JP2001122892A - Nucleic acid immobilized polymer gel and method for producing the gel - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a nucleic acid immobilized polymer gel and to provide a method for producing the gel. SOLUTION: A nucleic acid can be efficiently and firmly immobilized to a polymer gel through a glycidyl group to the surface or the inside of polymer.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a nucleic acid-immobilized polymer gel and a method for producing the same.

[0002]

2. Description of the Related Art In recent years, genome projects for various organisms have been promoted, and a large number of genes including human genes and their base sequences have been rapidly identified. The function of the sequenced gene can be examined by various methods. As one of the promising methods, gene expression analysis using the revealed base sequence information is known. For example, methods using various nucleic acid: nucleic acid hybridization reactions and various PCR reactions, such as Northern hybridizations, have been developed, and the method is used to examine the relationship between various genes and their biological function expression. Can be. Although these methods have limitations on the number of genes that can be applied, the synthesis of a very large number of genes at the individual level, as revealed through today's genomic projects,
DNA microarray method (DNA chip method) that enables simultaneous expression analysis of many genes for systematic analysis
A new analytical method, called methodology, has been developed.

[0003] Some of the present inventors have previously developed and applied for a novel method for manufacturing a microarray (Japanese Patent Application No. Hei 11-1999).
84100). According to the invention, a hollow fiber array holding a nucleic acid-immobilized gel holding a nucleic acid-immobilized gel therein is prepared, and a slice is obtained by cutting the hollow fiber array in a direction intersecting the fiber axis of the array. This slice is an immobilized nucleic acid two-dimensional high-density array, ie, a microarray.

Attempts have been made to immobilize nucleic acids on gels. For example, a method of immobilizing aminated DNA on a copolymer gel having hydroxysuccinimide as a leaving group (Polym. Gel. Netw., 4, ( 2), 11
1 (1996)), a method of binding aminated DNA to a polyacrylamide gel into which an aldehyde group has been introduced (Nu
cleic Acid Res. , 24, 3142 (1
996)), a method of binding aminated DNA to a polyacrylamide gel into which a mesyl group has been introduced (ibid.),
Method of binding aldehyde-modified DNA to polyacrylamide gel into which hydrazide group is introduced (Proc. Na
tl. Acad. Sci. , 93, 4913 (199
6)) and the like are known. However, due to problems of operability and practicality, a more excellent method has been demanded.

[0005]

SUMMARY OF THE INVENTION An object of the present invention is to provide a nucleic acid-immobilized polymer gel having improved operability and practicality, and a method for producing the same.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above problems, and as a result, by immobilizing nucleic acids on the surface and inside of a polymer gel via glycidyl groups, Of the present invention can be efficiently and firmly immobilized on a polymer gel, and the gel can be used to stably detect nucleic acids in a sample with high sensitivity.

That is, the present invention relates to a method for producing a nucleic acid-immobilized polymer gel in which nucleic acids are bonded and immobilized on the surface of a polymer gel and inside thereof via glycidyl groups.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, as a nucleic acid to be immobilized on a gel, deoxyribonucleic acid (DN
A) and ribonucleic acid (RNA). The nucleic acid used in the present invention may be a commercially available product or a nucleic acid obtained from living cells or the like.

[0009] The preparation of DNA or RNA from living cells
For known methods, such as DNA extraction, see Blin
Et al. (Nucleic Acids Res.
2303 (1976)) and the like, and for extraction of RNA, the method of Fabaloro et al. (Method)
s. Enzymol. 65.718 (1980)).

As the nucleic acid to be immobilized, a linear or circular plasmid DNA or chromosomal DNA is used.
These DNAs include restriction enzymes or chemically digested DNA fragments, and DNs synthesized by enzymes and the like in test tubes.
A or a chemically synthesized oligonucleotide may be used.

The gel that can be used in the present invention is not particularly limited. Examples thereof include acrylamide, N, N-dimethylacrylamide, N-isopropylacrylamide, N-acryloylaminoethoxyethanol, and N-gel.
At least one monomer selected from acryloylaminopropanol, N-methylolacrylamide, N-vinylpyrrolidone, hydroxyethyl methacrylate, (meth) acrylic acid, allyldextrin and the like;
A gel obtained by copolymerizing a polyfunctional monomer such as methylenebis (meth) acrylamide or polyethylene glycol di (meth) acrylate in an aqueous medium can be used.

As another method, for example, a gel of agarose, alginic acid, dextran, polyvinyl alcohol, polyethylene glycol or the like, or a gel obtained by cross-linking these can be used.

When a nucleic acid is immobilized on a gel via a glycidyl group, it is necessary to modify the nucleic acid in advance.
The modification is not particularly limited as long as it reacts with the glycidyl group. For example, those having an amino group introduced can be used.

Hereinafter, a method for introducing an amino group into a nucleic acid will be described. The binding position between the aliphatic hydrocarbon chain having an amino group and the single-stranded nucleic acid may be at the 5 'end of the nucleic acid, at the 3' end, in the chain, a phosphodiester binding site or a base site. It is preferable to bind at the terminal or 3 'terminal.

[0015] The single-stranded nucleic acid derivative is disclosed in
No. 39, U.S. Pat. No. 4,667,025, U.S. Pat.
It can be prepared according to the method described in the specification such as 789,737.

In addition to these methods, commercially available reagents for introducing an amino group, for example, aminolink II (manufactured by PE Biosystems Japan), Amino Modi
fiers (manufactured by Clontech) or D
A well-known method for introducing an aliphatic hydrocarbon chain having an amino group into the phosphoric acid at the 5 ′ end of NA (Nucleic Ac
ids Res. , 11 (18), 6513- (198
3)).

The modified nucleic acid can be immobilized on the polymer gel by mixing the polymer gel with the modified nucleic acid. It is also possible to use a catalyst such as a base in consideration of the reaction rate or the reaction rate.

[0018] The immobilization temperature is preferably from 0 ° C to 100 ° C, more preferably from 20 ° C to 80 ° C.

The nucleic acid-immobilized polymer gel can be used for detecting a nucleic acid having a specific base sequence in a sample by reacting the immobilized nucleic acid as a probe with the sample and performing hybridization.

In the present invention, the term "probe" refers to a nucleic acid having a nucleotide sequence complementary to the nucleotide sequence of a gene to be detected. That is, the nucleic acid-immobilized polymer gel of the present invention is reacted with a sample to perform hybridization, forms a hybrid with a nucleic acid present in a sample complementary to the probe, and detects the hybrid to achieve the objective. Nucleic acid in a sample having a base sequence of In a broad sense, it refers to a nucleic acid capable of specifically binding to a protein, a low-molecular compound, or the like present in a specimen.

Therefore, the immobilized polymer gel is not limited to the use for detecting a nucleic acid that forms a hybrid with the immobilized nucleic acid (probe), but may be a protein or a protein that specifically binds to the immobilized nucleic acid. It can also be used to detect various samples such as low molecular weight compounds, for example, biological components.

Known means can be used to detect nucleic acids that form hybrids with the immobilized nucleic acids and various biological components that specifically bind to the immobilized nucleic acids.
For example, a labeled substance such as a fluorescent substance, a luminescent substance, or a radioisotope is allowed to act on a nucleic acid, protein, low-molecular compound, or the like in a sample, and the labeled substance can be detected.
Regarding the type of these labels and the method of introducing the labels, etc.,
There is no particular limitation, and various conventionally known means can be used.

[0023]

The present invention will be described more specifically with reference to the following examples. However, the present invention is not limited to only these examples.

Example 1 (1) Preparation of Oligonucleotide Having Amino Group at 5 'Terminal The following oligonucleotides (probe A and probe B) were synthesized. Probe A: GCGATCGAAACCTTGCTTGT
ACGAGCGAGGGCTC (SEQ ID NO: 1) Probe B: GATGAGGGTGGAGGTCAGGG
TTTGGGACAGCAG (SEQ ID NO: 2)

Oligonucleotide synthesis is performed by using an automatic synthesizer DNA / RNA synthesizer (model).
394) (manufactured by PE Biosystems).
In the final step of DNA synthesis, NH 2 _{(CH 2)} the 5 'end of each oligonucleotide by using an amino link II (available Applied Biosystems) 6 _- to prepare the introduced aminated probe. These were used after deprotection and purification by a general method.

(2) Preparation of a nucleic acid-immobilized polymer gel The probe A or B (500 nmol /
ml) and 5 μl of glycidyl methacrylate were mixed and reacted at 70 ° C. for 2 hours. An aqueous monomer mixture solution (an aqueous solution containing 47.5% w / w of acrylamide and 2.5% w / w of methylenebisacrylamide) 50
μl, 450 μl of water and 5 μl of a 10% azobisisobutyronitrile aqueous solution were added, and a polymerization reaction was carried out at 70 ° C. for 2 hours to prepare a nucleic acid-immobilized polymer gel. The prepared nucleic acid-immobilized polymer gel was cut out to a thickness of 5 mm, and a detection operation was performed.

(3) Labeling of sample nucleic acid The probe A prepared in (1) was used as a model of the sample nucleic acid.
And oligonucleotides C and D complementary to a part of the sequence of B were synthesized. Oligonucleotide C: GAGCCCTCGCTCG
TACAGCAAGGTTTCG (SEQ ID NO: 3) Oligonucleotide D: CTGCTGTCCCCAAA
CCCTGACCTCCACC (SEQ ID NO: 4)

At the 5 'end of these oligonucleotides, NH ₂ (CH ₂ ) was prepared using Aminolink II (manufactured by PE Biosystems Japan) in the same manner as in (1).
_{After 6-} was introduced, it was labeled with digoxigenin (DIG: Digogenin, manufactured by Roche Diagnostics) as follows.

The terminally aminated oligonucleotide was dissolved in a 100 mM borate buffer (pH 8.5) to a final concentration of 2 mM. Equal amount of Digox
igenin-3-O-methylcarbonyl
-Ε-aminocapronic acid-Nh
hydroxy-succinimide ester
(26 mg / ml dimethylformamide solution) was added, and the mixture was allowed to stand at room temperature overnight.

The volume was adjusted to 100 μl, and 2 μl of glycogen (manufactured by Roche Diagnostics), 1
0 μl of 3 M sodium acetate (pH 5.2), 300 μl
One liter of cold ethanol was added, centrifuged at 15,000 rpm for 15 minutes, and the precipitate was collected. Further, 500 μl of 70% ethanol was added to the precipitate, and 15,000 r
The precipitate was collected by centrifugation at pm for 5 minutes. The precipitate was air dried and 100 μl of 10 mM Tris-HCl
(PH 7.5) dissolved in 1 mM EDTA. The DIG-labeled oligonucleotide thus obtained was used as a model of the sample nucleic acid.

(4) Hybridization The nucleic acid-immobilized polymer gel slice prepared in (2) is placed in a hybridization bag, and a hybridization solution having the following composition is poured into the bag.
Prehybridization was performed for 5 minutes, the DIG-labeled DNA obtained in (3) was added, and hybridization was performed at 45 ° C. for 15 hours. Hybridization solution composition; 5XSSC 5% blocking reagent (DIG Detection)
Reagent in kit) 0.01% N-lauroyl sarcosine sodium 0.02% SDS (sodium lauryl sulfate) 50% formamide

(5) Detection After completion of the hybridization, the nucleic acid-immobilized polymer gel section was placed in a 50-ml 0.1 ×
Transfer to SSC, 0.1% SDS solution and shake for 45 min.
Washing was performed three times at 20 ° C. for 20 minutes.

Next, DIG buffer 1 (0.1 M maleic acid, 0.15 M sodium chloride (pH 7.5)) was added, and SDS was removed while shaking at room temperature. After repeating this again, DIG buffer 2 (a blocking reagent having a concentration of 0.5% added to the DIG buffer) was added and shaken for 1 hour. After removing the buffer, 10 ^-4 volume of anti-DIG alkaline phosphatase-labeled antibody (DIG D
DIG buffer solution 2 (reagent of the detection kit)
An antigen-antibody reaction was performed by adding 10 ml and shaking slowly for 30 minutes. Next, 0.2% Tween
Washed twice with DIG buffer 1 containing 20 for 15 minutes, followed by DIG buffer 3 (0.1 M
It was immersed in Tris-hydrochloric acid (pH 9.5), 0.1 M sodium chloride, 0.05 M magnesium chloride for 3 minutes.
After removing DIG buffer 3, DIG buffer 3 containing CDP-Star (manufactured by Roche Diagnostics)
ml was added.

The moisture was removed, the film was transferred to a new hybridization bag, and the film was sandwiched together with the X-ray film in a binder for the X-ray film to expose the film.

As a result, it was confirmed that the oligonucleotide C was bound to the gel section of the probe A and the oligonucleotide D was bound to the gel section of the probe B.

Example 2 (1) Preparation of glycidyl group-containing polymer gel Azobisisobutyronitrile was added to an aqueous solution consisting of 4.65 parts by weight of acrylamide, 0.25 parts by weight of methylenebisacrylamide, and 0.1 parts by weight of glycidyl methacrylate. Was added to a concentration of 0.1% and reacted at 70 ° C. for 2 hours to prepare a polymer gel.

(2) Preparation of Nucleic Acid-Immobilized Polymer Gel The polymer gel prepared in (1) was cut into a 10 mm square thickness, and the probe A or B (500 nmol) prepared by the method of (1) of Example 1 was cut out. / Ml) and mix
The reaction was performed at 0 ° C. for 2 hours to prepare a nucleic acid-immobilized polymer gel. The prepared nucleic acid-immobilized polymer gel was cut out to a thickness of 5 mm, and detection was carried out by the same operation as in (3), (4) and (5) of Example 1.

As a result, it was confirmed that the oligonucleotide C was bound to the gel section of the probe A and the oligonucleotide D was bound to the gel section of the probe B.

[0039]

According to the present invention, a nucleic acid-immobilized gel in which a modified nucleic acid is efficiently and firmly immobilized can be obtained. In addition, when detecting nucleic acid in a sample using this material, it is possible to overcome problems such as a decrease in sensitivity due to desorption of nucleic acid occurring during a washing operation or the like.

[0040]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi Rayon Co., Ltd. <120> Nucleic acid-fixed polymer and that production method <130> P110496000 <140> <141> <160> 4 <170> PatentIn Ver. 2.0 < 210> 1 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 1 gcgatcgaaa ccttgctgta cgagcgaggg ctc 33 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 2 gatgaggtgg aggtcagggt ttgggacagc ag 32 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 3 gagccctcgc tcgtacagca aggtttcg 28 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 4 ctgctgtccc aaaccctgac ctccacc 27

[0041]

[Free text of Sequence Listing] SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA

Continued on the front page (72) Inventor Fujio Yu 10-1 Oguro-cho, Tsurumi-ku, Yokohama-shi, Kanagawa Prefecture F-term (reference) 4B024 AA20 CA01 CA04 CA11 HA12 HA19 4B063 QA01 QQ42 QQ52 QR41 QR82 QS32 4C057 BB02 BB05 CC03 DD01 MM02 MM04

Claims (8)

[Claims] 1. A nucleic acid-immobilized polymer gel in which a modified nucleic acid is bound and immobilized via a glycidyl group. 2. The nucleic acid-immobilized polymer gel according to claim 1, wherein the modified nucleic acid is a nucleic acid having an aminated terminal. 3. The nucleic acid-immobilized polymer gel according to claim 1, wherein the polymer gel is a copolymer gel of glycidyl (meth) acrylate, a polymerizable monomer, and a crosslinking agent. 4. The nucleic acid-immobilized polymer gel according to claim 3, wherein the polymerizable monomer is acrylamide. 5. The nucleic acid according to claim 1, wherein after reacting the glycidyl (meth) acrylate with the modified nucleic acid, a polymerizable monomer and a crosslinking agent are added to polymerize the nucleic acid. Manufacturing method of immobilized polymer gel. 6. The nucleic acid according to claim 1, wherein the modified nucleic acid is allowed to act on a copolymer gel of glycidyl (meth) acrylate, a polymerizable monomer, and a crosslinking agent. Manufacturing method of immobilized polymer gel. 7. The method for producing a nucleic acid-immobilized polymer gel according to claim 5, wherein the modified nucleic acid is a nucleic acid having an aminated terminal. 8. The method for producing a nucleic acid-immobilized polymer gel according to claim 5, wherein the polymerizable monomer is acrylamide.