JP2000157273A - New physiologically active peptide and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new physiologically active peptide composed of a physiologically active peptide having an ability of binding to a receptor protein containing a specified amino acid sequence, and useful for development of a receptor-binding assay system, a medicine or the like for an improver of a memorizing function, or the like. SOLUTION: This new physiologically active peptide is the one (a precursor, an amide, an ester or a salt) having an ability capable of binding to a receptor protein containing an amino acid sequence the same as or substantially the same as the amino acid sequence of formula I and an amino acid sequence the same as or substantially the same as the amino acid sequence of formulas II to IV. The physiologically active peptide is useful for the development of a receptor-binding assay system by using an expression system of a recombinant type receptor protein, the screening of candidate compounds for medicines, the development of a medicine such as an improver of a memorizing function, an improver of appetite, a function regulator in uterus, kidney, prostate, testis and skeletal muscle, and the like. The peptide is obtained by purifying and isolating an extract of swine hypothalamus by using galanin receptor-activating action as an index.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to an activator (such as a ligand peptide) for a galanin receptor.

[0002]

2. Description of the Related Art Galanin is a bioactive peptide consisting of 29 amino acid residues first found in porcine small intestine extract [FEBS Lett.
164, pp. 124-128 (1983)], and have been found in many mammals, birds, reptiles, and fish besides pigs. The amino acid sequence of galanin is human (FEBS Lett., 283, pp18
9-194 (1991)), cattle (FEBS Lett., 234, pp400-406 (19
88)), rat (J. Biol. Chem., 262, pp 16755-16758 (1
987)) and sheep (Peptides, 12, pp 855-859 (1991)) and the like. The 15 amino acid residues from the N-terminus are conserved among species. Porcine galanin has a precursor protein consisting of 123 amino acid residues [preprogalanin (1-123);
Proc. Natl. Acad. Sci. USA, 83, pp. 6287-6291 (198
6)] Also, the precursor p which is 9 residues longer at the N-terminus than galanin
reprogalanin (24-61) amide and preprogalanin (37-61) amide lacking the N-terminal 4 residues of galanin are known (Pep
tides, 13, pp 1055-1060 (1992)). The physiological effects of galanin include acetylcholine release inhibitory activity (Br
ain Research, 709, pp81-87 (1996)).
95 (1995)), Pituitary hormone release promoting action in the pituitary gland (Neuroscience Letter, 75, pp49-54 (1987); Endoc
rinology, 134, pp529-536 (1994); Peptides, 7, pp51
-53, (1986)), Insulin secretion inhibitory action in pancreas (Act
a Physiol. Scand., 139, pp591-596 (1990)) and the like, and its physiological actions are thought to be exerted via galanin receptors. Galanin receptor has three subtypes (GALR1, GALR2, GALR3)
For GALR1, human, rat and mouse (Proc. Natl. Acad. Sci. USA, 90, pp3845-38)
49 (1993); J. Mol. Neurosci., 6, pp33-41 (1995); FE
BS Lett., 411, pp. 225-230 (1997)) and GALR2 in rats (FEBS Lett., 405, pp. 285-290 (1997); Mol. Ph.
armacol., 52, pp337-343 (1997); J. Biol. Chem., 27
2, pp24612-24616 (1997)), and rats for GALR3 (J.
Biol. Chem., 272, pp31949-31952 (1997)). Moreover, these three types of galanin receptors have seven hydrophobic regions (transmembrane domains) characteristic of G protein-coupled receptors. It is thought to stimulate. Galanin has been confirmed to bind to galanin receptors of all three subtypes. The binding affinity of galanin is strongest for GALR1, followed by GALR2 and GALR3, and the affinity for GALR3 is about 10 times weaker than that for GALR1 (J. Biol. Chem. 272 , 31949-31).
952, 1997). In addition, galanin is cA in GALR1-expressing cells.
Cause MP production inhibition (Proc. Natl. Acad. Sc
iA. USA 90 , 3845-3849, 1993), cAM in GALR2-expressing cells
P production inhibition (Mol. Pharmacol., 52,
pp337-343 (1997)), and an increase in the inositol-phosphate metabolism system and an increase in intracellular calcium ion concentration have been reported (J. Biol. Chem. 272 , 24612-24616, 1997).

[0003]

To date, only galanin has been found as an endogenous agonist for the galanin receptor. In addition, galanin
Agonist-dependent G protein (G protein-coupled receptor protein) activation reaction at the receptor, for example,
³⁵ S-labeled guanosine-5'-O-3- thio triphosphate ^([35 S] GTPgS)
Increasing binding reaction (Methods in Enzymology, 237, pp3-13
(1994)) or GTP's hydrolysis reaction (Methods in Enz
ymology 237 , 13-26, 1994).
There is no report on its use for searching for ligands of receptors. It is desired to find new endogenous agonists that differ from galanin in selectivity (specificity) for the galanin receptor subtype.

[0004]

Means for Solving the Problems The present inventors have constructed galanin receptor GALR2-expressing cells and galanin receptor GALR1-expressing cells, and by using these cells, have been able to reduce the agonist activity for each subtype of galanin receptor. A simple assay for measurement, that is, [ ³⁵ S] GTPγS binding test was completed. As a result of screening for GALR2 agonists using this assay method, we succeeded in finding a novel activator that activates each of the galanin receptor subtypes differently from galanin. Furthermore, the present inventors have found that it is possible to screen for a compound that alters the binding between the novel activator and the galanin receptor based on this finding. That is, the present invention provides (1)
Contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 35, and is the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 A peptide having the ability to bind to a receptor protein containing the amino acid sequence of, or its precursor, its amide, its ester or its salt, (2) the same or substantially the same amino acid as the amino acid sequence represented by SEQ ID NO: 35 Contains the sequence and has SEQ ID NO: 1, SEQ ID NO: 2
Or the peptide according to (1) above, which has the ability to activate a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, its precursor, its amide or its ester, or A salt thereof, (3) a peptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 36, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof, 4) The peptide is SEQ ID NO: 11, 12, 1
The peptide according to the above (1) or (3), which is a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 5, 16, or 43, the precursor thereof, or the amide or ester thereof, or A salt thereof, (5) a peptide having SEQ ID NO: 11, 1
The peptide according to the above (1) or (3), which is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 2, 15, 16 or 43 and having a molecular weight of 5,000 to 10,000. Its precursor or its amide or its ester or its salt, (6) the peptide is SEQ ID NO: 31, 33 or 34
A peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by the above (1) or the peptide according to the above (3), a precursor thereof, an amide thereof, an ester thereof, or a salt thereof; The precursor of the peptide according to the above (1) or (3), wherein the precursor is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 29, or an amide or an ester thereof; (8) a substantially identical amino acid sequence represented by SEQ ID NO: 3
A precursor of the peptide according to the above (6), which is an amino acid sequence represented by 0, 37 or 38, or an amide or an ester or a salt thereof; (9) a peptide according to the above (1) or (3) (10) SEQ ID NO: 3
The DNA according to the above (9), which encodes a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 1, 33 or 34, (11) SEQ ID NO:
The DNA according to the above (10), having a base sequence represented by 32, 39 or 40; (12) SEQ ID NO: 29, 3
It contains a DNA containing a base sequence encoding the precursor of the peptide according to (1) or (3) having the same or substantially the same amino acid sequence as that represented by 0, 37 or 38. DNA, (13) The DN according to the above (12), which contains a DNA containing the base sequence represented by SEQ ID NO: 27, 28, 41 or 42.
A, (14) a recombinant vector containing the DNA of (9), (15) a transformant transformed with the recombinant vector of (14), (16) a transformant of (15) The transformant is cultured and the above (1) or (3)
A method for producing the peptide according to the above (1) or (3), a precursor thereof, an amide thereof, an ester thereof, or a salt thereof, (17) the above (1) or the above ( 3) an antibody against the peptide or the precursor thereof according to the above, (18) a diagnostic agent comprising the antibody according to the above (17), (19)
A medicament comprising the peptide according to (1) or (3) or a precursor thereof, an amide thereof, an ester thereof or a salt thereof, (20) a memory function improving agent,
The medicament according to the above (19), which is an appetite regulator, a uterine function regulator, a renal function regulator, a prostate function regulator, a testis function regulator or a skeletal muscle function regulator, (21) the (1) or (3) ) Or its precursor or amide or ester or salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, 2 or 3. And (22) a compound or a salt thereof obtained by the screening method described in (21) above.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION In the present specification, “substantially the same” means the activity of a protein, for example, an agonist activity for a receptor, ie, an activity of activating a receptor possessed by a ligand, an activity of binding a ligand to a receptor, and the like. Mean substantially the same. Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the peptide, in which case the substituted, deleted, added or inserted peptide is Would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. Glycine, serine, threonine, and polar (neutral) amino acids
Cysteine, tyrosine, asparagine, glutamine and the like. Examples of (basic) amino acids having a positive charge include arginine, lysine, histidine and the like.
Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid. The peptide of the present invention is a peptide having a binding ability to a galanin receptor. Preferably, it is a known ligand peptide other than galanin which has an activating effect on a galanin receptor. The galanin receptor is as described below.

The peptide of the present invention contains, for example, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 35 (eg, SEQ ID NO: 13, etc.), and A peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 and having the ability to bind to a receptor protein (preferably the ability to activate the receptor protein, etc.); In particular,
(I) contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 35 (for example, SEQ ID NO: 13, etc.), and has SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15 Contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 16 or SEQ ID NO: 43;
A peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 and having the ability to bind to a receptor protein (preferably the ability to activate the receptor protein, etc.); (II) the peptide according to (I), wherein the molecular weight is 5,000 to 10,000, and (III) the molecular weight is 5,000 to 80.
(IV) has the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 17, and SEQ ID NO: 1, SEQ ID NO: 2, or It has the ability to bind to a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 3 (preferably the ability to activate the receptor protein, etc.), and has a molecular weight of 5,000 to 10,000. (V) having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34, and SEQ ID NO: 1, SEQ ID NO: 2 or the ability to bind to a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 Peptides having the ability (preferably, the ability to activate a receptor protein, etc.) are exemplified. Further, as the peptide of the present invention, for example,
(VI) a peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 36, (VII) SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16 Or the peptide according to the above (VI), which contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 43, (VIII)
The peptide according to the above (VII) having a molecular weight of 5,000 to 10,000, (IX) the peptide according to the above (VII), having a molecular weight of 5,000 to 8,000, (X) SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by: (XI) a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 17, ( XII) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 35 (for example, SEQ ID NO: 13, etc.), and having SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 16 or SEQ ID NO: 43, (XIII) molecular weight 5000-10000 and is the (X) ~ (XII), wherein the peptide,

[0007] The peptide of the present invention, its production method and use are described in more detail below. Although the origin of the peptide of the present invention is not particularly limited, for example, tissues (eg, pituitary gland, pancreas,
Brain, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract, blood vessels, heart, testis, etc.)
Or a peptide derived from a cell or the like (eg, mouse brain, rat brain, pig brain, bovine brain, pig hypothalamus, bovine hypothalamus, pig lung, bovine lung, bovine stomach, human hypothalamus, pig testis) , Bovine testis, rat testis, human testis or human lung), or a synthetic peptide. For example, the peptide of the present invention is represented by SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34). In addition to a peptide containing an amino acid sequence, SEQ ID NO: 1
7, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO:
34 (preferably SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34) and about 5
0 to 99.9% (preferably 70 to 99.9%, more preferably 80 to 99.9%, and still more preferably 90 to 9
A peptide having substantially the same activity as a peptide containing an amino acid sequence having a homology of 9.9% (most preferably 95 to 99.9%) (provided that SEQ ID NO: 7,
Excluding the sequence of galanin or its precursor represented by 8, 9, or 10).

[0008] "Substantially the same activity" includes, for example, the activity of binding to the galanin receptor GALR1, GALR2 or GALR3, the activity of the galanin receptor GALR1, GALR2 or GA.
LR3 activating activity or associated arachidonic acid release, intracellular Ca ²⁺ release, inhibition of intracellular cAMP production, inositol phosphate production (inhibition), fluctuation of cell membrane potential, phosphorylation of intracellular protein, intracellular Shows homogeneity in the ability to activate signal transduction system such as pH change. Therefore, quantitative factors such as the intensity of these activities and the molecular weight of the peptide may be different. Specific examples of the peptide of the present invention include the following (however, excluding galanin having the amino acid sequence represented by SEQ ID NO: 7, 8, 9, or 10 or a precursor thereof). (I) SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 3
3 or SEQ ID NO: 34 (preferably, SEQ ID NO: 3
1, a mouse brain, a rat brain, a pig brain, or a bovine brain containing an amino acid sequence represented by the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 33 or SEQ ID NO: 34) or a partial sequence thereof. Peptide derived from porcine hypothalamus, bovine hypothalamus, porcine lung, bovine lung, bovine stomach, human hypothalamus, porcine testis, bovine testis, rat testis, human testis or human lung. (II) SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 3
3 or SEQ ID NO: 34 (preferably, SEQ ID NO: 3
1, one or more amino acids to a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 33 or SEQ ID NO: 34) or a partial peptide thereof. Peptides containing an amino acid sequence in which is substituted, deleted, added or inserted are mentioned as peptides containing substantially the same amino acid sequence. For example, (1) the amino acid sequence represented by SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34) or An amino acid sequence in which 1 to 7 amino acids, preferably 1 to 5 amino acids, and more preferably 1 to 3 amino acids in the partial sequence have been deleted, (2) SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably, SEQ ID NO: 31, SEQ ID NO:
33 or SEQ ID NO: 34) or 1 to 20 amino acids, preferably 1 to 15 amino acids, more preferably 1 to 10 amino acids added to the amino acid sequence represented by SEQ ID NO: 34 or a partial sequence thereof (or (3) SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34) Contains an amino acid sequence in which one or more and seven or less, preferably one or more and five or less, more preferably one or more and three or less amino acids in the amino acid sequence or a partial sequence thereof are substituted with another amino acid. Peptides and the like. The “substantially the same amino acid sequence” is 70 to 99.9%, more preferably 80 to 99.9% of the sequence.
%, More preferably 90 to 99.9%, and most preferably 95 to 99.9%.

The peptide of the present invention has a molecular weight of about 5,000 to about 10,000 daltons, preferably about 5,000 to about 800, as measured by gel filtration chromatography or the like.
0 daltons, more preferably about 5500 to about 8000 daltons, and even more preferably about 6000 to about 7000 daltons. In the peptide in the present specification, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide labeling. The peptides of the invention, C-terminal, usually a carboxyl group (-COOH) or carboxylate (-COO ^-) is a, C-terminal, it may be an amide (-CONH ₂₎ or ester (-COOR). As R of the ester, for example, methyl,
C _1-6 alkyl groups such as ethyl, n-propyl, isopropyl or n-butyl, C _3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl, phenyl, α-
C _6-12 aryl groups such as naphthyl, phenyl-C _1-2 alkyl such as benzyl, phenethyl, benzhydryl,
Or α-naphthyl-C such as α-naphthylmethyl
_In addition to C _7-14 aralkyl groups such as _1-2 alkyl and the like, pivaloyloxymethyl groups widely used as oral esters and the like can be mentioned. When the peptide of the present invention has a carboxyl group or carboxylate other than the C-terminal,
Those in which those groups are amidated or esterified are also included in the peptide of the present invention. As the ester at this time, for example, the same ester as the above-mentioned C-terminal ester and the like are used.

As a salt of the peptide of the present invention, a salt with a physiologically acceptable base (for example, an alkali metal or the like) or an acid (organic acid or inorganic acid) is used. Addition salts are preferred. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The peptide of the present invention can be produced by a method for purifying the peptide from human or warm-blooded animal tissues or cells, or according to the peptide synthesis method described below. The peptide of the present invention can also be produced by culturing a transformant containing a DNA encoding the peptide. DNA encoding the peptide can be obtained by a known cloning method [for example, Mo
lecular Cloning (2nd ed .; J. Sambrook et al., Col
d Spring Harbor Lab. Press, 1989). The cloning method includes: (1) a method of obtaining a transformant containing DNA encoding the peptide from a cDNA library by a hybridization method using a DNA probe or DNA primer designed based on the amino acid sequence of the peptide; Or (2) using a DNA primer designed based on the amino acid sequence of the peptide,
A method for obtaining a transformant containing the DNA encoding the peptide by the CR method. When producing the peptide of the present invention from human or warm-blooded animal tissues or cells,
After homogenizing human or warm-blooded animal tissues or cells, extraction with an acid or alcohol is performed, and the extract is subjected to salting out, dialysis, gel filtration, reverse phase chromatography,
Purification and isolation can be performed by combining chromatography such as ion exchange chromatography and affinity chromatography.

As described above, the peptide of the present invention comprises
It can be produced according to (1) a peptide synthesis method known per se, or (2) cleaving a peptide containing the peptide of the present invention with a suitable peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the peptide of the present invention with the remaining portion and, when the product has a protecting group, removing the protecting group. Known condensation methods and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Also, after the reaction, the peptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. Can be. When the peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and when it is obtained by a salt, it can be converted to a free form by a known method. .

As the amide of the peptide of the present invention, a commercially available resin for peptide synthesis suitable for amide formation can be used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin,
PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4-
(2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fm
ocaminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target peptide according to various condensation methods known per se. At the end of the reaction, the peptide is cleaved from the resin, and at the same time, various protecting groups are removed, and if necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target peptide. For the condensation of the protected amino acids described above, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimide and the like. Activation by these includes racemization inhibiting additives (eg, HOBt, HO
The protected amino acid together with OBt) can be added directly to the resin or can be added to the resin after activating the previously protected amino acid as a symmetric anhydride or HOBt ester or HOOBt ester.
The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, N,
Acid amides such as N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethyl sulfoxide, and pyridine For example, tertiary amines such as dioxane, tetrahydrofuran and the like, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from the range that can be used for the peptide bond formation reaction, and is usually about -20 ° C to about 50 ° C.
Is appropriately selected from the range. The activated amino acid derivative is usually used in about 1.5 to about 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction. Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, trifluoro Acetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like can be mentioned.
Examples of the carboxyl-protecting group include the above-mentioned C _1-6 alkyl group, C _3-8 cycloalkyl group and C
_7-14 aralkyl groups, 2-adamantyl, 4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl group and benzyloxycarbonyl hydrazide, tert-butoxycarbonyl hydrazide,
And trityl hydrazide. The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Suitable groups for this esterification include, for example, lower (C _1-6 ) alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group. . Examples of groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a tertiary butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br
-Z, tertiary butyl and the like. The protecting groups for imidazole of histidine include Tos, 4-methoxy-
2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like. Activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,
4,5-trichlorophenol, 2,4-dinitrophenol,
Cyanomethyl alcohol, paranitrophenol, HON
B, N-hydroxysuccinimide, N-hydroxyphthalimide, ester with HOBt)]. Examples of the activated amino group of the raw material include a corresponding phosphoric amide. As a method of removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethanesulfonic acid Acid treatment with trifluoroacetic acid or a mixture thereof, or base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc.
Also, reduction with sodium in liquid ammonia can be mentioned. The elimination reaction by the above acid treatment is generally performed at -20 ° C or higher.
It is carried out at a temperature of 40 ° C., but in the acid treatment, addition of a cation scavenger such as anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol. Is valid. In addition, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by an acid treatment in the presence of dithiol or the like, it is also removed by an alkali treatment with dilute sodium hydroxide, dilute ammonia or the like.

The protection and protection of functional groups that should not be involved in the reaction of the starting materials, the elimination of the protective groups, the activation of the functional groups involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining the amide form of the peptide of the present invention, first, after amidating the α-carboxyl group of the carboxyl terminal amino acid, extending the peptide chain to the desired chain length on the amino group side, And a peptide (or amino acid) from which only the protecting group for the N-terminal α-amino group is removed and a peptide (or amino acid) from which only the protecting group for the C-terminal carboxyl group is removed. To condense. Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude peptide. This crude peptide is purified using various known purification means,
The amide of the desired peptide can be obtained by freeze-drying the main fraction. In order to obtain an ester of the peptide of the present invention, an α-carboxyl group of the carboxy terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then an ester of the desired peptide is obtained in the same manner as the amide of the peptide. Can be. The peptide of the present invention is represented by SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34). As long as it has the same action (eg, GALR1 agonist activity, GALR2 agonist activity or GALR3 agonist activity) as a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence or its partial sequence. And any peptide. Such peptides include, for example, the aforementioned SEQ ID NO: 17, SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO: 34 (preferably SEQ ID NO: 31, SEQ ID NO:
33 or a partial sequence thereof represented by SEQ ID NO: 34) or a peptide having an amino acid sequence in which 1 to 5 amino acids have been deleted, added (inserted) or substituted. The precursor of the peptide of the present invention is a peptide encoding the ligand peptide of the present invention as a partial sequence thereof (provided that SEQ ID NO: 7,
(Excluding galanin having an amino acid sequence represented by 8, 9, or 10 or a precursor thereof).

As the precursor of the peptide of the present invention, specifically, for example, a peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 29, etc. can give. Here, the “substantially identical amino acid sequence” is 70 to 99.9 as the amino acid sequence represented by SEQ ID NO: 29.
%, More preferably 80 to 99.9%, still more preferably 90 to 99.9%, and most preferably 95 to 99.9%.
And the like. The “substantially identical amino acid sequence” includes (i) 1 to 7 amino acids, preferably 1 to 5 amino acids, more preferably 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 29.
(Ii) an amino acid sequence represented by SEQ ID NO: 29, wherein 1 to 7 amino acids are substituted with another amino acid, and 1 to 7 amino acids, preferably 1 to 5 amino acids, (Iii) 1 to 7 amino acids, preferably 1 to 5 amino acids, more preferably 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 29, wherein 1 to 3 amino acids are deleted. An amino acid sequence in which one or more and three or less amino acids are added (or inserted) is exemplified. The position of “substitution, deletion, addition (or insertion)” is not particularly limited as long as it is other than a region encoding the ligand peptide of the present invention as a partial sequence thereof. SEQ ID NO: 2
Specific examples of the peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 9 include, for example, (1) SEQ ID NO: 30
(2) a peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37; And (3) a peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 38. The peptide of the present invention can be further used as an antigen for preparing an anti-ligand peptide antibody. As the peptide as such an antigen, in addition to the above-mentioned peptide of the present invention, for example, partial peptides such as the N-terminal peptide, C-terminal peptide and central peptide of the above-mentioned peptide of the present invention are used.
As the partial peptide, a peptide individually containing each domain of the peptide of the present invention may be used, but a partial peptide containing a plurality of domains at the same time may be used. Further, since the above partial peptide may be used as long as it can be used as an antigen for preparing an anti-ligand peptide antibody, (i) the N-terminal peptide, C-terminal peptide, central peptide and the like of the peptide of the present invention One to several (preferably one to three, more preferably one or two)
And (ii) one to several (preferably) N-terminal peptide, C-terminal peptide, central peptide and other partial peptides of the peptide of the present invention. Is a partial peptide in which 1 to 3, more preferably 1 or 2) amino acid residues are deleted, (iii) a partial peptide such as an N-terminal peptide, a C-terminal peptide, or a central peptide of the peptide of the present invention. And partial peptides in which one to several (preferably one to three, more preferably one or two) of the constituent amino acids are replaced by other amino acid residues.

More specifically, as the above partial peptide, for example, (i) Ala
Pro Ala His Arg Gly Arg Gly Gly Gly Gly Gly Cys-NH ₂ (amide of SEQ ID NO: 44), and (ii) an amino acid sequence represented by SEQ ID NO: 11 Peptide, (iii) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 12, (i)
v) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 13, (v) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 15, (vi) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 16, (vii) SEQ ID NO: 17
(Viii) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 35, (ix) a peptide consisting of the amino acid sequence represented by SEQ ID NO: 36, and (x) a SEQ ID NO: : 43, and the like. The partial peptide in the present specification also has an amide (-CONH ₂ ) at the C-terminus.
Or it may be an ester (-COOR). Here, examples of the ester group are the same as those of the peptide described above. When the partial peptide has a carboxyl group or a carboxylate at a position other than the C-terminal, those in which those groups are amidated or esterified are also included in the partial peptide of the present invention. As the ester at this time, for example, the above-mentioned C-terminal ester and the like are used. The partial peptide of the peptide of the present invention may itself have the activity of the peptide of the present invention (eg, activating action on galanin receptor). The peptide of the present invention or a partial peptide thereof may be a fusion protein with a protein whose function or property is well known. Specific examples of the fusion protein include:
For example, Ala Pro A used in Example 11
la His Arg Gly Arg Gly Gly Cys-NH ₂ (SEQ ID NO: 44
And a fusion protein of a peptide containing an amino acid sequence represented by the following formula (amide form) and Keyhole Limpet Hemocyanin (KLH).

As the salt of the partial peptide of the peptide of the present invention, the same salts as the above-mentioned salts of the peptide are used.
The partial peptide of the peptide of the present invention or its amide, ester or salt thereof can be produced according to the same synthetic method as in the above-mentioned peptide, or by cleaving the peptide of the present invention with an appropriate peptidase. The DNA encoding the peptide of the present invention includes (I) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 35 (eg, SEQ ID NO: 13 and the like), and 1, having the ability to bind to a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 (preferably the ability to activate the receptor protein, etc.) DN containing a nucleotide sequence encoding a peptide or a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by (II) SEQ ID NO: 36
Any DNA may be used as long as it contains A. Further, D containing DNA containing a nucleotide sequence encoding the peptide of the present invention specifically described above.
Any NA may be used. Also,
Genomic DNA, genomic DNA library, cDNA derived from the above-mentioned tissue / cell, c derived from the above-mentioned tissue / cell
It may be either a DNA library or a synthetic DNA. The vectors used for the library are bacteriophage,
Any of a plasmid, a cosmid, a phagemid and the like may be used. In addition, reverse transcriptase poly is directly used by using an RNA fraction prepared from the above-mentioned tissue / cell.
It can also be amplified by a merase Chain Reaction (hereinafter abbreviated as RT-PCR method). More specifically,
(1) SEQ ID NO: 31, SEQ ID NO: 33 or SEQ ID NO:
DNA containing a DNA containing a base sequence encoding a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 34 (2) The DNA defined in (1) under stringent conditions DNA derived from a mammal that hybridizes with the sequence, (3) encodes a polypeptide having the same amino acid sequence as the above (3) due to degeneracy of the genetic code, does not hybridize with the sequence defined in (1) and (2) DNA or the like is used. Hybridization can be performed according to a method known per se or a method analogous thereto. The stringent conditions include, for example, 42 ° C., 50% formamide, 4 × S
SPE (1 × SSPE = 150 mM NaCl, 10 mM NaH ₂ PO ₄ .H ₂ O,
1mM EDTA pH7.4), 5x Denhardt's solution, 0.1% SD
S. A specific example of a DNA containing a DNA containing a base sequence encoding a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 31 is represented by SEQ ID NO: 32 And a DNA containing a nucleotide sequence encoding a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 33. DNA contained
Specific examples include a DNA containing a DNA containing the base sequence represented by SEQ ID NO: 39, and the like. An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 34 is Specific examples of the DNA containing the DNA containing the nucleotide sequence encoding the peptide contained therein include a DNA containing the DNA containing the nucleotide sequence represented by SEQ ID NO: 40. Also,
In the DNA encoding the peptide of the present invention or a partial peptide thereof, for example, 6 or more and 51 or less (preferably 9 or less)
A DNA fragment containing a partial nucleotide sequence of at least 30 and more preferably at most 12 and at most 30 is also preferably used as a DNA detection probe. Examples of the DNA encoding the precursor of the peptide of the present invention include the above-described precursor of the peptide of the present invention, specifically, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 29 (for example, , SEQ ID NO: 30, SEQ ID NO: 3
7 or the amino acid sequence represented by SEQ ID NO: 38)
Any DNA may be used as long as it contains a DNA containing a base sequence encoding a peptide (polypeptide) or the like. Specific examples of DNA containing a DNA containing a base sequence encoding a peptide (polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 29 include SEQ ID NO: D containing the base sequence represented by 27
DNA containing NA, and the like.
Specific examples of DNA containing a DNA containing a base sequence encoding a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by
And a DNA containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37. Specific examples of the DNA containing the base sequence-containing DNA include a DNA containing the base sequence-containing DNA represented by SEQ ID NO: 41, and the like. D containing a nucleotide sequence encoding a peptide containing the same or substantially the same amino acid sequence
As a specific example of DNA containing NA, SEQ ID NO: 4
Containing DNA containing the base sequence represented by 2
A and the like.

DNA encoding the peptide of the present invention
Can also be produced by the following genetic engineering techniques. The genetic engineering techniques include, for example, Molecular Cl
oning (2nd ed .; J. Sambrook et al., Cold Spring H
arbor Lab. Press, 1989). When a commercially available library or kit is used, the method may be performed according to the method described in the attached instruction manual. The DNA encoding the peptide or the like of the present invention is a DNA based on the amino acid sequence of the peptide or a part thereof.
The probe synthesized and labeled with the fragment can be selected by hybridization with a genomic DNA or cDNA library or the like. As a means for cloning a DNA that completely encodes the peptide of the present invention, a synthetic DNA primer having a partial nucleotide sequence of the peptide of the present invention is used, and a genomic DNA or cDNA library or the like is obtained by a PCR method known per se. The target DNA is amplified or the DNA incorporated into an appropriate vector is converted into a DNA fragment having a partial or entire region, such as the peptide of the present invention, or a synthetic DN.
Selection can be carried out by hybridization with those labeled with A. The cloned DNA encoding the peptide of the present invention can be used as it is depending on the purpose, or may be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA has an ATG as a translation initiation codon at its 5 'end,
TAA and T as translation termination codons are located at the 3 'end.
It may have GA or TAG. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. An expression vector such as the peptide of the present invention can be prepared, for example, by (A) cutting out a DNA fragment of interest from DNA encoding the peptide of the present invention, and (B) ligating the DNA fragment downstream of a promoter in an appropriate expression vector. Can be manufactured. As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pU
C13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as phage λ, and animal viruses such as retrovirus, vaccinia virus, and baculovirus.

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. When the host used for the transformation is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SRα promoter and the like can be used. When the host is Escherichia, trp promoter, T7 promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, etc., and when the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc. When the host is yeast, PHO5 promoter, PGK promoter, G
An AP promoter, an ADH1 promoter, a GAL promoter and the like are preferred. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. In addition to those described above, an expression vector containing an enhancer, a splicing signal, a polyA addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), and the like may be used as the expression vector. it can. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
^r ), neomycin resistance gene (hereinafter sometimes Neo, G418 resistance)
And the like. In particular, when CHO (dhfr ⁻ ) cells are used and the DHFR gene is used as a selection marker, selection can also be performed using a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the peptide or its partial peptide. When the host is a bacterium belonging to the genus Escherichia, a phoA signal sequence, an OmpA signal sequence, or the like is used. In some cases, such as mating factor α (MFα) signal sequence, invertase signal sequence, etc., and when the host is an animal cell, for example, insulin signal sequence, α-interferon signal sequence, antibody molecule
A signal sequence or the like can be used. Using the vector containing the DNA encoding the peptide thus constructed, a transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insects or insect cells, animal cells and the like are used. Examples of Escherichia bacteria include Escherichia coli K12.DH1.
[Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Bacillus spp.
Bacillus subtilis MI114 [Gene,
24, 255 (1983)], 207-21 [Journal of Biochemis
try), 95, 87 (1984)].
As yeast, for example Saccharomyces cerevisiae ^{(Saccharomyces cerevisiae) AH22, AH22R -} ,
NA87-11A, DKD-5D, 20B-12 and the like are used. As insects, for example, silkworm larvae are used [Maeda et al., Nature, 315
Vol., 592 (1985)]. As insect cells, for example,
When the virus is AcNPV, a cell line derived from a larva of night rob moth (Spodoptera frugiperda cell; Sf cell), Tric
MG1 cells from the midgut of hoplusia ni, Trichoplusia ni
Egg-derived High Five ^™ cells, Mamestrabrassicae-derived cells, Estigmena acrea-derived cells, and the like. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. As the Sf cells, for example, Sf9 cells (ATCC C
RL1711), Sf21 cells (Vaughn, JL et al., In Vitro, 13, 213-217 (1977)) and the like. Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (CHO / dhfr ⁻ cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, and human HEK293 cells. , Human FL cells, 29
3 cells, C127 cells, BALB3T3 cells, Sp-2
/ O cells and the like are used.

In order to transform Escherichia bacteria, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69, 21
10 (1972) and Gene, 17, 107 (1)
982). For transformation of Bacillus sp., For example, Molecular & General Genetics (Molecular & G)
Eneral Genetics), Vol. 168, 111 (1979). To transform yeast, for example, Procagings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 75,
1929 (1978).
To transform insect cells or insects, see, for example, Bio / Technology, Vol. 6, 47-5.
The method is carried out according to the method described on page 5 (1988) and the like. Transformation of animal cells is performed, for example, according to the method described in Virology, Vol. 52, 456 (1973). As a method for introducing an expression vector into cells, for example, a lipofection method [Felgner,
PL et al. Proceedings of the NatinalAcademy of Sci (Proceedings of the National Academy of Sciences of the USA)
ences of the United States of America), 84 volumes,
7413 (1987)], calcium phosphate method [Gr.
aham, FL and van der Eb, AJ virology (Viro
logy), 52, 456-467 (1973)],
Electroporation [Nuemann, E. et al. Embo J., 1, 841-845 (1982)
Year)]. Thus, a transformant transformed with the expression vector containing the DNA encoding the peptide of the present invention or the like is obtained. As a method for stably expressing the peptide or the like of the present invention using animal cells, there is a method of selecting, by clonal selection, cells in which the expression vector introduced into the animal cells has been integrated into the chromosome. Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the peptide of the present invention or the like can be obtained by repeatedly performing clonal selection on the animal cells obtained using the selection marker. When the dhfr gene is used as a selection marker, the DNA encoding the peptide of the present invention and the like are amplified together with the dhfr gene in cells by culturing the MTX concentration gradually and selecting a resistant strain. ,
Furthermore, an animal cell line with high expression can be obtained. The above-mentioned transformant is cultured under conditions capable of expressing the DNA encoding the peptide of the present invention, and the peptide of the present invention can be produced and accumulated by producing and accumulating the peptide of the present invention. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the cultivation. Nitrogen sources, inorganic substances, etc. are contained. Examples of carbon sources include glucose, dextrin, soluble starch, and sucrose. Examples of nitrogen sources include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like. Alternatively, examples of the organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride.
In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8. As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journal of Experiments in Mo
lecular Genetics), 431-433, Cold Spring Ha
rbor Laboratory, New York 1972]. If necessary, an agent such as 3β-indolylacrylic acid can be added to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, culturing is usually performed at about 15 to 43 ° C for about 3 to 24 hours,
If necessary, ventilation and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, culturing is usually performed at about 30 to 40 ° C. for about 6 hours.
It is carried out for up to 24 hours, and if necessary, ventilation and stirring can be added. When culturing a transformant whose host is yeast,
As the medium, for example, Burkholde
r) Minimal medium [Bostian, KL et al., "Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad.
Sci. USA), 77, 4505 (1980)] and 0.5
% Casamino acid SD medium [Bitter, GA et al.
"Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 81, 533
0 (1984)]. PH of the medium is about 5-8
It is preferred to adjust to. Culture is usually about 20 ° C to 35 ° C
For about 24 to 72 hours, and if necessary, aeration and stirring are added. When culturing a transformant whose host is an insect cell,
Grace's Insect Medium (Grace, TC
C., Nature, 195, 788 (1962)) to which an inactivated additive such as 10% bovine serum is appropriately added. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C. for about 3 to 5 days,
Vent or agitate as needed. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Seience, Vol. 122, 501 (1952)], DME
M medium [Virology, 8, 396 (1
959)], RPMI 1640 medium [Journal of the American Medical Association (Th
e Jounal of the American Medical Association) 19
9, 519 (1967)], 199 medium [Proceeding of the Society for the Medical Medicine (Proceeding of the Society for th
e Biological Medicine), 73, 1 (1950)]. Preferably, the pH is between about 6 and 8.
Culture is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours,
Vent or agitate as needed. Especially CHO (dhf
r ^-) in the case of using the cells and dhfr gene as a selection marker, it is preferable to use DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine. The peptide of the present invention and the like can be separated and purified from the culture by, for example, the following method.

When extracting the peptide or the like of the present invention from the cultured cells or cells, after the culture, the cells or cells are collected by a known method and suspended in an appropriate buffer.
After disrupting cells or cells by ultrasonication, lysozyme and / or freeze-thawing, a method of obtaining a crude peptide extract by centrifugation or filtration may be used as appropriate. In the buffer solution, a protein denaturant such as urea or guanidine hydrochloride, or Triton X-100 (registered trademark; hereinafter, TM
May be abbreviated. ) May be included. When the peptide is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. Purification of the peptide of the present invention contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separations,
Purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and S filtration.
DS-polyacrylamide gel electrophoresis and other methods that mainly use differences in molecular weight; methods that use differences in charge such as ion-exchange chromatography; methods that use specific affinity such as affinity chromatography; A method utilizing a difference in hydrophobicity such as liquid chromatography, a method utilizing a difference in isoelectric points such as isoelectric focusing or chromatofocusing are used. When the peptide or the like of the present invention thus obtained is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when it is obtained as a salt, a method known per se Alternatively, it can be converted to a free form or another salt by a method analogous thereto.
Incidentally, the peptide of the present invention produced by the transformant,
By applying an appropriate protein modifying enzyme before or after purification, the protein can be arbitrarily modified or the peptide can be partially removed. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the peptide of the present invention thus produced can be measured by an enzyme immunoassay using a specific antibody or the like. The DNA encoding the peptide of the present invention or the peptide of the present invention may be a part of the ligand of the galanin receptor protein, or synthesis of the full length, search for the physiological action of the peptide of the present invention, synthetic oligonucleotide probe or PC
Preparation of R primers, acquisition of DNAs encoding ligands and precursor proteins of G protein-coupled receptor proteins, development of receptor binding assay systems using recombinant receptor protein expression systems and screening of drug candidate compounds, antibodies And availability of antiserum, DNA, R
Development of diagnostic agents using NA, antibodies or antisera, memory function improvers (cognitive enhancers), appetite regulators, antidiabetic drugs,
Pituitary function improver, uterine function regulator, kidney function regulator,
Prostate function regulator, testis function regulator or skeletal muscle function regulator (preferably, memory function improver (cognitive agent), appetite regulator, uterine function regulator, renal function regulator, prostate function regulator, testis function Modulator or skeletal muscle function regulator), gene therapy and the like.

In particular, screening for a G protein-coupled receptor agonist or antagonist specific to a warm-blooded animal such as a human by a receptor binding assay system using a recombinant G protein-coupled receptor protein expression system described below. The agonists or antagonists can be used as agents for preventing or treating various diseases. Further, with respect to the above, the peptide of the present invention or DNA encoding the same may be contained in the hippocampus, the hypothalamus,
Galanin receptor (GALR) protein expressed in uterus, kidney, prostate, skeletal muscle, pancreas, testis, spleen, heart, pituitary, etc. is recognized as a ligand, and is useful as a safe and low-toxic drug For example, a memory function improver (a cognitive enhancer), an appetite regulator, an antidiabetic drug, a pituitary function improver, an appetite regulator, a uterine function regulator, a renal function regulator, a prostate function regulator or skeletal muscle Function modulators (preferably, memory function improvers (cognitive enhancers),
Appetite regulator, uterine function regulator, kidney function regulator, prostate function regulator or skeletal muscle function regulator). When the peptide of the present invention or the DNA encoding the same is used as the above-mentioned medicament, it can be carried out according to conventional means. For example, a sugar-coated or enteric-coated tablet as required, a capsule, a elixir, orally as a microcapsule, or a sterile solution with water or another pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound or a salt thereof can be a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative,
It can be manufactured by mixing with a stabilizer, a binder and the like in a unit dosage form required for a generally accepted pharmaceutical practice. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. When the DNA of the present invention is used, the DNA can be used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. Examples of additives that can be incorporated into tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Swelling agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as fats and oils can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80 (TM), HCO-5)
0) and the like. The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.

Further, a buffer (for example, a phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, and are therefore suitable for humans and mammals (eg, mice, rats, guinea pigs, rabbits, sheep, pigs, cows, cats, dogs, monkeys,
Etc.). The dose of the peptide of the present invention or the DNA encoding the same may vary depending on the symptoms and the like, but when the peptide is administered orally,
In general, for an adult (assuming a body weight of 60 kg), the dose is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day. When the peptide is administered parenterally (for example, by intravenous injection), the single dose depends on the administration subject,
Although it varies depending on the target organ, symptoms, administration method, etc., for example, in the form of an injection, for an adult (with a body weight of 60 kg), it is about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day, Preferably, it is about 0.1 to 10 mg. In the case of other animals, the above dose per 60 kg can be administered in terms of the weight of the animal. In the present invention, as the galanin receptor, humans and warm-blooded animals (for example,
Any tissue (eg, pituitary gland) of a warm-blooded mammal (eg, rabbit, sheep, goat, rat, mouse, guinea pig, cow, horse, pig), bird (eg, chicken, pigeon, duck, goose, quail) , Pancreas, brain, kidney, liver,
Gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle,
A G protein-coupled receptor protein derived from lung, gastrointestinal tract, blood vessel, heart, etc.) or cells;
1 is SEQ ID NO: 1, GALR2 is SEQ ID NO: 2, and GALR3 is any as long as it contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3. Is also good. That is, as the receptor protein, SEQ ID NO:
In addition to a protein containing the amino acid sequence represented by 1, 2, or 3, etc., it also contains an amino acid sequence having about 90 to 99.9% homology with the amino acid sequence represented by SEQ ID NO: 1, 2, or 3. And proteins having substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 1, 2 or 3.

The activities exhibited by these proteins include, for example, ligand binding activity and signal transduction activity. Substantially the same indicates that their activities are the same in nature. Therefore, quantitative factors such as strength of ligand binding activity and signal transduction activity and molecular weight of receptor protein may be different. Further, the receptor protein may be one in which the N-terminal Met is protected by a protecting group (eg, a C _1-6 alkanoyl group such as a formyl group or an acetyl group), Those in which the side chain of the amino acid in the molecule is protected by an appropriate protecting group (for example, a C _1-6 alkanoyl group such as a formyl group or an acetyl group), or a so-called glycoprotein having a sugar chain bonded thereto. It also includes complex proteins and the like. As the salt of the receptor protein,
The same as the above-mentioned salts of the peptide can be mentioned. The receptor protein or a salt thereof or a partial peptide thereof can be produced from human or warm-blooded animal tissues or cells by a protein purification method known per se, or a transformant containing a DNA encoding the aforementioned peptide. Can also be produced by the same method as the method of culturing. Further, it can be produced according to the above-mentioned peptide synthesis method. As the partial peptide of the receptor protein, for example, a site of the G protein-coupled receptor protein molecule which is exposed outside the cell membrane is used.
That is, in the hydrophobic plot analysis of the G protein-coupled receptor protein, the extracellular region (Hydrophilic)
Site).
Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. As the salt of the partial peptide of the receptor protein, those similar to the salts of the above-mentioned peptides are used.

The DNA encoding the galanin receptor protein contains a nucleotide sequence encoding a galanin receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence of SEQ ID NO: 1, 2 or 3. Anything that does is acceptable. They may be any of genomic DNA, genomic DNA library, tissue / cell derived cDNA, tissue / cell derived cDNA library, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, the RNA fraction can be directly amplified by RT-PCR known per se using an RNA fraction prepared from tissues or cells. SEQ ID NOs: 1, 2 and 3
Specific examples of the DNA encoding the galanin receptor having the amino acid sequence of SEQ ID NO:
DNAs having the base sequences represented by 4, 5, and 6 are used. GALR2 (galanin receptor
Type 2) is widely distributed in the hippocampus, hypothalamus, uterus, kidney, prostate, skeletal muscle, and the like. A neutralizing antibody against the peptide) can be used as a memory function improving agent, an appetite improving agent, or a uterine, kidney, prostate or skeletal muscle function improving agent. GALR1 (galanin receptor type 1) is widely distributed in the hypothalamus, hippocampus, pancreas and the like. Neutralizing antibodies against the peptide) can be used as antiobesity drugs, cognitive drugs, and insulin secreting drugs. GALR3
(Galanin receptor type 3) is testis, spleen,
Distributed in the heart, hypothalamus, pituitary, etc.,
The peptide of the present invention (or an antagonist to GALR3 and a neutralizing antibody to the peptide of the present invention), which is an agonist having GALR3 activating ability, can be used as a testis, spleen, or heart function improving agent. The present invention provides (1) contacting a test substance with a cell membrane fraction expressing a galanin receptor, which is obtained by culturing a transformant (cell) containing a DNA encoding the galanin receptor. And measuring the amount of binding of, for example, ³⁵ S-labeled guanosine-5′-O-3-thiotriphosphate to the cell membrane fraction in the case where the test substance is not brought into contact with the test substance, and comparing the measured amounts. A method for screening for a receptor activator (agonist) or a salt thereof, and (2) expressing the galanin receptor obtained by culturing a transformant (cell) containing the above-described DNA encoding the galanin receptor; When the cell membrane fraction is contacted with galanin or the peptide of the present invention, and when it is contacted with galanin or the peptide of the present invention in the presence of the test substance. That, for example,
A galanin receptor activation inhibitor (antagonist) characterized by measuring and comparing the amount of binding of ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate to the cell membrane fraction.
Or a method for screening a salt thereof.

The screening method of the present invention will be specifically described below. The above-mentioned galanin receptor protein may be any one containing a galanin receptor protein of GALR1, GALR2 or GALR3 or a partial peptide thereof and having the receptor function. Cell membrane fractions prepared from cultured cells expressing the galanin receptor protein in large amounts using (cells) (the preparation method thereof will be described later) are preferred. The cell containing the galanin receptor protein refers to a host cell that expresses the galanin receptor protein. Examples of the host cell include the aforementioned yeast, insect cells, and animal cells. Is preferred. The membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se. As a method for disrupting cells,
Methods include crushing cells with a Potter-Elvehjem homogenizer, crushing with a Waring blender or polytron (manufactured by Kinematica), crushing with ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure with a French press, etc. . For the fractionation of cell membranes, fractionation by centrifugal force such as fractionation centrifugation or density gradient centrifugation is mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically, about 1 minute to 10 minutes), and the supernatant is further centrifuged at a high speed (15,000 rpm).
(rpm to 30,000 rpm) for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is mainly composed of a membrane protein and a phospholipid constituting a cell membrane, and contains a G protein originally expressed in the cell together with the expressed galanin receptor. The amount of galanin receptor in cells and membrane fractions containing the galanin receptor is:
It is preferably 1-100 pmol, more preferably 5-20 pmol per mg of membrane fraction protein. As the galanin receptor expression level increases, the activity of activating the receptor (ligand binding activity, specific activity) per membrane fraction increases, so that not only a highly sensitive screening system can be constructed but also the same lot. Can measure a large amount of samples. Specifically, as a screening method for a compound (agonist) that activates a galanin receptor, first, a membrane fraction of cells containing a galanin receptor is suspended in a buffer suitable for screening to prepare the receptor sample. Prepare. The buffer may have a pH of about 4 to about 10 (preferably, a pH of about 6 to about 8).
Or a tris-hydrochloric acid buffer containing about 1 to 5 mM of magnesium ion, and guanosine diphosphate (GDP) of about 0.1 to about 5 mM.
nM to 100 μM, preferably about 0.1 to 1 μM may be added. In addition, a protease inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide Research Institute), or pepstatin may be added for the purpose of suppressing the degradation of the receptor or the test substance by the protease. About 0.01 ~
A fixed amount (5000 cp) is added to 10 ml of the receptor solution.
m-50000 cpm) of ³⁵ S-labeled guanosine-5'-O-3-
Add thiotriphosphate and the test substance. On the other hand, a reaction system (subject group) to which only the ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate was added without adding the test compound was also prepared. The reaction is carried out at about 0 to 50 ° C, preferably about 4 ° C to 37 ° C, for about 20 minutes to 24 hours, preferably for about 30 minutes to 3 hours. After the reaction, the solution is filtered through a glass fiber filter paper and the like, washed with an appropriate amount of the same buffer, and then the radioactivity of ³⁵ S-labeled guanosine-5′-O-3-thiotriphosphate remaining on the glass fiber filter paper is measured using a liquid scintillation counter. measure. If the compound has a higher radioactivity increase when the test compound is added compared to the radioactivity when the test compound is not added, it is converted to the galanin.
It can be selected as a candidate compound capable of activating the receptor. To screen for a compound (antagonist) that inhibits the activation of the galanin receptor, a cell membrane fraction is prepared in the same manner as in the above-described agonist screening, and a certain amount (5,000 c
pm to 50,000 cpm) of ³⁵ S-labeled guanosine-5'-O-
3-Thiotriphosphate, 10 ^-4 to 10 ^-6 M galanin or a peptide according to the present invention, and a test substance are added. In addition, a reaction system (subject group) is also prepared in which ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate and galanin or the peptide of the present invention are added and the test compound is not added. Perform a reaction in the same manner as described above, and if the compound has a large decrease in radioactivity when the test compound is added compared to the radioactivity when the test compound is not added, it is used to activate the galanin receptor. It can be selected as a candidate compound capable of inhibiting.

Examples of the test substance include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. These compounds are novel compounds Or a known compound. Since the galanin receptor agonist has the same activity as the physiological activity of the peptide of the present invention on the galanin receptor, it is useful as a safe and low-toxic drug like the peptide of the present invention. Conversely, a galanin receptor antagonist can suppress the physiological activity of the peptide of the present invention on the galanin receptor protein, and is therefore useful as a safe and low-toxic drug for suppressing the receptor activity. As a salt of the substance obtained by using the above-mentioned screening method, for example, a pharmaceutically acceptable salt or the like is used. Examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt. Preferred examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine,
Salts with ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N'-dibenzylethylenediamine and the like can be mentioned. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Salts with acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid and the like can be mentioned. Preferred examples of salts with basic amino acids include:
For example, salts with arginine, lysine, ortin and the like can be mentioned, and preferable examples with acidic amino acids include, for example, salts with aspartic acid, glutamic acid and the like.
When the substance obtained by using the screening method of the present invention or a salt thereof is used as the above-mentioned medicine, it can be carried out in the same manner as when the above-mentioned peptide of the present invention is used as a medicine. Antibodies against the peptide of the present invention (eg, polyclonal antibodies, monoclonal antibodies)
Alternatively, the antiserum uses the peptide of the present invention as an antigen,
It can be produced according to a method for producing an antibody or antiserum known per se.

For example, a polyclonal antibody can be produced according to the method described below. [Preparation of polyclonal antibody] A polyclonal antibody against the peptide of the present invention can be produced according to a method known per se or a method analogous thereto. For example, a complex of an immunizing antigen (antigen such as a peptide) and a carrier protein is formed, and a warm-blooded animal (eg, a mammal warm-blooded animal (eg, rabbit, sheep, goat, rat, Immunize mice, guinea pigs, cows, horses, pigs), birds (eg, chickens, pigeons, ducks, geese, quails), etc., and collect antibody-containing substances against the peptide of the present invention from the immunized animals. Can be produced by separation and purification of Regarding a complex of an immunizing antigen and a carrier protein used to immunize a mammal, the type of carrier protein and the mixing ratio between the carrier and the hapten (the peptide of the present invention or a partial peptide thereof) are determined by crosslinking the carrier with the immunity. If antibodies can be efficiently produced against the hapten
Whatever may be crosslinked at any ratio, for example, carriers such as bovine serum albumin, bovine thyroglobulin, keyhole limpet hemocyanin, etc.
About 0.1 to 2 parts by weight of protein per hapten
A method of coupling at a ratio of 0, preferably about 1 to 5 is used. For coupling the hapten and the carrier, various condensing agents can be used. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithiopyridyl group, or the like is used. The condensation product is administered to the above-mentioned warm-blooded animal at a site capable of producing an antibody itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody is preferably collected from blood, ascites, or the like of a mammal immunized by the above method. The antibody titer of the peptide of the present invention in the antiserum can be measured in the same manner as the antibody titer of the hybridoma culture supernatant described later. Antibody separation and purification can be performed according to the same immunoglobulin separation and purification method as the monoclonal antibody separation and purification described below.

A monoclonal antibody can be produced according to the method described below. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The peptide of the present invention can be prepared from a warm-blooded animal (eg, a warm-blooded mammal (eg, rabbit, sheep, goat, rat, mouse, guinea pig, cow, horse) , Pigs) and birds (eg, chickens, pigeons, ducks, geese, quails), etc., by themselves or together with carriers and diluents at sites where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually 2-6
It is performed once a week, about 2 to 10 times in total. When preparing monoclonal antibody-producing cells, the above-mentioned warm-blooded animal immunized with the antigen, for example, an individual having an antibody titer was selected from a mouse or the like, and the spleen or lymph node was collected 2 to 5 days after the final immunization. By fusing the antibody-producing cells contained therein with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The measurement of the antibody titer in the antiserum is performed, for example, by reacting the peptide labeled with the labeling agent described below or a partial peptide thereof with the antiserum, and then measuring the activity of the labeling agent bound to the antibody. . The fusion operation is performed by known methods, for example, the method of Koehler and Milstein [Nature, 25
6, 495 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used. Examples of myeloma cells include NS-1, P3U1,
SP2 / 0, AP-1 and the like can be mentioned, but P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is 1: 1 to 2
0: 1, and PEG (preferably PEG1000
-PEG6000) is added at a concentration of about 10-80%, and at 20-40 ° C, preferably 30-37 ° C, 1-10
Cell incubation can be carried out efficiently by incubating for minutes. Various methods can be used for screening an antibody-producing hybridoma against the peptide of the present invention. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which the peptide antigen of the present invention is adsorbed directly or together with a carrier. Then, an anti-immunoglobulin antibody labeled with a radioactive substance, an enzyme, or the like (if the cell used for cell fusion is a mouse, an anti-mouse immunoglobulin antibody is used) or Protein A, is added to the solid phase of the present invention. A method for detecting a monoclonal antibody against a peptide, adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a peptide of the present invention labeled with a radioactive substance, an enzyme, or the like, and binding to the solid phase Method for detecting a monoclonal antibody against the peptide of the present invention And the like. Selection of the monoclonal antibody against the peptide of the present invention can be carried out according to a method known per se or a method analogous thereto. Usually, it is performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a selection and breeding medium, any medium can be used as long as hybridomas can grow.
For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal calf serum, GIT medium containing 1-10% fetal calf serum (Wako Pure Chemical Industries, Ltd.) or serum-free for hybridoma culture Medium (SFM-101,
Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The cultivation is usually performed under 5% carbon dioxide.
The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer for the peptide of the present invention in the antiserum. (B) Purification of Monoclonal Antibody Separation and purification of the monoclonal antibody against the peptide of the present invention can be carried out in the same manner as in the separation and purification of a general polyclonal antibody, by the method of immunoglobulin separation and purification [eg, salting-out method, alcohol precipitation method, isoelectric focusing method. Method, electrophoresis, ion exchanger (eg, D
EAE) adsorption / desorption method, ultracentrifugation method, gel filtration method, specific purification method in which an antibody alone is collected using an antigen-bound solid phase or an active adsorbent such as protein A or protein G and the bond is dissociated to obtain the antibody] It is performed according to.

The antibody against the peptide of the present invention produced according to the above-mentioned methods (a) and (b) can specifically recognize the peptide of the present invention. For quantification, particularly for quantification by sandwich immunoassay. That is, the present invention relates to, for example, (i) a labeled peptide of the present invention which is made to react competitively with an antibody reacting with the peptide of the present invention, a test solution and a labeled peptide of the present invention, and bound to the antibody. (Ii) reacting the test solution with an antibody insolubilized on a carrier and a labeled antibody simultaneously or successively, wherein the method comprises the steps of: And then measuring the activity of the labeling agent on the insolubilized carrier, wherein one of the antibodies recognizes the N-terminal of the peptide of the present invention. A method for quantifying a peptide of the present invention in a test solution, wherein the other antibody is an antibody that reacts with a site other than the N-terminal (for example, the C-terminal) of the peptide of the present invention. I do. The peptide of the present invention can be measured using a monoclonal antibody that recognizes the peptide of the present invention, and can also be detected by tissue staining or the like. For these purposes, the antibody molecule itself may be used, and F (ab ') ₂ , F
The ab 'or Fab fraction may be used. The measurement method using the antibody of the present invention is not particularly limited, and the amount of antigen (eg, the amount of ligand peptide) in the liquid to be measured
If the measurement method is to detect the amount of the antibody, antigen or antibody-antigen complex corresponding to the above by chemical or physical means and calculate this from a standard curve prepared using a standard solution containing a known amount of antigen, Any of the measurement methods may be used. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use the sandwich method described later. Examples of the labeling agent used in the measurement method using the labeling substance include a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like. As the radioisotope, for example, [
¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are preferred as the above-mentioned enzymes, those which are stable and have high specific activities,
For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, etc., as fluorescent substances, fluorescamine, fluorescein isothiocyanate, etc., and as luminescent substances, luminol, luminol derivatives, luciferin , Lucigenin and the like. further,
A biotin-avidin system can be used for binding the antibody or antigen to the labeling agent. For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, a test solution is reacted with an antibody against the insoluble peptide of the present invention (primary reaction), and further reacted with a labeled antibody against the peptide of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the peptide of the present invention in the test solution can be determined. The primary and secondary reactions can be performed in reverse order,
It may be performed simultaneously or at a different time. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may.

In the method for measuring the peptide of the present invention by the sandwich method of the present invention, the antibodies against the peptide of the present invention used in the primary reaction and the secondary reaction are preferably antibodies having different binding sites for the peptide of the present invention. Used. That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the peptide of the present invention, the antibody used in the primary reaction is preferably An antibody that recognizes, for example, the N-terminal portion other than the C-terminal portion is used. An antibody against the peptide of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry. In the competition method, after the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, the unreacted labeled antigen, (F) and the labeled antigen (B) combined with the antibody
(B / F separation), the amount of labeling of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method,
A soluble antibody is used as the antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody to the antibody, or a solid phased antibody is used as the first antibody. And an immobilization method using an immobilized antibody as the second antibody. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used. In applying these individual immunological assay methods to the assay method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the peptide of this invention or its partial peptide, adding the usual technical consideration of those skilled in the art to the usual conditions and operation methods in each method. For more information on these common technical measures,
Review articles, books, etc. can be referred to [for example, Hiroe Irie, edited by "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Continued Radio Immunoassay" (Kodansha, published in 1974), Eiji Ishikawa et al. "Enzyme immunoassay" (ed. Medical Shoin, published in 1978), Eiji Ishikawa et al., "Enzyme immunoassay" (second edition) (ed.), Eiji Ishikawa et. "Methods" (3rd edition) (Issue Shoin, published in 1987), "Methods in ENZYMOLOGY"
Vol. 70 (Immunochemical Techniques (Part A)), same book
Vol. 73 (Immunochemical Techniques (Part B)), same book
Vol. 74 (Immunochemical Techniques (Part C)), Ibid.
l. 84 (Immunochemical Techniques (Part D: Selected Im
munoassays)), Ibid.Vol. 92 (Immunochemical Techniqu
es (Part E: Monoclonal Antibodies and General Immuno
assay Methods)), Ibid.Vol. 121 (Immunochemical Tech)
niques (Part I: Hybridoma Technology and Monoclonal A
ntibodies)) (see above, published by Academic Press). As described above, the peptide of the present invention can be quantified with high sensitivity by using an antibody against the peptide of the present invention.

Further, by quantifying the concentration of the peptide of the present invention using the antibody of the present invention, it can be used as a diagnostic agent. That is, (1) when a change in the concentration of the protein or the like of the present invention is detected, for example, obesity,
It can be diagnosed as a disease such as dementia, diabetes, or pituitary tumor, or as having a high possibility of suffering in the future. Further, the antibody of the present invention can be used for detecting the protein of the present invention or the like present in a subject such as a body fluid or a tissue. In addition, preparation of an antibody column used for purifying the protein of the present invention, detection of the protein of the present invention in each fraction at the time of purification, analysis of the behavior of the protein of the present invention in test cells, and the like Can be used for In the present specification and drawings, when a base, an amino acid, or the like is represented by an abbreviation, IUPAC-IU
B This is based on the abbreviation by Commision on Biochemical Nomenclature or the abbreviation commonly used in the art, examples of which are described below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine Y: thymine or cytosine N: thymine, cytosine, adenine or guanine R: adenine or guanine M: cytosine or adenine W: thymine or adenine Adenine S: cytosine or guanine I: inosine H: adenine, thymine or cytosine D: guanine, adenine or thymine B: guanine, thymine or cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine Triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate EDTA: ethylenediaminetetraacetic acid S S: sodium dodecyl sulfate EIA: enzyme immunoassay Gly or G: glycine Ala or A: alanine Val or V: valine Leu or L: leucine Ile or I: isoleucine Ser or S: serine Thr or T: threonine Cys or C: cysteine Or M: methionine Glu or E: glutamate Asp or D: aspartic acid Lys or K: lysine Arg or R: arginine His or H: histidine Phe or F: phenylalanine Tyr or Y: tyrosine Trp or W: tryptophan Pro or P: Asn or N: asparagine Gln or Q: glutamine pGlu: pyroglutamic acid Me: methyl group Et: ethyl group B u: butyl group Ph: phenyl group TC: thiazolidine-4 (R) -carboxamide group Further, substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene-2,3
- dicarboximide Bzl: benzyl Cl ₂ -Bzl: di-chlorobenzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chloro benzyloxycarbonyl Boc: t-butyloxycarbonyl HOBt: 1 -Hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tert-butoxymethyl Trt: trityl PAM: phenylacetamidomethyl BHA: benz Hydrylamine Bom: benzyloxymethyl OcHex: cyclohexyl ester MeBzl: 4-methylbenzyl CHO: formyl NMP: N-methylpyrrolidone

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the entire amino acid sequence of rat-type GALR1 (galanin receptor type 1). [SEQ ID NO: 2] This shows the entire amino acid sequence of rat GALR2 (galanin receptor type 2). [SEQ ID NO: 3] This shows the entire amino acid sequence of rat GALR3 (galanin receptor type 3). [SEQ ID NO: 4] This shows the nucleotide sequence of rat GALR1 (galanin receptor type 1) cDNA. [SEQ ID NO: 5] This shows the nucleotide sequence of rat GALR2 (galanin receptor type 2) cDNA. [SEQ ID NO: 6] This shows the base sequence of rat-type GALR3 (galanin receptor type 3) cDNA. [SEQ ID NO: 7] This shows the entire amino acid sequence (29 residues) of porcine galanin. [SEQ ID NO: 8] Pig-type galanin precursor preprogalan
1 shows the amino acid sequence of in (1-123). [SEQ ID NO: 9] Porcine galanin precursor preprogalan
1 shows the amino acid sequence of in (24-61). [SEQ ID NO: 10] Pig-type galanin precursor preprogal
Fig. 3 shows the amino acid sequence of anin (37-61). [SEQ ID NO: 11] This shows the partial amino acid sequence (34 residues from N-terminal) of pig-type peptide of the present invention. [SEQ ID NO: 12] This shows the partial amino acid sequence (32 residues from N-terminal) of pig-type peptide of the present invention. [SEQ ID NO: 13] Partial amino acid sequence (N) of chymotrypsin digested fragment (CHY-1) of porcine-type peptide of the present invention
9 residues from the end). [SEQ ID NO: 14] Partial amino acid sequence of chymotrypsin digested fragment (CHY-4) of porcine peptide of the present invention (6)
Residue). [SEQ ID NO: 15] Partial amino acid sequence of chymotrypsin digested fragment (CHY-3) of pig-type peptide of the present invention (2)
7 residues). [SEQ ID NO: 16] Partial amino acid sequence (1) of chymotrypsin digested fragment (CHY-2) of pig-type peptide of the present invention
1 residue). [SEQ ID NO: 17] This shows the partial amino acid sequence (44 residues) of the pig-type peptide of the present invention. [SEQ ID NO: 18] Synthetic D used for screening of nucleotide sequence of cDNA encoding rat GALR2
NA (primer 1) is shown. [SEQ ID NO: 19] Synthetic D used for screening of the nucleotide sequence of cDNA encoding rat GALR2
NA (primer 2) is shown. [SEQ ID NO: 20] Degenerate PCR (Degenerate PCR)
d PCR) synthetic DNA (primer pGAL4-7
F) is shown. [SEQ ID NO: 21] Degenerate PCR (Degenerate PCR)
dPCR) synthetic DNA (primer pGAL9-3
F) is shown. [SEQ ID NO: 22] Degenerate PCR (Degenerate PCR)
d PCR) synthetic DNA (primer pGAL34-1
R). [SEQ ID NO: 23] This shows the base sequence of the nested PCR product in pCR100-6. [SEQ ID NO: 24] This shows the base sequence of the nested PCR product in pCR100-7. [SEQ ID NO: 25] This shows the synthetic DNA (primer pGAL9-3F) used for preparing the hybridization probe. [SEQ ID NO: 26] This shows the synthetic DNA (primer pGAL34-8R) used for preparing the hybridization probe. [SEQ ID NO: 27] pGR2PL6 obtained in Example 5
1 shows the nucleotide sequence of the cDNA in FIG. [SEQ ID NO: 28] pGR2PL obtained in Example 5
3 shows the nucleotide sequence of cDNA in 3. [SEQ ID NO: 29] This shows the sequence of the precursor of the peptide of the present invention deduced from the nucleotide sequence of cDNA in pGR2PL6. [SEQ ID NO: 30] This shows the sequence of the precursor of the peptide of the present invention deduced from the nucleotide sequence of cDNA in pGR2PL3. [SEQ ID NO: 31] pGR2PL6 and pGR2PL
3 shows the sequence of the mature protein (porcine type) of the peptide of the present invention deduced from the nucleotide sequence of the cDNA in No. 3. [SEQ ID NO: 32] This shows the cDNA sequence (porcine type) encoding the mature protein of the peptide of the present invention. [SEQ ID NO: 33] This shows the sequence of the mature protein (rat type) of the peptide of the present invention. [SEQ ID NO: 34] This shows the sequence of the mature protein (human type) of the peptide of the present invention. [SEQ ID NO: 35] Partial amino acid sequence of a mature protein (common to rat type and human type) of peptide of the present invention (9 from N-terminal)
Residue). [SEQ ID NO: 36] Partial amino acid sequence of mature protein of the peptide of the present invention (common to rat type and human type)
1 residue). [SEQ ID NO: 37] This shows the amino acid sequence of the precursor protein of the mature protein (rat type) of the peptide of the present invention. [SEQ ID NO: 38] This shows the amino acid sequence of the precursor protein of the mature protein (human type) of the peptide of the present invention. [SEQ ID NO: 39] This shows the cDNA sequence encoding the mature protein (rat type) of the peptide of the present invention. [SEQ ID NO: 40] This shows the cDNA sequence encoding the mature protein (human type) of the peptide of the present invention. [SEQ ID NO: 41] This shows the cDNA sequence encoding the precursor protein of the mature protein (rat type) of the peptide of the present invention. [SEQ ID NO: 42] This shows the cDNA sequence encoding the precursor protein of the mature protein (human type) of the peptide of the present invention. [SEQ ID NO: 43] This shows the partial amino acid sequence (30 residues from N-terminus) of mature protein (porcine type) of peptide of the present invention. [SEQ ID NO: 44] This shows the amino acid sequence of the peptide used as the immunogen in Example 9. [SEQ ID NO: 45] Plasmid used in Example 18
Fig. 4 shows the DNA sequence of the EcoRI / BglII digested fragment of pGR2PL6. [SEQ ID NO: 46] Primer used in Example 18
1 shows the DNA sequence of pGAL1-1F. [SEQ ID NO: 47] Primer used in Example 18
Fig. 3 shows the DNA sequence of pGAL88-1R. [SEQ ID NO: 48] Primer used in Example 19
1 shows the DNA sequence of F / R120. [SEQ ID NO: 49] Primer used in Example 19
1 shows the DNA sequence of R / R120. [SEQ ID NO: 50] This shows the cDNA sequence obtained as a result of PCR in Example 19. [SEQ ID NO: 51] Primer used in Example 19
1 shows the DNA sequence of 1F / H120. [SEQ ID NO: 52] Primer used in Example 19
1 shows the DNA sequence of 1R / H120. [SEQ ID NO: 53] Primer used in Example 19
1 shows the DNA sequence of 1F / H470. [SEQ ID NO: 54] Primer used in Example 19
1 shows the DNA sequence of 1R / H470. [SEQ ID NO: 55] This shows the DNA sequence of primer 1 used in Example 20. [SEQ ID NO: 56] This shows the cDNA sequence of Primer 2 used in Example 20. [SEQ ID NO: 57] This shows the DNA sequence of primer 3 used in Example 20. [SEQ ID NO: 58] This shows the DNA sequence of Primer 4 used in Example 20. [SEQ ID NO: 59] Synthetic DNA used in Example 21
Shows the sequence. [SEQ ID NO: 60] Synthetic DNA used in Example 21
Shows the sequence. [SEQ ID NO: 61] This shows the amino acid sequence of rat galanin (rat galanin is the one in which the C-terminal of SEQ ID NO: 61 is amidated).

The transformant Esc obtained in Example 5 described later
herichia coli TOP10 / pGR2PL6 has been deposited with the Fermentation Research Institute (IFO) on August 21, 1998 as deposit number IFO 16201.
Also, the deposit number FERM BP-648 from September 4, 1998 at the Institute of Biotechnology and Industrial Technology (NIBH, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan)
Deposited as 6. The transformant Escherichia coli TOP10 / pGR2HL14 obtained in Example 19 described below was deposited with the Fermentation Research Institute (IFO) on February 5, 1999 under the accession number IFO16256, Deposit number from Feb. 22, 1999 at NIBH (NIBH, 1-3 1-3 Higashi, Tsukuba, Ibaraki, Japan)
Deposited as FERM BP-6657. Example 1 described later
8 Escherichia coli TOP10 / pGR
2RL4 has been deposited with the Fermentation Research Institute (IFO) as a deposit number IFO16257 since February 5, 1999. Also, the Institute of Biotechnology, Institute of Industrial Science and Technology, Ministry of International Trade and Industry of Japan (NIBH) Deposit No. FERM BP-6658 since February 22, 1999. Escherichia coli transformant obtained in Example 21 described later
MM294 (DE3) / pTFCGAL is the Institute of Fermentation (IFO)
On February 26, 1999 as deposit number IFO16260,
Research Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology (NIBH, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan)
Deposit No. FERM BP-6678 from March 10, 1999. Transformant used in Example 21 described later
Escherichia coli MM294 (DE3) / pTB96
0-11 was established in 1997 by the Fermentation Research Institute (IFO).
The deposit number is IFO16100 from March 25, and also the Institute of Biotechnology and Industrial Technology (NIBH,
June 1-3, 1998 at 1-3-1 Higashi, Tsukuba, Ibaraki, Japan
Deposited as deposit number FERM BP-6388 from the 5th. The transformant Escheri used in Example 21 described later
chia coli MM294 (DE3) / pTCIId23-
MPIF1 was established by the Fermentation Research Institute (IFO) in 1998.
From October 27, as the deposit number IFO16212, the Ministry of International Trade and Industry of Japan
H, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan) in 1998
It has been deposited as a deposit number FERM BP-6582 since November 23. GR2-1N used in Example 13 described below is
The fermentation research institute (IFO) was deposited on March 11, 1999 under the deposit number IFO 50515. No. 3) has been deposited as a deposit number FERM BP-6682 on March 17, 1999.

[0035]

The present invention will be described in more detail with reference to the following Reference Examples and Examples, which do not limit the scope of the present invention.

Example 1 Galanin receptor (GALR)
1. Detection of GALR2) activating action (1-1) Rat-type galanin receptor (GALR1, GAL
R2) Construction of expression cells In order to obtain rat GALR2 gene, rat hypothalamus cD
2 μl of NA (CLONTECH), 10 μM of primer 1
(5'-GTCGACATGAATGGCTCCGGCAGCCAG-3 ', SEQ ID NO: 1
8) and primer 2 (5'-ACTAGTTTAACAAGCCGGATCCA
GGGTTCTAC-3 ', SEQ ID NO: 19) 1 μl each, 5 μl 10-fold concentrated buffer (attached to Klen Taq Polymerase manufactured by CLONTECH), 1 μl 10 mM deoxynucleotide mixture (Invitrogen), Klen Taq DNA polymerase (C
1 μl of LONTECH) and 39 μl of distilled water for injection (Otsuka Pharmaceutical)
Were mixed to prepare a PCR reaction solution. The PCR reaction is
Using the Gene Amp PCR System 9700 (PERKIN ELMER), one cycle of (95 ° C, 5 minutes), (95 ° C, 30 seconds; 7
3 cycles of 6 ° C, 15 seconds; 72 ° C, 2 minutes) (95 ° C, 30 minutes)
Second; 72 ° C, 15 seconds; 72 ° C, 2 minutes) for 3 cycles, (95
C, 30 seconds; 68 ° C, 15 seconds; 72 ° C, 2 minutes) 3 cycles,
(95 ° C, 30 seconds; 64 ° C, 15 seconds; 72 ° C, 2 minutes) 3 cycles, (95 ° C, 30 seconds; 60 ° C, 15 seconds; 72 ° C, 2 minutes) 3 cycles, (95 ° C, 30 seconds; 56 ° C, 15 seconds; 72 ° C, 2 minutes)
Was set as 20 cycles to carry out the reaction. 10 μl of the solution after the PCR reaction was mixed with a 1% low melting point agarose gel (Sea Plas
(que GTG: FTN), and the PCR reaction product was confirmed by ethidium bromide staining. The PCR
A DNA band around 1.2 kbp obtained as a reaction product was recovered from the agarose gel by a known method. That is, the agarose gel fragment was transferred to a 0.5 ml sampling tube, heated to 70 ° C., melted, equilibrated to 40 ° C., and 0.5 μl of beta agarase (Nippon Gene) was added to decompose agarose, followed by reaction for 60 minutes. Was. A target DNA fragment was recovered from the reaction solution by a known ethanol precipitation method, and a ligation reaction was performed with a PCR-SCRIPT (STRATAGENE) plasmid vector. The reaction solution is
In addition to etent High (JM109: TOYOBO), transformation was performed, and the cells were cultured overnight on an LB agar medium (Wako Pure Chemical Industries) containing 100 μg / ml ampicillin. Colonies on the medium were checked for the insertion of the target DNA fragment by colony-PCR.
A colony having the inserted DNA fragment is cultured overnight in an LB medium (Wako Pure Chemical Industries) containing 100 μg / ml ampicillin, and a plasmid having the inserted DNA fragment is recovered from the culture using a Plasmid Mini Kit (QIAGEN) did. The reaction for nucleotide sequence analysis was performed using dye primer cycle sequencin.
It was performed using a g ready reaction (ABI), and nucleotide sequence analysis using a fluorescent automatic sequencer confirmed that the inserted DNA fragment in the plasmid was a DNA encoding GALR2 consisting of 1119 bp. An expression vector pAKKO-1.11 for animal cells was prepared by the method described in Example 4 of JP-A-7-304797. A DNA fragment encoding GALR2 was recovered from the plasmid by a known method, ligated to the vector pAKKO-1.11, and introduced into Escherichia coli DH5α to obtain a transformant. This transformant was cultured to prepare a plasmid containing DNA encoding GALR2. The plasmid was transduced into CHO cells using the CellPhect Transfection kit (Pharmacia) in the following procedure to obtain the desired GALR2-expressing cells. First, Buffer A (CellPhect Transfecti) was added to 9.6 mg of plasmid DNA dissolved in 240 µl of distilled water.
Add 240 μl, stir and let stand for 10 minutes, then Buffer B (attached to CellPhect Transfection Kit)
480 μl was added and stirred vigorously to form liposomes containing the DNA. 4 x 10 ⁵ CHO / dhfr ^- cells (ATCC
Was obtained and seeded in a 60 mm petri dish, and cultured in Ham's F-12 medium (Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum (BIO WHITTAKER) at 37 ° C. in 5% carbon dioxide for 2 days. Thereafter, 480 μl of the liposome was dropped on the cells of a petri dish. After culturing the cells at 37 ° C. in 5% carbon dioxide for 6 hours, the cells were washed twice with a serum-free Ham's F-12 medium, and 3 ml of 15% glycerol was added to the cells in a Petri dish. Minutes. This was again washed twice with a serum-free Ham's F-12 medium, and then cultured in a Ham's F-12 medium containing 10% fetal bovine serum at 37 ° C. in 5% carbon dioxide for 15 hours. The cells were dispersed by trypsin treatment and collected from a Petri dish, and 1.25 × 10 ⁴ cells each
Seed in 6-well plate, dialyzed 10% fetal bovine serum (JRH B
IOSCIENCES) including Dulbecco's modified Eagle me
37 ° C in dium (DMEM) medium (Nissui Pharmaceutical Co., Ltd.)
Culture was started in 5% carbon dioxide gas. The transformed CHO cells into which the plasmid was introduced grow in the medium, but the non-transfected cells gradually died. Therefore, the medium was replaced on the first day and the second day of the culture to remove dead cells. Eight days after the start of the culture, 20 colonies of transformed CHO cells (20 CHO cell clones) were selected. Collect the selected cells (20 CHO cell clones),
A membrane fraction was prepared by the method described in Example (1-2) described below. Porcine ¹²⁵ I-galanin (New England N
uclear) by a known method (eg, EP-071183).
A cell line having a high expression level of GALR2 was selected and used in subsequent experiments. GAL
The cDNA encoding R1 was obtained in the same manner as the above-described method for obtaining the cDNA encoding GALR2. Using the primers 3 and 4 rats, a brain cDNA library (C
Rat GALR1 cDNA consisting of 1486 bp was obtained from PCR (LONTECH) by PCR, inserted into pUC119 (TAKARA SHUZO CORPORATION), and named plasmid pRGR2. The cDNA fragment obtained by double digestion of this plasmid with the restriction enzymes EcoRI and PstI was incorporated into the double-digested portion of the expression plasmid vector pcDNA I for animal cells (Invitrogen) with the restriction enzymes EcoRI and NsiI. pR
Named GRPC. This plasmid pRGRPC is
The cDNA fragment obtained by double digestion with Hind III and Xba I was used to convert the expression plasmid vector pRc / CMV (In
The vector was digested with Hind III and Xba I (in vitrogen) to obtain a rat GALR1 cDNA expression plasmid pRGR1. CellPhect Transfection Kit (Pha
rmacia), and cultured in Ham's F12 medium (Nissui Pharmaceutical Co., Ltd.) by the known calcium phosphate method.
The rat GALR1 cDNA expression plasmid pRGR1 was introduced into HO-K1 cells (obtained from ATCC), and finally 500 μg / ml G
Twenty-four -418 resistant clones were isolated using stainless steel cylinders. Some of the cells of the 24 clones isolated in this manner were seeded on a 6-well plate, cultured to saturation, and then cultured at 100 pM swine / ¹²⁵ I-galanin (New Eng.
land Nuclear) (eg EP-0711)
830A) and the expression level of rat galanin receptor in 24 clones was examined. As a result, it was considered that the No. 3 cell had the highest binding activity to porcine ¹²⁵ I-galanin and the highest GALR1 expression level.
Therefore, No. 3 cells were seeded at a rate of 1 cell in 2 wells of a 96-well microplate by the limiting dilution method and proliferated from 1 cell. Twelve cloned cells were isolated from the singulated cells, and a similar binding experiment was performed again using a part of the cells. As a result, the highest binding activity to ^{1 25} I- Butagaranin clonal cells Nanba3-10, GALR
Since the expression level of 1 was considered to be the highest, this clone was used as a GALR1-expressing cell.

(1-2) Galanin receptor (GALR)
1. Preparation of GALR2) -expressing cell membrane fraction The GALR2-expressing cells obtained in (1-1) above were subconfluent (80- (90% confluence). After culturing the cells, 2.7 mM ethylenediamine-N, N, N ', N'-
Phosphate buffer containing tetraacetic acid (EDTA) (2.7 mM EDTA / Pho
sphate-buffer saline (138 mM NaCl, 2.7 mM KCl, 8 mM N
a ₂ HPO ₄ , 1 mM KH ₂ PO ₄ )] was added and suspended to release from the incubator, and the cells were recovered by centrifugation. The cells were treated with protease inhibitor mixture (final concentrations of 0.5 mM phenylmethylsulfonyl fluoride, 20 μg / ml leupeptin, 4 μg / ml, respectively).
Homogenized in a 10 mM sodium bicarbonate, 5 mM EDTA (pH 7.3) buffer containing E-64 (10 μg / ml pepstatin) using a Polytron homogenizer. The homogenate is centrifuged at 2500 rpm for 10 minutes using a high-speed centrifuge (CR26H, RR24A type rotor: Hitachi, Ltd.), and the obtained supernatant is subjected to an ultracentrifuge (SCP70H, RP42 type rotor: Hitachi, Ltd.). And centrifuged at 30,000 rpm for 1 hour to obtain a precipitate. This precipitate was again mixed with protease inhibitor mixture (0.5 mM phenylmethylsulfonyl fluoride, 20 μg / ml leupeptin, 4 μg / ml).
The suspension was suspended in 10 mM sodium bicarbonate and 5 mM EDTA (pH 7.3) buffer containing 10 ml / ml E-64, 10 μg / ml pepstatin, and used as a membrane fraction for detecting galanin receptor activation (-70 C).

(1-3) Detection of Galanin Receptor Activating Activity by [ ³⁵ S] GTPγS Binding Test The membrane fraction prepared in the above (1-2) was used at a concentration of 40 μg / ml.
(For GALR1 membrane fraction) or 1 μM guanosine-5'-diphosphate to 32 μg / ml (for GALR2 membrane fraction)
(GDP), 0.1% bovine serum albumin (BSA), 5 mM MgC
l ₂ , suspended in 50 mM Tris buffer (pH 7.4) containing 150 mM NaCl, add 0.2 ml each to a small polypropylene test tube (Falco
n 2053). 50 nM [ ³⁵ S] G in the dispensed membrane fraction
2 μl of TPγS (NewEngland Nuclear) and porcine galanin (100 μM, 10 μM, 1 μM) as an agonist
2 μl (at each concentration of M, 100 nM, 10 nM, 1 nM, 100 pM, or 10 pM) was added and reacted at 25 ° C. for 60 minutes. 1.5 ml of 0.05% 3-[(3-cholamidopropyl) dimethylmonio] propanesulfonic acid (CHAPS), 0.1% BS
A, 50 mM Tris buffer containing 5 mM MgCl ₂ , 1 mM EDTA
(pH 7.4) and GF / F glass fiber filter paper (Whatman)
And filtered. After the filter paper was washed with 1.5 ml of the same buffer and dried, the radioactivity was measured by a liquid scintillation counter. As a result, depending on the galanin concentration
An increase in the amount of [ ³⁵ S] GTPγS binding was observed (FIG. 1).
It was revealed that the galanin receptor agonist activity can be measured by this method. EC _{50 of} rat galanin
The value (concentration that gives half the maximum binding) is GALR
The value was about 3 nM for 1 and about 10 nM for GALR2.

Example 2 Screening of Compound Activating GALR2 (Galanin Receptor Type 2) (2-1) Preparation of Swine Hypothalamic Extract The swine hypothalamus was purchased from Tokyo Shibaura Organ Co., Ltd. for 3 hours The following procedure was performed to prepare an extract. First, 35 pig hypothalamus (about 500 g) were cut into small pieces using a kitchen knife, placed in a 3000 ml beaker containing 1250 ml of boiling distilled water, and boiled for 10 minutes. After boiling, the hypothalamus was water-bathed together with the beaker and then ice-bathed to lower the temperature to about 4 ° C. The hypothalamus was homogenized with distilled water used for boiling for 10 minutes using a Polytron homogenizer. 90 ml of acetic acid was added dropwise to the obtained homogenate so that the final concentration became 1 M, and the mixture was stirred for 1 hour. The homogenate was centrifuged at 10,000 rpm for 30 minutes using a high-speed centrifuge (CR26H, RR10A rotor: Hitachi, Ltd.) to obtain a supernatant (1). On the other hand, the precipitate obtained after centrifugation
2000 ml of M acetic acid was added and homogenized for 10 minutes using a Polytron homogenizer. The homogenate was stirred overnight (about 16 hours) using a stirring blade, and then homogenized using a Polytron homogenizer for 10 minutes to obtain a supernatant (2). The supernatant (1) and the supernatant (2) are mixed, twice the volume of acetone is added, and the mixture is stirred at 4 ° C. for 1 hour.
The mixture was centrifuged at 10,000 rpm for 15 minutes using Hitachi, Ltd.) to obtain a supernatant. The obtained supernatant was subjected to a rotary evaporator to remove acetone, and finally concentrated to 4000 ml. This concentrate was centrifuged at 35,000 rpm for 1 hour using an ultracentrifuge (SCP70H, Hitachi RPZ35T type rotor: Hitachi, Ltd.) to obtain a clear supernatant. 1000 ml of the obtained supernatant
Each was mixed with 500 ml of diethyl ether, mixed vigorously in a separating funnel, and an aqueous phase was obtained after two-phase separation. 1000 ml of the obtained aqueous phase using a rotary evaporator.
To obtain the final extract.

(2-2) Purification of porcine hypothalamus extract by octadodecyl reverse phase chromatography Silica gel ODS-AM 120-S50 having octadodecyl groups fixed
(YMC) was swollen with methanol, packed in a 5 cm diameter glass column to a volume of 130 ml, and equilibrated with 1 M acetic acid. The extract (500 g under the thalamus) prepared in (2-1) was applied to this column at a flow rate of 400 ml / h. Subsequently, about 500 ml of 1 M acetic acid was added to the column, followed by about 500 ml.
ml of 20% acetonitrile / 0.1% trifluoroacetic acid
The gel was washed at a flow rate of 400 ml / h. Finally, about 500 ml of 50% acetonitrile / 0.1% trifluoroacetic acid was passed through the column at a flow rate of 400 ml / h to elute the crude peptide component of interest. The obtained eluate was concentrated using an evaporator and then freeze-dried (12EL; VirTis
Lyophilized.

(2-3) TSKgel O of porcine hypothalamus extract
Purification by DS80TM reversed-phase high-performance liquid chromatography TSKgel ODS80TM reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 22.5 mm x 30 cm) at 40 ° C at a flow rate of 8 ml / min. Acetic acid / distilled water) was flowed in to equilibrate. The freeze-dried product obtained in the above (2-2) was dissolved in 40 ml of 1 M acetic acid, and 10 ml of each solution was subjected to four chromatography operations. That is, after 10 ml of lyophilized acetic acid solution was applied to the column, the flow rate was 8 ml / mi.
n, the solution A (0.1% trifluoroacetic acid / distilled water) volume 80% / solution B (0.1% trifluoroacetic acid / 100% acetonitrile) volume 20% and the solution A (0.1% trifluoroacetic acid / The volume was increased by a linear gradient to a volume of distilled water (40%) / solution B (0.1% trifluoroacetic acid / 100% acetonitrile) to 60%. The eluate was fractionated in 8 ml portions.
Nos. Were collected, dispensed into 1 ml portions, and concentrated and dried using a vacuum concentrator (Servant). To this dried product, add 0.03 ml of dimethyl sulfoxide and dissolve.
Samples for assay were used to measure 1 and GALR2 activation. (2-4) GALR2 by [ ³⁵ S] GTPγS binding test
Isolation and Purification of Compound Activating (Galanin Receptor Type 2) Using the GALR1 or GALR2 membrane fraction described in (1-3) above for the assay sample obtained in (2-3) above The galanin receptor activating action was measured by the [ ³⁵ S] GTPγS binding test. In the [ ³⁵ S] GTPγS binding test using the GALR1-expressing cell membrane fraction, fraction No. 36-
[ ³⁵ S] GTPγS binding promoting activity was observed in 39 and Nos. 42-43, while [ ³⁵ S] was determined using a GALR2-expressing cell membrane fraction.
In the GTPγS binding test, fractions No. 36-39, No. 4
2-35 and Nos. 46-49 showed [ ³⁵ S] GTPγS binding promoting activity [FIG. 2]. Furthermore, the assay sample was diluted 100-fold with dimethyl sulfoxide, and 3 ml of the diluted sample was analyzed using a porcine galanin radioimmunoassay kit (Peninsula).
Galanin immunoreactivity was detected at o.36-38 (FIG. 3). From the above results, GALR1 and GAL of fraction Nos. 36-39
The component having the R2 activating effect was determined to be porcine galanin. On the other hand, the components having a GALR2 activating effect of fractions Nos. 46-49 were expected to be compounds different from galanin.

(2-5) Measurement of molecular weight of compound activating GALR2 (galanin receptor type 2) By a known gel filtration high performance liquid chromatography method,
The molecular weight of the GALR2 activating component (fraction Nos. 46-49) obtained in the above (2-4) was measured. Fraction No.4
Dilute 0.02 ml of the sample mixture of 6-49 in 0.08 ml of 0.1% trifluoroacetic acid / distilled water, and dilute 0.05 ml of G2000SWXL.
(Tosoh Corporation) The column was attached, 0.1% trifluoroacetic acid / 10% acetonitrile was flowed at a flow rate of 0.5 ml / min, and the eluate was collected in 0.25 ml (every 0.5 minutes). The fractions collected are concentrated and dried (SpeedVac Plus SC210A; Savan
t company), and directly dissolved in the suspension of the membrane fraction.
2 μL of [ ³⁵ S] GTPγS (New England Nuclear) was added, and [ ³⁵ S] GT was prepared by the method described in (1-3) below.
The amount of PγS binding was measured. As a result, the component having a GALR2 activating action ([ ³⁵ S] GTPγS binding promoting activity) is contained in fraction No. 35 (retention time 17 to 17.5 minutes).
[Fig. 4]. Known peptides analyzed under the same conditions (Adrenomedulin, Gastric inhibitory peptide, P
ACAP38, Neuropeptide Y, β-endorphine, Galanin, SR
IF28 (Somatostatin 28), Bovine Serum Albumin, Tryps
Inhibitor, Lysozyme) (FIG. 5), it was estimated that the molecular weight of the component having the GALR2 activating effect of fraction Nos. 46-49 was about 5,000 to about 7,000. On the other hand, the molecular weight of known porcine galanin (Peptide Research Institute) is 3157.4 (retention time 18.858 minutes).
Therefore, GALR obtained as fraction Nos. 46-49
2 It was suggested that the compound having an activating effect is a substance different from known galanin.

Example 3 Purification of Compound Having GALR2 (Galanin Receptor Type 2) Activating Activity (3-1) Preparation of Pig Hypothalamic Extract The above-mentioned (2) ―
The method of 1) was simplified as follows. 50 pig hypothalamus frozen products (Tokyo Shibaura Organ Co., Ltd.) (about 1 kg)
Sliced into thin slices using a kitchen knife and boiled 2500m
Add to a 5000 ml beaker containing 1 liter of distilled water and boil for 10 minutes. The boiled hypothalamus was placed in a water bath and ice bath together with the beaker to lower the temperature to about 4 ° C., and the hypothalamus was homogenized with distilled water used for boiling for 10 minutes using a Polytron homogenizer. 150 ml of acetic acid and 8 ml of 6N hydrochloric acid were added dropwise to the obtained homogenate,
The final concentration of each was 1 M and 20 mM, and then the mixture was stirred overnight (about 16 hours) using a stirring blade. The homogenate was centrifuged at 8000 rpm for 30 minutes using a high-speed centrifuge (CR26H, Hitachi RR10A rotor: Hitachi, Ltd.), and the obtained supernatant was filtered with gauze to remove lipid fragments. By repeating the above operation four times, an extract was prepared from the hypothalamus of about 4 kg.

(3-2) Concentration and crude fractionation of porcine hypothalamus extract (3-2-1) Purification by octadodecyl reverse phase chromatography Silica gel with octadodecyl group fixed (YMC, OMC)
DS-AM 120-S50) was swollen with methanol, packed in a 5 cm diameter glass column so that the volume became 400 ml, and 1 M
Equilibrated with acetic acid. After half the amount of the extract prepared in (3-1) (for 2 kg of the hypothalamus) was applied to the column at a flow rate of 400 ml / h, at a flow rate of 400 ml / h, about 1000 ml of 1 M acetic acid was added, and then about 1200 ml. The gel was washed by flowing 20% acetonitrile / 0.1% trifluoroacetic acid. Finally, a flow rate of 400 ml / h
Then, about 2000 ml of 60% acetonitrile / 0.1% trifluoroacetic acid was passed through the column to elute the crude peptide fraction of interest. The obtained eluate was concentrated using an evaporator, and then lyophilized with a freeze dryer (12EL; VirTis). The above operation was performed twice, and about 4 kg (200
Lyophilized powder of the hypothalamus extract was prepared. (3-2-2) Purification by SP-Sephadex ion exchange chromatography S swelled in 10 mM hydrochloric acid on a 5 cm diameter glass column
P-Sephadex C25 (Pharmacia Biotech) with a capacity of 12
Fill to 0 ml, wash with 100 mM hydrochloric acid, then add 1 M
Equilibrated with acetic acid. The freeze-dried powder of the hypothalamus extract obtained in (3-2-1) was dissolved in about 800 ml of 1 M acetic acid, and applied to an equilibrated SP-Sephadex C25 column at a flow rate of 400 ml / ml.
h attached. About 600 ml of 1 M acetic acid, about 600 ml of 1 M pyridine, and about 600 ml of 1 M pyridine / acetic acid (pH 5.0)
The solution was sequentially passed through the column at 400 ml / h, and the eluate was collected in 40 ml aliquots, dispensed in 0.2 ml aliquots, and concentrated and dried with a vacuum concentrator (Servant). To this dried product, 0.04 ml of dimethyl sulfoxide was added and dissolved, and the above (1-
The GALR2 activating effect was measured by the test method 3). As a result, the component having the desired GALR2 activating action is 1
It was found that it was eluted by M pyridine · acetic acid (pH 5.0). From these results, it was considered that the component (compound) having GALR2 activating action was a strongly basic substance. (3-2-3) Purification by Sephadex G50 gel filtration chromatography 1M pyridine · acetic acid (pH
5.0) Use evaporator to collect 100 ml of the eluate sample.
Sephadex G50 concentrated to 1% and equilibrated with 1 M acetic acid
(Pharmacia Biotech) column (diameter 6 cm, capacity 3000 m
l) at a flow rate of 400 ml / h and then 1 M at a flow rate of 400 ml / h.
The acetic acid is applied to the column, and 33 ml of the eluate is collected in fraction N
Each sample was dispensed in 0.25 ml portions and concentrated and dried with a vacuum concentrator (Savant). In this dried product,
0.03 ml of dimethyl sulfoxide was added and dissolved, and the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, it was found that the target component having the GALR2 activating action was mainly eluted in the fractionated fraction No. 66-80. Weak activity was also detected in fractions No. 55-65 and No. 45-54. Fractions No. 66-80, 55-65 and 45-54 were mixed and freeze-dried. (3-3) Purification of compound having GALR2 activating action using HPLC (3-3-1) Purification by TSKgel ODS80TM reversed-phase high-performance liquid chromatography TSKgel ODS80TM reverse-phase high-performance liquid chromatography column (Tosoh, 22.5 mm × 30 cm) at 4O 0 C at a flow rate of 4 ml
Flow solution A (0.1% trifluoroacetic acid / distilled water) at / min,
Equilibrated. Sephadex G obtained in the above (3-2-3)
Each lyophilized product of the 50-fraction was dissolved in 1 M acetic acid and applied to the column.
From 0% solution A (0.1% trifluoroacetic acid / distilled water) volume 67% / solution B (0.1% trifluoroacetic acid / 60% acetonitrile) volume 33% to solution B (0.1% trifluoroacetic acid)
/ 60% acetonitrile) The eluate was recovered with a linear gradient up to 100% volume. The eluate was fractionated with a fraction No. for each 8 ml. The fraction N
The freeze-dried product of o.66-80 was chromatographed twice, and fraction Nos. 55-65 and 45-54 were separated by one chromatography each. Using 4 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, three types of activity peaks were mainly observed in all the chromatographys. The elution position of the component having an activating effect found in fraction Nos. 35-38 almost coincided with the elution position of galanin described in Example 2. In addition, fraction No. 47-
The activating component found in 50 is almost at the elution position of the component having GALR2 activating action described in Example 2 (which does not activate GALR1 and is not detected by the aforementioned porcine galanin radioimmunoassay kit). Matched. Therefore, it was decided to purify components having GALR2 activating action using fraction Nos. 47-50, and these fractions were mixed and freeze-dried. (3-3-2) Purification by TSKgel CM-2SW ion-exchange high-performance liquid chromatography A column for TSKgel CM-2SW ion-exchange high-performance liquid chromatography (Tosoh, 0.46 cm x 25 cm) was used at 20 ° C and a flow rate of 1 ml. Solution A (10 mM ammonium formate / 40%
(Acetonitrile) at a flow rate of 1 ml / min to equilibrate.
The lyophilized product of the preparative fraction of reversed-phase high-performance liquid chromatography obtained in (3-3-1) was dissolved in solution A, applied to the column, and subjected to A at a flow rate of 1 ml / min for 60 minutes.
The eluate was collected from a solution (10 mM ammonium formate / 40% acetonitrile) with a linear gradient from 100% volume to 100% solution B (500 mM ammonium formate / 40% acetonitrile). The eluate was fractionated with a 0.5 ml fraction number. Using 1 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, a main activity peak was detected in fractions No. 89-92. These fractions were combined and used for subsequent purification.

(3-3-3) Purification by Diphenyl Reversed-Phase High-Performance Liquid Chromatography A column for diphenyl reversed-phase high-performance liquid chromatography (Vydak 219TP54, 0.46 cm × 25 cm) was added at 40 ° C.
Solution A at a flow rate of 1 ml / min (0.1% trifluoroacetic acid / distilled water)
And allowed to equilibrate. After directly applying the preparative fraction obtained by the ion exchange high performance liquid chromatography obtained in the above (3-3-2) to the column, the volume of solution A (0.1% trifluoroacetic acid / distilled water) in 1 minute at a flow rate of 1 ml / min. From 100%, the volume of solution B (0.1% trifluoroacetic acid / 60% acetonitrile) was rapidly increased to 50%, and this was followed by a flow rate of 1%.
The eluate was collected by increasing the concentration of solution B to 100% in a linear gradient over 60 minutes at ml / min. Eluate 1
Fraction No. was added to each ml and fractionated. Using 1 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, the main activity peak was detected in fraction Nos. 24-26. These fractions were combined and used for subsequent purification. (3-3-4) Purification by Super Phenyl Reversed-Phase High-Performance Liquid Chromatography A TSKgel Super Phenyl Reversed-Phase High-Performance Liquid Chromatography column (Tosoh, 0.46 cm x 10 cm) was used at 40 ° C at a flow rate of 1 ml / min Solution A (0.1% trifluoroacetic acid / distilled water) was flowed to equilibrate. The diphenyl reversed-phase high-performance liquid chromatography fraction obtained in (3-3-3) was directly applied to the column, and the volume of solution A (0.1% trifluoroacetic acid / distilled water) was applied at a flow rate of 1 ml / min for 1 minute. 100
% Solution (0.1% trifluoroacetic acid / 60% acetonitrile) to a volume of 45%.
The eluate was collected by increasing the solution B concentration to 55% with a linear gradient at 80 ml / min over 80 minutes. Eluate 1 ml
Each fraction was numbered and fractionated. Using 1 μl of the fractionated fraction directly, according to the test method of (1-3) above,
GALR2 activating effect was measured. As a result, the main activity peaks were detected in fractions No.44-45 and No.50-52. Fraction Nos. 44-45 were mixed, and re-chromatography was performed under the same conditions. On the other hand, for Nos. 50, 51 and 52, re-chromatography was performed separately under the same conditions, and eluted fractions of 0.5 ml each were collected. 2 μl of each fraction was directly used, and the GALR2 activating effect was measured by the test method described in the above (1-3). As a result, N
Fractions No. 93-95 obtained by re-chromatography operation of o.44-45, and fraction Nos. 105-107 obtained by re-chromatography operation of fraction No. 50
An activity peak was detected. Fraction No. 105-1 obtained by re-chromatography of fraction No. 51
A major activity peak was detected at 07, and a weak activity peak was detected at fractions Nos. 108-109. Furthermore, fraction No.5
Fraction N obtained by re-chromatography operation of 2
In o.106-110, a major activity peak was broadly detected.

(3-3-5) Purification by Super ODS Reversed-Phase High Performance Liquid Chromatography (3-3-5-1) Purification of GALR2-Activated Main Component (3-3-5-1-1) Trifluoroacetic Acid Chromatography in the presence of TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 0.46 cm x 10 cm) at 40 ° C
At, solution A (0.1% trifluoroacetic acid / distilled water) was flowed at a flow rate of 1 ml / min to equilibrate. S obtained in (3-3-4)
Upper Phenyl Reversed-phase high-performance liquid chromatography Preparative fraction No93-95 was directly applied to the column, and the flow rate was 1 ml.
/ min, solution A (0.1% trifluoroacetic acid / distilled water) volume 100% to solution B (0.1% trifluoroacetic acid / 6
0% acetonitrile) volume was increased in a linear gradient to 50%, which was then added at a flow rate of 1 ml / min for 84 minutes.
The eluate was recovered by elevating the concentration of solution B to 62.5% with a linear gradient. Eluate 0.5 ml fraction N
o. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, the activity peak was fraction No. 9
6-97 detected. The obtained fraction Nos. 96-97 were mixed and re-chromatography was performed under the same conditions.
Fractions were collected in 0.5 ml portions. 210 nm UV (U
V) Although the peak detected by absorption was single, a shoulder of the peak suggesting contamination was observed. Using 2 μl of each fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, activity peaks were detected in fractions No. 98-100,
The peak coincided with the portion excluding the shoulder of the peak detected by 10 nm ultraviolet absorption. In order to remove impurities contained in the shoulder portion of the peak, further purification was performed by the method described in (3-3-5-1-2). (3-3-5-1-2) Chromatography in the presence of heptafluorobutyric acid A TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 0.46 cm x 10 cm) was subjected to 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid /
(Distilled water) was allowed to flow to equilibrate. (3-3-5-1-1)
After the fraction No. 98-100 obtained in step 1 was directly applied to the column, the flow rate was 1 ml / min, and the volume of solution A (0.1% heptafluorobutyric acid / distilled water) from 100% to solution B (0.1% heptafluorobutyric acid / 100%) for 1 minute. % Acetonitrile) volume was rapidly increased to 35%, which was then increased at a flow rate of 1 ml / min with a linear gradient to a 50% solution B concentration over 60 minutes to collect the eluate. The eluate was fractionated with a 0.5 ml fraction number. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions No. 67-69. This activity peak completely coincided with the earlier-eluted ultraviolet absorption peak of the 210 nm ultraviolet absorption peak separated into two lines, and it was determined that the single peptide had been purified. The component having this activating effect is referred to as GALR2 activating main component. (3-3-5-2) Purification of GALR2-activated accessory component (1) TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoh Corporation, 0.46 cm x 10 cm) was heated to 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid)
/ Distilled water) and allowed to equilibrate. Super Phenyl Reversed-Phase High-Performance Liquid Chromatography Preparative Fraction No. 105-107 (from Fraction No. 50), Fraction No. 105-107 (from Fraction No. 51), Fraction Obtained in (3-3-4) No.106-107 (from fraction No.52) mixed,
After applying directly to the column, the flow rate is 1 ml / min for 1 minute,
Solution A (0.1% trifluoroacetic acid / distilled water) Capacity 100
% Solution (0.1% trifluoroacetic acid / 60% acetonitrile) to 52.5% volume,
The eluate was collected by increasing the concentration of solution B to 65% in a linear gradient over 84 minutes at ml / min. The eluate was added to 0.
Fraction No. was added to each 5 ml, and fractionation was performed. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions No. 75-76. The obtained fractions No. 75-76 were mixed, and the same chromatography was performed again under the same conditions, and 0.5 ml each of the fraction Nos.
And attached. The eluate was detected as a single peak at 210 nm UV absorption. Preparative fraction 3 μl
Was directly used, and the GALR2 activating action was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions Nos. 76-78. This activity peak coincided with the ultraviolet absorption peak at 210 nm, and it was determined that the active ingredient had been purified to a single peptide. The component having this activating effect is referred to as GALR2 activation subcomponent (1).

(3-3-5-3) Purification of GALR2 Activating Secondary Component (2) A column for TSKgel Super ODS reversed phase high performance liquid chromatography (Tosoh Corporation, 0.46 cm × 10 cm) was heated at 40 ° C.
At a flow rate of 1 ml / min, solution A (0.1% heptafluorobutyric acid)
/ Distilled water) and allowed to equilibrate. Super phenyl reversed-phase high-performance liquid chromatography fractions No.108-109 (from fraction No.51) and fraction No.108-110 (from fraction No.52) obtained in (3-3-4) are mixed. After direct application to the column, the flow rate was 1 ml / min and the volume of solution A (0.1% trifluoroacetic acid / 60% acetonitrile) was rapidly increased from 100% to 52.5% in 1 minute. Next, at a flow rate of 1 ml / min, the solution B concentration was raised to 65% with a linear gradient over a period of 84 minutes, and the eluate was collected. The eluate was fractionated with a 0.5 ml fraction number. Using 2 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, an activity peak was detected in fractions No. 79-80. The obtained fraction No. 79-80 was mixed, and the same chromatography was performed again under the same conditions.
Each fraction was detected as a single peak by ultraviolet absorption at 210 nm. Using 3 μl of the fractionated fraction directly, the GALR2 activating effect was measured by the test method described in (1-3) above. As a result, the activity peak was fraction No. 7.
9-81. This activity peak coincided with the ultraviolet absorption peak at 210 nm, and it was determined that the active ingredient had been purified to a single peptide. GALR is a component that has this activating effect.
2 Called the activating subcomponent (2).

Example 4 Analysis of Amino Acid Sequence (4-1) Analysis of N-terminal amino acid sequence of main component having GALR2 activating action Fraction N obtained in (3-3-5-1-2) above
The GALR2-activated main component of O.67-69 was dissolved in 20 μl of 0.1% trifluoroacetic acid / 30% acetonitrile, dropped on a peptide support disk (Beckman), and dried with nitrogen gas. This was set in a protein sequencer (Beckman, LF3400DT) and subjected to an automatic Edman degradation reaction by a standard analysis method (procedure 40) to perform amino acid sequence analysis. The PTH amino acids identified for each cycle are shown in [Table 1].

[Table 1] From Table 1, the amino acid sequence from the N-terminus to the 34th residue of the GALR2 activation main component could be determined as follows (residue X at the 28th position is unidentified). APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGGGK (N-terminal amino acid sequence of GALR2-activating main component, SEQ ID NO: 11) A sequence consisting of 13 residues from the 9th to 21st residues from the N-terminus in the obtained amino acid sequence is a known pig galanin. N-terminal amino acid sequence. However, the amino acid sequence before and after that did not match any sequence of porcine galanin and its precursor. In addition, since no known peptide corresponding to the present amino acid sequence was found, the obtained GA
It was speculated that the LR2 activating main component was a novel peptide. (4-2) N-terminal amino acid sequence analysis of accessory component (1) having GALR2 activating action Fraction No. 76- obtained in (3-3-5-2) above
78 GALR2 activation accessory components were analyzed in the same manner as in (4-1). The amino acids identified in each cycle are shown in [Table 2].

[Table 2] From Table 2, the amino acid sequence from the N-terminus to the 32nd residue of the GALR2 activation subcomponent (1) could be determined as follows (residue X at the 28th position is unidentified). . APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGG (N-terminal sequence of GALR2 activating subcomponent (1), SEQ ID NO: 12) This amino acid sequence completely replaces 32 residues of the N-terminal amino acid sequence of the GALR2 activating main component obtained in (4-1) above. Matched.

(4-3) Analysis of N-terminal amino acid sequence of subcomponent (2) having GALR2 activating action Fraction No. 79- obtained in (3-3-5-3) above
81 GALR2 activation accessory component (2) was dissolved in 20 μl of 0.1% trifluoroacetic acid / 30% acetonitrile, ammonium bicarbonate (final concentration 1%), TLCK-chymotrypsin (final concentration)
(10 pmol Sigma) and distilled water to make 50 μl, and reacted at 37 ° C. for 1 hour. A Spheri-5 RP-18 reversed-phase high-performance liquid chromatography column (Brownley, 2.1 mm x 30 mm) was applied at 25 ° C at a flow rate of 300 µl / mi
Solution A (0.1% trifluoroacetic acid) was flowed in n to equilibrate. After attaching the entire amount of the enzyme reaction solution to the column, the flow rate was 300 μl.
/ min, increasing the volume of solution A (0.1% trifluoroacetic acid) from 100% to the volume of solution B (0.1% trifluoroacetic acid / 70% acetonitrile) to 70% over 30 minutes, and eluted peak showing ultraviolet absorption at 210 nm 4 (CHY-1, CHY-2, CHY-3 and C
HY-4) was collected as the elution fraction. Sorted 4
After concentrating the two fractions (fragments digested with chymotrypsin) under a nitrogen stream to 50 μl or less, (4-1)
The N-terminal amino acid sequence was analyzed using a protein sequencer in the same manner as described above. For CHY-3,
Beckman LF3400DT protein sequencer, CHY
For -1, CHY-2 and CHY-4, an Applied Biosystems 477A protein sequencer was used. The following sequence was obtained by N-terminal amino acid sequence analysis. CHY-1: APVHRGRGG (SEQ ID NO: 13) CHY-2: XAIDGLPYPQS (X unidentified) (SEQ ID NO: 16) CHY-3: LLGPVLHPPSXAEGGGKTALGILDL (X unidentified) (SEQ ID NO: 15) CHY-4: TLNSAG (SEQ ID NO: 14) N of the GALR2 activation main component obtained in (4-1) or the GALR2 activation subcomponent (1) obtained in (4-2) above
With reference to the terminal amino acid sequence results, it was inferred that the GALR2 activation accessory component (2) had the following N-terminal amino acid sequence. APVHRGRGGWTLNSAGYLLGPVLHPPSXAEGGGKTALGILDL (SEQ ID NO: 17)

Example 5 Pig-type ligand peptide (1-
CDNA encoding 60) 1) Cloning of porcine GALR2 activator gene fragment by degenerated PCR (Degenerated PCR) method Using TRIZOL reagent (Gibco BRL) from whole pig brain,
Total according to the method described in the attached manual
RNA was extracted. Then an oligo dT cellulose column (mRN
A (Purification Kit, Pharmacia) was used to prepare poly (A) ⁺ RNA from the total RNA according to the method described in the attached manual. Furthermore, 3'RACE System fo
r rapid amplification of cDNA ends (Gibco BRL)
Was used to synthesize a first strand cDNA from the Poly (A) ⁺ RNA according to the method described in the attached manual. In addition, the following degenerate primer designed based on the partial amino acid sequence of the porcine GALR2 activating component was synthesized. pGAL4-7F: 5'-CAYMGNGGIMGNGGIGGSTGGAC-3 '(SEQ ID NO: 20) pGAL9-3F: 5'-GGHTGGACNCTNAAYAGYGC-3' (SEQ ID NO: 21) pGAL34-1R: 5'-ATICCNAGIGCNGTYTTICCYTT-3 '(SEQ ID NO: 22) Using the first strand cDNA described above as a template, pGAL4-7
First-stage PCR using F and pGAL34-1R as primers
The reaction was performed. The reaction solution in the PCR reaction was Taq pol
0.5 μl of ymerase (Takara Shuzo Co., Ltd.)
10x PCR buffer (500 mM KCl-100 mM Tris-HCl, pH 8.
3) 10 μl, 25 mM MgCl ₂ 6 μl, 2.5 mM dNTP mixture
8 μl, primers pGAL4-7F and primer pGAL34-
1R (10 μM each), 10 μl each, and the template cDNA
8μl (first strand cDNA described above) and 47.5 distilled water
μl was prepared by mixing. As the PCR, 1) initial denaturation (94 ° C., 30 seconds), 2) 32 cycle reactions (94 ° C., 20 seconds)
-55 ° C for 30 seconds -72 ° C for 30 seconds) followed by 3) final extension reaction (72 ° C for 4 minutes) to obtain a first-stage PCR product. Second-stage PCR reaction (nested PCR) using the obtained first-stage PCR product as a template
Was done. The reaction solution was 0.5 μl of Taq polymerase (Takara Shuzo Co., Ltd.) and the attached 10x PCR buffer (500 mM KCl-100).
mM TrisHCl, pH 8.3) 10 μl, 25 mM MgCl ₂ 6 μl
l, 2.5 μm dNTP mixture, 8 μl, primer pGAL9-3F
And 10 μl each of pGAL34-1R (both 10 μM), 5 μl of the template cDNA (first-stage PCR product), and 50.5 μl of distilled water
Were mixed. As the PCR, 1) initial denaturation (94
℃ ・ 30sec) 2) 32 cycles (94 ℃ ・ 20sec)
-55 ° C for 30 seconds -72 ° C for 30 seconds) 3) Final elongation reaction (72
℃ 10 minutes) to obtain a nested PCR product. And ne
Perform a 2.0% agarose gel electrophoresis on the sted PCR product,
A gel piece containing a band of about 100 bp to be stained with cyber green was cut out with a razor. Gene Clean DN from the gel piece
A DNA fragment as a nested PCR product was recovered using an A extraction kit (BIO 101). This DNA fragment is used for TOPO TA Clonin
Using g Kit (Invitrogen), the plasmid was ligated to the plasmid vector pCRII attached to the kit according to the method described in the attached manual. QIAwe
Purification was performed using ll 8 Ultra plasmid purification kit (QIAGEN). The reaction for determining the nucleotide sequence of the nested PCR product in the plasmid was performed using the Dye Terminator Cycle S
This was performed using an equencing Kit (Applied Biosystems, PerkinElmer) and a fluorescent automatic sequencer (DNA
The nucleotide sequence of the nested PCR product was decoded using sequencer Prism 377 (Applied Biosystems, Perkin Elmer). As a result, several types of plasmids having a 98 bp DNA fragment encoding a partial peptide of porcine GALR2 activator could be obtained. Degenerate primer for PCR reaction
s, the D in these several plasmids was
NA had a difference in the nucleotide sequence in the portion corresponding to the primer. Below are two representative clones, pCR100-6 and pCR1
Shows the base sequence of the nested PCR product in 00-7. pCR100-6: GGCTGGACTT TAAATAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG GCTGAAGGAG GCGGGAAGGG CAAAACAGCC CTGGGCAT (SEQ ID NO: 23) pCR100-7: GGTTGGACTT TGAACAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCCGGCCAGCCGGCCGGCCGGCCGGCCGGCCGGCCGCGCGGCCGGCCGGCCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGCGCCCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGCGCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGCGGCCAG Code)
Cloning of cDNA From the aforementioned poly (A) ⁺ RNA obtained from whole pig brain, ZAP-
cDNA Gigapack III Gold cloning kit (STRATAGENE)
Was used to prepare a porcine whole brain cDNA phage library. The method followed the manual attached to the kit. The obtained phage (2,200,000 plaque forming units) was transformed into E. coli XL1-Blue MRF '(STRATAGENE
Was spread on 120 NZY medium agar plates and cultured at 37 ° C. for 8 hours. The phage was copied from the obtained E. coli plaque onto a Hybond-N + nylon membrane (Amersham). This nylon membrane
It was immersed in a 0.5 N sodium hydroxide solution containing 1.5 M sodium chloride, a 0.5 M tris buffer solution (pH 7.0) containing 1.5 M sodium chloride, and a 2 × SSC solution, and then air-dried. The obtained nylon membrane was mixed with a hybridization buffer (5x SSPE, 5x Denhardt's solution, 0.5% SDS, 0.1%
mg / ml salmon sperm DNA) at 60 ° C. for 24 hours, followed by a hybridization probe (5 × 10 ⁵ cpm / ml).
In a hybridization buffer (same as above) containing
It was kept at 60 ° C. for 24 hours. The hybridization probe was prepared by using the above-mentioned 1: 1 mixture of plasmids pCR100-6 and pCR100-7 as a template and the following two primers pGAL9-3F
And a DNA fragment amplified by pGAL34-8R. pGAL9-3F: 5'-GGHTGGACNCTNAAYAGYGC-3 '(SEQ ID NO: 25) pGAL34-8R: 5'-ATDCCBAGGGCDGTTTTGCCCTT-3' (SEQ ID NO: 26) That is, the amplification reaction [The reaction solution composition is ExTaq ), 5 μl of the attached 10x Ex Taq buffer (containing 20 mM MgCl ₂ ), 4 μl of 2.5 mM dNTP mixture, [α- ³²
P] dCTP (6000 Ci / mmol) 10 μl, primer pGAL9-3F
And 0.5 μl each of pGAL34-8R (10 μM each), 1 μl of template cDNA, and 29 μl of distilled water.
After initial denaturation at 96 ° C for 30 seconds, -55 ° C
32 cycles of 30 seconds -72 ° C for 30 seconds, and 72 ° C
-A final extension reaction was performed for 4 minutes to obtain an amplified DNA fragment. Nylon membrane after the hybridization reaction,
After washing with 0.2 × SSC buffer containing 0.1% SDS at 50 ° C. for 30 minutes, it was subjected to autoradiography using an X-ray film (Kodak, BioMax MS) in the presence of an intensifying screen ( Exposure conditions: -70 ° C, 3 days). Positive plaques detected from the results of the autoradiography were isolated, and SM buffer containing 0.1 ml of chloroform (100 mM NaC
l, 8 mM MgSO ₄ , 0.01% gelatin, 50 mM Tris ・ HCl, pH
7.5) Phage was extracted in 5 ml. The obtained phage was again infected into Escherichia coli XL1-Blue MRF ', spread on an NZY medium agar plate, and cultured at 37 ° C. for 8 hours. The phage was transferred from the obtained Escherichia coli plaque to a nylon membrane (Amersham, Hybond-N +) and subjected to hybridization in the same manner as described above. A single positive clone was isolated by autoradiography, and the same series of operations as described above was repeated once again to obtain a completely single phage clone.

Next, a plasmid was isolated and purified from the phage clone by the following method. The phage solution (1 μl) was mixed with E. coli XPORT (50 μl), helper phage (10 μl), and E. coli XLOLR (5 μl), spread on a NZY agar plate, and cultured at 37 ° C. for 8 hours. Pick a small colony of Escherichia coli XLOLR generated in Escherichia coli XPORT plaque with a toothpick and LB containing ampicillin and tetracycline
The cells were cultured overnight at 37 ° C. on a medium agar plate. Escherichia coli XLOLR was picked up from a single colony and liquid-cultured in LB medium. After culturing, collect E. coli XLOLR,
Plasmid purification kit (Qiagen, QIAwell 8 Ultr
The plasmid was purified using a). The reaction for determining the nucleotide sequence of the cDNA encoding the porcine GALR2 activator in the plasmid was performed by the Dye Terminator Cycle Sequencing Ki
t (Applied Biosystems, PerkinElmer), using a fluorescent automatic sequencer (DNA sequencerPri
The nucleotide sequence of the cDNA encoding the porcine GALR2 activator was decoded using sm 377: Applied Biosystems (Perkin Elmer). As a result, a plasmid pGR2PL6 having a 974 bp DNA fragment encoding a full-length peptide of a porcine GALR2 activator and a plasmid pGR2PL3 having a 1007 bp DNA fragment could be obtained. Although there were large differences in the chain length and amino acid sequence of the precursor of GALR2 activator encoded by both DNA sequences, the mature activator predicted to be produced by processing (mature activator)
The sequence of the peptide) portion was identical. The resulting two plasmids were introduced into E. coli TOP10 by a known method,
TOP10 / pGR2PL6 and TOP10 / pGR2PL3 were obtained respectively for the transformants.

Example 6 Pig-type ligand peptide (1-
60): Ala-Pro-Val-His-Arg-Gly-Arg-Gly-Gly-Trp-Th
r-Leu-Asn-Ser-Ala-Gly-Tyr-Leu-Leu-Gly-Pro-Val-Leu-
His-Pro-Pro-Ser-Arg-Ala-Glu-Gly-Gly-Gly-Lys-Gly-Ly
s-Thr-Ala-Leu-Gly-Ile-Leu-Asp-Leu-Trp-Lys-Ala-Ile-
Asp-Gly-Leu-Pro-Tyr-Pro-Gln-Ser-Gln-Leu-Ala-Ser
Production of (SEQ ID NO: 31) Commercially available Boc-Ser (Bzl) 1-OCH ₂ -PAM resin (0.73 mmol / g resi
n) Place 0.5 m moles in the reaction solution of the peptide synthesizer ABI 430A, and use the Boc-strategy (NMP-HOBt) peptide synthesis method for Boc.
-Ala, Boc-Leu, Boc-Gln, Boc-Ser (Bzl), Boc-Pro, Boc
-Tyr (Br-Z), Boc-Gly, Boc-Asp (OcHex), Boc-Ile, Boc-
Lys (Cl-Z), Boc-Trp (CHO), Boc-Thr (Bzl), Boc-Glu (OcH
ex), Boc-Arg (Tos), Boc-His (Bom), Boc-Val, Boc-Asn,
Were introduced in the desired amino acid sequence in order to obtain the desired protected peptide resin. 0.105 g of this resin is 1.1 g of p-cresol,
10 ml of anhydrous hydrogen fluoride with 1.2 ml of 1,4-butanedithiol
After stirring at 0 ° C. for 60 minutes, hydrogen fluoride was distilled off under reduced pressure.
Diethyl ether was added to the residue, and the precipitate was filtered. 50% acetic acid aqueous solution was added to this precipitate for extraction, and the insoluble portion was removed.
After fully concentrating the extract, the extract was applied to a Sephadexho G-25 column (2.0 x 80 cm) packed with 50% aqueous acetic acid, developed with the same solvent, and the main fractions were collected and reverse phase packed with LiChroprep RP-18. 0.1% TFA water on a chromatographic column (2.6 x 60 cm) 200
The mixture was washed with 0.1 ml of TFA and 300 ml of 0.1% TFA in water and 300 ml of 50% acetonitrile in water was subjected to linear gradient elution. The main fractions were collected, concentrated and lyophilized to obtain 39 mg of a white powder. This was further applied to an ion-exchange chromatography column packed with CM-cellulofine, and a linear gradient elution was performed at a concentration of 50 mM to 200 mM ammonium acetate. The main fraction was collected and freeze-dried repeatedly to obtain 10 mg of a white powder. (M + H) by mass spectrometry ⁺ 6204.7 (calculated value 6205.2) HPLC elution time 21.8 min Column conditions Column Wakosil 5C18T 4.6 x 100mm Eluent: A solution-0.1% TFA water, B solution-0.1% TFA containing acetonitrile A / B: 95/5 to 45/55 linear gradient elution (25 min) Flow rate: 1.0 ml / min

Example 7 Rat type ligand peptide (1
-60): Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Trp-
Thr-Leu-Asn-Ser-Ala-Gly-Tyr-Leu-Leu-Gly-Pro-Val-Le
u-His-Leu-Ser-Ser-Lys-Ala-Asn-Gln-Gly-Arg-Lys-Thr-
Asp-Ser-Ala-Leu-Glu-Ile-Leu-Asp-Leu-Trp-Lys-Ala-Il
e-Asp-Gly-Leu-Pro-Tyr-Ser-Arg-Ser-Pro-Arg-Met-Thr
(SEQ ID NO: 33) and human ligand polypeptide (1-60): Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly
-Trp-Thr-Leu-Asn-Ser-Ala-Gly-Tyr-Leu-Leu-Gly-Pro-V
al-Leu-His-Leu-Pro-Gln-Met-Gly-Asp-Gln-Asp-Gly-Lys
-Arg-Glu-Thr-Ala-Leu-Glu-Ile-Leu-Asp-Leu-Trp-Lys-A
la-Ile-Asp-Gly-Leu-Pro-Tyr-Ser-His-Pro-Pro-Gln-Pro
Production of -Ser (SEQ ID NO: 34) It can be obtained by performing synthesis and purification in the same manner as in Example 1 using a commercially available Boc-Thr (Bzl) 1-OCH ₂ -PAM resin.

Example 8 Antigen peptide used for preparation of monoclonal antibody Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cy
Production of s-NH ₂ (amide of SEQ ID NO: 44) Boc-Cys (MeBzl), Boc-Gly, Boc- using a commercially available p-methyl MBH resin (0.77 mmol / g resin) in the same manner as in Example 1. Arg (To
s), Boc-His (Bom), Boc-Ala, and Boc-Pro are condensed in the desired amino acid sequence, treated with hydrogen fluoride, and purified on a Sephadexho G-25 column (2.0 x 80 cm) packed with 50% acetic acid aqueous solution. After freeze-drying, 50 mg of a white powder was obtained. (M + H) ⁺ 980.5 (calculated value 980.5) by mass spectrometry HPLC elution time 5.2 min Column conditions Column Wakosil 5C18T 4.6 x 100 mm Eluent: A solution-0.1% TFA water, B solution-0.1% TFA in acetonitrile B Linear concentration gradient elution from liquid concentration 0 to 50% (25 minutes) Flow rate: 1.0 ml / min

Example 9 Ala-Pro-Ala-His-Arg-Gly-Arg-
Preparation of immunogen containing Gly-Gly (SEQ ID NO: 35) Ala-Pro-Ala-His-Arg-Gly-Arg- obtained in Example 8 above
A complex of the peptide shown by Gly-Gly-Cys-NH ₂ (amide of SEQ ID NO: 44) and Keyhole Limpet Hemocyanin (KLH) was prepared and used as an immunogen. That is, KLH20
mg in a volume of 1.4 M in 0.1 M phosphate buffer (pH 6.5).
The mixture was mixed with 100 μl of a DMF solution containing 2.2 mg (8 μmol) of N- (γ-maleimidobutyryloxy) succinimide (GMBS) and reacted at room temperature for 40 minutes. After the reaction, the mixture was fractionated on a Sephadex G-25 column, and 15 mg of KLH into which a maleimide group had been introduced and Ala-
Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys-NH ₂ (amide of SEQ ID NO: 44) was mixed with 1.6 mg of the peptide and reacted at 4 ° C. for 2 days. . After the reaction, the solution was dialyzed against physiological saline at 4 ° C. for 2 days.

Example 10 Immunization A 6-8 week-old BALB / C female mouse was immunized with the immunogen Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys (-N
About 30 μg / animal of H ₂ ) -KLH complex was subcutaneously immunized with complete Freund's adjuvant. Thereafter, every three weeks, the same amount of the immunogen was boosted twice with incomplete Freund's adjuvant.

Example 11 Preparation of enzyme-labeled antigen Horseradish peroxidase (HRP) -labeled Ala-Pro-
Ala-His-Arg-Gly-Arg-Gly-Gly-Cys-NH ₂ (SEQ ID NO: 4
Preparation of the peptide represented by the formula (4): Ala-Pro-Ala-His-Arg-Gly-Arg-
The peptide indicated by Gly-Gly-Cys-NH ₂ (amide of SEQ ID NO: 44) and HRP (for enzyme immunoassay, manufactured by Boehringer Mannheim) are cross-linked, and enzyme immunoassay (EIA)
Labeled product. That is, HRP 6mg (150n
mol) in 0.95 ml of 0.1 M phosphate buffer, pH
6.5 and dissolved in GMBS 0.42 mg (1.5 μm
ol) and mixed with 50 μl of a DMF solution containing
After reacting for minutes, fractionation was performed on a Sephadex G-25 column. 4.2 mg (105 nmol) of the maleimide group-introduced HRP thus prepared and Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Gly-produced in Example 9.
0.31 mg (315 nmol) of the peptide represented by Cys-NH ₂ (an amide of SEQ ID NO: 44) was mixed and reacted at 4 ° C. for 1 day. After the reaction, Ultrogel AcA44 (LKB
-Pharmacia) column and fractionated with HRP-labeled Al
to obtain a a-Pro-Ala-His- Arg-Gly-Arg-Gly-Gly-Cys-NH 2.

Example 12 Ala-Pro-Ala-His-Arg-Gly-Ar
Measurement of antibody titer in antiserum of mouse immunized with g-Gly-Gly-Cys (-NH ₂ ) -KLH complex Ala-Pro-Ala-His-Arg-Gly-Arg obtained in Example 9 above -
The antibody titer in the mouse antiserum immunized with the Gly-Gly-Cys (-NH ₂ ) -KLH complex was measured by the following method. To prepare an anti-mouse immunoglobulin antibody-bound microplate, first, a 0.1 M carbonate buffer, pH 9.6 solution containing 100 μg / ml of anti-mouse immunoglobulin antibody (IgG fraction, manufactured by Kappel) was placed in a 96-well microplate. Each 100 μl was dispensed and left at 4 ° C. for 24 hours.
Next, the plate was washed with phosphate buffered saline (PBS, pH
After washing in 7.4), 300 μl of PBS containing 25% Block Ace (manufactured by Snow Brand Milk Products Co., Ltd.) is dispensed in order to cover the excess binding site of the well, and at least 24 ° C. at 4 ° C.
Time processed. Buffer C [1% B] was added to each well of the anti-mouse immunoglobulin antibody-bound microplate.
0.02 M phosphate buffer, pH 7.0, containing SA, 0.4 M NaCl, and 2 mM EDTA]
l, Ala-Pro-Ala-His-Arg-Gly- diluted with buffer C
Arg-Gly-Gly-Cys (-NH ₂ ) -KLH complex antiserum 100
μl was added and reacted at 4 ° C. for 16 hours. Next, after washing the plate with PBS, the HRP-labeled Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cy prepared in Example 11 above was used.
100 μl of s-NH ₂ (diluted 500-fold with buffer C) was added and reacted at room temperature for 1 day. Next, after the plate was washed with PBS, the enzyme activity on the solid phase was measured using a TMB microwell peroxidase substrate system (KIRKEGAARD & PERRY L.).
AB, INC, Funakoshi Chemical Handling) 100 μl was added, and the reaction was carried out at room temperature for 10 minutes. Reaction 1
After stopping by adding 100 μl of M phosphoric acid, 450 nm
Plate reader (BICHROMATIC,
(Manufactured by Dainippon Pharma Co., Ltd.). The results are shown in FIG.
Ala-Pro-Ala-His-Arg-Gly- was added to all eight immunized mice.
Arg-Gly-Gly-Cys ( -NH 2) -KLH rise in antibody titer to complex was observed.

Example 13 Preparation of Monoclonal Antibody of Rat Ligand Peptide (1-60) (SEQ ID NO: 33)
The final immunization was performed by inoculating intravenously a solution prepared by dissolving 0 μg of the immunogen in 0.25 to 0.3 ml of physiological saline. The spleen was removed from the mouse 3 to 4 days after the final immunization, pressed with a stainless mesh, filtered, and suspended in Eagle's Minimum Essential Medium (MEM) to obtain a spleen cell suspension. As a cell used for cell fusion, BALB / C mouse-derived myeloma cell P3-
X63.Ag8. U1 (P3U1) [Current Topics in Microbiology and Immunology, 81, 1 (1978)]. Cell fusion was performed according to the original method [Nature, 256, 495 (1975)]. That is,
Spleen cells and P3U1 were isolated from serum-free M
After washing three times with EM, the ratio of spleen cells to the number of P3U1 was 1
The cells were mixed at 0: 1 and centrifuged at 800 rpm for 15 minutes to precipitate the cells. After sufficiently removing the supernatant, the precipitate was loosened gently, and 0.3 ml of 45% polyethylene glycol (PEG) 6000 (manufactured by Kochlite) was added.
In addition, fusion was performed by allowing the mixture to stand in a 37 ° C. hot water bath for 7 minutes. After fusion, MEM was added to the cells at a rate of 2 ml per minute,
After adding a total of 15 ml of MEM, the supernatant was removed by centrifugation at 600 rpm for 15 minutes. The cell sediment was purified using GIT Medium (Wako Pure Chemical) containing 10% fetal bovine serum (GIT
P3U1 was suspended in -10% FCS (2 × 10 ⁵ cells / ml) and seeded in 192 wells in a 24-well multi-dish (manufactured by Limbro) at 1 ml / well. After seeding, the cells were cultured at 37 ° C. in a 5% CO 2 incubator. After 24 hours, GIT-10% FCS medium (HAT medium) containing HAT (hypoxanthine 1 × 10 ⁻⁴ M, aminopterin 4 × 10 ⁻⁷ M, thymidine 1.6 × 10 ⁻³ M) was added per well. HAT selection culture was started by adding 1 ml each. The HAT selective culture was continued by discarding 1 ml of the old solution on days 3, 6, and 9 after the start of the culture, and then adding 1 ml of HAT medium. Hybridoma growth was observed 9 to 14 days after cell fusion, and when the culture broth turned yellow (about 1 × 10 ⁶ cells / cell).
ml) and the supernatant was collected, and the antibody titer was measured according to the method described in Example 5. Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-
As a typical example of screening for a hybridoma derived from a mouse immunized with the Gly-Cys (-NH ₂ ) -KLH complex, the results obtained using mouse No. 8 (see FIG. 7) are shown in FIG. 8. . Next, the hybridomas exhibiting these high antibody titers were subjected to cloning by the limiting dilution method.
When cloning, BAL was used as a feeder cell.
Thymocytes from B / C mice were added at 5 × 10 ⁵ cells per well. After cloning, the hybridomas
1 to 3 × 10 ⁶ cells / animal were intraperitoneally administered to mice (BALB / C) to which 0.5 ml of mineral oil had been intraperitoneally administered in advance, and antibody-containing ascites was collected 6 to 20 days later. The monoclonal antibody was purified from the ascites fluid obtained using a protein-A column. That is, ascites 6-20m
1 with an equal volume of binding buffer (3.5 M NaCl, 0.05
Recombinant protein-A-agarose (manufactured by Repligen) after dilution with 1.5 M glycine containing 0.1% NaN ₃ (pH 9.0), and previously equilibrated with a binding buffer.
The sample is applied to a column, and the specific antibody is dissolved in an elution buffer (0.05%
Elution was carried out with 0.1 M citrate buffer containing N ₃ (pH 3.0). The eluate was dialyzed against PBS at 4 ° C for 2 days, sterilized and filtered through a 0.22 µm filter (manufactured by Millipore), and stored at 4 ° C or -80 ° C. In determining the class and subclass of the monoclonal antibody, an enzyme-linked immunosorbent assay (ELISA) using a solid phase bound with the purified monoclonal antibody was performed. That is, a 0.1 M carbonate buffer, pH 9.6 solution containing 2 μg / ml of an antibody was added to a 96-well microplate in a volume of 1 μm.
The mixture was dispensed in an amount of 00 μl and left at 4 ° C. for 24 hours. According to the method described in Example 12 above, the excess binding site of the well is covered with block ace, and then the class of the immobilized antibody is determined by ELISA using an isotype typing kit (Mouse-TyperTM Sub-Isotyping Kit BioRad). And examined the subclass.

Example 14 Competition Method Enzyme Immunoassay (Competition Method-EIA) Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys (-NH ₂ )-
The reaction specificity of the monoclonal antibody prepared using the KLH complex as an immunogen was examined by the following method. First, the antibody titer of each monoclonal antibody solution was examined by the method described in Example 12, and the antibody concentration used for the competition method-EIA was determined as the antibody concentration at which the amount of the labeled substance was about 50% of the saturated amount (about 30%). ５０50 ng / ml). Next, the anti-mouse immunoglobulin antibody-bound microplate described in Example 12 was added to the determined concentration of buffer C.
50 μl of the antibody solution diluted with Ala-Pro-Ala-His-Arg-
Gly-Arg-Gly-Gly-Cys-NH ₂ (amide of SEQ ID NO: 44), porcine ligand peptide (1-60) (SEQ ID NO: 31) and rat galanin (SEQ ID NO: 61)
Of buffer C solution containing 0.05% CHAPS
l, and the HRP-labeled Ala-Pr described in Example 11 above.
50 μl of o-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys-NH ₂ (diluted 250-fold with buffer C) was added and reacted at 4 ° C. for 16 hours. After the reaction, the plate was washed with PBS, and the enzyme activity on the solid phase was measured by the method described in Example 12 above.
Table 3 shows the results.

[Table 3] As a typical example, a porcine ligand peptide (1-60)
The results of the competition method-EIA of the monoclonal antibody GR2-1N (IgG _2b , κ) showing the highest reactivity with (SEQ ID NO: 31) are shown in FIG. 9. GR2-1N is C
ys-Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly (SEQ ID NO:
44), it has the same degree of reactivity with the porcine ligand peptide (1-60) (SEQ ID NO: 31), and does not react with rat galanin (SEQ ID NO: 61).
GR2-1N porcine ligand peptide (1-60)
From the standard curve of (SEQ ID NO: 31), (B / B) =
Pig-type ligand peptide giving 0.5 (1-60)
(SEQ ID NO: 31) The concentration was 6 nM, 4.95 ng / w.
ell, and its detection sensitivity is about 0.1 nM [(B / B
o) = 0.8]. Therefore, G
The competition method EIA using R2-1N was carried out without cross-reaction with SEQ ID NO: X (rat galanin), and Ala-Pro-Ala-Hi
Rat-type ligand peptide having s-Arg-Gly-Arg-Gly-Gly (SEQ ID NO: 33), pig-type ligand peptide (1
-60) (SEQ ID NO: 31) or human ligand peptide (SEQ ID NO: 44) can be specifically measured up to about 0.1 nM.

Example 15 Pig-type ligand peptide (1
-34) Preparation of (SEQ ID NO: 11) 5 nmol of porcine ligand peptide (1-60) was 1
In a reaction solution of 250 μl of 1% ammonium bicarbonate containing 6% acetonitrile, 50 pmol of lysyl endopeptidase (manufactured by Wako Pure Chemical Industries, Ltd.) was incubated at 37 ° C. for 3.5 hours. Spheri-5 RP-18 reverse-phase high-performance liquid chromatography column (Brownley, 2.1 mm x 30 mm) was preliminarily charged with solution A (0.1% trifluoroacetic acid) at a flow rate of 300 μl / mi.
Flow at n and equilibrate at 25 ° C. After driving the enzyme reaction solution into the column, the concentration of solution B (0.1% trifluoroacetic acid / 70% acetonitrile) is increased to 70% over 30 minutes while maintaining a flow rate of 300 μl / min. The eluate was monitored by absorbance at 210 nm, and the peak was manually collected. The peak fraction eluted at 20.2 minutes was M + H ^{+3 by} mass spectrometry.
466.5, and the fragment ligand peptide (1-3) of the porcine type ligand peptide (1-60) was also analyzed by amino acid analysis.
4) was confirmed.

Example 16 Pig-type ligand peptide (1
-30) Preparation of (SEQ ID NO: 43) 5 nmol of porcine ligand peptide (1-60) was 8
50 pmol of endoproteinase Glu-C (Boehringer Mannheim) in a reaction solution of 250 μl of 1% ammonium bicarbonate containing 5% acetonitrile at 37 ° C.
For 6 hours and then at 25 ° C. for 13 hours. The enzyme reaction solution was separated under the same conditions as in the case of the pig-type ligand peptide (1-34). The peak fraction eluted at 19.8 minutes gave M + H ⁺ 3167.2 by mass spectrometry, and amino acid analysis confirmed that it was a fragment ligand peptide (1-30) of the porcine ligand peptide (1-60).

Example 17 Galanin Receptor Binding Experiment Using [ ¹²⁵ I] Rat Galanin The membrane fraction prepared in the above (1-2) was used at a concentration of 13 μg / ml.
(For GALR1 membrane fraction) or 15 μg / ml (for GALR2 membrane fraction), 0.1% bovine serum albumin (BSA),
5 mM MgCl ₂ , 0.5 mM phenylmethylsulfonyl fluoride, 20 μg / ml leupeptin, 10 μg / ml pepstatin, 8 50 mM Tris buffer containing μg / ml _E-64 (pH 7.
3), and add 0.1 ml each to a small polypropylene test tube (F
alcon 2053). Add 5 nM [ ¹²⁵
I] Rat galanin (New England Nuclear) (4 μl) and a variable concentration (100 μM to 100 pM dimethyl sulfoxide solution) of the peptide synthetic product of the present invention (porcine ligand peptide (1-60) (SEQ ID NO: 31)) , A limited digest of the peptide synthesis product of the present invention (porcine ligand peptide (1-3)
0) (SEQ ID NO: 43), porcine ligand peptide (1
-34) (SEQ ID NO: 11) or rat galanin
(Peptide Research Laboratories) (SEQ ID NO: 61) 1 μl was added and reacted at 25 ° C. for 60 minutes. Add 1.5 ml of 0.05 to the reaction solution.
% 3-[(3-cholamidopropyl) dimethylammonio] propanesulfonic acid (CHAPS), 0.1% BSA, 5 mM MgCl ₂ , 1
50 mM Tris buffer (pH 7.4) containing mM EDTA was added, and GF /
The solution was filtered through F glass fiber filter paper (manufactured by Whatman). After washing the filter paper with 1.5 ml of the same buffer, the radioactivity was measured with a gamma counter. The amount of binding obtained when 1 μl of 100 μM rat galanin was added was the nonspecific binding amount (NSB), and the amount of binding obtained when 1 μl of dimethyl sulfoxide was added was the maximum binding amount (B ₀ )), And the concentration IC ₅₀ of the peptide that inhibits the maximum specific binding amount (B ₀ -NSB) to 50% was determined (Table 4).

[Table 4] Example 18 Cloning of cDNA Encoding Rat Ligand Peptide (1-60) TRIZ was prepared from rat hypothalamus by the same method as in Example 5.
Total RNA was prepared using OL reagent (Gibco BRL). An oligo dT cellulose column (mRNA
Purification Kit, Pharmacia) using poly (A) ⁺ R
NA was purified. ZAP-cDNA Gigapack from the poly (A) ⁺ RNA
Using a III Gold cloning kit (Stratagene), a rat hypothalamus cDNA phage library was prepared. After infecting the obtained phage (2,200,000 plaque forming units) with Escherichia coli XL1-Blue MRF '(Stratagene), N
The ZY medium was spread on 130 agar plates and cultured at 37 ° C. for 8 hours. Phage from the obtained E. coli plaques were Hybond N ⁺
Photographed on nylon membrane (Amersham). This nylon membrane contains 1.5 M sodium chloride.
It was immersed in 5 N sodium hydroxide solution, 0.5 M Tris buffer solution (pH 7.0) containing 1.5 M sodium chloride, and 2 × SSC solution in order, and then air-dried. The obtained nylon membrane is mixed with a hybridization buffer (5x SSPE, 5xDenhard
ts solution, 0.1% SDS, 0.1 mg / ml salmon sperm DNA) at 60 ° C
The mixture was incubated for 4 hours, and then kept at 60 ° C. for 18 hours in a hybridization buffer (ibid.) Containing a hybridization probe (2.8 × 10 ⁶ cpm / ml). The hybridization probe was EcoRI / B of plasmid pGR2PL6.
A DNA fragment amplified by the following primers pGAL1-1F and pGAL88-1R using the glII digestion fragment (SEQ ID NO: 45) as a template
(356 base pairs). The reaction solution composition for the amplification reaction is ExTaq
(Takara Shuzo Co., Ltd.) 0.5 μl, 10x PCR buffer (500
mM KCl-25 mM MgCl ₂ -100 mM Tris-HCl, pH 8.3)
μl, 8 μl of 2.5 mM dNTP mixture, [α- ³² P] dCTP (600
0 Ci / mmol), primers pGAL9-3F and pGAL34
1 μl each of -8R (10 μM each) and 1 μl of template cDNA
μl and 54 μl of distilled water.
After the initial denaturation at 30 ° C for 30 seconds, a cycle reaction of 94 ° C for 20 seconds to -60 ° C for 30 seconds to 72 ° C for 30 seconds was performed 32 times, and a final extension reaction at 72 ° C for 4 minutes was performed. pGAL1-1F: 5'-ATGGCTCTGACTGTCCCTCTGATCGTTCT-3 '(SEQ ID NO: 46) pGAL88-1R: 5'-TGAAACCTCGTAGTTCCTGGTCGGATTCG-3' (SEQ ID NO: 47) The nylon membrane after hybridization is 2x SSC buffer containing 0.1% SDS. After washing with the solution at 50 ° C., the plate was subjected to autoradiography using an X-ray film (Kodak, BioMax MS) in the presence of an intensifying screen (exposure conditions: −70 ° C., 3 days). Extract the positive plaques revealed from the autoradiography results,
SM buffer containing 0.1 ml of chloroform (100 mM NaCl, 8
mM MgSO ₄ , 0.01% gelatin, 50 mM Tris ・ HCl, pH 7.5)
Phage was extracted in 5 ml. The obtained phage was infected again with Escherichia coli XL1-Blue MRF ', spread on an NZY medium agar plate, and cultured at 37 ° C. for 8 hours. The phage was copied from the obtained E. coli plaque onto a nylon membrane (Amersham, Hybond N ⁺ ) and hybridized in the same manner as described above. A single positive clone was selected by autoradiography and extracted with a capillary. The same series of operations was repeated once again to obtain a completely single phage clone. Next, a plasmid was isolated from the cloned phage by the following method. Transfer the phage solution (1 μl) to E. coli XPORT (50 μl), helper phage (10 μl),
Mix with LOLR (5 ml) and spread on NZY agar plate, 37
Cultured at 8 ° C for 8 hours. A small colony of Escherichia coli XLOLR generated in an Escherichia coli XPORT plaque was picked up with a toothpick and cultured overnight at 37 ° C. on an LB medium agar plate containing ampicillin and tetracycline. Escherichia coli XLOLR was picked up from a single colony and liquid-cultured in LB medium. After completion of the culture, Escherichia coli XLOLR was collected, and the plasmid was purified using a plasmid purification kit (Qiagen, QIAgen 8Well Ultra). Dy
e terminator Cycle Sequencing Kit (Applied Biosyst
ems, PerkinElmer), and the sequencing reaction was followed by DNA sequencing.
The analysis was performed using encer Prism 377 (Applied Biosystems, PerkinElmer). As a result, a 974 bp DN encoding the rat ligand full-length peptide (1-60)
PGR2RL4 having the A fragment (SEQ ID NO: 39) was obtained. Escherichia coli TOP10 transformed with the plasmid was named TOP10 / pGR2RL4.

Example 19 The human ligand peptide (1
-60) Cloning from human brain poly (A) ⁺ RNA (CLONTECH), ZAP-cDNA Synth
A human brain cDNA library was prepared using esis Kit (Stratagene). PCR was performed using the obtained cDNA as a template and primers F / R120 and R / R120. F / R120: 5'-AGGCTGGACCCTCAATAGTGCTGGTTAC-3 '(SEQ ID NO: 48) R / R120: 5'-CCATCTATGGCCTTCCACAGGTCTAGGA-3' (SEQ ID NO: 49) Taq (Takara Shuzo Co., Ltd.) attached with 0.5 μl of PCR reaction solution of
10x PCR buffer (500 mM KCl-25 mM MgCl ₂ -100 mM Tris
HCl, pH 8.3) 5 μl, 2.5 mM dNTP mixture 4 μl, 25
3 μl of mM MgCl ₂ with primers F / R120 and R / R120
(100 μM each), 0.25 ml each, and 1 template cDNA
μl and 36 μl of distilled water.
After the initial denaturation at 30 ° C for 30 seconds, a cycle reaction of 94 ° C for 30 seconds to -60 ° C for 30 seconds to 72 ° C for 60 seconds was performed 35 times, and a final extension reaction at 72 ° C for 10 minutes was performed. The obtained DNA fragment is used in TOPO TACloning Kit (Inv
Itrogen was cloned according to the method described in the attached manual. The cloned DNA sequence was decoded by the method described in Example 5 to obtain the sequence of SEQ ID NO: 50. AGGCTGGACC CTCAATAGTG CTGGTTACCT TCTGGGTCCC GTCCTCCACC TTCCCCAAAT 60 GGGTGACCAA GACGGAAAGA GGGAGACAGC CCTTGAGATC CTAGACCTGT GGAAGGCCAT 120 AGATGG 126 (SEQ ID NO: 50) Primer 1F / H120 from the obtained sequence
(SEQ ID NO: 51) and 1R / H120 (SEQ ID NO: 52) were prepared and used in the 5′RACE and 3′RACE experiments described below. 1F / H120: 5'-CAAATGGGTGACCAAGACGGAAAGAGGG-3 '(SEQ ID NO: 51) 1R / H120: 5'-GGTCTAGGATCTCAAGGGCTGTCTCCCT-3' (SEQ ID NO: 52) PCR reaction solution of 5'RACE and 3'RACE was Taq (Takara Shuzo Co., Ltd.) Company)
0.5 μl, attached 10x PCR buffer (500 mM KCl-25 mM MgC
_{l 2 -100 mM Tris · HCl,} pH 8.3) and 5 μl, 2.5 mM dNTP m
4 μl of ixture, 3 μl of 25 mM MgCl ₂ , 10 μM primer F / R120 (for 3'RACE) or 10 μM primer R / R1
20 ml (for 5'RACE), 1 ml, 10 μM primer AP1 (primer AP1 attached to CLONTECH's Marathon-Ready cDNA Kit), 1 μl, template cDNA (CLONTECH, Marathon-
Ready cDNA Kit, Human Hypothalamus) and 5 μl of distilled water were mixed. The reaction conditions are 94 ° C and 6
After initial denaturation of 0 seconds, 5 cycles of 94 ° C / 30 seconds-72 ° C / 120 seconds, 5 cycles of 94 ° C / 30 seconds-70 ° C / 120 seconds,
25 cycles of 94 ° C / 30 seconds-68 ° C / 120 seconds cycle reaction and 68 ° C
-The final extension reaction was 10 minutes. Subsequently, nested PCR was performed using the reaction solution of the PCR reaction as a template. The reaction solution was 0.5 μl of Taq (Takara Shuzo Co., Ltd.) and the attached 10x PCR buffer (500 m
M KCl-25 mM MgCl ₂ -100 mM Tris-HCl, pH 8.3)
l, 2.5 μm dNTP mixture 4 μl, 25 mM MgCl ₂ 3 μl
l, 10 μM primer 1F / H120 (for 3'RACE) or 10
1 μl of μM primer 1R / H120 (for 5'RACE), 10 μl
M Primer AP2 (Primer AP2 is CLONTECH's Maratho
1 μl of the template DNA (provided with the n-Ready cDNA Kit)
5 μl of a PCR reaction solution (50-fold dilution) and 31 μl of distilled water were mixed. The reaction conditions were as follows: after initial denaturation at 94 ° C for 60 seconds, 5 cycles of 94 ° C for 30 seconds to 72 ° C for 120 seconds, 94 ° C
5 cycles of 30 second-70 ° C / 120 second cycle, 94 ° C / 30 second-68 ° C
・ A cycle reaction of 120 seconds was performed 25 times and a final extension reaction was performed at 68 ° C. for 10 minutes. Transfer the obtained DNA fragment to TOPO TA Cloning Kit
(Invitrogen) according to the method described in the attached manual. Cloned
The DNA sequence was decoded by the method described in Example 5 (Section of porcine cDNA cloning) to obtain sequence information at the 5 'end and 3' end. Based on this sequence information, primers 1F / H470 and 1R / H450 were prepared. 1F / H470: 5'-GAGGAGCCAGAGAGAGCTGCGGAGAG-3 '(SEQ ID NO: 53) 1R / H470: 5'-GAGCTGGAGAAGAAGGATAGGAACAGGG-3' (SEQ ID NO: 54) Primer F / H using the human brain cDNA library as a template
PCR was performed using 450 and R / H450. PCR reaction solution is Pfu t
0.5 μl of urbo DNA polymerase (Stratagene)
10x PCR buffer (500 mM KCl-25 mM MgCl ₂ -100 mM Tris
・ HCl, pH 8.3) 5 μl, 2.5 mM dNTP mixture 4 μl
1, 10 μM primers F / H470 and R / H470, 2.5 ml each, template human whole brain cDNA 0.5 μl, and distilled water 35 μl were prepared. The reaction conditions were as follows:
35 cycles of 5 minutes at 30 ° C for 30 seconds and 70 ° C for 1 minute.
The final extension reaction was 0 minutes. The obtained DNA fragment is pPCR-Scr
Cloning was performed using ipt Amp SK ( ⁺ ) vector (Stratagene) according to the method described in the attached manual. The cloned DNA sequence was prepared in Example 5 (porcine cDNA c
loning section), and 473 bp of human ligand full length peptide (1-60) encoding
PGR2HL14 having a DNA fragment (SEQ ID NO: 40) was obtained. Escherichia coli TOP10 transformed with the plasmid was named TOP10 / pGR2HL14.

Example 20 Pig-type ligand peptide (1
Preparation of Structural Gene of (-60) (see FIG. 10) The structural gene of the peptide (1-60) of the present invention is obtained by cutting the NdeI cleavage site adjacent to the upstream of the structural gene from the plasmid pGR2PL6 obtained in Example 5. And a primer having methionine 1: 5'-AGCATATGGCTCCGGTCCACAGG-3 '(SEQ ID NO: 55, manufactured by Kikko Tech) and a primer 2: 5'-CTG having a stop codon and a BamHI cleavage site adjacent to the downstream.
Amplification was performed by PCR using GATCCTCAGGAGGCCAACTGAGAC-3 ′ (SEQ ID NO: 56, manufactured by Greiner Japan). This gene was ligated to the pCRII-TOPO vector using the TOPO TA Cloning Kit (manufactured by Invitrogen), and pCRII / G
Created AL. This plasmid was transformed into TOP10 One Shot competent cells, and X-gal (5-Bromo-4-Chloro-3-I
ndolyl-bD-Galactose) coated LB agar medium containing 50 μg / mL ampicillin (1% peptone, 0.5% yeast extract,
(0.5% sodium chloride, 2% agar), and cultured at 37 ° C. for 1 day. Transformants were selected using tetracycline resistance and β-galactosidase activity as indices. An LB medium containing 50 μg / mL ampicillin (1% peptone,
(0.5% yeast extract, 0.5% sodium chloride) overnight,
Plasmids were recovered using QIAprep8 Miniprep Kit (Qiagen). Primer 3: 5'-CAGCCCTCGGCA
TCCTGGACC-3 '(SEQ ID NO: 57 manufactured by Greiner Japan) and Primer 4: 5'-GGTCCAGGATGCCGAGGGCT
Site-directed mutagenesis (Quick Change, STRATAGE) using G-3 '(SEQ ID NO: 58, manufactured by Greiner Japan)
NE), the porcine ligand peptide of the present invention (1-
60) Ava I existing adjacent to BamH I in the structural gene
PCRII / GALdesBam from which the recognition site was deleted was created. Plasmid pig-type ligand peptide of the present invention (1-6)
0) The nucleotide sequence of the structural gene was confirmed using an Applied Biosystems model 377 DNA sequencer. 2 μg of pCRII / GALdesBam whose nucleotide sequence was confirmed
Cleavage with de I, T4 DNA polymerase (DNA Blunting Ki
t, manufactured by Takara Shuzo). Next, after digestion with EcoR V, 3% agarose gel electrophoresis was carried out, and an approximately 200 bp DN
Use the A fragment for QIAquick Gel Extraction Kit (Qiagen)
Extract with 25 μL of TE buffer (10 mM Tris-HCl (pH
8.0) and 1 mM EDTA).

Example 21 Pig-type ligand peptide (1
-60) Preparation of Expression Plasmid a) Preparation of fusion protein expression vector (see FIG. 11) FERM BP-6 from June 15, 1998 to the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH).
Escherichia coli M which has been deposited as 388 and deposited on June 25, 1997 with the Institute of Fermentation (IFO) as IFO 16100.
After cutting 1 μg of the plasmid pTB960-11 carried in M294 (DE3) / pTB960-11 with XbaI and AvaI
1% agarose gel electrophoresis was performed, and a DNA fragment of about 4.4 kbp was extracted using a QIAquick Gel Extraction Kit (Qiagen) and dissolved in 50 μL of TE buffer. hFGF mutein C
S23 structural gene deletion and Nde I
Both synthetic DNA (5′-CTAGACATATGCCAGCATTGC-3 ′ (SEQ ID NO: 59) and 5′-TCGGGCAATGCTGGCATATGT-3 ′ (SEQ ID NO: 60)) designed to insert a cleavage site and initiation codon are manufactured by Greiner Japan. 1) each
To 100 μL of a phosphorylation reaction solution [50 mM Tris-HCl (pH 7.6), 10
mM MgCl ₂ , 5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM EDTA, 1 mM ATP, 10 units T4 polynucleotide kinase (manufactured by Nippon Gene)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. went. After completion of the reaction, phenol / chloroform extraction and ethanol precipitation were performed.
The precipitate was dissolved in 50 μL of a TE buffer, and the solution was kept at 80 ° C. for 10 minutes, and then gradually cooled at room temperature for annealing. Xba I-
Ava I DNA fragment and annealing solution were obtained from Takara DNA Ligati
Ligation was performed using on Kit Ver2 (Takara Shuzo). That is, 3 μL of distilled water and 5 μL of Ligation I solution were added to 1 μL of the Xba I-Ava I DNA fragment and 1 μL of the annealing solution, and reacted at 16 ° C. for 30 minutes. This ligation solution 10
E. coli JM109 competent cell (Toyobo) using μL
Was transformed and seeded on an LB agar medium containing 10 μg / mL tetracycline, and the resulting tetracycline-resistant colonies were selected. This transformant was cultured overnight in LB medium,
Plasmids were prepared using QIAprep8 Miniprep Kit (Qiagen). After cutting this plasmid with Nde I, 1%
Agarose gel electrophoresis was performed to confirm that a Nde I cleavage site was newly generated, and the plasmid was designated as plasmid pTBNde. Next, 1 μg of plasmid pTBNde was digested with PstI, and T4
After blunt-ending with DNA polymerase (DNA Blunting Kit, Takara Shuzo), phenol / chloroform extraction and ethanol precipitation were performed. The obtained precipitate is diluted with 10 μL of TE buffer.
After digestion with NdeI, 3% agarose gel electrophoresis was performed, and a DNA fragment of about 470 bp was extracted with QIAquick Gel Extraction.
Extraction was performed using Kit (manufactured by Qiagen) and dissolved in 25 μL of TE buffer. Deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) from the Ministry of International Trade and Industry on November 24, 1998 as FERM BP-6582 and deposited with the Fermentation Research Institute (IFO) on October 27, 1998. The transformant Escherichia coli MM294 (D
E3) 1 μg of plasmid pTCII held in / pTCIId23-MPIF1 was digested with BsmI and PvuII, and then 1%
Perform agarose gel electrophoresis.
Extract using the IAquick Gel Extraction Kit and add 25 μL of T
Dissolved in E buffer. This DNA fragment was blunt-ended with T4 DNA polymerase using a DNA Blunting Kit, and then ligated. After the ligation solution is extracted with phenol / chloroform, ethanol precipitation is performed and TE buffer
Dissolved in 10 μL. This solution is cut with BamHI and T4 DNA
After blunting the ends with polymerase, further digestion with NdeI, 1% agarose gel electrophoresis, DNA of about 3.7 kbp
Extract the fragments using the QIAquick Gel Extraction Kit and
It was dissolved in 0 μL of TE buffer. Nde I-Blunt of about 470bp above
5 μL of the ligation solution I was added to 4 μL of the DNA fragment and 1 μL of the approximately 3.7 kbp Nde I-Blunt DNA fragment, and the mixture was reacted at 16 ° C. for 30 minutes. Escherichia coli JM109 competent cells (manufactured by Toyobo Co., Ltd.) were transformed with 10 μL of the ligation solution, seeded on an LB agar medium containing 10 μg / mL tetracycline, and the resulting tetracycline-resistant colonies were selected. After culturing this transformant in LB medium overnight, a plasmid was prepared using QIAprep8 Miniprep Kit, and the fusion protein expression vector pT was prepared.
FC. b) Construction of porcine ligand peptide (1-60) expression strain (see FIG. 12) 1 μg of fusion protein expression vector pTFC was digested with BamHI, and the ends were blunt-ended with T4 DNA polymerase (DNA Blunting Kit, manufactured by Takara Shuzo). After the gelation, 1% agarose gel electrophoresis was carried out, and a DNA fragment of about 4.2 kbp was subjected to QIAquick Gel Extraction.
It was extracted using on Kit (Qiagen) and dissolved in 50 μL of TE buffer. This fragment and the structural gene of the peptide of the present invention prepared in Example 20 were combined with Takara DNA Ligation Kit.
Ligation was performed using Ver2 (Takara Shuzo).
That is, 1 μL of a BamHI-cut blunting solution of pTFC and 4 μL of a structural gene solution of the peptide of the present invention were mixed, and 5 μL of Ligation I solution was added, followed by reaction at 16 ° C. for 30 minutes. E. coli JM109 competent cells (manufactured by Toyobo Co., Ltd.) were transformed with 10 μL of the ligation solution, seeded on an LB agar medium containing 10 μg / mL tetracycline, cultured at 37 ° C. for 1 day, and the resulting tetracycline-resistant colonies were isolated. Selected. This transformant was cultured overnight in an LB medium, and QIAprep8 Miniprep
The plasmid was recovered using Kit (manufactured by Qiagen), and was used as the peptide expression plasmid pTFCGAL of the present invention. The nucleotide sequence of the structural gene portion of the fusion protein of this plasmid is
Confirmation was performed using an Applied Biosystems model 377 DNA sequencer. This expression plasmid pTFCGA
L was transformed into E. coli MM294 (DE3), seeded on an LB agar medium containing 10 μg / mL tetracycline, cultured at 37 ° C. for 1 day, and a tetracycline-resistant transformant was selected, and the peptide expression strain of the present invention was selected. MM294 (DE3) / pTFCGAL was obtained.
This transformed E. coli MM294 (DE3) / pTFCGAL has the accession number FERM
BP-6678 was deposited on March 10, 1999 at the Research Institute of Microorganisms, Ministry of International Trade and Industry of Japan. It was deposited with the Fermentation Research Institute (IFO) under the accession number IFO 16260 on February 26, 1999.

Example 22 Pig-type ligand peptide (1
-60) Culture of expression strain MM294 (DE3) / peptide expression strain of the present invention obtained in Example 21
pTFCGAL was added to 1 L of LB medium containing 5 mg / L tetracycline.
The cells were shake-cultured at 16 ° C for 16 hours. The obtained culture solution is 20 L of main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride, 0.05% magnesium sulfate, 0.0005% thiamine hydrochloride, 1.5% % Glucose, 1.0% casamino acid, and 1.0% yeast extract) were transferred to a 50-L fermenter, and aeration-stirred culture was performed at 37 ° C., aeration rate of 20 L / min, and agitation speed of 200 rpm. When the turbidity of the culture reaches about 1200 klet units, isopropyl-β- is adjusted to a final concentration of 23.8 mg / L.
D-thiogalactopyranoside (IPTG) was added. IPTG
30 minutes and 150 minutes after the addition, 0.75% glucose was added, and the culture was performed until 10 hours after the start of the culture. 5000 rpm ・ 30m
In was centrifuged to obtain about 830 g of bacterial cells.

Example 23 Pig-type ligand peptide (1
Purification of -60) A 200 mM cell obtained in Example 22 contained 600 ml of 150 mM sodium chloride, 0.1 mM p-amidinophenylmethanesulfonyl fluoride hydrochloride (APMSF), and a 50 mM phosphate buffer solution (pH 7.0) containing 0.1 mM EDTA. 0), suspend, and sonicate (BRANSON S
ONIFIER MODEL450), then centrifuge (10,000 rpm ・ 10
Min), and the supernatant was discarded to obtain an inclusion body. This inclusion body was suspended in 60 mL of distilled water, and after adding and dissolving 140 mL of formic acid,
In order to perform a cleavage reaction at the C-terminal peptide bond of methionine linking the fusion protein CS23 and the porcine ligand peptide (1-60) of the present invention, 2 g of cyanogen bromide was added, followed by treatment at room temperature for 24 hours. went. After completion of the reaction, the solution was dialyzed overnight against distilled water and centrifuged (10,000 rpm, 10 minutes). After dialysis of the supernatant again against 50 mM Tris-HCl (pH 7.5) overnight,
Adjust to pH 6.0 with hydrochloric acid and centrifuge (10,000 rpm for 10 minutes)
Then, about 400 mL of the centrifuged supernatant was obtained. This supernatant is centrifuged at 50 mM
CM-TOYOPE equilibrated with sodium acetate buffer (pH 6.0)
After adsorbing to ARL 650M (3.0 cmID x 10 cmL, manufactured by Tosoh Corporation) at 10 mL / min, washing well with the buffer used for equilibration,
Elution was performed with a step gradient of 100% B (B = 50 mM sodium acetate buffer + 1 M sodium chloride, pH 6.0) to obtain a fraction containing the porcine ligand peptide (1-60) of the present invention. One-third of this fraction was equilibrated with 0.1% trifluoroacetic acid in C4P-50 (2.15 cmID × 30 cmL, manufactured by Showa Denko KK) at 5 mL / m
After adsorption by in, elution was performed with a step gradient of 33-43% B (B = 80% acetonitrile / 0.1% trifluoroacetic acid). The same operation is carried out for the remaining 2/3 amount. The fraction containing the porcine ligand peptide (1-60) of the present invention is collected and lyophilized to obtain the porcine ligand peptide (1-60) of the present invention. 67 mg of purified product was obtained. a) Analysis using SDS-polyacrylamide gel electrophoresis Purified product of the porcine ligand peptide (1-60) of the present invention
0.0625 Tris with 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.001% bromophenol blue
-HCl (pH6.8) [Laemmli, UK: Nature, 227, 680 (1
979)], boiled for 3 minutes, and electrophoresed on Multigel 15/25 (manufactured by Daiichi Kagaku). When the gel after electrophoresis was stained with Rapid CBB KANTO (Kanto Chemical), it was a single band (see FIG. 13). b) Amino acid composition analysis Purified product of the porcine ligand peptide (1-60) of the present invention
Perform gas phase hydrolysis with 6N hydrochloric acid containing 1% phenol at 110 ° C for 24 and 48 hours, and use an amino acid analyzer (Hitachi L-8500AAmino A
amino acid composition was determined using a cid Analyzer). As a result, as shown in Table 5, the results agreed with the amino acid composition predicted from the cDNA base sequence.

[Table 5] c) N-terminal amino acid sequence analysis The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems model 477A). As a result, as shown in Table 6, the amino acid composition was consistent with the amino acid composition predicted from the cDNA base sequence.

[Table 6] d) C-terminal amino acid analysis The purified porcine ligand peptide (1-60) of the present invention was subjected to gas-phase hydrolysis with anhydrous hydrazine at 100 ° C for 3.5 hours,
Amino acid analyzer (Hitachi L-8500A Amino Acid Analyzer)
Was used to determine the C-terminus. As a result, as shown in Table 7, the amino acids corresponded to the amino acids predicted from the cDNA base sequence.

[Table 7]

Example 24 Ingestion test Male Wistar rats (8 W) under pentobarbital anesthesia
A guide cannula was inserted into the third ventricle (AP: -7.1, L: 0.0, H: 2.0 mm). After the surgery, the rats were allowed to recover for one week before conducting a feeding experiment. The animals were bred at a light-dark cycle of 12 hours (light: 8:00 to 20:00), and the feeding experiment was started at 16:00. A microinjection cannula was attached to the rat without any anesthesia and without restraint, and the pig-type peptide (1-60) (SEQ ID NO: 31) or PBS alone dissolved in PBS was administered at 2.5 μl / min for 4 minutes. One minute after the end of the administration, the microinjection cannula was removed, and the rats were allowed to freely ingest the standard feed. The food consumed within 90 minutes from the end of the administration was weighed to determine the amount of food consumed (FIG. 14).

【The invention's effect】

The peptide of the present invention or its precursor or its amide or its ester or its salt has the ability to activate the galanin receptor. Therefore, it can be used for the development of a medicament such as a function regulator with few side effects in the hypothalamus, pituitary gland, uterus, kidney, prostate or skeletal muscle where the galanin receptor is distributed in large amounts. By using the peptide of the present invention or its precursor, its amide or its ester or its salt, it becomes possible to screen for a compound that changes the binding to the galanin receptor.

[0071]

[Sequence Listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Novel Physiological Active Peptide and its Use <130> A98030 <150> JP 10-078139 <151> 1998-03-25 <130> A98166 <150> JP 10-266972 <151> 1998-09-21 <160> 54 <210> 1 <211> 346 <212> PRT <213> Rat <400> 1 Met Glu Leu Ala Pro Val Asn Leu Ser Glu Gly Asn Gly Ser Asp Pro 1 5 10 15 Glu Pro Pro Ala Glu Pro Arg Pro Leu Phe Gly Ile Gly Val Glu Asn 20 25 30 Phe Ile Thr Leu Val Val Phe Gly Leu Ile Phe Ala Met Gly Val Leu 35 40 45 Gly Asn Ser Leu Val Ile Thr Val Leu Ala Arg Ser Lys Pro Gly Lys 50 55 60 Pro Arg Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Ser Ile Ala Asp 65 70 75 80 Leu Ala Tyr Leu Leu Phe Cys Ile Pro Phe Gln Ala Thr Val Tyr Ala 85 90 95 Leu Pro Thr Trp Val Leu Gly Ala Phe Ile Cys Lys Phe Ile His Tyr 100 105 110 Phe Phe Thr Val Ser Met Leu Val Ser Ile Phe Thr Leu Ala Ala Met 115 120 125 Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg Ser Ser Ser 130 135 140 Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Ph e Ile Trp Ala 145 150 155 160 Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr Tyr Gln Arg Leu Phe 165 170 175 His Arg Asp Ser Asn Gln Thr Phe Cys Trp Glu His Trp Pro Asn Gln 180 185 190 Leu His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe Gly Tyr Leu 195 200 205 Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val Leu Asn His 210 215 220 Leu His Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu Ala Ser Lys 225 230 235 240 Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val Phe Gly Ile 245 250 255 Ser Trp Leu Pro His His Val Ile His Leu Trp Ala Glu Phe Gly Ala 260 265 270 Phe Pro Leu Thr Pro Ala Ser Phe Phe Phe Arg Ile Thr Ala His Cys 275 280 285 Leu Ala Tyr Ser Asn Ser Ser Val Asn Pro Ile Ile Tyr Ala Phe Leu 290 295 300 Ser Glu Asn Phe Arg Lys Ala Tyr Lys Gln Val Phe Lys Cys Arg Val 305 310 315 320 Cys Asn Glu Ser Pro His Gly Asp Ala Lys Glu Lys Asn Arg Ile Asp 325 330 335 Thr Pro Pro Ser Thr Asn Cys Thr His Val 340 345 <210> 2 <211> 372 <212> PRT <213> Rat <400> 2 Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly 1 5 10 15 Gly Ser Gly Gly Trp Gln Pro Glu Ala Val Leu Val Pro Leu Phe Phe 20 25 30 Ala Leu Ile Phe Leu Val Gly Thr Val Gly Asn Ala Leu Val Leu Ala 35 40 45 Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile 50 55 60 Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro 65 70 75 80 Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu 85 90 95 Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser 100 105 110 Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg 115 120 125 Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala 130 135 140 Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr 145 150 155 160 Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His 165 170 175 Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe 180 185 190 Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ayr 195 200 205 Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Th r Ala Gly 210 215 220 Ser Gly Ser Gln Arg Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile 225 230 235 240 Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile 245 250 255 Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala 260 265 270 Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn 275 280 285 285 Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg 290 295 300 Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly 305 310 315 320 Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu 325 330 335 Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu 340 345 350 350 Val Pro Pro Pro Ala Leu Pro Asn Cys Thr Ala Ser Ser Arg Thr Leu 355 360 365 Asp Pro Ala Cys 370 <210> 3 <211> 370 <212> PRT <213> Rat <400> 3 Met Ala Asp Ile Gln Asn Ile Ser Leu Asp Ser Pro Gly Ser Val Gly 1 5 10 15 Ala Val Ala Val Pro Val Ile Phe Ala Leu Ile Phe Leu Leu Gly Met 20 25 30 Val Gly Asn Gly Leu Val Leu Ala Val Leu Leu Gln Pro Gly Pro Ser 35 40 45 Ala Trp Gln Glu Pro Ser Ser Thr Thr Asp Leu Phe Ile Leu Asn Leu 50 55 60 Ala Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala 65 70 75 80 Ala Ile Tyr Thr Leu Asp Ala Trp Leu Phe Gly Ala Phe Val Cys Lys 85 90 95 Thr Val His Leu Leu Ile Tyr Leu Thr Met Tyr Ala Ser Ser Phe Thr 100 105 110 Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Val Arg His Pro Leu 115 120 125 Arg Ser Arg Ala Leu Arg Thr Pro Arg Asn Ala Arg Ala Ala Val Gly 130 135 140 Leu Val Trp Leu Leu Ala Ala Leu Phe Ser Ala Pro Tyr Leu Ser Tyr 145 150 155 160 Tyr Gly Thr Val Arg Tyr Gly Ala Leu Glu Leu Cys Val Pro Ala Trp 165 170 175 Glu Asp Ala Arg Arg Arg Ala Leu Asp Val Ala Thr Phe Ala Ala Gly 180 185 190 Tyr Leu Leu Pro Val Ala Val Val Ser Leu Ala Tyr Gly Arg Thr Leu 195 200 205 Cys Phe Leu Trp Ala Ala Val Gly Pro Ala Gly Ala Ala Ala Ala Glu 210 215 220 Ala Arg Arg Arg Ala Thr Gly Arg Ala Gly Arg Ala Met Leu Ala Val 225 230 235 240 Ala Ala Leu Tyr Ala Leu Cys Trp Gly Pro His His Ala Leu Ile Leu 245 250 255 Cys Phe Tr p Tyr Gly Arg Phe Ala Phe Ser Pro Ala Thr Tyr Ala Cys 260 265 270 Arg Leu Ala Ser His Cys Leu Ala Tyr Ala Asn Ser Cys Leu Asn Pro 275 280 285 Leu Val Tyr Ser Leu Ala Ser Arg His Phe Arg Ala Arg Phe Arg Arg 290 295 300 Leu Trp Pro Cys Gly Arg Arg Arg His Arg His His His Arg Ala His 305 310 315 320 Arg Ala Leu Arg Arg Val Gln Pro Ala Ser Ser Gly Pro Ala Gly Tyr 325 330 335 Pro Gly Asp Ala Arg Pro Arg Gly Trp Ser Met Glu Pro Arg Gly Asp 340 345 350 Ala Leu Arg Gly Gly Gly Glu Thr Arg Leu Thr Leu Ser Pro Arg Gly 355 360 365 Pro Gln 370 <210> 4 <211> 1041 <212> DNA <213> Rat <400> 4 ATGGAACTGG CTCCGGTGAA CCTCAGTGAA GGGAATGGGA GCGACCCTGA ACCTCCAGCG 60 GAACCCAGGC CGCTCTTCGG CATCGGCGTG GAGAACTTCA TCACGCTGGT GGTGTTTGGC 120 CTTATTTTCG CGATGGGCGT GCTGGGCAAC AGCCTGGTGA TCACCGTGCT GGCGCGCAGC 180 AAACCGGGCA AGCCGCGCAG CACCACCAAC CTGTTCATCC TCAACCTGAG CATCGCAGAC 240 CTGGCCTACC TGCTCTTCTG CATCCCTTTC CAGGCCACCG TGTACGCACT GCCCACCTGG 300 GTGCTGGGCG CCTTCATCTG CAAGTTTATA CACTACTTCT TCACCGTGTC CATGCTCGTG 360 AGCATCTTCA CCCTGGCCGC GATGTCTGTG GATCGCTATG TGGCCATTGT GCATTCACGG 420 CGCTCCTCCT CCCTCAGGGT GTCCCGCAAC GCGCTGCTGG GCGTGGGCTT CATCTGGGCG 480 CTGTCCATCG CTATGGCCTC GCCGGTGGCC TACTACCAGC GCCTTTTTCA TCGGGACAGC 540 AACCAAACCT TCTGCTGGGA GCACTGGCCC AACCAACTCC ACAAGAAGGC TTACGTGGTG 600 TGCACTTTCG TCTTTGGTTA CCTTCTGCCC TTACTGCTCA TCTGCTTTTG CTATGCCAAG 660 GTTCTCAATC ATCTGCATAA AAAGTTGAAG AACATGTCAA AAAAGTCAGA GGCATCCAAG 720 AAAAAGACTG CACAGACTGT CCTGGTGGTC GTTGTGGTAT TTGGCATATC ATGGCTGCCC 780 CATCATGTCA TCCACCTCTG GGCTGAGTTC GGAGCATTCC CGCTGACCCC AGCTTCCTTC 840 TTCTTCAGAA TCACTGCCCA CTGCCTGGCA TACAGCAACT CCTCGGTGAA CCCCATCATC 900 TACGCCTTTC TCTCAGAAAA CTTCCGGAAG GCGTACAAGC AAGTGTTCAA GTGCCGTGTT 960 TGCAATGAGT CGCCGCACGG CGATGCTAAA GAAAAGAACC GAATAGATAC CCCGCCCTCC 1020 ACCAACTGCA CCCACGTGTG A 1041 <210> 5 <211> 1119 <212> DNA <213> Rat <400 > 5 ATGAATGGCT CCGGCAGCCA GGGCGCGGAG AACACGAGCC AGGAAGGCGG TAGCGGCGGC 60 TGGCAGCCTG AGGCGGTCCT TGTACCCCTA TTTTTCGCGC TCATCTTCCT CGTGGGCACC 120 GTGGGCAACG CGCTGGTGCT GGCGGTGCTG CTGCGCGGCG GCCAGGCGGT CAGCACCACC 180 AACCTGTTCA TCCTCAACCT GGGCGTGGCC GACCTGTGTT TCATCCTGTG CTGCGTGCCT 240 TTCCAGGCCA CCATCTACAC CCTGGACGAC TGGGTGTTCG GCTCGCTGCT CTGCAAGGCT 300 GTTCATTTCC TCATCTTTCT CACTATGCAC GCCAGCAGCT TCACGCTGGC CGCCGTCTCC 360 CTGGACAGGT ATCTGGCCAT CCGCTACCCG CTGCACTCCC GAGAGTTGCG CACACCTCGA 420 AACGCGCTGG CCGCCATCGG GCTCATCTGG GGGCTAGCAC TGCTCTTCTC CGGGCCCTAC 480 CTGAGCTACT ACCGTCAGTC GCAGCTGGCC AACCTGACAG TATGCCACCC AGCATGGAGC 540 GCACCTCGAC GTCGAGCCAT GGACCTCTGC ACCTTCGTCT TTAGCTACCT GCTGCCAGTG 600 CTAGTCCTCA GTCTGACCTA TGCGCGTACC CTGCGCTACC TCTGGCGCAC AGTCGACCCG 660 GTGACTGCAG GCTCAGGTTC CCAGCGCGCC AAACGCAAGG TGACACGGAT GATCATCATC 720 GTGGCGGTGC TTTTCTGCCT CTGTTGGATG CCCCACCACG CGCTTATCCT CTGCGTGTGG 780 TTTGGTCGCT TCCCGCTCAC GCGTGCCACT TACGCGTTGC GCATCCTTTC ACACCTAGTT 840 TCCTATGCCA ACTCCTGTGT CAACCCCATC GTTTACGCTC TGGTCTCCAA GCATTTCCGT 900 AAAGGTTTCC GCAAAATCTG CGCGGGCCTG CTGCGCCCTG CCCCGAGGCG AGCTTCGGGC 960 CGAGTGAGCA TCCTGGCGCC TGGGAACC AT AGTGGCAGCA TGCTGGAACA GGAATCCACA 1020 GACCTGACAC AGGTGAGCGA GGCAGCCGGG CCCCTTGTCC CACCACCCGC ACTTCCCAAC 1080 TGCACAGCCT CGAGTAGAAC CCTGGATCCG GCTTGTTAA 1119 <210> 6 <211> 1113 <212> DNA <213> Rat <400> 6 ATGGCTGACA TCCAGAACAT TTCGCTGGAC AGCCCAGGGA GCGTAGGGGC TGTGGCAGTG 60 CCTGTGATCT TTGCCCTCAT CTTCCTGTTG GGCATGGTGG GCAATGGGCT GGTGTTGGCT 120 GTGCTACTGC AGCCTGGCCC AAGTGCCTGG CAGGAGCCAA GCAGTACCAC AGATCTCTTC 180 ATCCTCAACT TGGCCGTGGC CGACCTTTGC TTCATCCTGT GCTGCGTGCC CTTCCAGGCA 240 GCCATCTACA CACTGGATGC CTGGCTCTTT GGGGCTTTCG TGTGCAAGAC GGTACATCTG 300 CTCATCTACC TCACCATGTA TGCCAGCAGC TTCACCCTGG CGGCCGTCTC CCTGGACAGG 360 TACCTGGCTG TGCGGCACCC ACTGCGCTCC AGAGCCCTGC GCACCCCGCG CAACGCGCGC 420 GCCGCCGTGG GGCTCGTGTG GCTGCTGGCG GCTCTCTTTT CCGCGCCCTA CCTAAGCTAT 480 TACGGCACGG TGCGCTACGG CGCGCTCGAG CTCTGCGTGC CCGCTTGGGA GGACGCGCGG 540 CGGCGCGCGC TGGACGTGGC CACCTTCGCC GCGGGCGCC TGCTGCCGGT GGCCGTGGTG 600 AGCCTGGCCT ACGGACGCAC GCTATGTTTC CTATGGGCCG CCGTGGGTCC CGCGGGCGCG 660 GCGGCAGCAG AGGCGCGCAG AC GGGCGACC GGCCGGGCGG GACGCGCCAT GCTGGCAGTG 720 GCCGCGCTCT ACGCGCTTTG CTGGGGCCCG CACCACGCGC TCATCCTCTG CTTCTGGTAC 780 GGCCGCTTCG CCTTCAGCCC GGCCACCTAC GCCTGTCGCC TGGCCTCGCA CTGCCTCGCC 840 TACGCCAACT CCTGCCTTAA CCCGCTCGTC TACTCGCTCG CCTCGCGCCA CTTCCGCGCG 900 CGCTTCCGCC GCCTGTGGCC CTGCGGCCGT CGCCGCCACC GCCACCACCA CCGCGCTCAT 960 CGAGCCCTCC GTCGTGTCCA GCCGGCGTCT TCGGGCCCCG CCGGTTATCC CGGCGACGCC 1020 AGGCCTCGTG GTTGGAGTAT GGAGCCCAGA GGGGATGCTC TGCGTGGTGG TGGAGAGACT 1080 AGACTAACCC TGTCCCCCAG GGGACCTCAA TAA 1113 <210> 7 <211> 29 <212> PRT <213> Porcine <400> 7 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile 1 5 10 15 Asp Asn His Arg Ser Phe His Asp Lys Tyr Gly Leu Ala 20 25 <210> 8 <211> 123 <212> PRT <213> Porcine <400> 8 Met Pro Arg Gly Cys Ala Leu Leu Leu Ala Ser Leu Leu Leu Ala Ser 1 5 10 15 Ala Leu Ser Ala Thr Leu Gly Leu Gly Ser Pro Val Lys Glu Lys Arg 20 25 30 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile 35 40 45 Asp Asn His Arg Ser Phe His Asp Lys Tyr Gly Leu Ala Gly Lys Arg 50 55 60 Glu Leu Glu Pro Glu Asp Glu Ala Arg Pro Gly Gly Phe Asp Arg Leu 65 70 75 80 Gln Ser Glu Asp Lys Ala Ile Arg Thr Ile Met Glu Phe Leu Ala Phe 85 90 95 Leu His Leu Lys Glu Ala Gly Ala Leu Gly Arg Leu Pro Gly Leu Pro 100 105 110 Ser Ala Ala Ser Ser Glu Asp Ala Gly Gln Ser 115 120 <210> 9 <211> 38 <212> PRT <213> Porcine <400> 9 Leu Gly Ser Pro Val Lys Glu Lys Arg Gly Trp Thr Leu Asn Ser Ala 1 5 10 15 Gly Tyr Leu Leu Gly Pro His Ala Ile Asp Asn His Arg Ser Phe His 20 25 30 Asp Lys Tyr Gly Leu Ala 35 <210> 10 <211> 25 <212> PRT <213> Porcine <400> 10 Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile Asp Asn His Arg 1 5 10 15 Ser Phe His Asp Lys Tyr Gly Leu Ala 20 25 <210> 11 <211> 34 <212> PRT <213> Porcine <400> 11 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 Gly Lys <210> 12 <211> 32 <212> PRT <213> Porcine <400> 12 Ala Pro Val His Arg Gly Arg Gly Gly Trp Th r Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 <210> 13 <211> 9 <212> PRT <213> Porcine <400> 13 Ala Pro Val His Arg Gly Arg Gly Gly 1 5 <210> 14 <211> 6 <212> PRT <213> Porcine <400> 14 Thr Leu Asn Ser Ala Gly 1 5 <210> 15 <211> 27 <212> PRT <213> Porcine <400> 15 Leu Leu Gly Pro Val Leu His Pro Pro Ser Xaa Ala Glu Gly Gly Gly 1 5 10 15 Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu 20 25 <210> 16 <211> 11 < 212> PRT <213> Porcine <400> 16 Xaa Ala Ile Asp Gly Leu Pro Tyr Pro Gln Ser 1 5 10 <210> 17 <211> 44 <212> PRT <213> Porcine <400> 17 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro ser Xaa Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu 35 40 <210 > 18 <211> 27 <212> DNA <213> Artifical Sequence <220> <223> <400> 18 GTCGACATGA ATGGCTCCGG CAGCCAG 27 <210> 19 <211> 32 <212> DNA <213> Artifical Sequence <220> < 223> <400> 19 ACTAGTTTAA CAAGCC GGAT CCAGGGTTCT AC 32 <210> 20 <211> 23 <212> DNA <213> Artifical Sequence <220> <223> <400> 20 CAYMGNGGIM GNGGIGGSTG GAC 23 <210> 21 <211> 20 <212> DNA <213> Artifical Sequence <220> <223> <400> 21 GGHTGGACNC TNAAYAGYGC 20 <210> 22 <211> 23 <212> DNA <213> Artifical Sequence <220> <223> <400> 22 ATICCNAGIG CNGTYTTICC YTT 23 <210> 23 <211> 98 <212> DNA <213> Porcine <400> 23 GGCTGGACTT TAAATAGTGC TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG 60 GCTGAAGGAG GCGGGAAGGG CAAAACAGCC CTGGGCAT 98 <210> 24 <211> 98 <212> DNA <213> Porcine <400> 24 GGTTGGCT TGGTTACCTC CTGGGTCCCG TACTCCATCC GCCCTCCAGG 60 GCTGAAGGAG GCGGGAAGGG CAAAACCGCC CTAGGCAT 98 <210> 25 <211> 20 <212> DNA <213> Artifical Sequence <220> <223> <400> 25 GGHTGGACNC TNAAYAGYGC 20 <210> 26 <211> 23 <212 > DNA <213> Artifical Sequence <220> <223> <400> 26 ATDCCBAGGG CDGTTTTGCC CTT 23 <210> 27 <211> 974 <212> DNA <213> Porcine <400> 27 TTCAGCCTCA AGCACCCATC CCTCCAGCCC TCAGATGGCT CTGACTGTCC CTCTGATCGT 60 TCTTGCAGTC CTGCTGCGC C TGATGGAGTC TCCAGCCTCT GCTCCGGTCC ACAGGGGGCG 120 AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT CCCGTACTCC ATCCGCCCTC 180 CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGG ATCCTGGACC TGTGGAAGGC 240 CATTGATGGG CTCCCCTATC CCCAGTCTCA GTTGGCCTCC AAGAGGAGTC TGGGGGAGAC 300 TTTCGCCAAA CCAGACTCTG GAGTAACATT TGTTGGAGTT CCTGACGTGG TGCCGTGGAA 360 ACGAATCCGA CCAGGAACTA CGAGGTTTCA GATCTAGGCA AGCTCTGCAA GAACGTTCCA 420 AAGGAGAAAG ATGCCTTGCC GTCATATATG CCTCCAAACT TCCGCTCCAA ACTTCCCCCC 480 CGTCTCCAGA TCCTCCTGAA ACCCTAGGTA GACACCCTCT ACTGAGACTG GGAGCCTGAA 540 AGTAAATCCC CAAATCCCAG GTAGAAAATG GGGAGCATTT GAAGAATTAT TCTCAAAAGT 600 CCCCGGACTG TGCCAGGTTT CACTGATCCC CCCCTCCCCC TTGGACTAAG TGTAAAGCGA 660 TGTAAACCAA CTCAAGAATA ATTCTGAAAC CATTCAGGAG ATCCGGAGAG GAATCGGGAA 720 ATACTCCTGC AGTGCATTTA AAGTAACTGG GTCCTATGCA ACATGAGCCA TTGGATCATA 780 CAATATTGAT ATCCCTTCTA ACACGGAGGT TCTAGGGTGT CTCAGCTGGA AAAGATTCTT 840 CAGAGTAGCA TGCTTGCCTT ACCCCATCCT TCTCACCCCA CCCCGAGCCT CCTCCAGCAG 900 AAAGGACGAG AGGCCATCTG GAGCAGAGCA GAGAGAA TAA ATATTCCCTT TCAAAGAAAA 960 AAAAAAAAAA AAAA 974 <210> 28 <211> 1007 <212> DNA <213> Porcine <400> 28 GGAACGAGCT GGGGAGAGCT GCCGACTGCA GGCAGCCTTC TTCAGCCTCA AGCACCCATC 60 CCTCCAGCCC TCAGATGGCT CTGACTGTCC CTCTGATCGT TCTTGCAGTC CTGCTCAGCC 120 TGATGGAGTC TCCAGCCTCT GCTCCGGTCC ACAGGGGGCG AGGAGGCTGG ACCCTCAACA 180 GTGCTGGTTA CCTCCTGGGT CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA 240 AGGGGAAGAC AGCCCTCGGG ATCCTGGACC TGTGGAAGGC CATTGATGGG CTCCCCTATC 300 CCCAGTCTCA GTTGGCCTCC AAGAGGAGTC TGGGGAGACT TTCGCCAAAC CAGACTCTGG 360 AGTAACATTT GTTGGAGTTC CTGACGTGGT GCCGTGGAAA CGAATCCGAC CAGGAACTAC 420 GAGGTTTCAG ATCTAGGCAA GCTCTGCAAG AACGTTCCAA AGGAGAAAGA TGCCTTGtCG 480 TCATATATGC CTCCAAACTT CCGCTCCAAA CTTCCCCCCC GTCcCCAGAT CCTCCTGAAA 540 CCCTAGGTAG ACACCCTCTA CTGAGACTGG GAGCCTGAAA GTAAATCCCC AAATCCCAGG 600 TAGAAAATGG GGAGCATTTG AAGAATTATT CTCAAAAGTC CCCGGACTGT GCCAGGTTTC 660 ACTGATCCCC CCCcCCCccc tCCTTGGACT AAGTGTAAAG CGATGTAAAC CAACTCAAGA 720 ATAATTCTGA AACCATTCAG GAGATCCGGA GAGGAATCGG GAAATACTCC TG CAGTGCAT 780 TTAAAGTAAC TGGGTCCTAT GCAACATGAG CCATTGGATC ATACAATATT GATATCCCTT 840 CTAACACGGA GGTTCTAGGG TGTCTCAGCT GGAAAAGATT CTTCAGAGTA GCATGCTTGC 900 CTTACCCCAT CCTTCTCACC CCACCCCGAG CCTCCTCCAG CAGAAAGGAC GAGAGGCCAT 960 CTGGAGCAGA GCAGAGAGAA TAAATATTCC CTTTCAAAGA AAAAAAA 1007 <210> 29 <211> 120 <212> PRT <213> Porcine <400> 29 Met Ala Leu Thr Val Pro Leu Ile Val Leu Ala Val Leu Leu Ser Leu 1 5 10 15 Met Glu Ser Pro Ala Ser Ala Pro Val His Arg Gly Arg Gly Gly Trp 20 25 30 Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro Val Leu His Pro Pro 35 40 45 Ser Arg Ala Glu Gly Gly Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu 50 55 60 Asp Leu Trp Lys Ala Ile Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu 65 70 75 80 Ala Ser Lys Arg Ser Leu Gly Glu Thr Phe Ala Lys Pro Asp Ser Gly 85 90 95 Val Thr Phe Val Gly Val Pro Asp Val Val Pro Trp Lys Arg Ile Arg 100 105 110 Pro Gly Thr Thr Arg Phe Gln Ile 115 120 <210> 30 <211 > 96 <212> PRT <213> Porcine <400> 30 Met Ala Leu Thr Val Pro Leu Ile Val Leu Ala Val Leu Leu Ser Leu 1 5 10 15 Met Glu Ser Pro Ala Ser Ala Pro Val His Arg Gly Arg Gly Gly Trp 20 25 30 Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro Val Leu His Pro Pro 35 40 45 Ser Arg Ala Glu Gly Gly Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu 50 55 60 Asp Leu Trp Lys Ala Ile Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu 65 70 75 80 Ala Ser Lys Arg Ser Leu Gly Arg Leu Ser Pro Asn Gln Thr Leu Glu 85 90 95 <210> 31 <211> 60 <212> PRT <213> Porcine <400> 31 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu Ala Ser 50 55 60 <210> 32 <211 > 180 <212> DNA <213> Porcine <400> 32 GCTCCGGTCC ACAGGGGGCG AGGAGGCTGG ACCCTCAACA GTGCTGGTTA CCTCCTGGGT 60 CCCGTACTCC ATCCGCCCTC CAGGGCTGAA GGAGGCGGGA AGGGGAAGAC AGCCCTCGGG 120 ATCCTGGACC <TGTGGAAGGC CATTGATGGCCTCCTAGT> TCTGTCCCTCTCGTGT120 <213> Rat <400> 33 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Ser Ser Lys Ala Asn Gln Gly 20 25 30 Arg Lys Thr Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser Arg Ser Pro Arg Met Thr 50 55 60 <210> 34 <211> 60 <212> PRT <213> Human <400> 34 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Pro Gln Met Gly Asp Gln Asp 20 25 30 Gly Lys Arg Glu Thr Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser His Pro Pro Gln Pro Ser 50 55 60 <210> 35 <211> 9 <212> PRT <213> Human, Rat <400> 35 Ala Pro Ala His Arg Gly Arg Gly Gly 1 5 <210> 36 <211> 21 <212> PRT <213> Human, Rat <400> 36 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro 20 <210> 37 <211> 123 <212> PRT <213> Rat <400> 37 Met Pro Cys Phe Ser Ser Ser Arg Met Ala Cys Ser Lys His Leu Val 1 5 10 15 Leu Phe Leu Thr Ile Leu Leu Ser Leu Ala Glu Thr Pro Asp Ser Ala 20 25 30 Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly Tyr 35 40 45 Leu Leu Gly Pro Val Leu His Leu Ser Ser Lys Ala Asn Gln Gly Arg 50 55 60 Lys Thr Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile Asp 65 70 75 80 Gly Leu Pro Tyr Ser Arg Ser Pro Arg Met Thr Lys Arg Ser Met Gly 85 90 95 Glu Thr Phe Val Lys Pro Arg Thr Gly Asp Leu Arg Ile Val Asp Lys 100 105 110 Asn Val Pro Asp Glu Glu Ala Thr Leu Asn Leu 115 120 <210> 38 <211> 116 <212> PRT <213> Human <400> 38 Met Ala Pro Pro Ser Val Pro Leu Val Leu Leu Leu Val Leu Leu Leu 1 5 10 15 Ser Leu Ala Glu Thr Pro Ala Ser Ala Pro Ala His Arg Gly Arg Gly 20 25 30 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro Val Leu His 35 40 45 Leu Pro Gln Met Gly Asp Gln Asp Gly Lys Arg Glu Thr Ala Leu Glu 50 55 60 Ile Leu Asp Leu Trp Lys Ala Ile Asp Gly Leu Pro Tyr Ser His Pro 65 70 75 80 Pro Gln Pro Ser Lys Arg Asn Val Met Glu Thr Phe Ala Lys Pro Glu 85 90 95 Ile Gly Asp Leu Gly Met Leu Ser Met Lys Ile Pro Lys Glu Glu Asp 100 105 110 Val Leu Lys Ser 115 <210> 39 <211> 180 <212> DNA <213> Rat <400> 39 GCACCTGCTC ACAGGGGACG AGGAGGCTGG ACCCTCAATA GTGCTGGTTA CCTCCTGGGT 60 CCTGTCCTCC ACCTTTCCTC AAAGGCCAGACAGACT AGCTCTTGAG 120 ATCCTAGACC TGTGGAAGGC CATAGATGGG CTCCCTTATT CCCGCTCTCC AAGGATGACC 180 <210> 40 <211> 180 <212> DNA <213> Human <400> 40 GCACCTGCCC ACCGGGGACG AGGAGGCTGG ACCCTCAATA GTGCTGGCTA CCTTCTGGGT 60 CCCGTCCTCC ACCTTCCCCA AATGGGTGAC CAAGACGGAA AGAGGGAGAC AGCCCTTGAG 120 ATCCTAGACC TGTGGAAGGC CATCGATGGG CTCCCCTACT CCCACCCTCC ACAGCCCTCC 180 <210> 41 <211> 695 <212> DNA <213> Rat <400> 41 AGGACAACTG GGATTACAGA TGTGCATCCC TGCAACCGGC TGCCACACAA GTTCTGGGAT 60 CTGAACTCCT GGCCTCAAAC TTGCCAGCAT TCCTTAGCTG TATGCCGTGC TTTTCCAGTT 120 CCAGGATGGC CTGCTCCAAG CATCTGGTCC TCTTCCTCAC CATCTTGCTA AGCCTCGCAG 180 AAACACCAGA CTCTGCACCT GCTCACAGGG GACGAGGAGG CTGGACCCTC AATAGTGCTG 240 GTTACCTCCT GGGTCCTGTC CTCCACCTTT CCTCAAAGGC CAACCAGGGC AGGAAGACAG 300 ACTCAGCTCT TGAG ATCCTA GACCTGTGGA AGGCCATAGA TGGGCTCCCT TATTCCCGCT 360 CTCCAAGGAT GACCAAAAGG TCAATGGGAG AAACGTTTGT CAAGCCGAGG ACTGGAGATC 420 TGCGCATAGT GGACAAGAAT GTTCCGGATG AAGAAGCCAC CCTGAACTTA TAGAGAGTTA 480 GCCCTAGCTC ACTCCTACGT TTCCAGCTCA CCGCCTCTCC CCCCACCCCC GCCCCCAGAA 540 GCGCTCTGAA CACCCTTTCT AAGTCTAAGA CCTTACAACT ATATTCCCTA ATCTCACTAA 600 GACATGTTGT GATATTTAAA GAGTTATTCT GCCCAGCTCC GAAAAAAAAA AAAAAAAAAA 660 AAGAGTTATT CTGACGTAAA AAAAAAAAAA AAAAA 695 <210> 42 <211> 473 <212> DNA <213> Human <400> 42 GAGGAGCCAG AGAGAGCTGC GGAGAGCTGC CAGCTGCACC GGGCGTGTTC CGCAGCTGTA 60 GGCACCTGTC GTCCTGCCTT CGATGGCTCC TCCCTCCGTC CCCCTGGTCC TCCTCCTCGT 120 CCTCTTGCTG AGCCTGGCAG AGACTCCAGC ATCCGCACCT GCCCACCGGG GACGAGGAGG 180 CTGGACCCTC AATAGTGCTG GCTACCTTCT GGGTCCCGTC CTCCACCTTC CCCAAATGGG 240 TGACCAAGAC GGAAAGAGGG AGACAGCCCT TGAGATCCTA GACCTGTGGA AGGCCATCGA 300 TGGGCTCCCC TACTCCCACC CTCCACAGCC CTCCAAGAGG AATGTGATGG AGACGTTTGC 360 CAAACCAGAG ATTGGAGATC TGGGCATGCT CAGCATGAAA ATTCCCAAGG AGGAAGATGT 420 CCTGAAGTCA TA GATGTCTT CAAATCCCTG TTCCTATCCT TCTTCTCCAG CTC 473 <210> 43 <211> 30 <212> PRT <213> Porcine <400> 43 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu 20 25 30 <210> 44 <211> 10 <212> PRT <213> Porcine <400> 44 Cys Ala Pro Ala His Arg Gly Arg Gly Gly 1 5 10 <210> 45 <211> 356 <212> DNA <213> Rat <400> 45 ATGGCTCTGA CTGTCCCTCT GATCGTTCTT GCAGTCCTGC TCAGCCTGAT GGAGTCTCCA 60 GCCTCTGCTC CGGTCCACAG GGGGCGAGGA GGCTGGACCC TCAACAGTGC TGGTTACCTC 120 CTGGGTCCCG TACTCCATCC GCCCTCCAGG GCTGAAGGAG GCGGGAAGGG GAAGACAGCC 180 CTCGGGATCC TGGACCTGTG GAAGGCCATT GATGGGCTCC CCTATCCCCA GTCTCAGTTG 240 GCCTCCAAGA GGAGTCTGGG GGAGACTTTC GCCAAACCAG ACTCTGGAGT AACATTTGTT 300 GGAGTTCCTG ACGTGGTGCC GTGGAAACGA ATCCGACCAG GAACTACGAG GTTTCA 356 <210> 46 <211> 19 <212> DNA <213> Artifical Sequence <220> <223> <400> 46 ATGGCTCTGA CTGTCCCTCT GATCGTTCT 19 <210> 47 <211> 19 <212> DNA <213> Artifical Sequence <220> <223> <400> 47 TGAAACCTCG TAGTT CCTGG TCGGATTCG 19 <210> 48 <211> 18 <212> DNA <213> Artifical Sequence <220> <223> <400> 48 AGGCTGGACC CTCAATAGTG CTGGTTAC 18 <210> 49 <211> 18 <212> DNA <213> Artifical Sequence <220> <223> <400> 49 CCATCTATGG CCTTCCACAG GTCTAGGA 18 <210> 50 <211> 126 <212> DNA <213> Human <400> 50 AGGCTGGACC CTCAATAGTG CTGGTTACCT TCTGGGTCCC GTCCTCCACC TTCCCCAAAT 60 GGGTGACCAA GACGGAAAGA GGGAGATCAGCCGATCGATCGATCGATCGATCGATCAGGATCAGGATCAGGATCAGGATCGATCAGGATCGATCAGGATCAGGATCGATCAGGATCGATCAGGATCGATCAGGATCAGGATCGATCAGGATCGATCGATCAGGATCGATCGATCAGGATCGATCGATCAGGATCGATCAGGATCGATCGATCAGGATCGATCGATCAGGATCGATCGATCGATCGATCAGGATCGATCAGGATCGATCGATCAGGATCGATCGATCGATCGATCGATCAGGATCGATCGATCGATCGATCAGGATCGATCAGGATCGATCATGA 126 <210> 51 <211> 18 <212> DNA <213> Artifical Sequence <220> <223> <400> 51 CAAATGGGTG ACCAAGACGG AAAGAGGG 18 <210> 52 <211> 18 <212> DNA <213> Artifical Sequence < 220> <223> <400> 52 GGTCTAGGAT CTCAAGGGCT GTCTCCCT 18 <210> 53 <211> 16 <212> DNA <213> Artifical Sequence <220> <223> <400> 53 GAGGAGCCAG AGAGAGCTGC GGAGAG 16 <210> 54 <211 > 18 <212> DNA <213> Artifical Sequence <220> <223> <400> 54 GAGCTGGAGA AGAAGGATAG GAACAGGG 18 <210> 55 <211> 23 <212> DNA <213> Artifical Sequence <220> <223> <400 > 55 AGCATATGGC TCCGGTCCAC AGG 23 <210> 56 <211> 27 <212> DNA <213 > Artifical Sequence <220> <223> <400> 56 CTGGATCCTC AGGAGGCCAA CTGAGAC 27 <210> 57 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 57 CAGCCCTCGG CATCCTGGAC C 21 <210 > 58 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 58 GGTCCAGGAT GCCGAGGGCT G 21 <210> 59 <211> 21 <212> DNA <213> Artifical Sequence <220> < 223> <400> 59 CTAGACATAT GCCAGCATTG C 21 <210> 60 <211> 21 <212> DNA <213> Artifical Sequence <220> <223> <400> 60 TCGGGCAATG CTGGCATATG T 21 <210> 61 <211> 29 < 212> PRT <213> Rat <400> 61 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro His Ala Ile 1 5 10 15 Asp Asn His Arg Ser Phe Ser Asp Lys His Gly Leu Thr 20 25 29

[0072]

[Brief description of the drawings]

Galanin by [Figure 1] ^[35 S] GTPγS binding test,
4 shows the results of detection of the receptor activating action.

[FIG. 2] [ ³⁵ S] GT using GALR2-expressing cell membrane fraction of the sample fraction obtained in Example 2 (2-3)
4 shows the results of a PγS binding test.

FIG. 3 shows the results of analysis of a sample fraction obtained in Example 2 (2-3) using a pig galanin radioimmunoassay kit (Peninsula).

FIG. 4 shows the results of molecular weight analysis of components having GALR2 activating action ([ ³⁵ S] GTPγS binding promoting activity) obtained in Example 2 (2-4) by gel filtration high performance liquid chromatography.

FIG. 5 shows the results of molecular weight analysis of known peptides by gel filtration high performance liquid chromatography in Example 2 (2-4).

FIG. 6 shows a comparison in amino acid sequence between the peptide of the present invention and a galanin precursor.

FIG. 7: Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys
The antibody titer of the mouse immunized with the (-NH ₂ ) -KLH complex was determined by HR
P-labeled Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys-NH
₂ shows the results of an examination using the method.

FIG. 8: Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys
1 shows a typical example of screening for a hybridoma after cell fusion using a mouse immunized with a (-NH ₂ ) -KLH complex.

FIG. 9: Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-Cys
Ala-Pro-Ala-His-Arg-Gly-Ar of monoclonal antibody GR2-1N prepared using (-NH ₂ ) -KLH complex as an immunogen
The reactivity to g-Gly-Gly-Cys-NH ₂ (amide of SEQ ID NO: 44), porcine ligand peptide (1-60) (SEQ ID NO: 31) and rat galanin (SEQ ID NO: 61) was HRP-labeled. Ala-Pro-Ala-His-Arg-Gly-Arg-Gly-Gly-
The results obtained by a competition method using Cys-NH ₂ -EIA are shown.

FIG. 10 shows a diagram relating to a method for preparing a structural gene for a porcine ligand peptide described in Example 20.

FIG. 11 shows a construction diagram of a fusion protein expression vector described in Example 21.

FIG. 12 shows a construction diagram of the pig-type ligand peptide expression strain described in Example 21.

FIG. 13 shows an analysis result (electropherogram) using SDS-polyacrylamide gel electrophoresis described in Example 23.

14 shows a diagram illustrating the results of a feeding test performed in Example 24. FIG.

Continuation of the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) A61P 21/00 A61K 31/00 621A 25/04 626 A61K 38/00 C07K 14/47 ZNA C07K 14/47 ZNA C12N 1 / 21 C12N 1/21 C12P 21/02 C C12P 21/02 G01N 33/15 Z G01N 33/15 33/566 33/566 33/577 B 33/577 C07K 1/18 // C07K 1/18 1/20 1 / 20 A61K 37/02 (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Kazuhiro Ogi 2-16-1, Umezono, Tsukuba-shi, Ibaraki Lunbeini Umezono 206 (72) Inventor Chieko Kitada 1-2-8 Minamikoyocho, Sakai-shi, Osaka F-term (reference) 4B024 AA01 AA11 BA01 BA43 BA44 BA61 CA04 DA02 DA03 DA06 EA04 GA01 4B064 AG01 AG26 AG27 CA19 CC24 CE09 DA01 DA13 4B065 AA26X AA90X AA90Y AA93Y AB01 AB05 AC14 CA24 CA25 CA44 CA46 4C084 AA01 AA02 AA06 AA07 BA01 BA17 BA18 BA19 BA20 CA53 DB01 ZA152 ZA702 Z A812 ZA942 4H045 AA10 AA11 AA30 BA10 CA40 DA30 DA75 DA76 EA20 EA50 FA51 FA72 FA74

Claims (22)

[Claims] An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 35,
And a peptide capable of binding to a receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a precursor thereof, or an amide thereof or The ester or a salt thereof. 2. An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 35,
2. The peptide according to claim 1, which has the ability to activate a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Precursors or amides or esters or salts thereof. 3. A peptide, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 36. 4. The method according to claim 1, wherein the peptide is SEQ ID NO: 11, 12, 1,
The peptide according to claim 1 or 3, which is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 5, 16, or 43, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof. . 5. The method according to claim 1, wherein the peptide is SEQ ID NO: 11, 12, 1,
Has the same or substantially the same amino acid sequence as the amino acid sequence represented by 5, 16 or 43, and has a molecular weight of 50
The peptide according to claim 1 or 3, which is a peptide having a molecular weight of from 00 to 10,000, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof. 6. The peptide according to claim 1, wherein the peptide is SEQ ID NO: 31, 33 or 3.
4. The peptide according to claim 1 or 3, which is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 4, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof. 7. The peptide precursor according to claim 1 or 3, wherein the precursor is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 29, or an amide or amide thereof. The ester or a salt thereof. 8. The substantially identical amino acid sequence is represented by SEQ ID NO:
The precursor of the peptide according to claim 6, which is an amino acid sequence represented by 30, 37 or 38, or an amide or ester thereof or a salt thereof. 9. A DN containing a DNA containing a nucleotide sequence encoding the peptide according to claim 1 or 3.
A. 10. The D according to claim 9, which encodes a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 31, 33 or 34.
NA. 11. The DNA according to claim 10, which has the nucleotide sequence represented by SEQ ID NO: 32, 39 or 40. (12) SEQ ID NO: 29, 30, 37 or 38
4. A DNA comprising a nucleotide sequence encoding the precursor of the peptide according to claim 1 or 3, which has the same or substantially the same amino acid sequence as the amino acid sequence represented by
DNA containing 13. SEQ ID NO: 27, 28, 41 or 42
The DNA according to claim 12, which comprises a DNA containing a base sequence represented by the formula: 14. A recombinant vector containing the DNA according to claim 9. [15] A transformant transformed with the recombinant vector according to [14]. (16) culturing the transformant according to (15),
A method for producing the peptide according to claim 1 or claim 3, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof. (17) an antibody against the peptide or the precursor thereof according to (1) or (3); [18] A diagnostic agent comprising the antibody according to [17]. 19. A pharmaceutical comprising the peptide according to claim 1 or 3 or a precursor thereof, an amide thereof, an ester thereof or a salt thereof. 20. The pharmaceutical according to claim 19, which is a memory function improving agent, an appetite regulator, a uterine function regulator, a kidney function regulator, a prostate function regulator, a testis function regulator or a skeletal muscle function regulator. 21. An amino acid sequence represented by SEQ ID NO: 1, 2 or 3, wherein the peptide according to claim 1 or 3 or its precursor or its amide or its ester or its salt is used. A method for screening for an agonist or antagonist for a receptor protein containing the same or substantially the same amino acid sequence. 22. A compound or a salt thereof obtained by the screening method according to claim 21.