysis that is expected to increase in the future, and the problems to be solved by the present invention It is.

[0008] Specifically, the problem to be solved by the present invention is that a biomolecule array production method by microspotting or microdispensing on a two-dimensional carrier such as a nylon sheet or a glass substrate has a problem. The amount of polymer immobilized is high, and the molecular species of biopolymers arranged per unit area can be densified. An array suitable for mass production, that is, a two-dimensional (plane The purpose is to establish a method for producing an array (an immobilized biopolymer two-dimensional array). Further, the problem to be solved by the present invention is, for example, when a nucleic acid is taken as an example of a biopolymer, compared to a method for producing a high-density oligonucleic acid array by a combination of photolithography and solid-phase synthesis on a silicon substrate, It is an object of the present invention to establish a method for producing an immobilized biopolymer two-dimensional array which can be applied to long-chain nucleic acids including cDNA and has a lower production cost.

Another object of the present invention is to fix biopolymers on a linear support, and after arranging them,
It is an object of the present invention to establish a method for producing an array of biopolymers at a lower production cost, at a high density and with good reproducibility, as compared to a method for obtaining an array of biopolymers by slicing the rods into rods. Accordingly, an object of the present invention is to provide a biopolymer-immobilized film laminate on which biopolymers such as nucleic acids, proteins, and polysaccharides are immobilized, a thin piece thereof, and a production method.

[0010]

Means for Solving the Problems The present inventors have conducted intensive studies in order to solve the above-mentioned problems, and as a result, the biopolymer arraying process and the immobilization process were performed on the same two-dimensional carrier. The idea of the conventional method, which is performed only by using only one method, was changed. The process of immobilizing the one-dimensional array of various biopolymers was performed independently on the film using patterning technology.
A biopolymer-immobilized film laminate is produced by introducing various film shaping and laminating techniques into the two-dimensional array immobilization process, and the immobilized biopolymer is immobilized through a lamination process of the obtained laminate. The inventors have found that a dimensional array can be produced, and have completed the present invention.

That is, the present invention is a laminate of a biopolymer-immobilized film in which at least two kinds of biopolymers are arranged and immobilized in a line or a band in parallel, and the arrangement direction is the same. It is a biopolymer-immobilized film laminate. Examples of the laminate include a biopolymer-immobilized film in which the biopolymer-immobilized film contains an array of 10 or more biopolymers per 1 cm in the film surface direction, and 10 or more biopolymer-immobilized films per 1 cm in the stack direction. The type of the immobilized biopolymer is different in all or a part of the immobilized region of each biopolymer immobilized film constituting the biopolymer immobilized film laminate, or immobilized. Examples include those in which the biopolymer is a nucleic acid.

Further, the present invention has a biopolymer-immobilized film cross section obtained by cutting each of the biopolymer-immobilized film laminates in a direction intersecting the direction in which the biopolymers are arranged linearly or in a band. It is a flake. As the slice, for example, a slice containing 100 or more biopolymer-immobilized regions per 1 cm ^{2 of} slice, or a slice having different types of biopolymers in all or part of the biopolymer-immobilized region in the slice And the like.

Further, the present invention provides a method for printing and immobilizing a biopolymer on a film surface in a linear or band-like parallel manner, and then fixing the biopolymer in the thickness direction of the film so that the linear or band-shaped arrangement direction is the same. After sequentially laminating, or after printing the biopolymer on the film surface in a line or strip parallel, immobilized,
In the method for producing each biopolymer-immobilized film laminate, the laminate is continuously laminated in the thickness direction of the wound film such that the linear or band-shaped arrangement direction is parallel to the winding axis. is there.

Further, the present invention is characterized in that the biopolymer-immobilized film laminate obtained by each of the above methods is cut in a direction intersecting the direction of the linear or band-like arrangement of the biopolymer. This is a method for producing a slice having a cross section of a biopolymer-immobilized film.

[0015]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
The present invention relates to a laminate in which at least two types of biopolymers are immobilized in a linear or band-shaped immobilization region and laminated to form a layer, and a method for producing the same. The present invention relates to a flake obtained by cutting a body in a thickness direction of a film and a method for producing the same. The laminate and the thin piece of the present invention and the outline of the production thereof will be described below.

In the present invention, the biopolymer to be immobilized on the film is deoxyribonucleic acid (DN).
A), ribonucleic acid (RNA), peptide nucleic acid (PNA),
Examples include nucleic acids such as oxypeptide nucleic acids (OPNA), proteins, polysaccharides, and the like. The biopolymer used in the present invention may be a commercially available product or a product obtained from living cells or the like.

For example, when a nucleic acid is used as a biopolymer, a known method for preparing DNA or RNA from living cells, for example, for extracting DNA, a method of Blin et al. (Blin et al., Nucleic Acid A).
cids Res. 3: 2303 (1976)), and for extraction of RNA, Fabaloro
Et al. (Favalor et al., Meth.
ods Enzymol. 65: 718 (1980)
) And the like. Further, a linear or circular plasmid DNA or chromosomal DNA, a DNA fragment obtained by cleaving them with a restriction enzyme or chemically, DNA synthesized by an enzyme or the like in a test tube, or a chemically synthesized oligonucleotide is used. Can also.

In the present invention, the biopolymer may be immobilized as it is, or a derivative obtained by chemically modifying the biopolymer or a biopolymer modified as necessary may be immobilized. For example, when a nucleic acid is used as a biopolymer, amination, biotinylation, digoxigenination, and the like are known as chemical modifications of the nucleic acid [Current.
Protocols In Molecular Bi
logic, Ed. Frederick M .; Aus
ubel et al. (1990), De-isotope experiment protocol (1) DIG hybridization (Shujunsha)], and these modifications can be adopted in the present invention.

In the present invention, the biopolymer prepared as described above may be directly immobilized by applying the biopolymer prepared as described above to a film in the form of a solution using the various printing techniques described above, or may be used as necessary. It may be fixed by mixing with a binder resin solution. When the biopolymer is directly immobilized on the film, for example, various chemical or physical interactions between the film and the biopolymer, i.e., the functional groups of the film and the nucleotide of the biopolymer Or a chemical or physical interaction between the constituents.

For example, when a nucleic acid is used as a biopolymer or when an unmodified nucleic acid is immobilized on a film,
After the biopolymer and the film act, they can be fixed by baking or ultraviolet irradiation. When immobilizing a nucleic acid modified with an amino group onto a film, a functional group of the film is immobilized using a crosslinking agent such as glutaraldehyde or 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC). Can be attached to a group. The temperature at which the sample containing the biopolymer acts on the film is 5 ° C.
To 95 ° C, more preferably 15 ° C to 60 ° C.
The processing time is usually 5 minutes to 24 hours, preferably 1 hour or more.

When the biopolymer is mixed with a binder resin solution to be immobilized, the binder resin that can be used in the present invention is not particularly limited. For example, acrylamide, N, N-dimethylacrylamide,
One or two types of monomers such as N-isopropylacrylamide, N-acryloylaminoethoxyethanol, N-acryloylaminopropanol, N-methylolacrylamide, N-vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, and allyldextrin Or more copolymers. If necessary, the copolymer can be cross-linked by copolymerization with a polyfunctional monomer such as methylenebis (meth) acrylamide or polyethylene glycol di (meth) acrylate. It can also be crosslinked. In addition, as the binder resin that can be used in the present invention, for example, agarose, alginic acid, dextran, polyvinyl alcohol, polyethylene glycol, or a crosslinked product thereof can be used.

The biopolymer may be physically immobilized and immobilized on the binder resin, or may be directly bonded to the constituent components of the binder resin. A carrier such as inorganic particles may be bound by a covalent bond or a non-covalent bond, and the carrier may be physically entrapped and immobilized on a binder resin. For example, a vinyl group can be introduced into a terminal group of a biopolymer (see WO 98/39351) and copolymerized with a component of polyacrylamide. Copolymerization includes a method of copolymerizing with a monomer, a polyfunctional monomer and a polymerization initiator, and a method of copolymerizing with a monomer and a polymerization initiator and then gelling with a crosslinking agent.

Alternatively, agarose can be imidcarbonated by the cyanogen bromide method, and can be bonded to the amino group of the terminally aminated biopolymer. At this time, agarose immobilized on a biopolymer may be mixed with another binder polymer.

As another method, there is a method in which a biopolymer is bound to a carrier such as polymer particles or inorganic particles, and the particles are immobilized and immobilized on the binder polymer.
For example, biotinylated biopolymer and avidinated agarose beads (eg, avidinated agarose manufactured by Sigma)
Agarose beads on which the biopolymer is immobilized can be obtained. The biopolymer-immobilized agarose beads can be comprehensively immobilized on polyacrylamide or the like. In addition, when binding to a binder polymer or a carrier, the binding can be performed using a crosslinking agent such as glutaraldehyde or 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC).

In the present invention, a method for immobilizing at least two kinds of biopolymers on a film in a linear or band-shaped immobilized area, for example, preferably, a biopolymer immobilized area of 10 or more per cm is linearly immobilized. Alternatively, as a method of immobilizing on a band-shaped immobilized region, a biopolymer can be immobilized on a film after a biopolymer is immobilized on a linear or belt-shaped support in advance, but immobilized on a film using a printing technique. By performing the patterning, the biopolymer can be immobilized on the linear or band-shaped immobilized region with lower manufacturing cost and high reproducibility with high density.

The printing technique used in the present invention is not particularly limited as long as the biopolymer can be immobilized. Examples thereof include techniques such as letterpress printing, plate printing, gravure printing, screen printing, and ink jet printing. Is mentioned. Furthermore, photolithography technology using various types of radiation light can be used. These printings (lithography) can be performed directly on a film, or can be transferred after printing on a release substrate. In addition to the linear or band-shaped biopolymer immobilized area, a spacer area for separating each immobilized area can be printed simultaneously or sequentially.

In the present invention, the film material that can be used for immobilizing a biopolymer is not particularly limited as long as the biopolymer can be immobilized. A film made of a molecule, a natural polymer, or the like can be used. As synthetic polymers, polyethylene, polypropylene, polystyrene and copolymers thereof, polyvinyl chloride, polyvinylidene chloride,
Polycarbonate, polymethyl methacrylate, saturated polyester, polyvinyl alcohol, polyamide (for example, nylon 6, nylon 66, nylon 610, nylon 11, etc.), polyimide, polyphenylene oxide, polysulfone, polyparaxylene, polyamideimide, polyesterimide, polybenzimidazole, etc. Is mentioned. Representative examples of semi-synthetic resins include cellulose derivatives such as diacetate, triacetate, and chitosan. Representative examples of natural polymers include cellulose, starch, chitin, collagen and the like.

The thickness of the film used in the present invention is not particularly limited, but is preferably from 0.1 μm to 1 μm.
000 μm. The form of the film used in the present invention is not particularly limited. For example, it may have a smooth surface, may have a porous membrane or a porous surface, or may be a nonwoven fabric. In this case, it is also possible to use the film surface, the inside of the film, the space inside the film, or the like as the region for immobilizing the biopolymer.

The film used in the present invention may be used as it is in an untreated state, but may be a film having a reactive functional group introduced therein if necessary. It may be a film which has been subjected to radiation treatment such as a wire, or a primer layer may be formed in advance.
The polymer constituting the primer layer is not particularly limited. For example, acrylamide, N, N-dimethylacrylamide, N-isopropylacrylamide, N-acryloylaminoethoxyethanol, N-acryloylaminopropanol, N-methylolacrylamide, N- One or more copolymers of monomers such as vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, and allyl dextrin may be mentioned. If necessary, methylene bis (meth) acrylamide, polyethylene glycol di (meth) ) It can be crosslinked by copolymerization with a polyfunctional monomer such as acrylate or the like, or can be crosslinked after coating. Other polymers that can be used in the present invention include, for example, polyamino acids such as agarose, polyalginic acid, polyaspartic acid, and polylysine, dextran, polyvinyl alcohol, polyethylene glycol, and cross-linked polymers thereof.

The biopolymer-immobilized film obtained by the above method can be subjected to an appropriate chemical or physical treatment. For example, the immobilized biopolymer is denatured by performing a heat treatment, an alkali treatment, a surfactant treatment, or the like. Alternatively, when a biopolymer obtained from a raw material such as a cell or a bacterial body is used, unnecessary cell components and the like are removed. Then, the processed film can be used as a material for detecting a biopolymer. Note that these processes may be performed separately or simultaneously. In addition, it may be appropriately carried out before immobilizing a sample containing a biopolymer on a film.

The biopolymer-immobilized film prepared as described above can be used as a basic unit constituting the biopolymer-immobilized film laminate of the present invention.

FIG. 1 illustrates a case where three types of films 1 to 3 are used as films to be laminated. Different types of biopolymers can be used in the biopolymer fixed regions 4 to 12 on the films 1 to 3, respectively, and a plurality of the same biopolymers may be fixed. The film is laminated in the z-axis direction based on the xy plane in the three-dimensional coordinates of the x, y, and z axes (FIG. 1A). As a result, when the films 1 to 3 are laminated, a laminate (A1) can be obtained (FIG. 1B). The number of layers of the film to be laminated is not particularly limited,
Usually, 10 to 1,000 depending on the thickness of one film.
It is preferable that the layers be stacked so as to have zero layers. Next, after bonding each film, the laminated body is cut (sliced) in the thickness direction of the film. That is, the laminate (A1) is converted to y
Cutting is performed in a direction intersecting the x axis by the z plane. As a result, a thin section (P1) containing all of the biopolymer-immobilized regions 4 to 12 of the films 1 to 3 can be obtained (FIG. 1).
(C)).

FIG. 2 shows a case where the film 13 is used as a film to be laminated. In the biopolymer-immobilized regions 14 to 22 on the film 13, it is possible to use different types of biopolymers, respectively, and a plurality of the same biopolymers may be immobilized (FIG. 2 ( a)). The film 13 is fixed to the biopolymer fixing region 14.
As shown in FIG. 2 (b), when the X-axis is taken up as the winding axis, the laminate (A2) can be obtained so that all of the elements 22 to 22 are exposed (exposed) on the end surface of the yz plane. . The number of films to be laminated is not particularly limited, and a plurality of films may be laminated beforehand, or a plurality of films may be laminated continuously. The number of layers of the film to be laminated is not particularly limited, but usually,
It is preferable to laminate the layers so as to have 10 to 1,000 layers according to the thickness of one film. Next, after bonding each film, the laminated body is cut (sliced) in the thickness direction of the film. That is, the laminate (A2) is cut along the yz plane in a direction intersecting the x-axis. As a result, a thin section (P2) including all of the biopolymer-immobilized regions 14 to 22 of the film 13 can be obtained (FIG. 2C).

The method of bonding the film is not particularly limited, and the film can be bonded by a generally known bonding method, for example, a laminating method.
Lamination methods include hot melt lamination,
Dry lamination, wet lamination and the like can be mentioned.

As the adhesive used for the hot lamination, low molecular weight polyethylene-vinyl acetate copolymer, paraffin wax, ethylene-acrylate copolymer, etc. are used. Can be laminated. Examples of the adhesive used for the dry lamination include vinyl resins such as vinyl acetate, vinyl chloride and vinylidene chloride, cellulose resins such as nitrocellulose and ethyl cellulose, epoxy resins, rubber resins and the like. After coating the film, it is dried, and then pressurized or heated and pressurized, and then laminated.

Examples of the adhesive used for wet lamination include water-soluble adhesives such as casein, gluten, gelatin, dextrin, starch, etc., and polyvinyl chloride, polyvinyl acetate, polyvinyl butyral, and vinyl acetate-acrylate. Emulsions such as polymers, synthetic rubber latex and the like can be mentioned. Immediately after these are applied, they are press-bonded, dried and laminated.

As a method for cutting the bonded and fixed laminate, there is, for example, a method of cutting a thin piece from the array using a microtome. The thickness of the flake can be arbitrarily adjusted, but is usually 0.1 to 1000 μm.
It is.

The types of biopolymers immobilized in each biopolymer immobilized region in the slice can be different types of biopolymers, and the same biopolymers can be used. May be included in any number. That is, according to the present invention, the type and sequence of the immobilized biopolymer can be arbitrarily set according to the purpose. As for the number of biopolymers per cross-sectional area of the slice, the number of biopolymers to be immobilized on the biopolymer-immobilized film to be used, and the thickness or immobilization method of the biopolymer-immobilized film to be used are appropriately selected. By doing so, it is possible to produce a lamella in which 100 or more, and more than 1,000, biomolecules are immobilized per 1 cm ^{2 of} lamella cross-sectional area.

In this case, it is preferable that the biopolymers immobilized on the film are laminated in a predetermined state, but it is not always necessary to laminate them in such a manner. The reason is that even though the type of the biopolymer immobilized on the film is unknown at the stage of forming the laminate, after cutting the cross section of the laminate, the type of the biopolymer in the cross section is temporarily determined using a hybridization technique or the like. This is because the position of the film on which the specific biopolymer is fixed can be confirmed by determining the arrangement position. Therefore, once using this method, once the types and positions of a plurality of types of biopolymers arranged in the slice have been determined, since the slices obtained from the same array all have the same position arrangement,
The position arrangement of the biopolymer of all the slices obtained from the same array is known.

For example, when the immobilized biopolymer is a nucleic acid, these slices are reacted with a sample using the immobilized nucleic acid as a probe to perform hybridization, thereby obtaining a specific base sequence in the sample. It can be used for detecting biopolymers. The probe referred to in the present invention broadly refers to an immobilized-side biopolymer that can specifically bind to a sample-sample-side biopolymer such as a protein or a low-molecular compound present in the sample. Therefore, the method of using these slices is not limited to the use for detecting a sample sample-side biopolymer that forms a hybrid with the immobilized biopolymer (probe), but also for the immobilized biopolymer. Use for detecting various samples such as a protein or a low molecular compound that specifically binds is exemplified.

In the case of detecting a hybrid, a known means capable of specifically recognizing the hybrid can be used. For example, a labeled substance such as a fluorescent substance, a luminescent substance, or a radioisotope is allowed to act on a biopolymer in a sample, and the labeled substance can be detected. There is no particular limitation on the type of the label or the method for introducing the label, and various conventionally known means can be used.

[0042]

The present invention will be described in more detail with reference to the following examples. However, the technical scope of the present invention is not limited by these examples.

Reference Example 1 Preparation of Oligonucleotide and Oligonucleotide Having an Amino Group at the 5 'Terminal: The following oligonucleotides (probe A and probe B) were synthesized. Probe A: GCGATCGAAACCTTGCTGTACGAGCGAGGGCTC (SEQ ID NO: 1) Probe B: GATGAGGTGGAGGTCAGGGTTTGGGACAGCAG (SEQ ID NO: 2) Oligonucleotide synthesis was performed by an automatic synthesizer DNA / RNA synthesizer from PE Biosystems.
(Model 394), and used after deprotection and purification by a general method. In the final step of DNA synthesis, a biotinylated probe was prepared using biotin amidite.

Example 1 Preparation of biopolymer-immobilized film (1): A nylon film (Biodyne A manufactured by Nippon Pall Co., Ltd.) was subjected to the unmodified oligonucleotides (probe A, probe B) prepared in Reference Example 1. ) Were respectively immobilized by the following method. An aqueous solution of the oligonucleotide (probe A) prepared in Reference Example 1 (nucleic acid concentration: 10 μm)
g / ml) and an aqueous solution of an oligonucleotide (probe B) (nucleic acid concentration: 10 μg / ml) were applied to one surface of a nylon film in a pattern shown in FIG. 3 using screen printing, followed by drying in air. Baking was performed at 80 ° C. for 1 hour to obtain a film in which the oligonucleotides (probe A and probe B) shown in FIG. 3 were immobilized in the linear regions.

Example 2 Preparation of biopolymer-immobilized film (2): A biotinylated oligonucleotide (probe A, probe B) prepared in Reference Example 1 was applied to a polyethylene terephthalate film (film thickness: 20 μm), respectively. And immobilized by the method described above. A solution having the following composition and containing the oligonucleotide having a biotin group at the 5 ′ end obtained in Reference Example 1 was prepared. Acrylamide 3.8 parts by weight Methylenebisacrylamide 0.3 parts by weight 2,2'-azobis (2-amidinopropane) dihydrochloride 0.1 parts by weight Biotinylated oligonucleotide (probe A or probe B) 0.005 parts by weight Avidinated agarose (6%) suspension (Sigma) 1.0 part by weight Agarose aqueous solution (0.2%) 94.3 parts by weight Polyacrylamide 0.5 part by weight A polyethylene terephthalate film of 2 cm × 10 cm was YAMATO CHEMICAL CO., LTD. Plasma etching system (PLASMA REACTOR MODELPR-3)
02), plasma etching was performed for 1 minute at an oxygen flow rate of 100 ml / min and an RF output of 100 W, and then the above solution was applied to one surface of the film in the pattern shown in FIG. The polymerization reaction was carried out by transferring to a closed glass container which had been purged with nitrogen and the inside of which was saturated with water vapor, and left at 80 ° C. for 4 hours. As a result, a nucleic acid-immobilized film in which a polymer layer containing agarose fine particles to which oligonucleotides (probe A and probe B) were immobilized via biotin-avidin bonds was formed in the pattern shown in FIG. 4 was obtained.

Example 3 Preparation of biopolymer-immobilized film laminate (1) Non-immobilization of 20 films obtained in Example 1 and having oligonucleotides (probe A and probe B) immobilized in a pattern A solution of polyvinyl acetate in ethyl acetate (solid content: 10%) was applied to the surface to a dry film thickness of 20 μm, and dried at room temperature. Next, the non-immobilized surface and the immobilized surface of the film were sequentially bonded to obtain a laminate of a nucleic acid-immobilized film having 20 layers.

Example 4 Preparation of a slice of a biopolymer-immobilized film laminate (1) The nucleic acid-immobilized film laminate obtained in Example 3 was made to have a thickness of 100 μm by using a microtome in a direction perpendicular to the film. By cutting out, a slice having a cross section of the nucleic acid-immobilized film laminate shown in FIG. 5 was obtained.

Example 5 Preparation of biopolymer-immobilized film laminate (2) The oligonucleotide (probe A, probe B) obtained in Example 2 was immobilized in a pattern on the non-immobilized surface of the film. Ethyl acetate solution of polyvinyl acetate (solid content 10
%) Was applied to a dry film thickness of 20 μm and dried at room temperature. Next, a laminate of a nucleic acid-immobilized film was obtained by winding the film from the end face of the film while adhering with a PE / vinyl acetate copolymer rod (diameter: 2 mm) as a core.

Example 6 Preparation of a thin section of a biopolymer-immobilized film laminate (2) The nucleic acid-immobilized film laminate obtained in Example 5 was reduced to a thickness of 100 μm by using a microtome in a direction perpendicular to the film. By cutting out, a slice having a cross section of the nucleic acid-immobilized film laminate shown in FIG. 6 was obtained.

Reference Example 2 Labeling of sample nucleic acid: As a model of the sample nucleic acid, oligonucleotides (C, C) complementary to a part of the sequence of the oligonucleotides (probe A and probe B) synthesized in Reference Example 1 were used.
D) was synthesized. Oligonucleotide C: GAGCCCTCGCTCGTACAGCAAGGTTTC
G (SEQ ID NO: 3) Oligonucleotide D: CTGCTGTCCCAAACCCTGACCTCCACC
(SEQ ID NO: 4) The 5 'end of each oligonucleotide was ligated to the 5' end of each oligonucleotide using Aminolink II (trade name) (PE Biosystems Japan) in the same manner as in Reference Example 4. After the introduction of ₂ (CH ₂ ) _6- , digoxigenin (DIG: Di)
goxigenin, Roche Diagnostics, Inc.). Each of the terminally aminated oligonucleotides was treated with a 100 mM borate buffer (pH 8.
In 5), it was dissolved to a final concentration of 2 mM. Equivalent Di
goxigenin-3-O-methylcarbo
nyl-ε-aminocapronic acid-
N-hydroxy-succinimide est
er (26 mg / ml dimethylformamide solution) was added, and the mixture was allowed to stand at room temperature overnight. Adjust the volume to 100 μl,
2 μl glycogen (Roche Diagnostics, Inc.), 10 μl 3M sodium acetate (pH
5.2), 300 μl of cold ethanol was added, and
The precipitate was collected by centrifugation at 00 rpm for 15 minutes. Add 500 μl of 70% ethanol to the precipitate and add 15,000 r
The precipitate was collected again at the bottom of the tube by centrifugation at pm 5 minutes. The precipitate was air dried and 100 μl of 10 mM Tris-
HCl (pH 7.5), dissolved in 1 mM EDTA. The DIG-labeled oligonucleotide thus obtained was used as a model of the sample nucleic acid.

Reference Example 3 Hybridization: A slice having a cross section of the nucleic acid-immobilized film laminate prepared in Examples 3 and 4 was placed in a hybridization bag, and a hybridization solution having the following composition was poured into the bag. ° C
For 30 minutes. Next, the DIG-labeled DNA obtained in Reference Example 2 was added, and
Hybridization was performed at 150C for 15 hours. Hybridization solution composition: 5 × SSC (0.75 M sodium chloride, 0.075 M sodium citrate, pH 7.0) 5% blocking reagent (Roche Diagnostics Co., Ltd.) 0.1% N-lauroyl sarcosine sodium 0.02% SDS (sodium lauryl sulfate) 50% formamide

Reference Example 4 Detection: After completion of hybridization, the nucleic acid-immobilized slice was placed in 50 ml of 0.1 × SS which had been kept warm.
C, transferred to a 0.1% SDS solution, and washed for 20 minutes with shaking at 45 ° C. three times. DIG buffer 1 having the following composition was added, and SDS was removed while shaking at room temperature.
After repeating this again, DIG buffer 2 having the following composition was added and shaken for 1 hour. After removing the buffer, 10 ml of a solution obtained by adding 1 / 10,000 volume of anti-DIG alkaline phosphatase-labeled antibody solution to DIG buffer 2 was added, and
The antigen-antibody reaction was performed by gently shaking for minutes. Next, the plate was washed by shaking twice with DIG buffer 1 containing 0.2% Tween 20 for 15 minutes, and then immersed in DIG buffer 3 having the following composition for 3 minutes. After removing the DIG buffer 3, the DIG buffer containing AMPPD 3m
1 was added and equilibrated for 10 minutes. After draining the water, the mixture was transferred to a new hybridization bag and left at 37 ° C. for 1 hour, and then sandwiched together with an X-ray film in an X-ray film binder to expose the film. As a result, it was confirmed that the oligonucleotide C was bound to the place where the probe A was placed and the oligonucleotide D was bound to the place where the probe B was placed. DIG buffer 1: 0.1 M maleic acid, 0.15 M sodium chloride (pH 7.5) DIG buffer 2: DIG buffer 1 with 0.5% blocking reagent added DIG buffer 3: 0.1 M Tris -Hydrochloric acid (pH 9.
5) 0.1 M sodium chloride, 0.05 M magnesium chloride Blocking reagent: Anti-DIG alkaline phosphatase-labeled antibody solution and AMPPD are DIG Detecti
The reagent in the on kit (Roche Diagnostics, Inc.).

[0053]

According to the present invention, it is possible to efficiently and efficiently obtain, with good reproducibility, thin slices in which biopolymers are arbitrarily densely arranged two-dimensionally. Using this slice, the type and amount of the biopolymer in the sample can be examined. Advantages and usefulness of the present invention compared to the conventional method include, for example,
The immobilization process can be separated and performed independently on the film to enable quantitative immobilization of biopolymers regardless of chain length, and the patterning process has been introduced into the immobilization process, making it easier. High-density and high-reproducibility arraying, lamination of films of any thickness, high-density and high-reproducibility alignment in a measurable form, and the resulting tertiary A thinning process that was not available in the conventional method was newly introduced to produce the target two-dimensional array from the laminate as the original structure. Is unnecessary, and mass production through continuous sectioning has become possible.

[0054]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi Rayon Co., Ltd. <120> An Array of a Biopolymer-Fixed Film, a Slice of the Array and Process for Producing them <130> P110435000 <160> 4 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 1 gcgatcgaaa ccttgctgta cgagcgaggg ctc <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <223> Synthetic DNA < 400> 2 gatgaggtgg aggtcagggt ttgggacagc ag <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <223> Synthetic DNA <400> 3 gagccctcgc tcgtacagca aggtttcg <210> 4 <211> 27 <212> DNA 〉 Artificial Sequence 〈223〉 Synthetic DNA 〈400〉 4 ctgctgtccc aaaccctgac ctccacc

[0055]

[Free text of Sequence Listing] SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA

[0056]

[Brief description of the drawings]

FIG. 1 is a diagram showing an outline for producing a laminate and a thin piece.

FIG. 2 is a diagram showing an outline for producing a laminate and a thin piece.

FIG. 3 is a schematic view showing a biopolymer-immobilized film.

FIG. 4 is a schematic view showing a biopolymer-immobilized film.

FIG. 5 is a schematic view showing a cross section of a biopolymer-immobilized film.

FIG. 6 is a schematic view showing a cross section of a biopolymer-immobilized film.

Description of reference numerals: 1-3: biopolymer-immobilized film 4-12: biopolymer-immobilized region 13: biopolymer-immobilized film 14-22: biopolymer-immobilized region 23: probe A Immobilization area 24 ... Immobilization area of probe B

 ──────────────────────────────────────────────────続 き Continued on the front page F-term (reference) 4B024 AA11 AA19 AA20 CA01 CA11 HA14 4B029 AA07 FA12 FA15 4B063 QA01 QA18 QQ42 QQ52 QR13 QR32 QR35 QR55 QR56 QR58 QR66 QS34 QX02 QX07 4F100 AA40A AA40B90BAB ASB DCA

Claims (11)

[Claims] 1. A biopolymer in which at least two types of biopolymers are arranged and immobilized in a linear or band-like parallel manner and immobilized in a biopolymer-immobilized film, wherein the arrangement direction is the same. Immobilized film laminate. 2. The biopolymer-immobilized film laminate according to claim 1, wherein the biopolymer-immobilized film includes an array of 10 or more biopolymers per 1 cm in the film surface direction. 3. The biopolymer-immobilized film laminate according to claim 1, wherein the biopolymer-immobilized film laminate includes 10 or more biopolymer-immobilized films per 1 cm in the laminating direction. 4. The type of the immobilized biopolymer differs in all or a part of the immobilized region of each biopolymer immobilized film constituting the biopolymer immobilized film laminate. The biopolymer-immobilized film laminate according to any one of claims 1 to 3. 5. The biopolymer-immobilized film laminate according to claim 4, wherein the immobilized biopolymer is a nucleic acid. 6. A biomolecule obtained by cutting the biopolymer-immobilized film laminate according to any one of claims 1 to 5 in a direction that intersects a direction in which the biopolymers are arranged linearly or in a band. A flake having a cross section of a molecule-immobilized film. 7. A lamella having a cross section of a biopolymer-immobilized film according to claim 6, comprising 100 or more biopolymer-immobilized regions per 1 cm ^{2 of} lamella. 8. The lamella having a cross section of a biopolymer-immobilized film according to claim 6, wherein the type of the biopolymer is different in all or a part of the biopolymer-immobilized region in the lamella. 9. After printing and immobilizing a biopolymer on a film surface in a line or band shape in parallel, the layers are sequentially laminated in the film thickness direction so that the line or band arrangement direction is the same. The method for producing a biopolymer-immobilized film laminate according to any one of claims 1 to 5, characterized in that: 10. A biofilm is printed and immobilized on a film surface in a linear or band shape in parallel, and then the thickness of the wound film is adjusted so that the linear or band arrangement direction is parallel to the winding axis. The method for producing a biopolymer-immobilized film laminate according to any one of claims 1 to 5, wherein the laminate is continuously laminated in the direction. 11. A biopolymer-immobilized film laminate obtained by the method according to claim 9 or 10, which is cut in a direction intersecting with a linear or bandwise arrangement direction of the biopolymer. A method for producing a thin section having a cross section of a biopolymer-immobilized film according to claim 8.