JP2002000280A - Physiologically active new peptide and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a useful mouse homolog ligand for human being-derived ligand (WO 99/48920) specific to galanin receptor. SOLUTION: This mouse homolog ligand comprises a peptide, its precursor, its amide, its ester or its salt which contains the amino acid sequence homologous or substantially homologous to a mouse-derived specific amino acid sequence and the amino acid sequence homologous or substantially homologous to either of three kinds of rat-derived specific amino acid sequences and exhibits an ability of combining with a galanin receptor protein. The DNA or the like encoding the peptide can be used for (i) the development of a receptor-bound assay system using a recombinant receptor protein expression system and the screening of a compound being considered for medicine or (ii) the development or the like of a medicine, e.g. a mneme ameliorative agent, an aperitive or a function regulator on uterus, ren, prostate, testis or skeletal muscle, having slight adverse drug reactions.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to an activator (such as a ligand peptide) for a galanin receptor.

[0002]

2. Description of the Related Art Galanin is a bioactive peptide consisting of 29 amino acid residues first found in porcine small intestine extract [FEBS Lett.
164, pp. 124-128 (1983)], and have been found in many mammals, birds, reptiles, and fish besides pigs. The amino acid sequence of galanin is human (FEBS Lett., 283, pp18
9-194 (1991)), cattle (FEBS Lett., 234, pp400-406 (19
88)), rat (J. Biol. Chem., 262, pp 16755-16758 (1
987)) and sheep (Peptides, 12, pp 855-859 (1991)) and the like. The 15 amino acid residues from the N-terminus are conserved among species. Porcine galanin has a precursor protein consisting of 123 amino acid residues [preprogalanin (1-123);
Proc. Natl. Acad. Sci. USA, 83, pp. 6287-6291 (198
6)] Also, the precursor p which is 9 residues longer at the N-terminus than galanin
reprogalanin (24-61) amide and preprogalanin (37-61) amide lacking the N-terminal 4 residues of galanin are known (Pep
tides, 13, pp 1055-1060 (1992)). The physiological effects of galanin include acetylcholine release inhibitory activity (Br
ain Research, 709, pp81-87 (1996)).
95 (1995)), Pituitary hormone release promoting action in the pituitary gland (Neuroscience Letter, 75, pp49-54 (1987); Endoc
rinology, 134, pp529-536 (1994); Peptides, 7, pp51
-53, (1986)), Insulin secretion inhibitory action in pancreas (Act
a Physiol. Scand., 139, pp591-596 (1990)) and the like, and its physiological actions are thought to be exerted via galanin receptors. Galanin receptor has three subtypes (GALR1, GALR2, GALR3)
For GALR1, human, rat and mouse (Proc. Natl. Acad. Sci. USA, 90, pp3845-38)
49 (1993); J. Mol. Neurosci., 6, pp33-41 (1995); FE
BS Lett., 411, pp. 225-230 (1997)) and GALR2 in rats (FEBS Lett., 405, pp. 285-290 (1997); Mol. Ph.
armacol., 52, pp337-343 (1997); J. Biol. Chem., 27
2, pp24612-24616 (1997)), and rats for GALR3 (J.
Biol. Chem., 272, pp31949-31952 (1997)). In addition, these three types of galanin receptors have seven hydrophobic regions (transmembrane domains) characteristic of G protein-coupled receptors. It is thought to stimulate. Galanin has been confirmed to bind to galanin receptors of all three subtypes. The binding affinity of galanin is strongest for GALR1, followed by GALR2 and GALR3, and the affinity for GALR3 is about 10 times weaker than that for GALR1 (J. Biol. Chem. 272, 31949-31).
952, 1997). Also, galanin is cA in GALR1-expressing cells.
Causing inhibition of MP production (Proc. Natl. Acad. Sc
i. USA 90, 3845-3849, 1993), cAM in GALR2-expressing cells
P production inhibition (Mol. Pharmacol., 52,
pp 337-343 (1997)), causing an increase in the inositol-phosphate metabolism system and an increase in intracellular calcium ion concentration (J. Biol. Chem. 272, 24612-24616, 1997).

[0003]

Heretofore, substances that inhibit the binding between a G protein-coupled receptor and a physiologically active substance (that is, a ligand), and signal transmission that binds to the same as a physiologically active substance (that is, a ligand) Have been utilized as specific antagonists or agonists of these receptors as pharmaceuticals that regulate biological functions. Therefore, a novel G protein-coupled receptor protein that is not only important in the physiological expression in vivo but can also be a target for drug development is newly discovered, and a specific ligand of the novel G protein-coupled receptor protein is identified. Finding is a very important tool in finding agonists and antagonists. At that time, in order to clarify the physiological mechanism of the receptor, a counterpart gene such as a mouse for the human receptor gene or ligand gene was obtained, and the protein chemical properties and biological activities of the gene product were searched. It is also important to estimate the function in humans by examining the qualitative and quantitative dynamics and physiological mechanisms in animals in detail, in order to create effective drugs. Further, when selecting candidate agonists and antagonists, selecting and determining candidate compounds while recognizing the presence or absence of species differences is an indispensable item in drug discovery. The present invention
As mentioned above, specific human ligands for useful galanin receptors (WO 99/48920)
(Hereinafter, sometimes referred to as “peptide of the present invention”).

[0004]

Means for Solving the Problems The present inventors have constructed galanin receptor GALR2 expressing cells and galanin receptor GALR1 expressing cells, and by using these cells, have been able to reduce the agonist activity for each subtype of galanin receptor. A simple assay for measurement, that is, a [ ³⁵ S] GTPγS binding test was completed. As a result of screening for GALR2 agonists using this assay method, we succeeded in finding a novel mouse-derived activator that has a different activation effect on galanin receptor subtypes from galanin. Furthermore, the present inventors have found that it is possible to screen for a compound that alters the binding between the novel activator and the galanin receptor based on this finding. That is, the present invention relates to (1) a peptide or a precursor thereof, or an amide or ester thereof or a ester thereof, which is characterized by containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. A salt, (2) the precursor according to the above (1), which contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, (3) the above (1) DNA containing DNA encoding the peptide or precursor of
(4) the DNA according to the above (3), which contains the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 20, (5) a recombinant vector containing the DNA according to the above (3),
(6) The transformant transformed with the recombinant vector according to (5) above, (7) The transformant described in (6) above is cultured, and the peptide or precursor described in (1) above or an amide thereof is cultivated. Or the method for producing the peptide or the precursor or the amide or the ester or the salt thereof according to the above (1), wherein the method produces or accumulates the ester or the salt thereof;
An antibody against the peptide or the precursor according to the above, (9) a medicine comprising the antibody according to the above (8), (10) a diagnostic agent comprising the antibody according to the above (8), (11) a diagnostic agent comprising the antibody according to the above (1). A) a medicament comprising the peptide or precursor thereof, or an amide thereof, an ester thereof or a salt thereof, (12) a memory function improving agent, an appetite regulator, a uterine function regulator, a renal function regulator, a prostate function regulator, (13) The medicament according to the above (11), which is a testis function regulator or a skeletal muscle function regulator, (13) the peptide according to the above (1), a precursor thereof, an amide thereof, an ester thereof, or a salt thereof. , A receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13 The screening method of an agonist or antagonist to, (14) (13)
Or a salt thereof obtained by the screening method described above, (15) a memory function improving agent, an appetite regulator, a uterine function regulator, a renal function regulator, a prostate function regulator containing the compound or salt thereof described in (14) above. Agent, testis function regulator or skeletal muscle function regulator, (16) memory function improving action, appetite regulation action, uterine function regulation action, kidney function regulation action, prostate function regulation action, testis function regulation action or skeletal muscle function regulation action The peptide according to the above (1) or a precursor thereof, an amide thereof or an ester thereof or a salt thereof for producing a medicament having the above (3),
Use of the DNA of the above or the antibody of the above (8),
And (17) administering the peptide according to the above (1) or its precursor or its amide or its ester or its salt, the DNA according to the above (3), or the antibody according to the above (8) to a mammal. Memory function improvement, appetite control, uterine function control, kidney function control, prostate function control, testis function control or skeletal muscle function control method.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION In the present specification, “substantially the same” means the activity of a protein, for example, an agonist activity for a receptor, ie, an activity of activating a receptor possessed by a ligand, an activity of binding a ligand to a receptor, and the like. Mean substantially the same. Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the peptide, in which case the substituted, deleted, added or inserted peptide is Would be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. Glycine, serine, threonine, and polar (neutral) amino acids
Cysteine, tyrosine, asparagine, glutamine and the like. Examples of (basic) amino acids having a positive charge include arginine, lysine, histidine and the like.
Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid. The peptide of the present invention is a peptide having a binding ability to a galanin receptor. Preferably, it is a known ligand peptide other than galanin which has an activating effect on a galanin receptor. The galanin receptor is as described below.

[0006] The peptide of the present invention contains, for example, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1;
1, having the ability to bind to a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12 or SEQ ID NO: 13 (preferably the ability to activate the receptor protein, etc.) Peptides and the like. SEQ ID NO: 11 is the entire amino acid sequence of rat GALR1 (galanin receptor type 1), SEQ ID NO: 12 is the entire amino acid sequence of rat GALR2 (galanin receptor type 2), and SEQ ID NO: 13 Is a rat type GALR3
1 shows the entire amino acid sequence of (Galanin receptor type 3).

[0007] The peptide of the present invention, its production method and use will be described in more detail below. The origin of the peptide of the present invention is mouse, and its tissue (eg, pituitary, pancreas, brain, kidney, liver, gonad, thyroid, gallbladder, bone marrow,
It may be a peptide derived from the adrenal gland, skin, muscle, lung, digestive tract, blood vessel, heart, testis, etc.) or a cell, or may be a synthetic peptide. For example, the peptide of the present invention includes a peptide containing an amino acid sequence having about 90% or more (preferably 95% or more, more preferably 98% or more) homology with the amino acid sequence represented by SEQ ID NO: 1. can give.

[0008] "Substantially the same activity" includes, for example,
Binds to the galanin receptor GALR1, GALR2 or GALR3
Activity, galanin receptor GALR1, GALR2 or GA
LR3 activating activity or caused by it
Arachidonic acid release, intracellular Ca ²⁺Release, intracellular cAMP generation
Inhibition, inositol phosphate production (inhibition), cell membrane potential change
Signal, phosphorylation of intracellular proteins, changes in intracellular pH, etc.
Homologous in ability to activate null signaling activity system
Indicates that Therefore, the intensity of these activities and the amount of peptide
Quantitative factors such as child quantity may be different. The present invention
Specific examples of the peptide include:
You. The amino acid sequence represented by SEQ ID NO: 1 or
An amino acid sequence identical or substantially identical to the partial sequence
For the contained peptide or its partial peptide,
Substitution or deletion or addition of one or more amino acids
Is the peptide containing the inserted amino acid sequence
A peptide containing a qualitatively identical amino acid sequence
I can do it. For example, (1) the amino acid represented by SEQ ID NO: 1
1 or more and 10 or more in the no acid sequence or its partial sequence
Below, preferably one or more and five or less, more preferably one
An amino acid sequence in which at least three or less amino acids have been deleted,
(2) the amino acid sequence represented by SEQ ID NO: 1 or
1 or more and 10 or less, preferably 1 or more
5 or less, more preferably 1 or more and 3 or less amino acids
(3) an amino acid sequence added (or inserted)
Amino acid sequence represented by SEQ ID NO: 1 or a part thereof
1 to 10 in the sequence, preferably 1 to 5
Or less, more preferably one or more and three or less amino acids
Containing an amino acid sequence substituted with a certain amino acid
And so on. "Substantially the same amino acid sequence"
As 90% or more, more preferably 95%
% Or more, more preferably 98% or more
Amino acid sequences.

In the present specification, the left end of the peptide is the N-terminal (amino terminal) and the right end is the C-terminal (carboxyl terminal) according to the convention of peptide description. The peptide of the present invention usually has a carboxyl group (—COOH) or a carboxylate (—COO ⁻ ) at the C-terminus, but may have an amide (—CONH ₂ ) or ester (—COOR) at the C-terminus. As R of the ester, for example, methyl,
A C _1-6 alkyl group such as ethyl, n-propyl, isopropyl or n-butyl; a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl; phenyl;
a C _6-12 aryl group such as α-naphthyl, benzyl,
Phenyl- _C1-2 such as phenethyl and benzhydryl
In addition to alkyl or a C _7-14 aralkyl group such as α-naphthyl-C _1-2 alkyl such as α-naphthylmethyl, a pivaloyloxymethyl group widely used as an oral ester and the like can be mentioned. The peptide of the present invention is C
When the compound has a carboxyl group or a carboxylate at a position other than the terminal, those in which these groups are amidated or esterified are also included in the peptide of the present invention. As the ester at this time, for example, the same ester as the above-mentioned C-terminal ester and the like are used.

As a salt of the peptide of the present invention, a salt with a physiologically acceptable base (for example, an alkali metal or the like) or an acid (organic acid or inorganic acid) is used. Addition salts are preferred. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The peptide of the present invention can be produced by a method for purifying the peptide from human or warm-blooded animal tissues or cells, or according to the peptide synthesis method described below. The peptide of the present invention can also be produced by culturing a transformant containing a DNA encoding the peptide. DNA encoding the peptide can be obtained by a known cloning method [for example, Mole
cular Cloning (2nd ed .; J. Sambrook et al., Cold
Spring Harbor Lab. Press, 1989)
Can be created according to The cloning method includes (1) using a DNA probe or DNA primer designed based on the amino acid sequence of the peptide,
A method of obtaining a transformant containing the DNA encoding the peptide from a DNA library by a hybridization method, or (2) encoding the peptide by a PCR method using a DNA primer designed based on the amino acid sequence of the peptide. There is a method for obtaining a transformant containing DNA. When producing the peptide of the present invention from human or warm-blooded animal tissues or cells, after homogenizing the human or warm-blooded animal tissues or cells, acid,
Alternatively, extraction can be performed with an alcohol or the like, and the extract can be purified and isolated by combining chromatography such as salting out, dialysis, gel filtration, reverse phase chromatography, ion exchange chromatography, and affinity chromatography.

As described above, the peptide of the present invention comprises
It can be produced according to (1) a peptide synthesis method known per se, or (2) cleaving a peptide containing the peptide of the present invention with a suitable peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the peptide of the present invention with the remaining portion and, when the product has a protecting group, removing the protecting group. Known condensation methods and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York, 1965. Can be. When the peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and when it is obtained by a salt, it can be converted to a free form by a known method. .

As the amide of the peptide of the present invention, a commercially available resin for peptide synthesis suitable for amide formation can be used. Examples of such resins include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin,
PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4-
(2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fm
ocaminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to the sequence of the target peptide according to various condensation methods known per se. At the end of the reaction, the peptide is cleaved from the resin, and at the same time, various protecting groups are removed, and if necessary, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a target peptide. For the condensation of the protected amino acids described above, various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Examples of the carbodiimides include DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like. Activation by these includes racemization inhibiting additives (eg, HOBt, HO
The protected amino acid together with OBt) can be added directly to the resin or can be added to the resin after activating the previously protected amino acid as a symmetric anhydride or HOBt ester or HOOBt ester.
The solvent used for activation of the protected amino acid or condensation with the resin may be appropriately selected from solvents known to be usable for the peptide condensation reaction. For example, N,
Acid amides such as N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethyl sulfoxide, pyridine Tertiary amines, such as dioxane, tetrahydrofuran, etc .; nitriles, such as acetonitrile and propionitrile; esters, such as methyl acetate and ethyl acetate; or an appropriate mixture thereof. The reaction temperature is appropriately selected from the range that can be used for the peptide bond formation reaction, and is usually about -20 ° C to about 50 ° C.
Is appropriately selected from the range. The activated amino acid derivative is usually used in about 1.5 to about 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction. Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, trifluoro Acetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like can be mentioned.
Examples of the carboxyl-protecting group include 2-adamantyl, as well as the above-mentioned C _1-6 alkyl group, C _3-8 cycloalkyl group, and C _7-14 aralkyl group as R.
4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl group and benzyloxycarbonyl hydrazide, tert-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Suitable groups for this esterification include, for example, lower (C _1-6 ) alkanoyl groups such as acetyl groups, aroyl groups such as benzoyl groups, and groups derived from carbonic acid such as benzyloxycarbonyl groups and ethoxycarbonyl groups. .
Examples of groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a tertiary butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like. Examples of the imidazole protecting group for histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, and Fmoc. Activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,
4,5-trichlorophenol, 2,4-dinitrophenol,
Cyanomethyl alcohol, paranitrophenol, HON
B, N-hydroxysuccinimide, N-hydroxyphthalimide, ester with HOBt)]. The activated amino group of the raw material includes, for example, a corresponding phosphoric amide. As a method of removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethanesulfonic acid Acid treatment with trifluoroacetic acid or a mixture thereof, or base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc.
Also, reduction with sodium in liquid ammonia can be mentioned. The elimination reaction by the above-mentioned acid treatment is generally performed at -20 ° C or higher.
It is performed at a temperature of 40 ° C., but in the acid treatment, a cation scavenger such as anisole, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol is added. Is valid. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide, dilute ammonia or the like.

The protection and protection of functional groups that should not be involved in the reaction of the raw materials, the elimination of the protective groups, the activation of the functional groups involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining the amide form of the peptide of the present invention, first, after amidating the α-carboxyl group of the carboxyl-terminal amino acid, extending the peptide chain to a desired chain length on the amino group side, And a peptide (or amino acid) from which only the protecting group for the carboxyl group at the C-terminus has been removed, and both peptides in a mixed solvent as described above. To condense. Details of the condensation reaction are the same as described above. After purifying the protected peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude peptide. This crude peptide is purified using various known purification means,
The amide of the desired peptide can be obtained by freeze-drying the main fraction. In order to obtain an ester of the peptide of the present invention, an α-carboxyl group of the carboxy terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then an ester of the desired peptide is obtained in the same manner as the amide of the peptide. Can be. The peptide of the present invention has the same action as a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a partial sequence thereof (eg, GALR
(1) Any peptide having an agonistic activity, GALR2 agonistic activity or GALR3 agonistic activity) may be used. Examples of such a peptide include a peptide having an amino acid sequence in which 1 to 5 amino acids have been deleted, added (inserted), or substituted from the amino acid sequence represented by SEQ ID NO: 1 or a partial sequence thereof. I can give it. The precursor of the peptide of the present invention may be any peptide as long as it encodes the ligand peptide of the present invention as a partial sequence thereof.

As a precursor of the peptide of the present invention, specifically, for example, a peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, etc. can give. Here, the “substantially identical amino acid sequence” is 80% or more, more preferably 90% or more, further preferably 95% or more, and most preferably 98% or more of the amino acid sequence represented by SEQ ID NO: 2. And the like. The “substantially identical amino acid sequence” includes (i) 1 to 20 amino acids, preferably 1 to 10 amino acids, and more preferably 1 amino acid in the amino acid sequence represented by SEQ ID NO: 2. An amino acid sequence in which at least 5 amino acids have been substituted with another amino acid, and (ii) one or more and no more than 20 amino acids in the amino acid sequence represented by SEQ ID NO: 2, preferably one or more but no more than 10 Is 1
An amino acid sequence in which at least 5 and no more than 5 amino acids have been deleted, (i
ii) one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2
0 or less, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids are added (or inserted)
Amino acid sequence and the like. The position of “substitution, deletion, addition (or insertion)” is not particularly limited as long as it is other than a region encoding the ligand peptide of the present invention as a partial sequence thereof. Specific examples of the peptide (or polypeptide) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 include:
For example, it contains the amino acid sequence represented by SEQ ID NO: 1, and (i) in the amino acid sequence represented by SEQ ID NO: 2 from 1 to 20, preferably from 1 to 10, more preferably An amino acid sequence in which one or more and five or less amino acids have been substituted with another amino acid; More preferably, an amino acid sequence in which one or more and five or less amino acids have been deleted, (iii) SEQ ID NO:
1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids
Peptides (or polypeptides) having an amino acid sequence in which not more than three amino acids have been added (or inserted) are exemplified. The peptide of the present invention can be further used as an antigen for preparing an anti-ligand peptide antibody.
As the peptide as such an antigen, in addition to the above-described peptide of the present invention, for example, partial peptides such as the N-terminal peptide, C-terminal peptide and central peptide of the above-mentioned peptide of the present invention are used. As the partial peptide, a peptide individually containing each domain of the peptide of the present invention may be used, but a peptide containing a plurality of domains at the same time may be used. Further, since the above partial peptide may be used as long as it can be used as an antigen for preparing an anti-ligand peptide antibody, (i)
Part where one or several (preferably 1 to 5, more preferably 1 or 2) other amino acid residues are added (or inserted) to a partial peptide such as a terminal peptide, a C-terminal peptide, or a peptide at the center. Peptide, (ii) one to several (preferably 1 to 5, more preferably 1 or 2) partial peptides such as the N-terminal peptide, C-terminal peptide, and central peptide of the peptide of the present invention.
) Amino acid residues, (iii)
One to several (preferably 1 to 5, more preferably 1 or 2) of the constituent amino acids of the partial peptide such as the N-terminal peptide, C-terminal peptide and central peptide of the peptide of the present invention are other amino acids A partial peptide substituted with a residue is also included.

More specifically, the partial peptide may be, for example, N-amino acid sequence represented by SEQ ID NO: 1.
24th (Pro) to 30th (Asp) from terminal
A partial amino acid sequence consisting of the 32nd position (Gly) to a 37th position (Ser);
And a peptide containing a partial amino acid sequence consisting of the (His) to the 60th (Thr). The partial peptide in this specification also has an amide (-CONH ₂ ) at the C-terminus.
Or it may be an ester (-COOR). Here, examples of the ester group are the same as those of the peptide described above. When the partial peptide has a carboxyl group or a carboxylate at a position other than the C-terminal, those in which those groups are amidated or esterified are also included in the partial peptide of the present invention. As the ester at this time, for example, the above-mentioned C-terminal ester and the like are used. The partial peptide of the peptide of the present invention may itself have the activity of the peptide of the present invention (eg, activating action on galanin receptor). The peptide of the present invention or a partial peptide thereof may be a fusion protein with a protein whose function or property is well known.

As the salt of the partial peptide of the peptide of the present invention, the same salts as the above-mentioned salts of the peptide are used.
The partial peptide of the peptide of the present invention or its amide, ester or salt thereof can be produced according to the same synthetic method as in the above-mentioned peptide, or by cleaving the peptide of the present invention with an appropriate peptidase. The DNA encoding the peptide of the present invention contains, for example, the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, and preferably further contains SEQ ID NO: 11, SEQ ID NO: 12 or A nucleotide sequence encoding a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 and having the ability to bind to a receptor protein (preferably the ability to activate the receptor protein, etc.) Any DNA may be used as long as it contains DNA. Furthermore, any DNA may be used as long as it contains the DNA encoding the peptide of the present invention specifically described above. Genomic DNA, genomic DNA library,
Any of the above-described cDNA derived from a tissue / cell, a cDNA library derived from the tissue / cell described above, or a synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, R
Using the prepared NA fraction directly for Reverse Transcri
ptase Polymerase Chain Reaction (hereinafter, RT-PCR
Method). More specifically, (1) DNA containing a DNA encoding a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 (2) Under stringent conditions DNA derived from a mammal that hybridizes with the sequence defined in (1), (3) does not hybridize with the sequence defined in (1) and (2) due to the degeneracy of the genetic code, but has the same amino acid sequence For example, DNA encoding a polypeptide having Hybridization can be performed according to a method known per se or a method analogous thereto. The stringent conditions include, for example, 42 ° C., 50% formamide,
× SSPE (1 × SSPE = 150 mM NaCl, 10 mM NaH ₂ PO ₄
・ H ₂ O, 1mM EDTA pH7.4), 5 × Denhardt's solution, 0.1
% SDS. A specific example of a DNA containing a DNA encoding a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 includes the base sequence represented by SEQ ID NO: 3 And the like. Further, in the DNA encoding the peptide of the present invention or a partial peptide thereof, for example,
A DNA fragment containing at least 40 and up to 40 (preferably at least 1 and at most 30 and more preferably at least 1 and up to 20) partial base sequences is also preferably used as a DNA detection probe. Examples of the DNA encoding the precursor of the peptide of the present invention include the above-described precursor of the peptide of the present invention,
Specifically, any DNA may be used as long as it contains a DNA encoding a peptide (polypeptide) having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2. Good. A specific example of a DNA containing a DNA encoding a peptide (polypeptide) having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 is represented by SEQ ID NO: 20 DNA containing DNA
A and the like.

DNA encoding the peptide of the present invention
Can also be produced by the following genetic engineering techniques. The genetic engineering techniques include, for example, Molecular Cl
oning (2nd ed .; J. Sambrook et al., Cold Spring H
arbor Lab. Press, 1989). When a commercially available library or kit is used, the method may be performed according to the method described in the attached instruction manual. The DNA encoding the peptide or the like of the present invention may be a DNA based on the amino acid sequence of the peptide or a part thereof.
The probe synthesized and labeled with the fragment can be selected by hybridization with a genomic DNA or cDNA library or the like. As a means for cloning a DNA that completely encodes the peptide of the present invention, a synthetic DNA primer having a partial nucleotide sequence of the peptide of the present invention is used, and a genomic DNA or cDNA library or the like is obtained by a PCR method known per se. The target DNA is amplified or the DNA incorporated into an appropriate vector is converted into a DNA fragment having a partial or entire region, such as the peptide of the present invention, or a synthetic DN.
Selection can be carried out by hybridization with those labeled with A. The cloned DNA encoding the peptide of the present invention can be used as it is depending on the purpose, or may be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA has an ATG as a translation initiation codon at its 5 'end,
TAA and T as translation termination codons are located at the 3 'end.
It may have GA or TAG. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. An expression vector such as the peptide of the present invention can be prepared, for example, by (A) cutting out a DNA fragment of interest from DNA encoding the peptide of the present invention, and (B) ligating the DNA fragment downstream of a promoter in an appropriate expression vector. Can be manufactured. As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pU
C13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as phage λ, and animal viruses such as retrovirus, vaccinia virus, and baculovirus.

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. When the host used for the transformation is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SRα promoter and the like can be used. When the host is Escherichia, trp promoter, T7 promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, etc., and when the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc. When the host is yeast, PHO5 promoter, PGK promoter, G
An AP promoter, an ADH1 promoter, a GAL promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. In addition to those described above, an expression vector containing an enhancer, a splicing signal, a polyA addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), and the like may be used as the expression vector. it can. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
^r ), a neomycin resistance gene (hereinafter sometimes abbreviated as Neo ^r , G418 resistance) and the like. In particular, when CHO (dhfr ⁻ ) cells are used and the DHFR gene is used as a selection marker, selection can also be performed using a thymidine-free medium.
If necessary, a signal sequence suitable for the host is added to the N-terminal side of the peptide or its partial peptide.
When the host is a bacterium belonging to the genus Escherichia, a phoA signal sequence, an OmpA signal sequence, or the like is used. In some cases, a mating factor α (MFα) signal sequence, an invertase signal sequence, etc.
A signal sequence or the like can be used. Using the vector containing the DNA encoding the peptide thus constructed, a transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insects or insect cells, animal cells and the like are used. Examples of the genus Escherichia include Escherichia coli K12.DH1.
[Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 160
(1968)], JM103 [Nukuilec Acids
Research, (Nucleic Acids Research), 9, 309
(1981)], JA221 [Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Bacillus spp.
Bacillus subtilis MI114 [Gene,
24, 255 (1983)], 207-21 [Journal of Biochemis
try), 95, 87 (1984)].
Examples of yeast include Saccharomyces cerevisiae AH22, AH22
R ⁻ , NA87-11A, DKD-5D, 20B-12
Are used. As insects, for example, silkworm larvae are used [Maeda et al., Nature, 3
15, 592 (1985)]. As insect cells, for example, when the virus is AcNPV, a cell line derived from the larva of night-moth (Spodoptera frugiperda cell; Sf cell);
MG1 cells from Trichoplusia ni midgut, Trichoplusi
High Five ^TM cells from a ni eggs, Mamestra brassi
Cells derived from cae or Estigmena acrea are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. As the Sf cells, for example, Sf9 cells (AT
CC CRL1711), Sf21 cells [Vaughn, JL et al.
In Vitro, Volume 13, 213-217
Page (1977)]. Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese hamster cells CHO, and DHFR gene-deficient Chinese hamster cells CHO (CHO / dhfr ⁻
Cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, human HEK293 cells, human FL cells,
93 cells, C127 cells, BALB3T3 cells, Sp-
2 / O cells and the like are used.

In order to transform Escherichia, for example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69, 21
10 (1972) and Gene, 17, 107 (1)
982). For transformation of Bacillus sp., For example, Molecular & General Genetics (Molecular & G)
Eneral Genetics), Vol. 168, 111 (1979). To transform yeast, for example, Processing of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 75,
1929 (1978).
To transform insect cells or insects, see, for example, Bio / Technology, Vol. 6, 47-5.
The method is carried out according to the method described on page 5 (1988) and the like. Transformation of animal cells is performed, for example, according to the method described in Virology, Vol. 52, 456 (1973). As a method for introducing an expression vector into cells, for example, a lipofection method [Felgner,
PL et al. Proceedings of the National Academy of S.A.
ciences of the United States of America), 84
Vol. 7413 (1987)], calcium phosphate method [Graham, FL and van der Eb, AJ Virology, 52, 456-467 (1973).
)], Electroporation [Nuemann, E. et al. EMBO J., 1, 841-845 (19)
1982)]. Thus, a transformant transformed with the expression vector containing the DNA encoding the peptide of the present invention or the like is obtained. In addition, as a method for stably expressing the peptide of the present invention using animal cells, there is a method of selecting, by clonal selection, cells in which the expression vector introduced into the animal cells is integrated into the chromosome. Specifically, a transformant is selected using the above-mentioned selection marker as an index. Furthermore, a stable animal cell line having a high expression ability of the peptide of the present invention or the like can be obtained by repeatedly performing clonal selection on the animal cells thus obtained using the selection marker. When the dhfr gene is used as a selection marker, the DNA encoding the peptide of the present invention together with the dhfr gene is amplified in cells by culturing the MTX concentration gradually and selecting resistant strains. In addition, an animal cell line with higher expression can be obtained. The above transformant was transformed into DN encoding the peptide or the like of the present invention.
By culturing under conditions in which A can be expressed, and producing and accumulating the peptide or the like of the present invention, the peptide or the like of the present invention can be produced. When culturing a transformant in which the host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. Examples of the carbon source include glucose, dextrin, soluble starch, and sucrose, and examples of the nitrogen source include ammonium salts, nitrates,
Inorganic or organic substances such as corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, etc. Examples of the inorganic substances include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like.
In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8. As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Mille (Mille)
r), Journal of Experimen in Molecular Genetics
ts in Molecular Genetics), 431-433, Cold S
Spring Harbor Laboratory, New York 1972]. If necessary, an agent such as 3β-indolylacrylic acid can be added to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast, for example, Burkholder (Burkho
lder) Minimal medium [Bostian, KL et al., "Procedures of the National Academy of Sciences of the USA (Proc. Natl. Ac
ad. Sci. USA), 77, 4505 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA
Proc. Natl. Acad. Sci. USA, 81, 5, Procedings of the National Academy of Sciences of the USA.
330 (1984)]. The pH of the medium is about 5
It is preferable to adjust to ８8. Culture is usually about 20 ° C-3
The reaction is performed at 5 ° C. for about 24 to 72 hours, and aeration and stirring are added as necessary. When culturing a transformant in which the host is an insect cell, Grace's Insect Medium (Grace, T .;
CC, Nature, 195, 788 (1962)) to which an inactivated additive such as 10% bovine serum is appropriately added. The pH of the medium is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or agitation are added. When culturing a transformant in which the host is an animal cell, examples of the medium include a MEM medium containing about 5 to 20% fetal bovine serum [Science, Vol. 122, 501 (1952)], D
MEM medium [Virology, 8, 396
(1959)], RPMI 1640 medium [Journal
The Journal of the American Medical Association
n) Volume 199, 519 (1967)], 199 Medium [Proceeding of the Society for the Biological Medicine (Proceeding of the Society)]
for the Biological Medicine), 73, 1 (195
0)]. Preferably, the pH is between about 6 and 8. The cultivation is usually carried out at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. Especially CHO
When (dhfr ⁻ ) cells and the dhfr gene are used as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine. The peptide of the present invention and the like can be separated and purified from the culture by, for example, the following method.

When extracting the peptide or the like of the present invention from the cultured cells or cells, after the culture, the cells or cells are collected by a known method and suspended in an appropriate buffer.
After disrupting cells or cells by ultrasonication, lysozyme and / or freeze-thawing, a method of obtaining a crude peptide extract by centrifugation or filtration may be used as appropriate. In the buffer solution, a protein denaturant such as urea or guanidine hydrochloride, or Triton X-100 (registered trademark; hereinafter, TM
May be abbreviated. ) May be included. When the peptide is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. Purification of the peptide of the present invention contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separations,
Purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and S filtration.
DS-polyacrylamide gel electrophoresis and other methods that mainly use differences in molecular weight; methods that use differences in charge such as ion-exchange chromatography; methods that use specific affinity such as affinity chromatography; A method utilizing a difference in hydrophobicity such as liquid chromatography, a method utilizing a difference in isoelectric points such as isoelectric focusing or chromatofocusing are used. When the peptide or the like of the present invention thus obtained is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when it is obtained as a salt, a method known per se Alternatively, it can be converted into a free form or another salt by a method analogous thereto.
Incidentally, the peptide of the present invention produced by the transformant,
By applying an appropriate protein modifying enzyme before or after purification, the protein can be arbitrarily modified or the peptide can be partially removed. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the peptide of the present invention thus produced can be measured by an enzyme immunoassay using a specific antibody or the like.

DNA encoding the peptide of the present invention
Alternatively, the peptide of the present invention may be a partial or full-length ligand of a galanin receptor protein, search for physiological actions of the peptide of the present invention, preparation of synthetic oligonucleotide probes or PCR primers, G protein-coupled receptor Acquisition of DNA encoding protein ligands and precursor proteins, development of receptor binding assay system using recombinant receptor protein expression system and screening of drug candidate compounds, acquisition of antibodies and antisera, DNA, RNA, antibodies Or the development of diagnostics using antisera, memory improvers (cognitive enhancers), appetite regulators, diabetes treatments, pituitary function improvers,
Uterine function regulator, kidney function regulator, prostate function regulator,
A testis function regulator or a skeletal muscle function regulator (preferably,
For the development of medicines such as memory function improvers (cognitive drugs), appetite regulators, uterine function regulators, kidney function regulators, prostate function regulators, testis function regulators or skeletal muscle function regulators), and gene therapy Can be used. In particular, by a receptor binding assay system using a recombinant G protein-coupled receptor protein expression system described below, a G protein-coupled receptor agonist or antagonist specific to a warm-blooded animal such as human can be screened, The agonist or antagonist can be used as an agent for preventing or treating various diseases. Further, regarding the above, the peptide of the present invention or a DNA encoding the same
Is a ligand recognized by galanin receptor (GALR) protein expressed in hippocampus, hypothalamus, uterus, kidney, prostate, skeletal muscle, pancreas, testis, spleen, heart, pituitary, etc. And is useful as a low-toxicity drug, for example, memory function improvers (cognitive enhancers), appetite regulators, antidiabetic drugs, pituitary function improvers, appetite regulators, uterine function regulators, renal function regulators, Prostate function regulator or skeletal muscle function regulator (preferably, memory function improver (cognitive agent), appetite regulator, uterine function regulator, kidney function regulator, prostate function regulator or skeletal muscle function regulator)
It can be used as such. Furthermore, the polypeptide of the present invention or a DNA encoding the same has a specific action of increasing blood LH concentration (LH secretion promoting action).
Since no H secretion promoting action is observed, the LH secretion promoting action is a specific action of the polypeptide of the present invention not found in galanin. Since the peptide of the present invention or the DNA encoding the same has a LH secretion promoting action,
Various diseases related to H secretion deficiency (specifically, infertility,
It can be used as a preventive or therapeutic drug for irregular menstruation, dysmenorrhea, amenorrhea, premenstrual syndrome, menopause, pituitary dysfunction or obesity. That is, a polypeptide of the present invention or a DNA encoding the polypeptide of the present invention.
LH secretion regulator containing
It can be used as a prophylactic / therapeutic agent for infertility, irregular menstruation, dysmenorrhea, amenorrhea, premenstrual syndrome, menopause, pituitary dysfunction or obesity. In addition, LH secretion regulators containing the polypeptide of the present invention or the DNA encoding the polypeptide of the present invention are particularly suitable for various diseases caused by abnormal leptin receptors (specifically, obesity,
It is considered to be effective as a prophylactic / therapeutic agent for infertility. On the other hand, since the polypeptide of the present invention has a high affinity for its receptor protein, when the dose of the polypeptide of the present invention or the DNA encoding the same is increased, desensitization to LH secretion occurs. It also has the effect of suppressing. In this case, the LH secretion regulator containing the polypeptide of the present invention or the DNA encoding the same is LH
As a secretion inhibitor, it can be used as a prophylactic / therapeutic agent for various diseases related to LH hypersecretion (specifically, prostate cancer, prostatic hypertrophy, precocious puberty or LH-producing pituitary tumor).

When the peptide of the present invention or the DNA encoding the same is used as the above-mentioned medicine, it can be carried out according to a conventional method. For example, a sugar-coated or enteric-coated tablet as required, a capsule, a elixir, orally as a microcapsule, or a sterile solution with water or another pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injections such as suspensions. For example, the compound or a salt thereof can be a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative,
It can be manufactured by mixing with a stabilizer, a binder and the like in a unit dosage form required for a generally accepted pharmaceutical practice. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained. When the DNA of the present invention is used, the DNA can be used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, followed by a conventional method. Examples of additives that can be incorporated into tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Swelling agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as fats and oils can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. For example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80 (TM), HCO-5)
0) and the like. The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent.

Further, a buffer (for example, a phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, and are therefore suitable for humans and mammals (eg, mice, rats, guinea pigs, rabbits, sheep, pigs, cows, cats, dogs, monkeys,
Etc.). The dose of the peptide of the present invention or the DNA encoding the same may vary depending on the symptoms and the like, but when the peptide is orally administered,
In general, for an adult (assuming a body weight of 60 kg), the dose is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day. When the peptide is administered parenterally (for example, by intravenous injection), the single dose depends on the administration subject,
Although it varies depending on the target organ, symptoms, administration method, etc., for example, in the form of an injection, for an adult (with a body weight of 60 kg), it is about 0.01 to 30 mg, preferably about 0.1 to 20 mg per day, Preferably, it is about 0.1 to 10 mg. In the case of other animals, the above dose per 60 kg can be administered in terms of the weight of the animal. In the present invention, as the galanin receptor, humans and warm-blooded animals (for example,
Any tissue (eg, pituitary gland) of a warm-blooded mammal (eg, rabbit, sheep, goat, rat, mouse, guinea pig, cow, horse, pig), bird (eg, chicken, pigeon, duck, goose, quail) , Pancreas, brain, kidney, liver,
Gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle,
A G protein-coupled receptor protein derived from lung, gastrointestinal tract, blood vessel, heart, etc.) or cells;
1 is SEQ ID NO: 11, GALR2 is SEQ ID NO: 12, and GALR3 is any as long as it contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13. Is also good. That is, as the receptor protein, SEQ ID NO:
In addition to the protein containing the amino acid sequence represented by 11, 12, or 13, SEQ ID NO: 11, 12, or 1
3 containing an amino acid sequence having about 90-99.9% homology with the amino acid sequence represented by SEQ ID NO: 3,
Proteins having substantially the same activity as the protein containing the amino acid sequence represented by 12 or 13 can be mentioned.

The activities exhibited by these proteins include, for example, ligand binding activity and signal transduction activity. Substantially the same indicates that their activities are the same in nature. Therefore, quantitative factors such as strength of ligand binding activity and signal transduction activity and molecular weight of receptor protein may be different. Further, the receptor protein may be one in which the N-terminal Met is protected by a protecting group (for example, a C _1-6 alkanoyl group such as a formyl group or an acetyl group), and the N-terminal glutamine residue is pyroglutamine-oxidized. Wherein the side chain of the amino acid in the molecule is protected with a suitable protecting group (for example, a C _1-6 alkanoyl group such as a formyl group or an acetyl group);
Alternatively, a complex protein such as a so-called glycoprotein to which a sugar chain is bound is also included. Examples of the salt of the receptor protein include the same salts as the above-mentioned salts of the peptide.
The receptor protein or a salt thereof or a partial peptide thereof can be produced from human or warm-blooded animal tissues or cells by a protein purification method known per se, or a transformant containing a DNA encoding the aforementioned peptide. Can also be produced by the same method as the method of culturing. Further, it can be produced according to the above-mentioned peptide synthesis method. As the partial peptide of the receptor protein, for example, a site of the G protein-coupled receptor protein molecule which is exposed outside the cell membrane is used.
That is, in the hydrophobic plot analysis of the G protein-coupled receptor protein, the extracellular region (Hydrophilic)
Site).
Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. As the salt of the partial peptide of the receptor protein, those similar to the salts of the above-mentioned peptides are used.

The DNA encoding the galanin receptor protein contains a nucleotide sequence encoding a galanin receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence of SEQ ID NO: 11, 12 or 13. Anything can be used as long as it does. In addition, they are genomic DNA, genomic DNA
Any of a library, a cDNA derived from a tissue / cell, a cDNA library derived from a tissue / cell, and a synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by a known RT-PCR method using an RNA fraction prepared from tissues or cells. Specific examples of the DNA encoding the galanin receptor containing the amino acid sequences of SEQ ID NOs: 11, 12, and 13 include DNAs having the base sequences represented by SEQ ID NOs: 17, 18, and 19, respectively. SEQ ID NO: 17 is the nucleotide sequence of rat GALR1 (galanin receptor type 1) cDNA, and SEQ ID NO: 18 is the rat GALR2 (galanin receptor type 2) c
SEQ ID NO: 19 is a rat GA
1 shows the nucleotide sequence of LR3 (galanin receptor type 3) cDNA. GALR2 (galanin receptor
Type 2) is widely distributed in the hippocampus, hypothalamus, uterus, kidney, prostate, skeletal muscle, and the like. A neutralizing antibody against the peptide) can be used as a memory function improving agent, an appetite improving agent, or a uterine, kidney, prostate or skeletal muscle function improving agent. GALR1 (galanin receptor type 1) is widely distributed in the hypothalamus, hippocampus, pancreas and the like. Neutralizing antibodies against peptides) can be used as antiobesity drugs, cognitive drugs, and insulin secretion drugs. GALR3
(Galanin receptor type 3) is testis, spleen,
Distributed in the heart, hypothalamus, pituitary, etc.,
The peptide of the present invention (or an antagonist to GALR3 and a neutralizing antibody to the peptide of the present invention), which is an agonist having GALR3 activating ability, can be used as a testis, spleen, or heart function improving agent. The present invention provides (1) contacting a test substance with a cell membrane fraction expressing a galanin receptor, which is obtained by culturing a transformant (cell) containing a DNA encoding the galanin receptor. Galanin, wherein the amount of binding of, for example, ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate to the cell membrane fraction is measured and compared when the test substance is not brought into contact with the test substance. Screening method for receptor activator (agonist) or salt thereof, and (2) transformant (cell) containing DNA encoding galanin receptor described above
When the cell membrane fraction expressing the galanin receptor obtained by culturing is contacted with galanin or the peptide of the present invention, and when the galanin or the peptide of the present invention is contacted in the presence of the test substance, for example,
^A method for screening a galanin receptor activation inhibitor (antagonist) or a salt thereof, comprising measuring and comparing the amount of binding of ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate to the cell membrane fraction. And so on.

The screening method of the present invention will be specifically described below. The above-mentioned galanin receptor protein may be any one containing a galanin receptor protein of GALR1, GALR2 or GALR3 or a partial peptide thereof and having the receptor function. Cell membrane fractions prepared from cultured cells expressing the galanin receptor protein in large amounts using (cells) (the preparation method thereof will be described later) are preferred. The cell containing the galanin receptor protein refers to a host cell that expresses the galanin receptor protein. Examples of the host cell include the aforementioned yeast, insect cells, and animal cells. Is preferred. The membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se. As a method for disrupting cells,
Methods include crushing cells with a Potter-Elvehjem homogenizer, crushing with a Waring blender or Polytron (Kinematica), crushing with ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure with a French press, etc. . For fractionation of cell membranes, fractionation by centrifugal force, such as fractionation centrifugation and density gradient centrifugation, is mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically, about 1 minute to 10 minutes), and the supernatant is further centrifuged (15000).
(rpm to 30,000 rpm) for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is mainly composed of a membrane protein and a phospholipid constituting a cell membrane, and includes a G protein originally expressed by the cell together with the expressed galanin receptor. The amount of galanin receptor in cells and membrane fractions containing the galanin receptor is:
It is preferably 1-100 pmol, more preferably 5-20 pmol, per mg of membrane fraction protein. The higher the expression level of the galanin receptor, the higher the receptor activation activity (ligand binding activity, specific activity) per membrane fraction, which not only enables the construction of a highly sensitive screening system, but also enables the same lot to be constructed. Can measure a large amount of samples. Specifically, as a method for screening a compound (agonist) that activates a galanin receptor, first, a membrane fraction of a cell containing a galanin receptor is suspended in a buffer suitable for screening to prepare the receptor sample. Prepare. The buffer may have a pH of about 4 to about 10 (preferably, a pH of about 6 to about 8).
Or a tris-hydrochloric acid buffer containing about 1 to 5 mM of magnesium ion, and guanosine diphosphate (GDP) of about 0.1 to about 5 mM.
nM to 100 μM, preferably about 0.1 to 1 μM may be added. In addition, a protease inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide Research Laboratories), or pepstatin may be added for the purpose of suppressing the degradation of the receptor or the test substance by the protease. About 0.01 ~
A fixed amount (5000 cp) is added to 10 ml of the receptor solution.
m-50000 cpm) of ³⁵ S-labeled guanosine-5'-O-.
Add 3-thiotriphosphate and the test substance. On the other hand, a reaction system (subject group) to which only the ³⁵ S-labeled guanosine-5'-O-3-thiotriphosphate was added without adding the test compound was also prepared.
The reaction is carried out at about 0-50 ° C, preferably about 4 ° -37 ° C for about 2 hours.
The reaction is carried out for 0 minute to 24 hours, preferably for about 30 minutes to 3 hours. After the reaction, the reaction solution is filtered through a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity of ³⁵ S-labeled guanosine-5′-O-3-thiotriphosphate remaining on the glass fiber filter is measured using a liquid scintillation counter. measure. If the compound has an increased radioactivity when the test compound is added compared to the radioactivity when the test compound is not added, the compound is selected as a candidate compound capable of activating the galanin receptor. can do. To screen for a compound (antagonist) that inhibits the activation of the galanin receptor, a cell membrane fraction is prepared in the same manner as in the case of the above-described agonist screening, and a certain amount (500
0 cpm to 50,000 cpm) ³⁵ S-labeled guanosine
-5'-O-3-thiotriphosphate, and 10 ^-4 to 10 ^-6 M
Of galanin or a peptide according to the present invention, and a test substance. In addition, ³⁵ S-labeled guanosine-5'-O-3
A reaction system (subject group) is also prepared in which thiotriphosphate and galanin or the peptide according to the present invention are added and the test compound is not added. Perform a reaction in the same manner as above, and if the compound has a large decrease in radioactivity when the test compound is added compared to the radioactivity when the test compound is not added, it is used to activate the galanin receptor. It can be selected as a candidate compound capable of inhibiting.

Examples of the test substance include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. These compounds are novel compounds Or a known compound. Since the galanin receptor agonist has the same activity as the physiological activity of the peptide of the present invention on the galanin receptor, it is useful as a safe and low-toxic drug like the peptide of the present invention. Conversely, a galanin receptor antagonist can suppress the physiological activity of the peptide of the present invention on the galanin receptor protein, and is therefore useful as a safe and low-toxic drug for suppressing the receptor activity. As a salt of the substance obtained by using the above-mentioned screening method, for example, a pharmaceutically acceptable salt or the like is used. Examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt. Preferred examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine,
Salts with ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N'-dibenzylethylenediamine and the like can be mentioned. Preferred examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Salts with acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid and the like can be mentioned. Preferred examples of salts with basic amino acids include:
For example, salts with arginine, lysine, ortin and the like can be mentioned, and preferable examples with acidic amino acids include, for example, salts with aspartic acid, glutamic acid and the like.
When the substance obtained by using the screening method of the present invention or a salt thereof is used as the above-mentioned medicine, it can be carried out in the same manner as when the above-mentioned peptide of the present invention is used as a medicine. Antibodies against the peptide of the present invention (eg, polyclonal antibodies, monoclonal antibodies)
Alternatively, the antiserum uses the peptide of the present invention as an antigen,
It can be produced according to a method for producing an antibody or antiserum known per se.

For example, a polyclonal antibody can be produced according to the method described below. [Preparation of polyclonal antibody] A polyclonal antibody against the peptide of the present invention can be produced according to a method known per se or a method analogous thereto. For example, a complex of an immunizing antigen (antigen such as a peptide) and a carrier protein is formed, and a warm-blooded animal (eg, a mammal warm-blooded animal (eg, rabbit, sheep, goat, rat, Immunize mice, guinea pigs, cows, horses, pigs), birds (eg, chickens, pigeons, ducks, geese, quails), etc., and collect antibody-containing substances against the peptide of the present invention from the immunized animals. Can be produced by separation and purification of Regarding a complex of an immunizing antigen and a carrier protein used for immunizing a mammal, the type of the carrier protein and the mixing ratio between the carrier and the hapten (the peptide of the present invention or a partial peptide thereof) are determined by cross-linking with the carrier. If antibodies can be efficiently produced against the hapten
Whatever may be crosslinked at any ratio, for example, carriers such as bovine serum albumin, bovine thyroglobulin, keyhole limpet hemocyanin, etc.
About 0.1 to 2 parts by weight of protein per hapten
A method of coupling at a ratio of 0, preferably about 1 to 5 is used. For coupling the hapten and the carrier, various condensing agents can be used. For example, glutaraldehyde, carbodiimide, a maleimide active ester, an active ester reagent containing a thiol group or a dithiopyridyl group, or the like is used. The condensation product is administered to the above-mentioned warm-blooded animal at a site capable of producing an antibody itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody is collected from the blood, ascites, etc., preferably from the blood of the mammal immunized by the above method. The antibody titer to the peptide of the present invention in the antiserum can be measured in the same manner as the antibody titer of the hybridoma culture supernatant described later. Antibody separation and purification can be performed according to the same immunoglobulin separation and purification method as the monoclonal antibody separation and purification described below.

The monoclonal antibody can be produced according to the method described below. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The peptide of the present invention can be prepared from a warm-blooded animal (for example, a mammal warm-blooded animal (eg, rabbit, sheep, goat, rat, mouse, guinea pig, cow, horse) , Pigs) and birds (eg, chickens, pigeons, ducks, geese, quails), etc., by themselves or together with carriers and diluents at sites where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually 2-6
It is performed once a week, about 2 to 10 times in total. When preparing monoclonal antibody-producing cells, the above-mentioned warm-blooded animal immunized with the antigen, for example, an individual having an antibody titer was selected from a mouse or the like, and the spleen or lymph node was collected 2 to 5 days after the final immunization. By fusing the antibody-producing cells contained therein with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The measurement of the antibody titer in the antiserum is performed, for example, by reacting the peptide labeled with the labeling agent described below or a partial peptide thereof with the antiserum, and then measuring the activity of the labeling agent bound to the antibody. . The fusion operation is performed by known methods, for example, the method of Koehler and Milstein [Nature, 25
6, 495 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used. Examples of myeloma cells include NS-1, P3U1,
SP2 / 0, AP-1 and the like can be mentioned, but P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is 1: 1 to 2
0: 1, and PEG (preferably PEG1000
-PEG6000) is added at a concentration of about 10-80%, and at 20-40 ° C, preferably 30-37 ° C, 1-10
Cell incubation can be carried out efficiently by incubating for minutes. Various methods can be used for screening an antibody-producing hybridoma against the peptide of the present invention. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which the peptide antigen of the present invention is adsorbed directly or together with a carrier. Then, an anti-immunoglobulin antibody labeled with a radioactive substance, an enzyme, or the like (if the cell used for cell fusion is a mouse, an anti-mouse immunoglobulin antibody is used) or Protein A, is added to the solid phase of the present invention. A method for detecting a monoclonal antibody against a peptide, adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a peptide of the present invention labeled with a radioactive substance, an enzyme, or the like, and binding to the solid phase Method for detecting a monoclonal antibody against the peptide of the present invention And the like. Selection of the monoclonal antibody against the peptide of the present invention can be carried out according to a method known per se or a method analogous thereto. Usually, it is performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a selection and breeding medium, any medium can be used as long as a hybridoma can grow.
For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal calf serum, GIT medium containing 1-10% fetal calf serum (Wako Pure Chemical Industries, Ltd.) or serum-free for hybridoma culture Medium (SFM-101,
Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The cultivation is usually performed under 5% carbon dioxide.
The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer for the peptide of the present invention in the antiserum. (B) Purification of Monoclonal Antibody Separation and purification of the monoclonal antibody against the peptide of the present invention can be carried out in the same manner as in the separation and purification of normal polyclonal antibodies, such as immunoglobulin separation and purification methods (eg, salting-out method, alcohol precipitation method, isoelectric focusing method). Method, electrophoresis, ion exchanger (eg, D
EAE) adsorption / desorption method, ultracentrifugation method, gel filtration method, specific purification method in which an antibody alone is collected using an antigen-bound solid phase or an active adsorbent such as protein A or protein G and the bond is dissociated to obtain the antibody] It is performed according to.

The antibody against the peptide of the present invention produced according to the above-mentioned methods (a) and (b) can specifically recognize the peptide of the present invention. Quantification, particularly quantification by sandwich immunoassay. That is, the present invention provides, for example, (i) competitive reaction between an antibody that reacts with the peptide of the present invention and a test solution and the labeled peptide of the present invention, and the labeled peptide of the present invention bound to the antibody. (Ii) reacting the test solution with an antibody insolubilized on a carrier and a labeled antibody simultaneously or successively, wherein the method comprises the steps of: And then measuring the activity of the labeling agent on the insolubilized carrier, wherein one of the antibodies recognizes the N-terminal of the peptide of the present invention. A method for quantifying a peptide of the present invention in a test solution, wherein the other antibody is an antibody that reacts with a site other than the N-terminal (for example, the C-terminal) of the peptide of the present invention. I do. The peptide of the present invention can be measured using a monoclonal antibody that recognizes the peptide of the present invention, and can also be detected by tissue staining or the like. For these purposes, the antibody molecule itself may be used, and the F (ab ′) ₂ , F
The ab 'or Fab fraction may be used. The measurement method using the antibody of the present invention is not particularly limited, and the amount of antigen (eg, the amount of ligand peptide) in the liquid to be measured
If the measurement method is to detect the amount of the antibody, antigen or antibody-antigen complex corresponding to the above by chemical or physical means and calculate this from a standard curve prepared using a standard solution containing a known amount of antigen, Any of the measurement methods may be used. For example, nephelometry, a competitive method, an immunometric method, and a sandwich method are preferably used, and in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later. Examples of the labeling agent used in the measurement method using the labeling substance include a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like. As the radioisotope, for example, [ ^1
25 I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are preferable as the above-mentioned enzymes, which are stable and have high specific activities. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase ,
Malate dehydrogenase, etc., as fluorescent substances, fluorescamine, fluorescein isothiocyanate, etc.
Examples of the luminescent substance include luminol, luminol derivatives, luciferin, lucigenin and the like. Furthermore, biotin-
Avidin systems can also be used. For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, a test solution is reacted with an antibody against the insoluble peptide of the present invention (primary reaction), and further reacted with a labeled antibody against the peptide of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the peptide of the present invention in the test solution can be determined. Even if the primary reaction and the secondary reaction are performed in reverse order,
Further, they may be performed at the same time or at different times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may.

In the method for measuring the peptide of the present invention by the sandwich method of the present invention, the antibodies against the peptide of the present invention used in the primary reaction and the secondary reaction are preferably antibodies having different binding sites for the peptide of the present invention. Used. That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the peptide of the present invention, the antibody used in the primary reaction is preferably An antibody that recognizes, for example, the N-terminal portion other than the C-terminal portion is used. An antibody against the peptide of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry. In the competition method, after the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, the unreacted labeled antigen, (F) and the labeled antigen (B) combined with the antibody
(B / F separation), the amount of labeling of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method,
A soluble antibody is used as the antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody to the antibody, or a solid phased antibody is used as the first antibody. And an immobilization method using an immobilized antibody as the second antibody. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. And an excess amount of the labeled antibody, and then immobilized antigen is added to bind unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used. In applying these individual immunological assay methods to the assay method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measuring system of the peptide of this invention or its partial peptide, adding the usual technical consideration of those skilled in the art to the usual conditions and operation methods in each method. For more information on these common technical measures,
Review articles, books, etc. can be referred to [for example, Hiroe Irie, "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Continuing Radio Immunoassay" (Kodansha, published in 1974), Eiji Ishikawa et al. "Enzyme immunoassay" (ed., Medical Shoin, published in 1978), "Enzyme immunoassay" (ed. 2nd edition) (ed.), Eiji Ishikawa, et al. "Methods" (3rd edition) (Issue Shoin, published in 1987), "Methods in ENZYMOLOGY"
Vol. 70 (Immunochemical Techniques (Part A)), same book
Vol. 73 (Immunochemical Techniques (Part B)), same book
Vol. 74 (Immunochemical Techniques (Part C)), Ibid.
l. 84 (Immunochemical Techniques (Part D: Selected Im
munoassays)), Ibid.Vol. 92 (Immunochemical Techniqu
es (Part E: Monoclonal Antibodies and General Immuno
assay Methods)), Ibid.Vol. 121 (Immunochemical Tech)
niques (Part I: Hybridoma Technology and Monoclonal A
ntibodies)) (see above, published by Academic Press). As described above, the peptide of the present invention can be quantified with high sensitivity by using an antibody against the peptide of the present invention.

Furthermore, by quantifying the concentration of the peptide of the present invention using the antibody of the present invention, it can be used as a diagnostic agent. That is, (1) when a change in the concentration of the peptide or the like of the present invention is detected, for example, it is a disease such as obesity, dementia, diabetes, or pituitary tumor, or the disease is likely to be affected in the future. Can be diagnosed. Further, the antibody of the present invention can be used for detecting the peptide of the present invention or the like present in a subject such as a body fluid or a tissue. In addition, preparation of an antibody column used for purifying the peptide of the present invention, detection of the peptide of the present invention in each fraction during purification, analysis of the behavior of the peptide of the present invention in the test cells, etc. Can be used for

Using the DNA of the present invention, a transgenic animal expressing the peptide of the present invention can be prepared. Examples of animals include mammals (for example, rats, mice, rats, sheep, pigs, cows, cats, dogs, monkeys, and the like), and mouse and rat are particularly preferable. Such an animal is very useful for functional analysis of the peptide of the present invention, research on diseases related thereto, and the like. In transferring the DNA of the present invention to a target animal, it is generally advantageous to use the DNA as a gene construct linked downstream of a promoter capable of being expressed in animal cells. For example, the DN of the present invention derived from a mouse
When transferring A, a gene construct linked to downstream of various promoters capable of expressing the DNA of the present invention derived from an animal having high homology with the animal cell in animal cells, for example,
By microinjection into a mouse fertilized egg, a DNA-transferred animal that highly produces the receptor protein of the present invention can be produced. As this promoter, for example, a ubiquitous expression promoter such as a virus-derived promoter or metallothionein may be used, but an NGF gene promoter or an enolase gene promoter that is specifically expressed in the brain is preferably used. Transfer of the DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target animal. The presence of the peptide of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the peptide of the present invention in all of its germ cells and somatic cells. The progeny of such animals that have inherited the gene will have the peptide of the invention in all of their germinal and somatic cells. After confirming that the DNA-transferred animal of the present invention stably retains the gene by breeding, it can be subcultured in a normal breeding environment as the DNA-bearing animal. Furthermore, by crossing male and female animals having the target DNA, homozygous animals having the transgene on both homologous chromosomes are obtained, and by crossing the male and female animals, all the offspring have the DNA. Breeding can be subcultured. The animal into which the DNA of the present invention has been transferred has high expression of the peptide of the present invention, and thus is useful as an animal for screening for an agonist or antagonist for the peptide of the present invention. The transgenic animal of the present invention can also be used as a cell source for tissue culture. For example, the DN of the present invention
The peptide of the present invention can be analyzed by directly analyzing DNA or RNA in the tissue of the A-transferred mouse or by analyzing the tissue in which the peptide of the present invention expressed by the gene is present. The cells of a tissue having the peptide of the present invention can be cultured by standard tissue culture techniques and used to study the function of cells from commonly difficult tissues such as, for example, from brain or peripheral tissues. . In addition, by using the cells, for example, a drug that enhances the function of various tissues can be selected. Further, if there is a high expression cell line, the peptide of the present invention can be isolated and purified therefrom.

Further, by using the same method as described above, a knockout animal in which the gene encoding the peptide of the present invention has been disrupted and its function has been lost can also be produced. Such knockout animals are also very useful for functional analysis of the peptide of the present invention.

In the present specification and drawings, when bases, amino acids, and the like are represented by abbreviations, IUPAC-IUB
It is based on the abbreviation by the Commission on Biochemical Nomenclature or the abbreviation commonly used in the relevant field. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine Y: thymine or cytosine N: thymine, cytosine, adenine or guanine R: adenine or guanine M: cytosine or adenine W: thymine or adenine Adenine S: cytosine or guanine I: inosine H: adenine, thymine or cytosine D: guanine, adenine or thymine B: guanine, thymine or cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine Triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate EDTA: ethylenediaminetetraacetic acid S S: sodium dodecyl sulfate EIA: enzyme immunoassay Gly or G: glycine Ala or A: alanine Val or V: valine Leu or L: leucine Ile or I: isoleucine Ser or S: serine Thr or T: threonine Cys or C: cysteine Or M: methionine Glu or E: glutamate Asp or D: aspartic acid Lys or K: lysine Arg or R: arginine His or H: histidine Phe or F: phenylalanine Tyr or Y: tyrosine Trp or W: tryptophan Pro or P: Asn or N: asparagine Gln or Q: glutamine pGlu: pyroglutamic acid Me: methyl group Et: ethyl group B u: butyl group Ph: phenyl group TC: thiazolidine-4 (R) -carboxamide group

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene-2,3
- dicarboximide Bzl: benzyl Cl ₂ -Bzl: di-chlorobenzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chloro benzyloxycarbonyl Boc: t-butyloxycarbonyl HOBt: 1 -Hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tert-butoxymethyl Trt: trityl PAM: phenylacetamidomethyl BHA: benz Hydrylamine Bom: benzyloxymethyl OcHex: cyclohexyl ester MeBzl: 4-methylbenzyl CHO: formyl NMP: N-methylpyrrolidone

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the mature mouse GALR2 ligand of the present invention. [SEQ ID NO: 2] This shows the amino acid sequence of the mouse GALR2 ligand precursor of the present invention. [SEQ ID NO: 3] This shows the base sequence of cDNA of mouse GALR2 ligand of the present invention. [SEQ ID NO: 4] cD of mouse GALR2 ligand
The base sequence of the primer used for PCR for cloning NA is shown. [SEQ ID NO: 5] cD of mouse GALR2 ligand
The base sequence of the primer used for PCR for cloning NA is shown. [SEQ ID NO: 6] This shows the base sequence of cDNA cloned using primers of SEQ ID NOs: 4 and 5. [SEQ ID NO: 7] cD of mouse GALR2 ligand
The base sequence of the primer used for 5′RACE for cloning NA is shown. [SEQ ID NO: 8] cD of mouse GALR2 ligand
The base sequence of the primer used for 3′RACE for cloning NA is shown. [SEQ ID NO: 9] cD of mouse GALR2 ligand
The base sequence of the primer used for PCR for cloning NA is shown. [SEQ ID NO: 10] c of mouse GALR2 ligand
1 shows the nucleotide sequence of a primer used for PCR for cloning DNA. [SEQ ID NO: 11] rat-type GALR1 (galanin
1 shows the entire amino acid sequence of receptor type 1). [SEQ ID NO: 12] rat-type GALR2 (galanin
The entire amino acid sequence of receptor type 2) is shown. [SEQ ID NO: 13] rat-type GALR3 (galanin
The entire amino acid sequence of receptor type 3) is shown. [SEQ ID NO: 14] This shows the amino acid sequence of the pig-type galanin receptor ligand (described in WO 99/48920). [SEQ ID NO: 15] Amino acid sequence of rat-type galanin receptor ligand (described in WO99 / 48920)
Is shown. [SEQ ID NO: 16] This shows the amino acid sequence of human galanin receptor ligand (described in WO99 / 48920). [SEQ ID NO: 17] Rat-type GALR1 (galanin
1 shows the nucleotide sequence of cDNA of receptor type 1). [SEQ ID NO: 18] rat-type GALR2 (galanin
The nucleotide sequence of the receptor type 2) cDNA is shown. [SEQ ID NO: 19] rat-type GALR3 (galanin
The nucleotide sequence of the receptor type 3) cDNA is shown. [SEQ ID NO: 20] This shows the base sequence of cDNA of mouse GALR2 ligand precursor of the present invention.

The transformant Esc obtained in Example 1 described later
herichia coli TOP10 / pGR2ML1 has been deposited with the Fermentation Research Institute (IFO) since February 2, 2000 under the deposit number IFO 16361.
And from the Ministry of International Trade and Industry of Japan (NIBH, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan) as deposit number FERM BP-70 from March 16, 2000.
Deposited as 92.

[0040]

The present invention will be described in more detail with reference to the following Examples, which do not limit the scope of the present invention. Example 1 Cloning of mouse-type ligand peptide cDNA Mouse testis Marathon-Ready cDNA (derived from BALB / c mouse, C
Primer F / R120 and R / R120
(Described in WO 99/48920) to perform PCR. F / R120: 5'-AGGCTGGACCCTCAATAGTGCTGGTTAC-3 '(SEQ ID NO: 4) R / R120: 5'-CCATCTATGGCCTTCCACAGGTCTAGGA-3' (SEQ ID NO: 5) 0.5 μl of ExTaq (Takara Shuzo) PCR reaction solution attached 5 μl of 10x PCR buffer and 2.5 mM dNTP mixture in 4
μl, primers F / R120 and R / R120 (10 μl each)
M), 0.5 μl each, 1 μl template cDNA and 34.
5 μl were mixed, and the reaction conditions were: initial denaturation at 94 ° C for 30 seconds, 35 cycles of 94 ° C / 30 seconds-62 ° C / 30 seconds-72 ° C / 60 seconds, and 72 ° C / 30 seconds. The final extension reaction was 10 minutes. The obtained DNA fragment was cloned using a TOPO TA Cloning Kit (Invitrogen) according to the method described in the attached manual. ABI377D for the sequence of the cloned DNA
Decoding was performed using NA sequencer, and the sequence of SEQ ID NO: 6 was obtained. AGGCTGGACC CTCAATAGTG CTGGTTACCT CCTGGGTCCT GTCCTCCCCG TTTCCTCCAA 60 GGCCGACCAG GGCAGGAAGA GAGACTCAGC TCTTGAGATC CTAGACCTGT GGAAGGCCAT 120 AGATGG 126 (SEQ ID NO: 6) Primer 1F / M120 from the obtained sequence
(SEQ ID NO: 7) and 1R / M120 (SEQ ID NO: 8) were prepared and used in the 5′RACE and 3′RACE experiments described below. 1F / M120: 5'-TCCAAGGCCGACCAGGGCAGGAAGAGAG-3 '(SEQ ID NO: 7) 1R / M120: 5'-GGTCTAGGATCTCAAGAGCTGAGTCTCT-3' (SEQ ID NO: 8) PCR reaction solution of 5'RACE and 3'RACE was Taq (Takara Shuzo Co., Ltd.) Company)
0.5 μl, attached 10x PCR buffer (500 mM KCl-25 mM MgC
_{l 2 -100 mM Tris · HCl,} pH 8.3) and 5 μl, 2.5 mM dNTP m
4 μl of ixture, 3 μl of 25 mM MgCl ₂ , 10 μM primer F / R120 (for 3'RACE) or 10 μM primer R / R1
1 μl of 20 (for 5'RACE), 1 μl of 10 μM primer AP1 (primer AP1 is attached to Marathon-Ready cDNA Kit of CLONTECH), template cDNA (CLONTECH, mouse testis Marathon-Ready cDNA) 5 μl and distilled water 31
μl was prepared by mixing. The reaction conditions were as follows: after initial denaturation at 94 ° C for 60 seconds, 5 cycles of 94 ° C for 30 seconds-72 ° C for 120 seconds.
℃ ・ 30sec-70 ℃ ・ 120sec cycle reaction 5 times, 94 ℃ ・ 30sec-6
The cycle reaction at 8 ° C for 120 seconds was performed 25 times and the final extension reaction at 68 ° C for 10 minutes. Subsequently, nested PCR was performed using the reaction solution of the PCR reaction as a template. The reaction solution was 0.5 μl of Taq (Takara Shuzo Co., Ltd.) and the attached 10x PCR buffer (500 mM KCl-25 m
M MgCl ₂ -100 mM TrisHCl, pH 8.3) 5 μl, 2.5 mM d
NTP mixture 4 μl, 25 mM MgCl ₂ 3 μl, 10 μM primer 1F / M120 (for 3'RACE) or 10 μM primer 1R / M120 (for 5'RACE) 1 μl, 10 μM primer A
P2 (primer AP2 is a CLONTECH Marathon-Ready cDNA
1 μl of the template DNA (50 PCR reactions)
5 μl) and 31 μl of distilled water were mixed. Reaction conditions are 94 ° C for 30 seconds after initial denaturation at 94 ° C for 60 seconds.
5 cycles of -72 ° C for 120 seconds, 94 ° C for 30 seconds -70 ° C for 120 seconds
The cycle reaction of 5 seconds was performed 5 times, the cycle reaction of 94 ° C./30 seconds-68 ° C./120 seconds was performed 25 times, and the final extension reaction was performed at 68 ° C./10 minutes. The obtained DNA fragment is used as a TOPO TA Cloning Kit (Invitrog
(en company) according to the method described in the attached manual. The cloned DNA sequence was decoded to obtain sequence information of the 5 'end and 3' end. Based on this sequence information, primers 1F / M650 and 1R / M650 were prepared. 1F / H650: 5'-GAAAGACAGTCTCAAATCAAGGACCTGC-3 '(SEQ ID NO: 9) 1R / H650: 5'-TGAGCTGGAAACGAAGGAGGAGTGAGGT-3' (SEQ ID NO: 10) Balb / c mouse-derived testis poly (A) + RNA (Nippon Gene) Supersrcipt II reverse transcript
Single strand DNA was synthesized using ase (GIBCO / BRL). PCR was performed using this DNA as a template and primers F / M650 and R / M650. PCR reaction solution is Pfu DNA polymerase
1 μl (Stratagene) and 5 μl of the attached 10x PCR buffer
l, 2.5 mM dNTP mixture 4 μl, 10 μM primer F / M
650 and R / M650 were prepared by mixing 2.5 μl each, 1 μl of template DNA, and 34.5 μl of distilled water. The reaction condition is 94 ℃ ・ 3
After an initial denaturation of 0 seconds, a cycle reaction of 94 ° C / 30 seconds-67 ° C / 30 seconds-72 ° C / 4 minutes was performed 30 times, and a final extension reaction at 72 ° C / 10 minutes was performed. The obtained DNA fragment was transformed into pCRII Blunt TOPO vector (In
(vitrogen) according to the method described in the attached manual. Cloned DNA
The sequence was sequenced according to a standard method, and mouse GALR2 li
pGR2ML1 having a 180 bp DNA fragment (SEQ ID NO: 3) encoding the full-length gand peptide was obtained. E. coli TOP10 transformed with the plasmid was
It was named OP10 / pGR2ML1. The amino acid sequence deduced from the base sequence of 180 base pairs is shown in SEQ ID NO: 2. The mature part is shown in SEQ ID NO: 1. The amino acid sequence of the mature portion was compared with the amino acid sequences of porcine small intestinal galanin (galanin), porcine GalR2 ligand (P-GALR2L), rat GalR2 ligand (R-GALR2L) and human GalR2 ligand (H-GALR2L). However, the amino acid sequence of the mature portion showed high homology to porcine GalR2 ligand (P-GALR2L), rat GalR2 ligand (R-GALR2L) and human GalR2 ligand (H-GALR2L) (FIG. 1). reference).

[0041]

The peptide of the present invention or its precursor or its amide or its ester or its salt is
It has the ability to activate galanin receptors. Therefore, it can be used for the development of a medicament such as a function regulator with few side effects in the hypothalamus, pituitary gland, uterus, kidney, prostate or skeletal muscle where the galanin receptor is distributed in large amounts. By using the peptide of the present invention or its precursor, its amide or its ester or its salt, it becomes possible to screen for a compound that changes the binding to the galanin receptor.

[0042]

[Sequence List Free Text]

SEQ ID NO. 4 Designed oligonucleotide Primer to amplify mouse G
ALR2 ligand. SEQ ID NO. 5 Designed oligonucleotide Primer to amplify mouse G
ALR2 ligand. SEQ ID NO. 7 Designed oligonucleotide Primer for 5 'RACE to amp
lify mouse GALR2 ligand. SEQ ID NO. 8 Designed oligonucleotide Primer for 3 'RACE to amp
lify mouse GALR2 ligand. SEQ ID NO. 9 Designed oligonucleotide Primer to amplify mouse G
ALR2 ligand. SEQ ID NO. 10 Designed oligonucleotide Primer to amplify mouse G
ALR2 ligand.

[0043]

[Sequence List] Sequence Listing <110> Takeda Chemical Industries, Ltd. <120> Novel Physiological Active Peptide and its Use <130> 177095 <160> 19 <210> 1 <211> 60 <212> PRT <213> Mouse < 400> 1 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu Pro Val Ser Ser Lys Ala Asp Gln Gly 20 25 30 Arg Lys Arg Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ile Ile 35 40 45 Asp Gly Leu Pro Tyr Ser His Ser Pro Arg Met Thr 50 55 60 <210> 2 <211> 117 <212> PRT <213> Mouse <400> 2 Met Ala Cys Ser Val His Leu Val Leu Phe Leu Thr Ile Leu Leu Ser 1 5 10 15 Leu Ala Glu Thr Pro Glu Ser Ala Pro Ala His Arg Gly Arg Gly Gly 20 25 30 Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Pro Val Leu Pro Val 35 40 45 Ser Ser Lys Ala Asp Gln Gly Arg Lys Arg Asp Ser Ala Leu Glu Ile 50 55 60 Leu Asp Leu Trp Lys Ile Ile Asp Gly Leu Pro Tyr Ser His Ser Pro 65 70 75 80 Arg Met Thr Lys Arg Thr Met Gly Glu Thr Phe Val lys Ala Asn Thr 85 90 95 Gly Asp Met His Ile Leu Asp Lys Asn Val Pro Lys Glu Glu Ala Thr 100 105 110 Leu Asp Ser Glu Ser 115 <210> 3 <211> 180 <212> DNA <213> Mouse <400> 3 tgtggaagat cattgatgga cttccttatt cccactctcc aaggatgacc 180 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide Primer to amplify mouse GALR2 ligand <400> 4 aggctggacc ctcaatagtg ctggttac 28 <210> 5 < 211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide Primer to amplify mouse GALR2 ligand <400> 5 ccatctatgg ccttccacag gtctagga 28 <210> 6 <211> 126 <212> DNA <213> Mouse <400> 6 aggctggacc ctcaatagtg ctggttacct cctgggtcct gtcctccccg tttcctccaa 60 ggccgaccag ggcaggaaga gagactcagc tcttgagatc ctagacctgt ggaaggccat 120 agatgg 126 <210> 7 <211> 28 <212> DNA <212> Sequence <220> DNA <212> 5 to amplify mouse GALR2 ligand <400> 7 tccaaggccg accagggcag gaagagag 28 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide Primer for 3 'RACE to amplify mouse GALR2 ligand <400> 8 ggtctaggat ctcaagagct gagtctct 28 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide Primer to amplify mouse GALR2 ligand <400> 9 gaaagacagt ctcaaatcaa ggacctgc 28 <210> 10 <211> 28 <212> DNA <213 > Artificial Sequence <220> <223> Designed oligonucleotide Primer to amplify mouse GALR2 ligand <400> 10 tgagctggaa acgaaggagg agtgaggt 28 <210> 11 <211> 346 <212> PRT <213> Rat <400> 11 Met Glu Leu Ala Pro Val Asn Leu Ser Glu Gly Asn Gly Ser Asp Pro 1 5 10 15 Glu Pro Pro Ala Glu Pro Arg Pro Leu Phe Gly Ile Gly Val Glu Asn 20 25 30 Phe Ile Thr Leu Val Val Phe Gly Leu Ile Phe Ala Met Gly Val Leu 35 40 45 Gly Asn Ser Leu Val Ile Thr Val Leu Ala Arg Ser Lys Pro Gly Lys 50 55 60 Pro Arg Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Ser Ile Ala Asp 65 70 75 80 Leu Ala Tyr Leu Leu Phe Cys Ile Pro Phe Gln Ala Thr Val Tyr Ala 85 90 95 Leu Pro Thr Trp Val Leu Gly Ala Phe Ile Cys Lys Phe Ile His Tyr 100 105 110 Phe Phe Thr Val Ser Met Leu Val Ser Ile Phe Thr Leu Ala Ala Met 115 120 125 Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg Ser Ser Ser 130 135 140 Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Phe Ile Trp Ala 145 150 155 160 Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr Tyr Gln Arg Leu Phe 165 170 175 His Arg Asp Ser Asn Gln Thr Phe Cys Trp Glu His Trp Pro Asn Gln 180 185 190 Leu His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe Gly Tyr Leu 195 200 205 Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val Leu Asn His 210 215 220 Leu His Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu Ala Ser Lys 225 230 235 240 Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val Phe Gly Ile 245 250 255 Ser Trp Leu Pro His His Val Ile His Leu Trp Ala Glu Phe Gly Ala 260 265 270 Phe Pro Leu Thr Pro Ala Ser Phe Phe Phe Arg Ile Thr Ala His Cys 275 280 285 Leu Ala Tyr Ser Asn Ser Ser Val As n Pro Ile Ile Tyr Ala Phe Leu 290 295 300 Ser Glu Asn Phe Arg Lys Ala Tyr Lys Gln Val Phe Lys Cys Arg Val 305 310 315 320 Cys Asn Glu Ser Pro His Gly Asp Ala Lys Glu Lys Asn Arg Ile Asp 325 330 335 Thr Pro Pro Ser Thr Asn Cys Thr His Val 340 345 <210> 12 <211> 372 <212> PRT <213> Rat <400> 12 Met Asn Gly Ser Gly Ser Gln Gly Ala Glu Asn Thr Ser Gln Glu Gly 1 5 10 15 Gly Ser Gly Gly Trp Gln Pro Glu Ala Val Leu Val Pro Leu Phe Phe 20 25 30 Ala Leu Ile Phe Leu Val Gly Thr Val Gly Asn Ala Leu Val Leu Ala 35 40 45 Val Leu Leu Arg Gly Gly Gln Ala Val Ser Thr Thr Asn Leu Phe Ile 50 55 60 Leu Asn Leu Gly Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro 65 70 75 80 Phe Gln Ala Thr Ile Tyr Thr Leu Asp Asp Trp Val Phe Gly Ser Leu 85 90 95 Leu Cys Lys Ala Val His Phe Leu Ile Phe Leu Thr Met His Ala Ser 100 105 110 Ser Phe Thr Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Ile Arg 115 120 125 Tyr Pro Leu His Ser Arg Glu Leu Arg Thr Pro Arg Asn Ala Leu Ala 130 135 140 Ala Ile Gly Leu Ile Trp Gly Leu Ala Leu Leu Phe Ser Gly Pro Tyr 145 150 155 160 Leu Ser Tyr Tyr Arg Gln Ser Gln Leu Ala Asn Leu Thr Val Cys His 165 170 175 Pro Ala Trp Ser Ala Pro Arg Arg Arg Ala Met Asp Leu Cys Thr Phe 180 185 190 Val Phe Ser Tyr Leu Leu Pro Val Leu Val Leu Ser Leu Thr Tyr Ala 195 200 205 Arg Thr Leu Arg Tyr Leu Trp Arg Thr Val Asp Pro Val Thr Ala Gly 210 215 220 Ser Gly Ser Gln Arg Ala Lys Arg Lys Val Thr Arg Met Ile Ile Ile 225 230 235 240 Val Ala Val Leu Phe Cys Leu Cys Trp Met Pro His His Ala Leu Ile 245 250 255 Leu Cys Val Trp Phe Gly Arg Phe Pro Leu Thr Arg Ala Thr Tyr Ala 260 265 270 270 Leu Arg Ile Leu Ser His Leu Val Ser Tyr Ala Asn Ser Cys Val Asn 275 280 285 Pro Ile Val Tyr Ala Leu Val Ser Lys His Phe Arg Lys Gly Phe Arg 290 295 300 Lys Ile Cys Ala Gly Leu Leu Arg Pro Ala Pro Arg Arg Ala Ser Gly 305 310 315 320 Arg Val Ser Ile Leu Ala Pro Gly Asn His Ser Gly Ser Met Leu Glu 325 330 335 Gln Glu Ser Thr Asp Leu Thr Gln Val Ser Glu Ala Ala Gly Pro Leu 340 345 350 Val Pro Pro Pro Ala Leu Pro Asn CysThr Ala Ser Ser Arg Thr Leu 355 360 365 Asp Pro Ala Cys 370 <210> 13 <211> 370 <212> PRT <213> Rat <400> 13 Met Ala Asp Ile Gln Asn Ile Ser Leu Asp Ser Pro Gly Ser Val Gly 1 5 10 15 Ala Val Ala Val Pro Val Ile Phe Ala Leu Ile Phe Leu Leu Gly Met 20 25 30 Val Gly Asn Gly Leu Val Leu Ala Val Leu Leu Gln Pro Gly Pro Ser 35 40 45 Ala Trp Gln Glu Pro Ser Ser Thr Thr Asp Leu Phe Ile Leu Asn Leu 50 55 60 Ala Val Ala Asp Leu Cys Phe Ile Leu Cys Cys Val Pro Phe Gln Ala 65 70 75 80 Ala Ile Tyr Thr Leu Asp Ala Trp Leu Phe Gly Ala Phe Val Cys Lys 85 90 95 Thr Val His Leu Leu Ile Tyr Leu Thr Met Tyr Ala Ser Ser Phe Thr 100 105 110 Leu Ala Ala Val Ser Leu Asp Arg Tyr Leu Ala Val Arg His Pro Leu 115 120 125 Arg Ser Arg Ala Leu Arg Thr Pro Arg Asn Ala Arg Ala Ala Val Gly 130 135 140 Leu Val Trp Leu Leu Ala Ala Leu Phe Ser Ala Pro Tyr Leu Ser Tyr 145 150 155 160 Tyr Gly Thr Val Arg Tyr Gly Ala Leu Glu Leu Cys Val Pro Ala Trp 165 170 175 Glu Asp Ala Arg Arg Arg Ala Leu Asp Val Ala Thr Phe Ala Ala Gly 18 0 185 190 Tyr Leu Leu Pro Val Ala Val Val Ser Leu Ala Tyr Gly Arg Thr Leu 195 200 205 Cys Phe Leu Trp Ala Ala Val Gly Pro Ala Gly Ala Ala Ala Ala Ala Glu 210 215 220 Ala Arg Arg Arg Ala Thr Gly Arg Ala Gly Arg Ala Met Leu Ala Val 225 230 235 240 Ala Ala Leu Tyr Ala Leu Cys Trp Gly Pro His His Ala Leu Ile Leu 245 250 255 Cys Phe Trp Tyr Gly Arg Phe Ala Phe Ser Pro Ala Thr Tyr Ala Cys 260 265 270 Arg Leu Ala Ser His Cys Leu Ala Tyr Ala Asn Ser Cys Leu Asn Pro 275 280 285 Leu Val Tyr Ser Leu Ala Ser Arg His Phe Arg Ala Arg Phe Arg Arg 290 295 300 Leu Trp Pro Cys Gly Arg Arg Arg His Arg His His His Arg Ala His 305 310 315 320 Arg Ala Leu Arg Arg Val Gln Pro Ala Ser Ser Gly Pro Ala Gly Tyr 325 330 335 Pro Gly Asp Ala Arg Pro Arg Gly Trp Ser Met Glu Pro Arg Gly Asp 340 345 350 Ala Leu Arg Gly Gly Gly Glu Thr Arg Leu Thr Leu Ser Pro Arg Gly 355 360 365 Pro Gln 370 <210> 14 <211> 60 <212> PRT <213> Porcine <400> 14 Ala Pro Val His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu L eu Gly Pro Val Leu His Pro Pro Ser Arg Ala Glu Gly Gly 20 25 30 Gly Lys Gly Lys Thr Ala Leu Gly Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Pro Gln Ser Gln Leu Ala Ser 50 55 60 <210> 15 <211> 60 <212> PRT <213> Rat <400> 15 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Ser Ser Lys Ala Asn Gln Gly 20 25 30 Arg Lys Thr Asp Ser Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser Arg Ser Pro Arg Met Thr 50 55 60 <210> 16 <211 > 60 <212> PRT <213> Human <400> 16 Ala Pro Ala His Arg Gly Arg Gly Gly Trp Thr Leu Asn Ser Ala Gly 1 5 10 15 Tyr Leu Leu Gly Pro Val Leu His Leu Pro Gln Met Gly Asp Gln Asp 20 25 30 Gly Lys Arg Glu Thr Ala Leu Glu Ile Leu Asp Leu Trp Lys Ala Ile 35 40 45 Asp Gly Leu Pro Tyr Ser His Pro Pro Gln Pro Ser 50 55 60 <210> 17 <211> 1041 <212> DNA < 213> Rat <400> 17 atggaactgg ctccggtgaa cctcagtgaa gggaatggga gcgaccctga acctccagcg 60 gaacccaggc cgctcttcgg catcggcgtg gagaa cttca tcacgctggt ggtgtttggc 120 cttattttcg cgatgggcgt gctgggcaac agcctggtga tcaccgtgct ggcgcgcagc 180 aaaccgggca agccgcgcag caccaccaac ctgttcatcc tcaacctgag catcgcagac 240 ctggcctacc tgctcttctg catccctttc caggccaccg tgtacgcact gcccacctgg 300 gtgctgggcg ccttcatctg caagtttata cactacttct tcaccgtgtc catgctcgtg 360 agcatcttca ccctggccgc gatgtctgtg gatcgctatg tggccattgt gcattcacgg 420 cgctcctcct ccctcagggt gtcccgcaac gcgctgctgg gcgtgggctt catctgggcg 480 ctgtccatcg ctatggcctc gccggtggcc tactaccagc gcctttttca tcgggacagc 540 aaccaaacct tctgctggga gcactggccc aaccaactcc acaagaaggc ttacgtggtg 600 tgcactttcg tctttggtta ccttctgccc ttactgctca tctgcttttg ctatgccaag 660 gttctcaatc atctgcataa aaagttgaag aacatgtcaa aaaagtcaga ggcatccaag 720 aaaaagactg cacagactgt cctggtggtc gttgtggtat ttggcatatc atggctgccc 780 catcatgtca tccacctctg ggctgagttc ggagcattcc cgctgacccc agcttccttc 840 ttcttcagaa tcactgccca ctgcctggca tacagcaact cctcggtgaa ccccatcatc 900 tacgcctttc tctcagaaaa cttccggaag gcgtacaagc aagtgttcaa gtg ccgtgtt 960 tgcaatgagt cgccgcacgg cgatgctaaa gaaaagaacc gaatagatac cccgccctcc 1020 accaactgca cccacgtgtg a 1041 <210> 18 <211> 1119 <212> DNA <213> Rat <400> 18 atgaatggct ccggcagcca gggcgcggag aacacgagcc aggaaggcgg tagcggcggc 60 tggcagcctg aggcggtcct tgtaccccta tttttcgcgc tcatcttcct cgtgggcacc 120 gtgggcaacg cgctggtgct ggcggtgctg ctgcgcggcg gccaggcggt cagcaccacc 180 aacctgttca tcctcaacct gggcgtggcc gacctgtgtt tcatcctgtg ctgcgtgcct 240 ttccaggcca ccatctacac cctggacgac tgggtgttcg gctcgctgct ctgcaaggct 300 gttcatttcc tcatctttct cactatgcac gccagcagct tcacgctggc cgccgtctcc 360 ctggacaggt atctggccat ccgctacccg ctgcactccc gagagttgcg cacacctcga 420 aacgcgctgg ccgccatcgg gctcatctgg gggctagcac tgctcttctc cgggccctac 480 ctgagctact accgtcagtc gcagctggcc aacctgacag tatgccaccc agcatggagc 540 gcacctcgac gtcgagccat ggacctctgc accttcgtct ttagctacct gctgccagtg 600 ctagtcctca gtctgaccta tgcgcgtacc ctgcgctacc tctggcgcac agtcgacccg 660 gtgactgcag gctcaggttc ccagcgcgcc aaacgcaagg tgacacggat gatcatcatc 720 gtggcggtgc ttttctgcct ctgttggatg ccccaccacg cgcttatcct ctgcgtgtgg 780 tttggtcgct tcccgctcac gcgtgccact tacgcgttgc gcatcctttc acacctagtt 840 tcctatgcca actcctgtgt caaccccatc gtttacgctc tggtctccaa gcatttccgt 900 aaaggtttcc gcaaaatctg cgcgggcctg ctgcgccctg ccccgaggcg agcttcgggc 960 cgagtgagca tcctggcgcc tgggaaccat agtggcagca tgctggaaca ggaatccaca 1020 gacctgacac aggtgagcga ggcagccggg ccccttgtcc caccacccgc acttcccaac 1080 tgcacagcct cgagtagaac cctggatccg gcttgttaa 1119 <210> 19 <211> 1113 <212> DNA <213> Rat <400> 19 atggctgaca tccagaacat ttcgctggac agcccaggga gcgtaggggc tgtggcagtg 60 cctgtgatct ttgccctcat cttcctgttg ggcatggtgg gcaatgggct ggtgttggct 120 gtgctactgc agcctggccc aagtgcctgg caggagccaa gcagtaccac agatctcttc 180 atcctcaact tggccgtggc cgacctttgc ttcatcctgt gctgcgtgcc cttccaggca 240 gccatctaca cactggatgc ctggctcttt ggggctttcg tgtgcaagac ggtacatctg 300 ctcatctacc tcaccatgta tgccagcagc ttcaccctgg cggccgtctc cctggacagg 360 tacctggctg tgcggcaccc actgcgctcc agagccctgc gcaccccggg caacgcg cgc 420 gccgccgtgg ggctcgtgtg gctgctggcg gctctctttt ccgcgcccta cctaagctat 480 tacggcacgg tgcgctacgg cgcgctcgag ctctgcgtgc ccgcttggga ggacgcgcgg 540 cggcgcgcgc tggacgtggc caccttcgcc gcgggctacc tgctgccggt ggccgtggtg 600 agcctggcct acggacgcac gctatgtttc ctatgggccg ccgtgggtcc cgcgggcgcg 660 gcggcagcag aggcgcgcag acgggcgacc ggccgggcgg gacgcgccat gctggcagtg 720 gccgcgctct acgcgctttg ctggggcccg caccacgcgc tcatcctctg cttctggtac 780 ggccgcttcg ccttcagccc ggccacctac gcctgtcgcc tggcctcgca ctgcctcgcc 840 tacgccaact cctgccttaa cccgctcgtc tactcgctcg cctcgcgcca cttccgcgcg 900 cgcttccgcc gcctgtggcc ctgcggccgt cgccgccacc gccaccacca ccgcgctcat 960 cgagccctcc gtcgtgtcca gccggcgtct tcgggccccg ccggttatcc cggcgacgcc 1020 aggcctcgtg gttggagtat ggagcccaga ggggatgctc tgcgtggtgg tggagagact 1080 agactaaccc tgtcccccag gggacctcaa taa 1113 <210> 20 <211> 351 <212> DNA <213> Rat <400> 20 atggcctgct ccgtacatct ggtcctcttc ctcaccatct tgctgagcct ggcagaaaca 60 ccggaatctg cacctgctca caggggacga ggaggctgga ccctcaatag tgctgg ttac 120 ctcctgggtc ctgtcctccc cgtttcctcc aaggccgacc agggcaggaa gagagactca 180 gctcttgaga tcctagacct gtggaagatc attgatggac ttccttattc ccactctcca 240 aggatgag agat gagagacagagatgagagagagagagagagagagattag cc

[Brief description of the drawings]

FIG. 1: Pig small intestine galanin (galanin), porcine Ga
1R2 ligand (P-GALR2L), rat Gal
R2 ligand (R-GALR2L), human GalR2
It is a figure which compares the amino acid sequence of a ligand (H-GALR2L) and the mouse | mouth type GalR2 ligand of this invention.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 48/00 A61P 13/08 4C085 A61P 1/14 13/12 4H045 13/08 15/04 13/12 15 / 08 15/04 19/00 15/08 21/00 19/00 25/28 21/00 C07K 14/47 25/28 16/18 C07K 14/47 C12N 1/15 16/18 1/19 C12N 1 / 15 1/21 1/19 C12P 21/02 C 1/21 G01N 33/15 Z 5/10 33/50 Z C12P 21/02 33/53 D G01N 33/15 33/566 33/50 C12P 21/08 33 / 53 C12N 15/00 ZNAA 33/566 5/00 A // C12P 21/08 A61K 37/02 F term (reference) 2G045 AA40 DA36 FB03 FB07 4B024 AA01 AA11 BA80 CA04 CA20 DA01 DA02 DA05 DA06 DA11 EA04 GA11 HA17 4B064 AG01 AG27 CA01 CA02 CA10 CA19 CA20 CC01 CC24 DA01 DA13 4B065 AA01X AA26X AA58X AA72X AA87X AA91Y AC14 BA02 CA2 4 CA43 CA44 CA46 4C084 AA16 NA14 ZA15 ZA70 ZA81 ZA85 ZA94 ZA96 4C085 AA13 AA14 CC21 CC29 DD62 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA75 EA20 EA50 FA71 FA74

Claims (17)

[Claims] 1. A peptide, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. 2. The precursor according to claim 1, wherein the precursor contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2. 3. A DNA containing a DNA encoding the peptide or the precursor according to claim 1. 4. The DNA according to claim 3, which comprises the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 20. 5. A recombinant vector containing the DNA according to claim 3. 6. A transformant transformed with the recombinant vector according to claim 5. 7. The method according to claim 1, wherein the transformant according to claim 6 is cultured to produce and accumulate the peptide or precursor according to claim 1 or an amide or ester thereof or a salt thereof. Of a peptide or precursor thereof, or an amide or ester thereof or a salt thereof. 8. An antibody against the peptide or the precursor according to claim 1. 9. A pharmaceutical comprising the antibody according to claim 8. A diagnostic agent comprising the antibody according to claim 8. 11. A pharmaceutical comprising the peptide or precursor according to claim 1 or an amide or ester thereof or a salt thereof. 12. The medicament according to claim 11, which is a memory function improving agent, an appetite regulator, a uterine function regulator, a renal function regulator, a prostate function regulator, a testis function regulator or a skeletal muscle function regulator. 13. An amino acid represented by SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13, wherein the peptide according to claim 1, a precursor thereof, an amide thereof, an ester thereof, or a salt thereof is used. A method for screening an agonist or antagonist for a receptor protein containing an amino acid sequence identical or substantially identical to the sequence. 14. A compound obtained by the screening method according to claim 13, or a salt thereof. 15. A memory function improving agent, an appetite regulating agent, a uterine function regulating agent, a renal function regulating agent, a prostate function regulating agent, a testis function regulating agent or a skeletal muscle function containing the compound according to claim 14 or a salt thereof. Agent. 16. A method for producing a medicament having a memory function improving action, appetite controlling action, uterine function controlling action, renal function controlling action, prostate function controlling action, testis function controlling action or skeletal muscle function controlling action. Use of the peptide or the precursor thereof or the amide or the ester or the salt thereof, the DNA of the claim 3, or the antibody of the claim 8. 17. A method according to claim 1, wherein the peptide according to claim 1 or its precursor or its amide or its ester or its salt, the DNA according to claim 3 or the antibody according to claim 8 is administered to a mammal. A method for improving memory function, appetite control, uterine function control, kidney function control, prostate function control, testis function control or skeletal muscle function control.