JP2002233386A - Prolactin secretion regulator containing rfrp - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide the use of a new peptide. SOLUTION: This polypeptide has a prolactin secretion-promoting action and a prolactin secretion-retarding action. (1) The polypeptide as the prolactin secretion-promoting agent is useful as a medicine for preventing and treating various kinds of diseases related to prolactin secretion, such as ovarian hypofunction, testicular hypoplasia, menopausal disorders and dysthyroidism, and (2) the polypeptide as the prolactin secretion-retarding agent is useful as a medicine for preventing and treating various kinds of diseases related to prolactin secretion, such as pituitary adenoma, diencephalic tumor, menstrual disorder, autoimmune disease, prolactinoma, sterility, impotence, amenorrhea, galactorrhea, acromegaly, Chiari-Frommel syndrome, Argonz-del Castilo syndrome, Forbesp-Albright syndrome, lymphoma, Sheehan's syndrome, and aspermatogenesis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD [0001] The present invention relates to a prolactin secretion regulator containing a novel polypeptide (sometimes referred to as a novel physiologically active polypeptide in the present specification) or a partial peptide thereof.

[0002]

2. Description of the Related Art Many hormones and neurotransmitters regulate biological functions through specific receptors present on cell membranes. Many of these receptors are conjugated to guanine nucleotide-binding proteins (guanine nucleoti
Intracellular signal transduction is performed through activation of de-binding protein (hereinafter, sometimes abbreviated as G protein).
In addition, since these receptors have a common structure having seven cell transmembrane domains, G protein-coupled receptors or seven transmembrane receptors (7T
MR). The hypothalamus-pituitary system is one of the pathways that regulate the functions of living organisms by such hormones and neurotransmitters and G protein-coupled receptors. This is because hypothalamic hormones (pituitary hormones) regulate the secretion of pituitary hormones from the pituitary gland and regulate the function of target cells and organs via pituitary hormones released into the blood. It is. This pathway regulates important functions for living organisms, such as maintenance of homeostasis and regulation of reproductive system, development, metabolism and growth of individuals. Pituitary hormones are regulated by a positive or negative feedback mechanism by hypothalamic hormones and peripheral hormones secreted from target endocrine glands.

[0003] Further, it is known that these hormones, factors and their receptors do not exist exclusively in the hypothalamus-pituitary system but are generally widely distributed in the brain. From this, it is considered that a substance called hypothalamic hormone functions as a neurotransmitter or a neuromodulator in the central nervous system.
It is also distributed in peripheral tissues in the same manner, and is considered to play important functions.

[0004]

From the foregoing, it is apparent that a drug that regulates the secretion of pituitary hormone from the pituitary gland by regulating the function of the living body by the G protein-coupled receptor and its ligand, particularly by regulating the secretion of hypothalamic hormone. The development of was desired.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have found that RF amide
Or a bioactive peptide characterized by having an RS amide-like structure, in particular a polypeptide characterized by containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or The inventors have found that the partial peptide has an effect of regulating the release of prolactin, and as a result of further study, have completed the present invention.

That is, the present invention relates to (1) SEQ ID NO: 1.
A prolactin secretion regulator containing a polypeptide or an amide or an ester or a salt thereof, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by (2) Is the amino acid sequence represented by SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 33 or SEQ ID NO: 50;
(3) secretion of prolactin containing a partial peptide of a polypeptide or an amide or ester thereof or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 Modulator, (4) No. 81 of SEQ ID NO: 1 (Me
(3) the prolactin secretion regulator according to the above (3), which comprises a partial peptide comprising the amino acid sequence from t) to the 92nd position (Phe), an amide thereof, an ester thereof, or a salt thereof; The prolactin secretion regulator according to the above (3), comprising a partial peptide comprising the amino acid sequence from the 101st (Ser) to the 112th (Ser), or an amide or an ester or a salt thereof, (6) a sequence Number 1 124
The prolactin secretion regulator according to the above (3), comprising a partial peptide comprising the amino acid sequence from the (Val) to 131st (Phe), or an amide or an ester or a salt thereof, (7) SEQ ID NO: 5th of 1
The prolactin secretion regulator according to the above (3), comprising a partial peptide comprising the amino acid sequence from the 6th (Ser) to the 92nd (Phe), or an amide or an ester or a salt thereof, (8) SEQ ID NO: The prolactin secretion regulator according to the above (3), which comprises an amide of a partial peptide of a polypeptide or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1: (9) A partial peptide of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 in which the carboxyl group at the C-terminus is amidated or a salt thereof ( 8) The prolactin secretion regulator according to the above,
(10) The prolactin secretion regulator according to the above (1) or (3), which is a prolactin secretion promoter, (11)
The prolactin secretion inhibitor according to the above (1) or (3), which is a prolactin secretion inhibitor, (12) hypoovarian dysfunction, seminal vesicle dysplasia, osteoporosis, menopause, lactation deficiency, hypothyroidism, renal failure The prolactin secretagogue according to the above (10), which is a preventive or therapeutic agent for
(13) Hyperprolactinemia, pituitary gland tumor, mesencephalic tumor, menstrual abnormalities, stress, autoimmune diseases, prolactinoma, infertility, impotence, amenorrhea, milk leakage, acromegaly, Chiari-Fronmel (Chiari- Frommel syndrome, Argonz-del Castil
o) Syndrome, Forbes-Albrig
ht) the prolactin secretion inhibitor according to the above (11), which is a preventive or therapeutic agent for syndrome, breast cancer lymphoma or Sheehan syndrome or spermatogenesis, (14) the above (1), which is a milk secretion promoter for livestock mammals or The prolactin secretion regulator according to the above (3), (15) the prolactin secretion regulator according to the above (1) or (3), which is a test agent for a prolactin secretion function, (16) (i) SEQ ID NO:
A polypeptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by 1, a amide thereof, an ester thereof, or a salt thereof, or (ii) an amino acid represented by SEQ ID NO: 1. (I) using a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the sequence, an amide thereof, an ester thereof, or a salt thereof; A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence to be obtained, its amide or its ester or its salt, or (ii)
A compound which promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 Or a method for screening a salt thereof, or
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: (I) a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 1, or an amide or an ester or a salt thereof; : A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 1: or its amide or its ester or its salt; or (ii) represented by SEQ ID NO: 1 A polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence; (I) The same or substantially the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, which is obtained using a screening kit for a compound or a salt thereof which promotes or inhibits the activity of the peptide or its amide or its ester or its salt. A polypeptide, an amide thereof, an ester thereof, or a salt thereof, or (ii)
A compound which promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Or a prolactin secretion regulator containing a salt thereof,

(17) (I) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, its amide or its ester, or its polypeptide A salt, or (ii) a partial peptide of a polypeptide or an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, and (Iii) using a protein or a salt thereof, or a partial peptide thereof, an amide thereof or an ester thereof or a salt thereof, containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37. (I) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 A polypeptide characterized by containing a amino acid sequence or an amide or ester thereof or a salt thereof, or (ii) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. A method for screening a compound or a salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof or a salt thereof, or (II) (i) represented by SEQ ID NO: 1. A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence, its amide or its ester or its salt, or (ii) the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1. Portion of a polypeptide characterized by containing the same amino acid sequence Peptide or its amide or its ester or its salt, and (iii) a protein or its salt containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37, or its partial peptide or its amide Or (i) a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or a amide thereof or an amide thereof. An ester or a salt thereof, or (ii) a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide thereof or an ester thereof or Compounds or salts thereof that promote or inhibit the activity of the salt (I) a polypeptide, or an amide or ester thereof, or an amide or ester thereof, which is obtained by using a screening kit and comprises (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. Salt, or (ii) SEQ ID NO: 1.
A partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by the following, or a compound or a salt thereof which promotes or inhibits the activity of an amide or an ester or a salt thereof. A prolactin secretion regulator, (18)
(1) The 81st position (Met) to the 92nd position of SEQ ID NO: 1
A peptide having the amino acid sequence of the (Phe) th or its amide or its ester or its salt, (2)
A peptide having the 101st (Ser) to 112th (Ser) amino acid sequence of SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof; (3) a 124th (Val) to valid of the SEQ ID NO: 1 A peptide having the 131st amino acid sequence (Phe), an amide thereof, an ester thereof, or a salt thereof; (4) a 56th position (Ser) to a 92nd position (Phe) of SEQ ID NO: 1
A peptide having the amino acid sequence of, or an amide or ester thereof, or a salt thereof, (5) SEQ ID NO: 1
4, a peptide having the 81st (Met) to 92nd (Phe) amino acid sequence or an amide or an ester or a salt thereof; (6) a 101st (Ser) to 112th (SEQ ID NO: 14) (U) a peptide having the amino acid sequence of Leu), an amide thereof, an ester thereof, or a salt thereof;
A peptide having an amino acid sequence from the 8th (Ser) to the 92nd (Phe) or an amide or an ester or a salt thereof, (8) the 83rd (Val) to the 94th (Phe) of SEQ ID NO: 33, A peptide having an amino acid sequence, an amide thereof, an ester thereof or a salt thereof, (9) the 118th sequence of SEQ ID NO: 33 (Ph
e) a peptide having the amino acid sequence from the 125th position (Phe) or an amide or an ester or a salt thereof; (10) a 58th position (Se
r) a peptide having an amino acid sequence from the 94th position (Phe) or an amide or an ester or a salt thereof, or (11) an amino acid sequence from the 58th (Ser) to the 94th (Phe) of SEQ ID NO: 50 Or an amide or ester thereof or a salt thereof, (19) an amide or salt thereof of the peptide of (18), (20) a peptide of (18) wherein the carboxyl group at the C-terminus is amidated Or its amide or its ester or its salt, (2
1) DNA encoding the peptide of (18),
(22) (1) SEQ ID NO: 241st to 2nd
76th nucleotide sequence, (2) 301st to 336th nucleotide sequence of SEQ ID NO: 2, (3) SEQ ID NO: 2
The 370th to 393rd nucleotide sequences of (4)
166th to 276th nucleotide sequence of SEQ ID NO: 2, (5) 241st to 2nd nucleotide sequence of SEQ ID NO: 15
76th base sequence, (6) 301st of SEQ ID NO: 15
To the 336rd to 336th nucleotide sequences, (7) SEQ ID NO:
15, a peptide having the 172nd to 276th amino acid sequence or its amide or its ester or its salt, (8) the 247th to 282nd base sequence of SEQ ID NO: 34, (9) the SEQ ID NO: 3
4, the 352nd to 375th base sequence, (1
0) the 172nd to 282nd nucleotide sequences of SEQ ID NO: 34, or (11) the 172nd nucleotide of SEQ ID NO: 51
(2) having the nucleotide sequence of the
(23) an antibody against the peptide according to the above (18) or an amide thereof, an ester thereof or a salt thereof; (24) a DNA containing the DNA according to the above (21) or the antibody according to the above (23); Diagnostic agent,
(25) an antisense DNA having a base sequence complementary or substantially complementary to the DNA of (21), and having an action of suppressing expression of the DNA; (26) an antisense DNA of (18); An agent comprising the peptide or its amide or its ester or its salt, (27) a medicament comprising the peptide or its amide or its ester or its salt according to (18), (2)
8) The medicament according to the above (27), which is a prolactin secretion regulator, (29) the peptide according to the above (18), wherein the peptide according to the above (18) or an amide or ester thereof or a salt thereof is used. A method for screening a compound or a salt thereof that promotes or inhibits the activity of the amide or its ester or its salt, (30) further comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 37 A screening method according to the above (29), wherein a protein or a salt thereof, a partial peptide thereof, an amide or an ester thereof or a salt thereof, and (31) a peptide of the above (18) or an amide or an ester thereof Or (1) containing a salt thereof A) a screening kit for a compound or a salt thereof that promotes or inhibits the activity of the peptide or amide or ester thereof or a salt thereof according to the above); (18) A compound or a salt thereof which promotes or inhibits the activity of the peptide or amide or ester thereof or salt thereof described in (18) above, which can be obtained by using (33) for producing a medicament having a prolactin secretion regulating action. i)
A polypeptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof; or (ii) a polypeptide represented by SEQ ID NO: 1. (34) (i) use of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which is characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence to be obtained; A polypeptide characterized by containing the same or substantially the same amino acid sequence as the represented amino acid sequence, its amide or its ester or its salt, or (ii)
Administering to a mammal a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. A method for regulating prolactin secretion, (35) a method for producing a medicament having a prolactin secretion regulating action,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: (I) using a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 1, or an amide or an ester or a salt thereof; SEQ ID NO:
A polypeptide or an amide or an ester or a salt thereof, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by 1, or (ii) the amino acid represented by SEQ ID NO: 1 A method for screening a compound or a salt thereof that promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises an amino acid sequence identical or substantially identical to the sequence, or (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: An amino acid identical or substantially identical to the amino acid sequence represented by 1 (I) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, comprising a partial peptide of a polypeptide characterized by containing a sequence, an amide thereof, an ester thereof, or a salt thereof. A polypeptide characterized by containing an amino acid sequence, an amide thereof, an ester thereof, or a salt thereof; or (ii) containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. (I) SEQ ID NO: obtained using a screening kit for a compound or a salt thereof that promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof,
A polypeptide or an amide or an ester or a salt thereof, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by 1, or (ii) the amino acid represented by SEQ ID NO: 1 Use of a compound or a salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which is characterized by containing an amino acid sequence identical or substantially identical to the sequence, (3
6) (I) (i) for producing a medicament having a prolactin secretion regulating action, characterized by containing a polyamino acid sequence having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. A peptide or an amide or an ester or a salt thereof, or (ii) a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or a partial peptide thereof An amide or an ester or a salt thereof, and (iii) SEQ ID NO: 37
(I) using a protein or a salt thereof, or a partial peptide thereof, an amide thereof, an ester thereof or a salt thereof, containing the same or substantially the same amino acid sequence as the amino acid sequence represented by : A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 1: or its amide or its ester or its salt; or (ii) represented by SEQ ID NO: 1 A method for screening a compound or a salt thereof that promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence, or (II) (i) an amino acid sequence represented by SEQ ID NO: 1 A polypeptide characterized by containing one or substantially the same amino acid sequence, its amide or its ester or its salt, or (ii) the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1 (Ii) a partial peptide of a polypeptide, or an amide or an ester or a salt thereof, which comprises the amino acid sequence of (ii)
i) a protein or a salt thereof having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37, or a partial peptide thereof, an amide thereof or an ester thereof or a salt thereof;
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. (I) obtained using the screening kit of
A polypeptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof; or (ii) a polypeptide represented by SEQ ID NO: 1. Use of a compound or a salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester thereof or a salt thereof, which is characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence to be obtained; (37) (i) a polypeptide characterized by containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof, or (ii) An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 Characterized by using the polypeptide partial peptide or its amide or ester, or a salt thereof, characterized in that it contains,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (i) SEQ ID NO: 1
Or a amide or an ester or a salt thereof, or (ii) an amino acid sequence represented by SEQ ID NO: 1. (I) an amino acid represented by SEQ ID NO: 1 comprising a partial peptide of a polypeptide or an amide or an ester or a salt thereof, wherein the partial peptide has the same or substantially the same amino acid sequence as A polypeptide characterized by containing the same or substantially the same amino acid sequence as its sequence, its amide or its ester or its salt, or (ii) SEQ ID NO:
A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. (I) a polypeptide, or an amide or ester thereof, characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 obtained by using the screening kit of A salt thereof, or (ii) a partial peptide of a polypeptide, or an amide or ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. A compound or a salt thereof that promotes or inhibits the activity is administered to mammals. And (38) (I) (i) a polylactide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. A peptide or an amide or an ester or a salt thereof, or (ii) a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or a partial peptide thereof Amide or its ester or its salt, and (iii) a protein or its salt containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37, or its partial peptide or its amide or its ester Or (i) represented by SEQ ID NO: 1, characterized by using a salt thereof. A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence, its amide or its ester or its salt, or (ii) the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1. A method for screening a compound or a salt thereof that promotes or inhibits the activity of a partial peptide of a polypeptide characterized by containing the same amino acid sequence or an amide or an ester or a salt thereof, or
(II) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof, or (ii) SEQ ID NO: 1
A partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by: and (iii) SEQ ID NO: 37. (I) SEQ ID NO: 1 comprising a protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence, or a partial peptide thereof, an amide thereof or an ester thereof or a salt thereof. A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence, its amide or its ester or its salt, or (ii) the same or the same as the amino acid sequence represented by SEQ ID NO: 1. A polypeptide characterized in that it contains substantially the same amino acid sequence. (I) The same or substantially the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, which is obtained using a screening kit for a compound or a salt thereof which promotes or inhibits the activity of the peptide or its amide or its ester or its salt. A polypeptide, an amide thereof, an ester thereof, or a salt thereof, or (ii)
A compound which promotes or inhibits the activity of a partial peptide of a polypeptide or an amide or an ester or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Or a method for regulating prolactin secretion, which comprises administering a salt thereof to a mammal. Furthermore, the present invention provides (39) an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1,
About 70% or more of the amino acid sequence represented by SEQ ID NO: 1,
The agent according to the above (1), which is preferably an amino acid sequence having about 80% or more, more preferably about 90% or more, and still more preferably about 95% or more homology, and (40) SEQ ID NO: 1. The amino acid sequence substantially identical to the amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO:
14, 1 to 20 (preferably 1 to 15, more preferably 1 to 5, more preferably 1 to 20) in the amino acid sequence represented by SEQ ID NO: 18, SEQ ID NO: 33 or SEQ ID NO: 50. 3) amino acid sequence deleted, SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 14,
SEQ ID NO: 18, SEQ ID NO: 33 or SEQ ID NO: 50
1 to 20 amino acids (preferably 1 to 20
15, more preferably 1 to 5, more preferably
SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO:
18, 1 to 20 (preferably 1 to 15, more preferably 1 to 5, more preferably 1 to 3) in the amino acid sequence represented by SEQ ID NO: 33 or SEQ ID NO: 50
Amino acid sequence having the amino acid of SEQ ID NO:
1, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18,
1 to 20 or more (preferably 1 to 15, more preferably 1 to 5 or more, more preferably 1 to 3) in the amino acid sequence represented by SEQ ID NO: 33 or SEQ ID NO: 50
Or more), wherein the amino acid sequence is the amino acid sequence in which the amino acid sequence is replaced with another amino acid, or an amino acid sequence obtained by combining the amino acid sequences. The same amino acid sequence
About 50% or more, preferably about 70% or more, more preferably about 80% or more of the amino acid sequence represented by SEQ ID NO: 37
As described above, the agent according to the above (17), which is more preferably about 90% or more, and most preferably about 95% or more homologous, (42) substantially the same as the amino acid sequence represented by SEQ ID NO: 37. The amino acid sequence represented by SEQ ID NO: 37 is 1 to 20 (preferably 1 to 15, more preferably 1 to 5, and more preferably 1 to 3) amino acids Has the amino acid sequence represented by SEQ ID NO: 37,
20 (preferably 1 to 15, more preferably 1 to
An amino acid sequence to which 5 (more preferably 1 to 3) amino acids have been added, 1 to 20 or more (preferably 1 to 15, more preferably 1 to 15) (17) The agent according to the above (17), which is an amino acid sequence in which 5 or more (more preferably 1 to 3 or more) amino acids are substituted with another amino acid, or an amino acid sequence obtained by combining them. .

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION A polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 (hereinafter sometimes referred to as the polypeptide of the present invention) is a human. And warm-blooded animals (for example,
Cells of guinea pig, rat, mouse, chicken, rabbit, pig, sheep, cow, monkey, etc. (eg, retinal cells, hepatocytes, splenocytes, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans) Cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils) Spheres, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, or precursor cells, stem cells or Cancer cells) or any tissue where these cells are present, such as the brain, various parts of the brain (eg, retina, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus,
Hypothalamus, cerebral cortex, medulla oblongata, cerebellum), spinal cord, pituitary gland,
Stomach, pancreas, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, prostate , Testicles, ovaries, placenta, uterus, bones, joints, skeletal muscle, etc.
Or cells of the blood cell system or cultured cells thereof (for example, M
EL, M1, CTLL-2, HT-2, WEHI-3,
HL-60, Josk-1, K562, ML-1, MO
LT-3, MOLT-4, MOLT-10, CCRF-
CEM, TALL-1, Jurkat, CCRT-HS
B-2, KE-37, SKW-3, HUT-78, HU
T-102, H9, U937, THP-1, HEL, J
K-1, CMK, KO-812, MEG-01, etc.) or a synthetic polypeptide.

The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is about 70% or more, preferably about 80% or more, more preferably about 90% or more of the amino acid sequence represented by SEQ ID NO: 1. % Or more, more preferably about 95% or more homology. Examples of the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 include an amino acid sequence having the 22nd to 180th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. More specifically, as an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, for example, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO:
33 or SEQ ID NO: 50.

The polypeptide of the present invention having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 includes, for example, an amino acid substantially identical to the amino acid sequence represented by the aforementioned SEQ ID NO: 1. Sequences (eg, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18,
Having the amino acid sequence represented by SEQ ID NO: 33 or SEQ ID NO: 50) and having a prolactin secretion regulating activity, like the polypeptide having the amino acid sequence represented by SEQ ID NO: 1. Substantially the same means that their activities are qualitatively (eg, physiochemically or pharmacologically) the same. Therefore, the activity of regulating prolactin secretion is equivalent (eg, about 0.1 to 100 times,
Preferably about 0.5 to 10 times, more preferably 0.5 to
2 times), but the extent of these activities,
Quantitative factors such as the molecular weight of the polypeptide may be different. The prolactin secretion regulating activity can be measured according to a method known per se. For example, it can be measured according to Example 1 described later. Examples of the polypeptide of the present invention include amino acids 1 to 3 in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 33 or SEQ ID NO: 50. Amino acid sequence in which 20 (preferably 1 to 15, more preferably 1 to 5, and more preferably 1 to 3) amino acids have been deleted, SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: : 14, SEQ ID NO: 18, SEQ ID NO: 33 or SEQ ID NO: 50, the amino acid sequence represented by 1 to 20 (preferably 1 to 15, more preferably 1 to 5, more preferably 1 to ~ 3) amino acids added, SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO:
33 or an amino acid in which 1 to 20 (preferably 1 to 15, more preferably 1 to 5, and more preferably 1 to 3) amino acids have been inserted into the amino acid sequence represented by SEQ ID NO: 50 SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO:
33 or 1 to 20 (preferably 1 to 15, more preferably 1 to 5, and more preferably 1 to 3) amino acids in the amino acid sequence represented by SEQ ID NO: 50 are other amino acids And so-called muteins such as polypeptides containing an amino acid sequence substituted with, or a combination thereof. When the amino acid sequence is inserted, deleted or substituted as described above,
The position of the insertion, deletion or substitution is not particularly limited. Specific examples of the polypeptide containing the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 include, for example, a polypeptide containing the amino acid sequence represented by SEQ ID NO: 8; A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 18; a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 33; and a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 50. Polypeptides and the like.

In the present specification, the left end is the N-terminus (amino terminal) and the right end is the C-terminus (carboxyl terminus) in accordance with the convention of peptide labeling. SEQ ID NO: 1
The polypeptide of the present invention, including the polypeptide containing the amino acid sequence represented by the following formula, usually has a carboxyl group (—COOH) or a carboxylate at the C-terminus.
(—COO ⁻ ), but the C-terminal is an amide (—CONH ₂ )
Alternatively, it may be an ester (—COOR). Here, as R in the ester, for example, a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, for example, phenyl A C _6-12 aryl group such as α-naphthyl, for example, a phenyl-C _1-2 alkyl group such as benzyl and phenethyl or a C _7- alkyl group such as α-naphthyl-C _1-2 alkyl group such as α-naphthylmethyl. _In addition to ₁₄ aralkyl groups,
A pivaloyloxymethyl group commonly used as an ester for oral use is used. When the polypeptide of the present invention has a carboxyl group (or carboxylate) other than at the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the polypeptide of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Further, the polypeptides of the present invention, amino acid residues (eg, methionine residue) of the N-terminal amino group protecting group (e.g., formyl group, such as C _1-6 alkanoyl such as acetyl group C _1-6 Acyl-group-protected), N-terminal glutamine residue generated by cleavage in vivo, pyroglutamine-oxidized, substituent on the side chain of amino acid in the molecule (for example, -O
H, -SH, amino group, imidazole group, indole group, guanidino group, etc. are suitable protecting groups (for example, C _1-6 acyl groups such as C _1-6 alkanoyl groups such as formyl group and acetyl group). Protected proteins and complex proteins such as so-called glycoproteins to which sugar chains are bound are also included. Hereinafter, these polypeptides may be abbreviated as the polypeptide of the present invention.

Specific examples of the polypeptide of the present invention include:
For example, a human-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 1 (FIG. 1), a human-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 8 (FIG. 3), represented by SEQ ID NO: 14 Bovine polypeptide having the amino acid sequence shown in FIG. 4, SEQ ID NO: 1
A rat-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 8 (FIG. 5), a mouse-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 33 (FIG. 7), having the amino acid sequence represented by SEQ ID NO: 50 Rat-derived polypeptides and the like are used. For example, a human-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 1, a human-derived polypeptide having the amino acid sequence represented by SEQ ID NO: 8, SEQ ID NO: 14 A bovine-derived polypeptide having the amino acid sequence represented by is preferably used.

The partial peptide of the polypeptide of the present invention (hereinafter sometimes referred to as the partial peptide of the present invention) is the partial peptide of the polypeptide of the present invention described above, and is a receptor for the polypeptide of the present invention. (Specifically, a protein characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37 or a salt thereof) is added to cells expressing the same. Any substance having prolactin secretion regulating activity may be used. Further, the partial peptide of the present invention has 1 to 5 (preferably,
1 to 3 amino acids are deleted, or 1 to 5 (preferably 1 to 3) amino acids are added to the amino acid sequence, or 1 to 5 (preferably, 1 to 5 amino acids may be inserted, or 1 to 5 amino acids in the amino acid sequence (preferably, may contain an amino acid sequence in which 1 to 3 amino acids are substituted with another amino acid, The partial peptide of the present invention may have a carboxyl group (—COOH) or a carboxylate (—COO ⁻ ) at the C-terminus. as a, it may be C-terminal amide (-CONH ₂₎ or an ester (-COOR) (R is as defined above). of these, C-terminal amide (-C
ONH ₂ ) is preferred. When the partial peptide of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, a polypeptide in which the carboxyl group is amidated or esterified is also included in the polypeptide of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the partial peptide of the present invention has a N-terminal amino acid residue (eg, methionine residue) in which the amino group is protected by a protecting group, and a N-terminal side, similarly to the above-described polypeptide of the present invention. Glutamine residue generated by cleavage in vivo, which is subjected to pyroglutamine oxidation, substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or so-called glycopeptide to which a sugar chain is bound And the like. Hereinafter, these partial peptides may be abbreviated as the partial peptide of the present invention. Preferably, the partial peptide of the polypeptide of the present invention is RFamide, RSa
Peptides having a mide or RLamide structure, more preferably peptides having an RFamide or RSamide structure, particularly preferably peptides having an RFamide. The RFamide structure means that the C-terminal of the peptide is Argi
nine (arginine) -Phenylalanine refers it is in the (phenylalanine) -NH ₂ structure, the RSamide structure, C-terminal, the peptide is Arginine (Arginine) -seri
ne (serine) -NH ₂ structure, RLam
The ide structure means that the C-terminal of the peptide has an Arginine (arginine) -Leucine (leucine) -NH ₂ structure.

Among these partial peptides of the present invention, for example, the amino acid sequence represented by SEQ ID NO: 56th (Ser) to 92nd (Phe), 73rd (Met) to
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn)-131st (Phe), 124th (Val)
To the 131st (Phe), 1st (Met) to 92nd (Phe), 1st (Met) to 112th (Ser) or 1st (Met) to 131st (Phe) amino acid sequences 56th (Ser) to 92nd (Phe), 73rd (Met) to 73rd amino acid sequence of the amino acid sequence represented by SEQ ID NO: 8
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn)-131st (Phe), 124th (Val)
To the 131st (Phe), 1st (Met) to 92nd (Phe), 1st (Met) to 112th (Ser) or 1st (Met) to 131st (Phe) amino acid sequences No. 58 of the amino acid sequence represented by SEQ ID NO: 14
(Ser)-92nd (Phe), 81st (Met)
-92nd (Phe), 101st (Ser)-112th
(Leu), 124th (Val)-131st (Ph
e), 1st (Met) to 92nd (Phe) or 1st
A peptide comprising the amino acid sequence of positions (Met) to 131 (Phe), the 58th amino acid sequence represented by SEQ ID NO: 33;
(Ser)-94th (Phe), 83rd (Val)
To the 94th (Phe), the 84th (Pro) to the 94th (Phe) or the 118th (Phe) to the 125th (Ph)
e) a peptide containing the amino acid sequence of SEQ ID NO: 50;
(Ser) to 94th (Phe) or 84th (Pr)
Preferable examples include a peptide containing the amino acid sequence from o) to 94th (Phe), and particularly, the 56th (Ser) to 92nd (Phe) and 56th (She) amino acid sequences represented by SEQ ID NO: 1. 73rd (Met) ~
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn) to 131st (Phe) or 124th (Va
l) A peptide containing the 131st amino acid sequence (Phe), the 56th amino acid sequence (Ser) to the 92nd amino acid sequence (Phe), the 73rd amino acid sequence (Met) to
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn) to 131st (Phe) or 124th (Va
l) a peptide containing the amino acid sequence of positions 131 to 131 (Phe), the 58th amino acid sequence represented by SEQ ID NO: 14
(Ser)-92nd (Phe), 81st (Met)
-92nd (Phe), 101st (Ser)-112th
A peptide containing the amino acid sequence of position (Leu) or position 124 (Val) to position 131 (Phe); 58th amino acid sequence represented by SEQ ID NO: 33
(Ser)-94th (Phe), 83rd (Val)
To the 94th (Phe), the 84th (Pro) to the 94th (Phe) or the 118th (Phe) to the 125th (Ph)
e) a peptide comprising the amino acid sequence of SEQ ID NO: 50;
(Ser) to 94th (Phe) or 84th (Pr)
Preferred examples include peptides containing the amino acid sequence from o) to the 94th (Phe). Among them, 56th (Ser) to 92nd (Phe), 73rd (Met) to 73rd (Met) of the amino acid sequence represented by SEQ ID NO: 1
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn) to 131st (Phe) or 124th (Va
l) A peptide containing the 131st amino acid sequence (Phe), the 56th amino acid sequence (Ser) to the 92nd amino acid sequence (Phe), the 73rd amino acid sequence (Met) to
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn) to 131st (Phe) or 124th (Va
l) a peptide comprising the amino acid sequence of positions 131 to 131 (Phe), the 58th amino acid sequence represented by SEQ ID NO: 14
(Ser)-92nd (Phe), 81st (Met)
-92nd (Phe), 101st (Ser)-112th
A peptide containing the amino acid sequence of position (Leu) or position 124 (Val) to position 131 (Phe); 58th amino acid sequence represented by SEQ ID NO: 33
(Ser)-94th (Phe), 83rd (Val)
-94th (Phe) or 118th (Phe)-1st
A peptide comprising the amino acid sequence of position 25 (Phe); the amino acid sequence represented by SEQ ID NO: 50;
Peptides containing the amino acid sequence from the (Ser) to the 94th (Phe) are preferred, and particularly, the 56th (Ser) to the 92nd (Phe) and 73rd amino acids in the amino acid sequence represented by SEQ ID NO: 1. Th (Met) ~
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 115th (Asn) to 131st (Phe) or 12
A peptide containing the amino acid sequence of the 4th (Val) to 131st (Phe); the 56th (Ser) to the 92nd (Phe) and the 73rd (Met) to the amino acid sequence represented by SEQ ID NO: 8;
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 115th (Asn) to 131st (Phe) or 12
A peptide containing the 4th (Val) to 131st (Phe) amino acid sequence; the 58th amino acid sequence represented by SEQ ID NO: 14;
(Ser)-92nd (Phe), 81st (Met)
-92nd (Phe) or 124th (Val)-13
Peptides containing the first (Phe) amino acid sequence are preferred. Among them, 56th (Ser) to 92nd (Phe), 73rd (Met) to 73rd (Met) of the amino acid sequence represented by SEQ ID NO: 1
92nd (Phe), 81st (Met)-92nd (Phe) or 84th (Ser)-92nd (Phe)
A peptide comprising the amino acid sequence of SEQ ID NO: 56: 56th (Ser) to 92nd (Phe), 73rd (Met) to
92nd (Phe), 81st (Met)-92nd (Phe) or 84th (Ser)-92nd (Phe)
A peptide comprising the amino acid sequence of SEQ ID NO: 14;
(Ser) to 92nd (Phe) or 81st (Me
A peptide containing the amino acid sequence from t) to 92nd (Phe) is preferable, and particularly, a peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. Peptide, a peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 8, and the 81st amino acid sequence of the amino acid sequence represented by SEQ ID NO: 14
Peptides containing the amino acid sequence from the (Met) to the 92nd (Phe) are preferred. In particular, the amino acid sequence from the 81st (Met) to the 92nd (Phe) of the amino acid sequence represented by SEQ ID NO: 1 Preferred is a peptide containing the amino acid sequence from the 81st position (Met) to the 92nd position (Phe) of the amino acid sequence represented by SEQ ID NO: 8. Preferable examples of the partial peptide of the present invention include (a) a peptide having the 81st (Met) to 92nd (Phe) amino acid sequence of SEQ ID NO: 1, and (b) a 101st amino acid sequence of SEQ ID NO: 1. Th (Ser)
(C) a peptide having an amino acid sequence of positions 124 (Val) to 131 (Phe) of SEQ ID NO: 1, (d) a peptide having an amino acid sequence of positions 124 to 131 (Phe), 56th (Ser) to 9th
A peptide having a second (Phe) amino acid sequence, (e)
A peptide having the 81st (Met) to 92nd (Phe) amino acid sequence of SEQ ID NO: 14, (f) the 101st (Ser) to 112th (L) of SEQ ID NO: 14;
eu) a peptide having the amino acid sequence of (g), SEQ ID NO: 14 at position 58 (Ser) to position 92 (Phe)
A peptide having the amino acid sequence of (h) SEQ ID NO: 3
3, a peptide having the 83rd (Val) to 94th (Phe) amino acid sequence; (i) a peptide having the 118th (Phe) to 125th (Phe) amino acid sequence of SEQ ID NO: 33; (J) fifth of SEQ ID NO: 33
A peptide having an amino acid sequence from the 8th (Ser) to the 94th (Phe); and (k) a peptide having an amino acid sequence from the 58th (Ser) to the 94th (Phe) of SEQ ID NO: 50. .

Particularly, an amide of these peptides (preferably, a carboxyl group at the C-terminus of these peptides (-C
(OHH) amidated (-CONH ₂ ) peptide)
Is preferred. Specifically in SEQ ID NO: 81 amino acid sequence represented by 1 (Met) ~ 92 th C-terminus of the peptide represented by the amino acid sequence of (Phe) was amidated (-CONH ₂₎ peptide ( SEQ ID NO: 39), the 101st amino acid sequence (Se
r) to 112 th (C-terminus of the peptide represented by the amino acid sequence of Ser) is amidated (-CONH ₂₎ peptide (SEQ ID NO: 41) and SEQ ID NO: 124th amino acid sequence represented by (Val)-131st (Ph
e) The peptide (SEQ ID NO: 4) in which the C-terminus of the peptide represented by the amino acid sequence is amidated (-CONH ₂ )
0). In particular, the peptide represented by the amino acid sequence from the 81st (Met) to the 92nd (Phe) of the amino acid sequence represented by SEQ ID NO: 1 has a C-terminal amidated (-CONH ₂ ) peptide (sequence). number:
39) Alternatively, the C-terminal of the peptide represented by the amino acid sequence at positions 124 (Val) to 131 (Phe) of the amino acid sequence represented by SEQ ID NO: 1 is amidated (-
CONH ₂ ) peptide (SEQ ID NO: 40) and the like, and the C-terminal of the peptide represented by the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1 is an amide. (-CONH ₂ )
Peptides (SEQ ID NO: 39) are particularly preferred.

As the salt of the polypeptide of the present invention or the partial peptide of the present invention, salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts) are used. Particularly preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid),
Alternatively, organic acids (eg, acetic acid, formic acid, propionic acid,
Fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid,
For example, salts with malic acid, oxalic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid) are used. The polypeptide of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof can be produced from a cell or tissue of a human or a warm-blooded animal by a known method for purifying a polypeptide, or a polypeptide described below. It can also be produced by culturing a transformant containing DNA encoding the peptide. Further, it can be produced according to the peptide synthesis method described later. When producing from human or mammalian tissues or cells, the homogenized human or mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated.

For the synthesis of the polypeptide of the present invention or a salt thereof, or the partial peptide of the present invention or a salt thereof,
Usually, commercially available resins for polypeptide synthesis can be used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin,
PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4-
(2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin, and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide according to various condensation methods known per se. At the end of the reaction, the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed.In addition, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution, and the polypeptide of the present invention or a salt thereof or the partial peptide of the present invention or Get that salt. For the condensation of the above protected amino acids, various activating reagents that can be used for polypeptide synthesis can be used, and carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-
Diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimide and the like are used. For activation by these, the protected amino acid was directly added to the resin together with a racemization inhibitor additive (eg, HOBt, HOOBt), or the protected amino acid was previously activated as a symmetric acid anhydride or HOBt ester or HOOBt ester. It can be added later to the resin. The solvent used for activating the protected amino acid or condensing with the resin may be appropriately selected from solvents known to be usable for the polypeptide condensation reaction. For example, N, N-dimethylformamide, N, N-dimethylacetamide,
Acid amides such as N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethyl sulfoxide, pyridine, dioxane,
Ethers such as tetrahydrofuran, nitriles such as acetonitrile and propionitrile, methyl acetate,
Esters such as ethyl acetate or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for the polypeptide bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually 1.5 to 4
Used in fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

Examples of the amino-protecting group for the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2
-Nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group is
For example, alkyl esterification (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl,
Cyclohexyl, cycloheptyl, cyclooctyl, 2
Linear, branched or cyclic alkyl esterification such as adamantyl), aralkyl esterification (eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification) , Phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine is
For example, it can be protected by esterification or etherification. Suitable groups for this esterification include, for example, lower (C _1-6 alkanoyl,
An aroyl group such as a benzoyl group and a group derived from carbonic acid such as a benzyloxycarbonyl group and an ethoxycarbonyl group are used. Examples of the group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. As the protecting group for the phenolic hydroxyl group of tyrosine, for example, Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, t-butyl and the like are used. As a protecting group for imidazole of histidine, for example, To
s, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc
Are used. Examples of the activated carboxyl group of the raw material include, for example, the corresponding acid anhydride, azide,
Activated ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBt ) And the like) are used.
As the activated amino group of the raw material, for example,
The corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon,
Also, acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and reduction with sodium in liquid ammonia Also used. The elimination reaction by the acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C.
In the acid treatment, for example, anisole, phenol,
It is effective to add a cation scavenger such as thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol and the like. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like. Protection of functional groups that should not participate in the reaction of the raw materials, as well as protecting groups,
The elimination of the protective group and activation of the functional group involved in the reaction can be appropriately selected from known groups or known means.

As another method for obtaining an amide of the polypeptide or partial peptide of the present invention, for example,
After protecting the α-carboxyl group of the carboxy terminal amino acid by amidation, extending the peptide (polypeptide) chain to the amino group side to a desired length,
A polypeptide from which only the protecting group for the terminal α-amino group has been removed and a polypeptide from which only the protecting group for the carboxyl group at the C-terminal have been removed are produced, and both polypeptides are condensed in a mixed solvent as described above. . Details of the condensation reaction are the same as described above. After purifying the protected polypeptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. This crude polypeptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired polypeptide or partial peptide.
To obtain an ester of the polypeptide or partial peptide of the present invention, for example, α-
After condensing the carboxyl group with a desired alcohol to form an amino acid ester, an ester of the desired polypeptide or partial peptide can be obtained in the same manner as the amide of the polypeptide. The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se, or by cleaving the polypeptide of the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the partial peptide of the present invention with the remaining portion, and removing the protective group when the product has a protective group. Known condensation methods and elimination of protecting groups include, for example,
The following methods are mentioned. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Pharmaceuticals, Vol. 14, Peptide Synthesis, Hirokawa Shoten Thereafter, the partial peptide of the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the partial peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the partial peptide is obtained as a salt, a known method or analogous method It can be converted into a free form or another salt by a method. DNA encoding the polypeptide of the present invention
May be any as long as it contains a base sequence encoding the polypeptide of the present invention described above. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells / tissues, cDNA library derived from the aforementioned cells / tissues, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Also, Reverse Transcriptase Polymerase Chain R
It can also be amplified by eaction (hereinafter abbreviated as RT-PCR method).

DNA encoding the polypeptide of the present invention
For example, a DNA containing the base sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51;
Or SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15,
SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51
Having a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by the following, and having substantially the same activity as the polypeptide of the present invention (eg, cell stimulating activity, etc.)
Any DNA may be used as long as it encodes a polypeptide having Examples of the DNA that can hybridize with the base sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51 under high stringent conditions include DNA containing a base sequence having about 70% or more, preferably about 80% or more, more preferably about 90% or more, and still more preferably about 95% or more homology with the base sequence represented by SEQ ID NO: 2, respectively. Are used. Hybridization is performed by a method known per se or a method analogous thereto, for example, Molecular Cloning 2nd (J. Sambrook eta).
l., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM.
In mM, the temperature is about 50-70 ° C, preferably about 60-6
The condition at 5 ° C. is shown. In particular, when the sodium concentration is about 19 mM
Most preferably, the temperature is about 65 ° C.

More specifically, DN coding for a polypeptide having the amino acid sequence represented by SEQ ID NO: 1
As A, a DNA having the base sequence represented by SEQ ID NO: 2 or the like is used. As the DNA encoding the polypeptide having the amino acid sequence represented by SEQ ID NO: 8, a DNA having the base sequence represented by SEQ ID NO: 9 or the like is used, and has the amino acid sequence represented by SEQ ID NO: 14. D encoding the polypeptide
As the NA, a DNA having the base sequence represented by SEQ ID NO: 15 or the like is used.
As NA, a DNA having the base sequence represented by SEQ ID NO: 19 or the like is used.
As NA, a DNA having the base sequence represented by SEQ ID NO: 34 or the like is used.
As the NA, a DNA having the base sequence represented by SEQ ID NO: 51 or the like is used. The DNA encoding the partial peptide of the present invention may be any DNA as long as it contains the above-described nucleotide sequence encoding the partial peptide of the present invention. In addition, genomic DNA, genomic DNA library, and the above-described cell / tissue-derived cD
NA, any of the above-described cell / tissue-derived cDNA libraries and synthetic DNAs may be used.

DNA encoding the partial peptide of the present invention
For example, a DNA having a partial base sequence of a DNA having a base sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51; Alternatively, it has a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51. A DNA having a partial nucleotide sequence of a DNA encoding a polypeptide having substantially the same activity as that of the polypeptide of the present invention is used. SEQ ID NO:
2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19,
The DNA hybridizable with the nucleotide sequence represented by SEQ ID NO: 34 or SEQ ID NO: 51 has the same significance as described above. The same hybridization method and high stringency conditions as described above are used. A polypeptide encoded by a DNA capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 34 or SEQ ID NO: 51 is described later in the present invention. And the amides, esters and salts of the polypeptide include the same as the above-mentioned amides, esters and salts of the polypeptide of the present invention.

More specifically, as the DNA encoding the partial peptide of the present invention, the 56th (Ser) to 92nd (Phe) and 73rd (Met) amino acid sequences represented by SEQ ID NO: 1 ) ~
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn)-131st (Phe), 124th (Va
l) 131st (Phe), 1st (Met) to 92nd (Phe), 1st (Met) to 112th (Ser) or 1st (Met) to 131st (Phe) amino acids DNA encoding the peptide containing the sequence, or DNA containing the nucleotide sequence hybridizing with these under high stringency conditions, 56th position (Ser) to 92nd position of the amino acid sequence represented by SEQ ID NO: 8 (Phe), 73rd (Met) ~
92nd (Phe), 81st (Met) to 92nd (Phe), 84th (Ser) to 92nd (Phe), 101st (Ser) to 112th (Ser), 115th (Asn)-131st (Phe), 124th (Val)
To the 131st (Phe), 1st (Met) to 92nd (Phe), 1st (Met) to 112th (Ser) or 1st (Met) to 131st (Phe) amino acid sequences A DNA encoding the peptide contained therein, or a DNA having a base sequence hybridizable thereto under high stringency conditions, a DNA encoding the 58th amino acid sequence represented by SEQ ID NO: 14
(Ser)-92nd (Phe), 81st (Met)
-92nd (Phe), 101st (Ser)-112th
(Leu), 124th (Val)-131st (Ph
e), 1st (Met) to 92nd (Phe) or 1st
DNA encoding a peptide containing the amino acid sequence of positions (Met) to 131 (Phe), or a DNA containing a base sequence that hybridizes therewith under high stringency conditions, the amino acid represented by SEQ ID NO: 33 No. 58 of the array
(Ser)-94th (Phe), 83rd (Val)
To the 94th (Phe), the 84th (Pro) to the 94th (Phe) or the 118th (Phe) to the 125th (Ph)
e) D encoding a peptide containing the amino acid sequence of
NA, or a DNA containing a base sequence hybridizable therewith under high stringency conditions, the 58th amino acid sequence of SEQ ID NO: 50
(Ser) to 94th (Phe) or 84th (Pr)
o) DNA encoding a peptide containing the amino acid sequence from the 94th to the 94th (Phe), or a DNA containing a base sequence that hybridizes with these under high stringency conditions.

The DNA encoding the peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1 includes a nucleotide sequence represented by SEQ ID NO: 42 DNA containing (the 241st to 276th base sequence of the base sequence represented by SEQ ID NO: 2), 101st (Ser) to 112th (Ser) of the amino acid sequence represented by SEQ ID NO: 1 The DNA encoding the peptide containing the amino acid sequence of SEQ ID NO: 43 includes the nucleotide sequence represented by SEQ ID NO: 43 (the 301st to 33rd nucleotides of the nucleotide sequence represented by SEQ ID NO: 2).
DNA containing the 6th base sequence), the 124th (Val) to 13th positions of the amino acid sequence represented by SEQ ID NO: 1
The DNA encoding the peptide containing the first (Phe) amino acid sequence includes a nucleotide sequence represented by SEQ ID NO: 44 (the 370th to 393rd nucleotides of the nucleotide sequence represented by SEQ ID NO: 2). DNA containing the sequence
The first (Me) of the amino acid sequence represented by SEQ ID NO: 1
DNA encoding a peptide containing the amino acid sequence from t) to the 92nd position (Phe) includes a base sequence represented by SEQ ID NO: 45 (first to ninth bases of the base sequence represented by SEQ ID NO: 2) 276 base sequence)
A, DNA encoding a peptide containing the first (Met) to 112th (Ser) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1 includes SEQ ID NO: 46
DNA containing the base sequence represented by SEQ ID NO: 1 (the first to 336th base sequence of the base sequence represented by SEQ ID NO: 2) and the first amino acid sequence represented by SEQ ID NO: 1 (Met The DNA encoding the peptide containing the amino acid sequence of positions 131 to 131 (Phe) includes a base sequence represented by SEQ ID NO: 47 (first to 393rd positions of the base sequence represented by SEQ ID NO: 2). Base sequence)
And the like. Also, SEQ ID NO:
56th amino acid sequence (Ser) to 9th amino acid sequence represented by 1
As the DNA encoding the peptide containing the second (Phe) amino acid sequence, a DNA containing the 166th to 276th nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2; Seventh of the represented amino acid sequence
The DNA encoding the peptide containing the 3rd (Met) to 92nd (Phe) amino acid sequence contains the 217st to 276th base sequence of the base sequence represented by SEQ ID NO: 2. No. 84 (Ser) to No. 92 (Ph) of the amino acid sequence represented by DNA, SEQ ID NO: 1.
e) D encoding a peptide containing the amino acid sequence of
NA is the second nucleotide of the nucleotide sequence represented by SEQ ID NO: 2.
DNA containing the nucleotide sequence at positions 53 to 276,
As a DNA encoding a peptide containing the amino acid sequence from position 115 (Asn) to position 131 (Phe) of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2
A DNA containing the 346th to 393rd nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 8; the 56th (Ser) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 8; Examples of the DNA encoding the contained peptide include a DNA containing the nucleotide sequence at positions 169 to 276 of the nucleotide sequence represented by SEQ ID NO: 9, and a DNA containing the nucleotide sequence at position 73 in the amino acid sequence represented by SEQ ID NO: 8. (Met) ~
As the DNA encoding the peptide containing the 92nd amino acid sequence (Phe), a DNA containing the 220th to 276th nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 9, SEQ ID NO: 8 The DNA encoding the peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 9 is the 244th to the 244th amino acid sequence of the nucleotide sequence represented by SEQ ID NO: 9. 276
DNA containing the ninth base sequence, the 84th (Ser) -92nd (P
he) D encoding a peptide containing the amino acid sequence of
NA is the second nucleotide of the nucleotide sequence represented by SEQ ID NO: 9.
DNA containing the nucleotide sequence at positions 53 to 276,
The DNA encoding the peptide having the 101st (Ser) to 112th (Ser) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 8 includes SEQ ID NO: 9
DNA containing the 304th to 336th nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 8, 115th (Asn) to 131st (Phe) of the amino acid sequence represented by SEQ ID NO: 8
DNA encoding a peptide containing the amino acid sequence of
No. 346 of the nucleotide sequence represented by SEQ ID NO: 9
A DNA containing the nucleotide sequence from the ninth to the 393rd, and the 124th (Va) of the amino acid sequence represented by SEQ ID NO: 8;
l) As the DNA encoding the peptide containing the 131st (Phe) amino acid sequence, a DNA or a sequence containing the 373rd to 393rd base sequences of the base sequence represented by SEQ ID NO: 9 DNA encoding a peptide containing the amino acid sequence of the 1st (Met) to 92nd (Phe) of the amino acid sequence represented by No. 8 includes
1st to 276th of the nucleotide sequence represented by SEQ ID NO: 9
DNA containing the base sequence at position 1 (Met) to position 112 (S
er) D encoding a peptide containing the amino acid sequence of
NA is the first nucleotide of the base sequence represented by SEQ ID NO: 9.
DNA containing the 336th to 336th nucleotide sequences, the first (Met) to the amino acid sequence represented by SEQ ID NO: 8
As the DNA encoding the peptide containing the 131st amino acid sequence (Phe), a DNA containing the 1st to 393rd nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 9; SEQ ID NO: 14 As a DNA encoding a peptide containing the amino acid sequence of the 58th position (Ser) to the 92nd position (Phe) of the amino acid sequence represented by SEQ ID NO: 15, the 172nd to 172nd positions of the nucleotide sequence represented by SEQ ID NO: 15 27
The DNA containing the sixth base sequence, the DNA encoding the peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 14 include SEQ ID NO: : DNA containing the 241st to 276th nucleotide sequence of the nucleotide sequence represented by 15; the first amino acid sequence represented by SEQ ID NO: 14
The DNA encoding the peptide containing the amino acid sequence from the 01th (Ser) to the 112th (Leu) includes the 301st to 33rd nucleotides of the nucleotide sequence represented by SEQ ID NO: 15.
DNA containing the sixth base sequence, the 124th position (Val) to the 13th position in the amino acid sequence represented by SEQ ID NO: 14
As the DNA encoding the peptide containing the first (Phe) amino acid sequence, a DNA containing the 370th to 393rd nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 15; The DNA encoding the peptide containing the first (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by the first to 276th nucleotide sequences of SEQ ID NO: 15 DNA containing the base sequence No. 14, the first (Met) to the 131st (Ph) of the amino acid sequence represented by SEQ ID NO: 14
e) D encoding a peptide containing the amino acid sequence of
As NA, DNA containing the 1st to 393rd nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 15; 58th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 33 (Se
r) The DNA encoding the peptide containing the 94th amino acid sequence (Phe) includes a DNA containing the 172nd to 282nd nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 34; The DNA encoding the peptide having the 83rd amino acid sequence (Val) to the 94th amino acid sequence (Phe) of the amino acid sequence represented by No. 33 is 247th of the base sequence represented by SEQ ID NO: 34. A DNA containing the base sequence from the 282nd to the 282nd, the 84th (Pro) amino acid sequence represented by SEQ ID NO: 33;
As the DNA encoding the peptide containing the amino acid sequence from the 94th to the 94th (Phe), a DNA containing the 250th to 282nd nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 34, SEQ ID NO: As a DNA encoding a peptide containing the amino acid sequence at positions 118 (Phe) to 125 (Phe) of the amino acid sequence represented by 33, the DNA encoding the peptide having the amino acid sequence at positions 352 to 352 of the base sequence represented by SEQ ID NO: 34 DNA containing the 375th base sequence, 58th (Ser) amino acid sequence represented by SEQ ID NO: 50
As the DNA encoding the peptide containing the amino acid sequence from the 94th to the 94th (Phe), a DNA containing the 172nd to 282nd nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 51, SEQ ID NO: As a DNA encoding a peptide containing the amino acid sequence at positions 84 (Pro) to 94 (Phe) of the amino acid sequence represented by 50, the DNA encoding the peptide having the amino acid sequence at positions 250 to 250 of the base sequence represented by SEQ ID NO: 51 DNAs containing the 282nd nucleotide sequence and the like can be mentioned.

The polypeptide or its partial peptide of the present invention, the receptor protein or its partial peptide of the present invention described below, and the DNA encoding these proteins or peptides may be labeled by a method known per se. Isotope-labeled,
Fluorescent labels (for example, fluorescent labels with fluorescein or the like), biotinylated ones, enzyme-labeled ones, and the like can be given. The polypeptide or the partial peptide of the present invention (hereinafter, in the description of the cloning and expression of DNAs encoding these polypeptides and the like, these polypeptides and the like may be simply abbreviated to the polypeptide of the present invention) may be completely encoded. As a means for cloning the DNA, the DNA of the present invention is amplified by a PCR method known per se using a synthetic DNA primer having a partial base sequence of the polypeptide of the present invention, or the DNA of the present invention is incorporated into an appropriate vector. Fragment or synthetic D encoding part or all of
Selection can be carried out by hybridization with a substance labeled with NA. Hybridization methods include, for example, molecular cloning (Mo
lecular Cloning) 2nd (J. Sambrook et al., Cold Sp
ring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. The DNA base sequence can be converted using a known kit, for example, Mutan ^™ -super ExpressKm (Takara Shuzo), Mutan ^™ -K (Takara Shuzo), or the like.
-The method can be carried out according to a method known per se, such as the LA PCR method, the Gapped duplex method, the Kunkel method, or a method analogous thereto. D encoding the cloned polypeptide
NA can be used as it is depending on the purpose, or as desired, after digestion with a restriction enzyme or adding a linker. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation start codon and translation stop codon
It can also be added using an appropriate synthetic DNA adapter.

The expression vector of the polypeptide of the present invention comprises
For example, (a) DN encoding the polypeptide of the present invention
A, a DNA fragment of interest is cut out from (A) and the DN
It can be produced by ligating the A fragment downstream of the promoter in an appropriate expression vector. As a vector, a plasmid derived from Escherichia coli (eg, pBR322,
pBR325, pUC12, pUC13) and plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC19)
4), yeast-derived plasmids (eg, pSH19, pSH1
5), bacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., pA1-11, pXT1, pR
c / CMV, pRc / RSV, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, the SRα promoter,
SV40 promoter, HIV / LTR promoter,
CMV promoter, HSV-TK promoter and the like can be mentioned. Of these, it is preferable to use a CMV (cytomegalovirus) promoter, SRα promoter, or the like. When the host is a genus Escherichia,
trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, T7 promoter, etc., when the host is Bacillus sp., SPO1 promoter, SPO2 promoter, penP promoter, etc .; , PGK promoter, GA
P promoters and ADH promoters are preferred.
When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. In addition to the above, the expression vector may optionally include an enhancer, a splicing signal, a polyA addition signal, a selection marker,
Those containing the SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) or the like can be used. As the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistant gene (hereinafter sometimes abbreviated as Amp ^r),
Neomycin resistant gene (hereinafter sometimes abbreviated as Neo ^r, G418 resistance) and the like. In particular, dh
Using fr gene-deficient Chinese hamster cells
When the hfr gene is used as a selection marker, the target gene can also be selected using a thymidine-free medium. Further, if necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide of the present invention. When the host is a genus Escherichia, a PhoA signal sequence, an OmpA signal sequence, and the like. In some cases, MFα signal sequence, SUC2 signal sequence, etc., and when the host is an animal cell, insulin signal sequence, α-interferon signal sequence, antibody molecule, signal sequence, etc. can be used. Using the vector containing the DNA encoding the polypeptide of the present invention thus constructed, a transformant can be produced. As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used.

Specific examples of the genus Escherichia include, for example, Escherichia coli K12.
DH1 [Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60, 1
60 (1968)], JM103 [Nukuilec Acids Research, (Nucleic Acids Research), 9, 3
09 (1981)], JA221 [Journal of Molecular Biology (Journal of Molecular Bio
logy)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Examples of Bacillus bacteria include, for example, Bacillus
Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry
emistry), Vol. 95, 87 (1984)]. Examples of yeast include, for example, Saccharomyces cerevisiae AH22, AH22
^{R -, NA87-11A, DKD-5D} , 20B-1
2. Schizosaccharomy
ces pombe) NCYC1913, NCYC2036, Pichia pastoris KM71 and the like.

As insect cells, for example, the virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestra brassicae or
Estigmena acrea-derived cells and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mor
iN cells; BmN cells) and the like. As the Sf cells, for example, Sf9 cells (ATCC CRL1711), Sf9
21 cells (Vaughn, JL et al., In Vivo
ivo), 13, 213-217, (1977)). As insects, for example, silkworm larvae are used [Maeda et al., Nature, 315, 592 (198).
5)]. As animal cells, for example, monkey cells COS-
7, Vero, Chinese hamster cell CHO (hereinafter referred to as
CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, human FL cells, and the like. Transformation of the genus Escherichia can be performed, for example, by the procedure of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 69, 21.
10 (1972) and Gene, 17, 107 (1)
982). For transformation of Bacillus sp., For example, Molecular and General Genetics (Mole
cular & General Genetics), 168, 111 (19
79) and the like.
To transform yeast, see, for example, Methods in Enzymology, 194.
Vol. 182-187 (1991).
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
USA), Vol. 75, 1929 (1978).

To transform an insect cell or insect,
For example, Bio / Technology, 6, 4
7-55 (1988)). To transform animal cells, for example, see Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267
(1995) (published by Shujunsha), virology (Virolog)
y), Vol. 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide can be obtained. When culturing a transformant whose host is Escherichia or Bacillus,
A liquid medium is suitable as a medium used for culture,
It contains a carbon source, a nitrogen source, inorganic substances and the like necessary for the growth of the transformant. As the carbon source, for example, glucose, dextrin, soluble starch,
As a nitrogen source such as sucrose, for example, inorganic salts or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, inorganic substances such as calcium chloride , Sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. PH of the medium is about 5-8
Is desirable. As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently.

When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be applied. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, for example, Burkholder's minimum medium [Bostian, KL et al., Processings of
The National Academy of Sciences
Of the USA (Proc. Natl. Acad. Sci. U
SA), vol. 77, 4505 (1980)] or SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings of the National Academy of Sciences of the USA]. (Proc. Na
Acad. Sci. USA), 81, 5330 (198).
4)]. Preferably, the pH of the medium is adjusted to about 5-8. Culture is usually performed at about 20 ° C to 35 ° C for about 24 to
Run for 72 hours, adding aeration and agitation as needed. When culturing a transformant in which the host is an insect cell or an insect, Grace's Insect Medium (Grace, T .;
CC, Nature, 195, 788 (1962)) to which an immobilized additive such as 10% bovine serum is appropriately added. Preferably, the pH of the medium is adjusted to about 6.2-6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, examples of the medium include a MEM medium containing about 5 to 20% fetal bovine serum [Science, Vol. 122, 501 (1952)],
DMEM medium [Virology, 8, 39
6 (1959)], RPMI 1640 medium [The Journal of the American Medical Association]
n) Volume 199, 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine (Proceeding of the Society)]
for the Biological Medicine), 73, 1 (195
0)]. Preferably, the pH is between about 6-8. The cultivation is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. As described above, the polypeptide of the present invention can be produced on the cell membrane or the like of the transformant. The polypeptide of the present invention can be separated and purified from the culture by, for example, the following method.

When the polypeptide of the present invention is extracted from cultured cells or cells, the cells or cells are collected by a known method after culture, and suspended in an appropriate buffer.
After disrupting the cells or cells by ultrasonication, lysozyme and / or freeze-thawing, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the polypeptide is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. Purification of the polypeptide contained in the culture supernatant or the extract obtained in this manner can be performed by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, mainly molecular weight. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used. When the polypeptide thus obtained is obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a method known per se or analogous thereto Depending on the method, it can be converted into a free form or other salts. The polypeptide produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein-modifying enzyme before or after purification. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence or activity of the thus produced polypeptide of the present invention or a salt thereof can be measured by a binding experiment with a labeled ligand, an enzyme immunoassay using a specific antibody, or the like. Specifically, the receptor of the polypeptide of the present invention or its amide or its ester or its salt, its partial peptide or its amide or its ester or its salt (hereinafter, may be abbreviated as the receptor protein of the present invention) is specifically mentioned. For example, a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37 can be mentioned.

The receptor protein of the present invention may be, for example, a mammal (eg, human, guinea pig, rat, mouse,
Rabbits, pigs, sheep, cattle, monkeys, etc. (eg, spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts) Cells, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, Synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, or precursors, stem cells or cancer cells of these cells), blood cells,
Or any tissue in which those cells are present, for example,
Brain, each part of the brain (eg, olfactory bulb, squamous nucleus, basal sphere, hippocampus, thalamus, hypothalamus, hypothalamus, cerebral cortex, medulla, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, tail Nucleus, brain stain, substantia nigra), spinal cord, pituitary, stomach, pancreas, kidney, liver, gonads,
Thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testicle, testis, ovary, It may be a protein derived from placenta, uterus, bone, joint, skeletal muscle and the like (particularly, brain and various parts of the brain), or may be a synthetic protein. As the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 37, for example,
About 50% or more, preferably about 70% or more, more preferably about 80% or more of the amino acid sequence represented by SEQ ID NO: 37
Above, more preferably about 90% or more, most preferably about 95% or more amino acid sequences having homology.

The protein of the present invention having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 37 includes, for example, an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 37. And a protein having substantially the same activity as the amino acid sequence represented by SEQ ID NO: 37. Specific examples include a protein containing the amino acid sequence represented by SEQ ID NO: 54. As substantially the same activity, for example,
Ligand binding activity or signal transduction action. Substantially the same indicates that their activities are the same in nature. Therefore, the activities such as ligand binding activity or signal information transmission activity are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 2 times). However, quantitative factors such as the degree of these activities and the molecular weight of the protein may be different. The measurement of the activity such as the ligand binding activity or the signal information transduction action can be performed according to a method known per se, and for example, can be measured according to a ligand determination method or a screening method described later. In addition, the receptor protein of the present invention includes one or more (preferably one or more) in the amino acid sequence represented by SEQ ID NO: 37 or SEQ ID NO: 54.
An amino acid sequence in which about 30 to about 30, more preferably about 1 to 10, and still more preferably several (one or two) amino acids have been deleted, SEQ ID NO: 37 or SEQ ID NO: 5
An amino acid sequence obtained by adding one or more (preferably about 1 to 30, more preferably about 1 to 10, and still more preferably several (1 or 2)) amino acids to the amino acid sequence represented by 4 1 or 2 in the amino acid sequence represented by SEQ ID NO: 37 or SEQ ID NO: 54
Or more (preferably about 1 to 30, more preferably about 1 to 10, and still more preferably several (1 or 2
)), An amino acid sequence in which the amino acid is replaced with another amino acid, or a protein containing an amino acid sequence obtained by combining them.

According to the receptor protein used in the present specification, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide labeling. SEQ ID NO: 37, beginning with the receptor protein containing the amino acid sequence represented by, the receptor protein of the present invention, C-terminal, usually a carboxyl group (-COOH) or carboxylate (-COO ^-) is a, C-terminal, May be an amide (—CONH ₂ ) or an ester (—COOR). Here, as R in the ester, for example, a C _1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl, for example, phenyl And C _6-12 aryl groups such as α-naphthyl, for example, phenyl-C _1-2 alkyl groups such as benzyl and phenethyl or C _7- alkyl groups such as α-naphthyl-C _1-2 alkyl groups such as α-naphthylmethyl. _In addition to ₁₄ aralkyl groups, a pivaloyloxymethyl group commonly used as an oral ester is used.

When the receptor protein of the present invention has a carboxyl group (or carboxylate) at a position other than the C-terminal, those having a carboxyl group amidated or esterified are also included in the receptor protein of the present invention.
As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the receptor protein of the present invention is a polypeptide as defined above, an amino group protecting group of the N-terminal methionine residue (e.g., formyl group, such as C _2-6 alkanoyl group such as acetyl C _1-6
Acyl group), a glutamyl group formed by cleavage of the N-terminal side in vivo and pyroglutamine oxidation, a substituent on the side chain of an amino acid in the molecule (for example, -OH, -SH, An amino group, an imidazole group, an indole group, a guanidino group, etc.) which are protected with a suitable protecting group (for example, a C _1-6 acyl group such as a C _2-6 alkanoyl group such as formyl group and acetyl); Alternatively, a complex protein such as a so-called glycoprotein to which a sugar chain is bound is also included. Specific examples of the receptor protein of the present invention include, for example, a rat-derived receptor protein containing the amino acid sequence represented by SEQ ID NO: 37, a human-derived receptor protein represented by SEQ ID NO: 54, and the like. The partial peptide of the receptor protein of the present invention may be any peptide as long as it is a partial peptide of the above-described receptor protein of the present invention. For example, among the receptor protein molecules of the present invention, And a site having a receptor binding activity. Specifically, SEQ ID NO: 3
7 or a partial peptide of the receptor protein having the amino acid sequence represented by SEQ ID NO: 54 includes an extracellular region (hydrophilic (Hydrophili
c) a peptide containing a portion that was analyzed to be a site). Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used.

The number of amino acids of the partial peptide of the receptor protein of the present invention is at least 20 or more, preferably 50 or more, more preferably 100 or more of the amino acid sequences constituting the receptor protein of the present invention. Are preferred. A substantially identical amino acid sequence is defined as about 50%
Or more, preferably about 70% or more, more preferably about 80%
% Or more, more preferably about 90% or more, and most preferably about 95% or more homology.
Here, “substantially the same activity” has the same meaning as described above. The “substantially equivalent activity” can be measured in the same manner as described above. Further, the partial peptide of the receptor protein of the present invention has one or more (preferably about 1 to 10, more preferably several (1 or 2)) amino acids in the above amino acid sequence deleted. Or one or more amino acid sequences (preferably 1 to
About 20 amino acids are added, more preferably about 1 to 10 amino acids, and still more preferably several (1 or 2) amino acids,
Alternatively, one or more (preferably about 1 to 10, more preferably several (1 or 2)) amino acids in the amino acid sequence may be substituted with another amino acid. The partial peptide of the receptor protein of the present invention usually has a carboxyl group (—COOH) or a carboxylate (—COO ⁻ ) at the C-terminus.
NH ₂ ) or an ester (—COOR) (R is as defined above). When the partial peptide of the receptor protein of the present invention has a carboxyl group (or carboxylate) other than the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the receptor protein of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, similar to the receptor protein of the present invention, the partial peptide of the receptor protein of the present invention includes
N-terminal methionine residue whose amino group is protected with a protecting group, N-terminal side is cleaved in vivo and Gln formed is pyroglutamine-oxidized, and substituent on the side chain of amino acid in the molecule is appropriate Also included are those protected with various protecting groups or complex peptides such as so-called glycopeptides to which sugar chains are bonded.

As the salt of the receptor protein or its partial peptide of the present invention, a physiologically acceptable acid addition salt is particularly preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) And tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid). The receptor protein of the present invention or a salt thereof can be produced from the aforementioned human or mammalian cells or tissues by a known method for purifying a receptor protein, or contains a DNA encoding the receptor protein of the present invention described below. (The host may be the same as the host of the above-mentioned transformant containing the DNA encoding the polypeptide of the present invention, etc.), and may contain the DNA encoding the polypeptide of the present invention. Alternatively, it can be produced by culturing according to the above-described method for culturing a transformant containing the DNA encoding the polypeptide of the present invention. Further, it can also be produced by the aforementioned polypeptide synthesis method or a method analogous thereto. When producing from human or mammalian tissues or cells, the homogenized human or mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated.

The partial peptide of the receptor protein of the present invention or a salt thereof can be produced according to the aforementioned peptide synthesis method known per se, or by cleaving the receptor protein of the present invention with an appropriate peptidase. The receptor protein of the present invention or its salt, its partial peptide, its amide or its ester or its salt is synthesized by the same method as the above-mentioned synthesis method of the polypeptide of the present invention or its amide or its ester or its salt. be able to. The polynucleotide encoding the receptor protein of the present invention may be any polynucleotide containing a nucleotide sequence (DNA or RNA, preferably DNA) encoding the receptor protein of the present invention. The polynucleotide is RNA such as DNA or mRNA encoding the receptor protein of the present invention, and may be double-stranded or single-stranded. In the case of double-stranded, it may be double-stranded DNA, double-stranded RNA or DNA: RNA hybrid. In the case of a single strand, the sense strand (ie,
Coding strand) or antisense strand (ie, non-coding strand). Using the polynucleotide encoding the receptor protein of the present invention, for example, by the method described in the known experimental medicine special edition "New PCR and its application" 15 (7), 1997, or a method analogous thereto, the receptor protein of the present invention mRNA can be quantified. Examples of the DNA encoding the receptor protein of the present invention include genomic DNA, genomic DNA library, cDNA derived from the above-described cells and tissues, and cDNA derived from the above-described cells and tissues.
It may be either a library or a synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, reverse RNA was directly prepared by using a total RNA or mRNA fraction prepared from the cells and tissues described above.
anscriptase Polymerase Chain Reaction (hereinafter, RT-
PCR method).

Specifically, the DNA encoding the receptor protein of the present invention includes, for example, SEQ ID NO: 38,
It hybridizes with a DNA containing the nucleotide sequence represented by SEQ ID NO: 55 or SEQ ID NO: 56, or with the nucleotide sequence represented by SEQ ID NO: 38, SEQ ID NO: 55 or SEQ ID NO: 56 under high stringent conditions. DNA encoding a receptor protein having a base sequence and having substantially the same activity as the receptor protein of the present invention (eg, ligand binding activity, signal information transduction action, etc.)
Any one may be used. Examples of the DNA that can hybridize with the nucleotide sequence represented by SEQ ID NO: 38, SEQ ID NO: 55 or SEQ ID NO: 56 include, for example, the nucleotide sequence represented by SEQ ID NO: 38, SEQ ID NO: 55 or SEQ ID NO: 56. 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 9% or more.
DNA containing a base sequence having a homology of 5% or more is used. Hybridization can be carried out by a method known per se or a method analogous thereto, for example, Molecular Cloning 2nd (J. Samb.
rook etal., Cold Spring Harbor Lab. Press, 1989)
And the like. Also,
When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. The high stringency conditions include, for example, a condition in which the sodium concentration is about 19 to 40 mM, preferably about 19 to 20 mM, and the temperature is about 50 to 70 ° C, preferably about 60 to 65 ° C. Particularly, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C. is most preferable. The polypeptide encoded by the DNA capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 38, SEQ ID NO: 55 or SEQ ID NO: 56 can be produced in the same manner as the above-mentioned method for producing the polypeptide of the present invention. Examples of the amide, ester, and salt of the polypeptide include those similar to the above-mentioned amide, ester, and salt of the polypeptide of the present invention. More specifically, D encoding a receptor protein containing the amino acid sequence represented by SEQ ID NO: 37
As the NA, a DNA having the base sequence represented by SEQ ID NO: 38 is used, and as the DNA encoding the receptor protein containing the amino acid sequence represented by SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO:
DNA having a base sequence represented by 56 or the like is used.

D encoding the receptor protein of the present invention
The polynucleotide comprising a part of the base sequence of NA or a part of the base sequence complementary to the DNA includes not only DNA encoding the following partial peptide of the present invention, but also RNA. Is also used in a sense that also encompasses
The DNA encoding the partial peptide of the receptor protein of the present invention may be any DNA containing the above-described nucleotide sequence encoding the partial peptide of the present invention. In addition, genomic DNA, genomic DNA library, cDNA derived from the above-described cells / tissue, cDNA library derived from the aforementioned cells / tissue, synthetic DNA
Either may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, directly using an mRNA fraction prepared from the cells and tissues described above,
Reverse Transcriptase Polymerase Chain Reaction
(Hereinafter, abbreviated as RT-PCR method). Specifically, the DNA encoding the partial peptide of the present invention includes, for example, (1) SEQ ID NO: 3
8, DN having a partial nucleotide sequence of DNA having the nucleotide sequence represented by SEQ ID NO: 55 or SEQ ID NO: 56
A, or (2) having a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 38, SEQ ID NO: 55 or SEQ ID NO: 56, and substantially the same as the receptor protein of the present invention. For example, a DNA having a partial nucleotide sequence of a DNA encoding a receptor protein having the same activity (eg, ligand binding activity or signal information transmitting action) may be used.

(1) The polypeptide of the present invention or its amide or its ester or a salt thereof, or the partial peptide of the present invention or its amide or its ester or its salt (hereinafter simply referred to as the polypeptide of the present invention) Has an effect of regulating prolactin secretion, that is, an effect of promoting and suppressing prolactin secretion. That is, since the polypeptide of the present invention has a prolactin secretion-promoting action, as can be seen from the examples described below, it can be used as a preventive and therapeutic drug for various diseases related to prolactin secretion deficiency. On the other hand, since the polypeptide of the present invention has a strong affinity for its receptor protein, desensitization of prolactin secretion occurs when the dose is increased, so that the polypeptide also has an effect of suppressing prolactin secretion. In this case, it can be used as an agent for preventing and treating various diseases related to prolactin hypersecretion. Therefore, the polypeptide of the present invention may be used as a prolactin secretagogue, for various diseases related to prolactin secretion such as ovarian hypofunction, seminal vesicle growth deficiency, osteoporosis, climacteric disorder, lactation deficiency, hypothyroidism, and renal failure. Useful as prophylactic and therapeutic agents. Furthermore, since the polypeptide of the present invention has a libido promoting action (pheromone-like action) based on a prolactin secretion promoting action, it is also useful as a libido promoting agent. In addition, the polypeptide of the present invention may be used as a prolactin secretion inhibitor, such as hyperprolactinemia, pituitary gland tumor, mesencephalic tumor, menstrual abnormalities, stress, autoimmune diseases, prolactinoma, infertility, impotence, amenorrhea, and milk leakage. Disease, acromegaly, Chiari-Frommel syndrome, Argonz-del Castil
o) Syndrome, Forbes-Albrig
ht) It is useful as a preventive and therapeutic agent for various diseases related to prolactin secretion such as syndrome, breast cancer lymphoma or Sheehan syndrome or spermatogenesis abnormality. Further, the polypeptide of the present invention is also useful as a contraceptive, based on its prolactin secretion inhibitory action. In addition, the polypeptide of the present invention is also useful as a test drug for examining prolactin secretion function, and also as an animal drug such as a milk secretion promoter for livestock mammals such as cows, goats and pigs, and Is expected to be applied to the production of useful substances by producing useful substances in the livestock mammals and secreting them into milk. Furthermore, since the polypeptide of the present invention has a placental function regulating effect, it prevents or treats choriocarcinoma, hydatidiform mole, invasive mole, miscarriage, fetal growth deficiency, abnormal glucose metabolism, abnormal lipid metabolism, or induced labor. It is also useful as a medicine. The prolactin secretion regulating activity of the polypeptide of the present invention is described in Neuroendocrinology,
Vol. 62, 1995 pp. 198-206, or Neuroscience Letter
s, Vol. 203, 1996, pp. 164-170, or a method analogous thereto, and is desirably performed by the method described in Examples below.

When the polypeptide of the present invention is used as the above-mentioned medicine or veterinary medicine, it may be carried out according to a conventional method. For example, tablets, capsules, elixirs, microcapsules, and the like, optionally coated with sugar, aseptic, or aseptic solution or suspension in water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections. For example, the polypeptide or a salt thereof is a physiologically acceptable carrier, flavoring agent,
It can be prepared by mixing with excipients, vehicles, preservatives, stabilizers, binders and the like in the unit dosage form generally required for accepted pharmaceutical practice. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives which can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. And a lubricating agent such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, reddish oil or cherry, and the like. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. , For example, alcohol (eg, ethanol),
It may be used in combination with a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, polysorbate 80 ( ^TM ), HCO-50). The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. Also, a buffer (for example,
Phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, Phenol, etc.), antioxidants and the like. The prepared injection is usually aseptically filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, so that they can be used, for example, in mammals (eg, humans,
Mouse, rat, guinea pig, rabbit, sheep, pig,
Cattle, cats, dogs, monkeys, baboons, chimpanzees, etc.). The dose of the polypeptide of the present invention varies depending on the symptoms and the like. However, in the case of oral administration, generally, in an adult patient with hypothyroidism (based on a body weight of 60 kg), the dose is usually about 0.5 mg / day.
1 to 100 mg, preferably about 1.0 to 50 mg,
More preferably, it is about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, symptoms, administration method, and the like. For example, in the case of an injection, in an adult hypothyroid patient (for a body weight of 60 kg), , Usually about 0.01 to 30m per day
About g, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg may be administered by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

(2) A method for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention, characterized by using the polypeptide of the present invention, or containing the polypeptide of the present invention. A compound or a salt thereof obtained by using a screening kit for a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention, or a polypeptide of the present invention, and a receptor protein of the present invention or a salt thereof. A compound or a salt thereof which promotes or inhibits the activity of the polypeptide of the present invention, which comprises using a partial peptide, an amide or an ester thereof, or a salt thereof (hereinafter, may be abbreviated as the receptor protein of the present invention). Screening method, or the polypeptide of the present invention and the A compound or a salt thereof obtained by using a kit for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention comprising a putter protein, or a prolactin that also has a prolactin secretion promoting action. It can be used as a preventive or therapeutic drug for various diseases related to secretory deficiency. When it has an inhibitory action on prolactin secretion, it can be used for a preventive or therapeutic drug for various diseases related to prolactin hypersecretion. When the obtained compound or a salt thereof has a prolactin secretion promoting action, it can be used as a prophylactic or therapeutic drug for various diseases related to prolactin secretion deficiency. Prevention of various diseases related to prolactin secretion such as hypotension, seminal vesicle dysgenesis, osteoporosis, menopause, lactation insufficiency, hypothyroidism, renal insufficiency
Useful as a therapeutic. Further, the compound or a salt thereof has a libido promoting action (pheromone-like action) based on a prolactin secretion promoting action, and thus is also useful as a libido promoting agent. On the other hand, when the obtained compound or a salt thereof has an inhibitory action on prolactin secretion, it can be used as a prophylactic / therapeutic agent for various diseases related to prolactin hypersecretion, and the compound or a salt thereof is used as a prolactin secretion inhibitor. , Hyperprolactinemia, pituitary gland tumor, mesencephalic tumor, menstrual abnormalities, stress, autoimmune diseases, prolactinoma, infertility, impotence, amenorrhea, milk leakage, acromegaly, Chiari-Fromel
mmel syndrome, Argonz del Castillo (Argonz-
del Castilo syndrome, Forbes Albright (For)
It is useful as a prophylactic / therapeutic agent for various diseases related to prolactin secretion such as bes-Albright) syndrome, breast cancer, lymphoma or Sheehan syndrome or spermatogenesis abnormalities. Further, the compound or a salt thereof is also useful as a contraceptive, based on its prolactin secretion inhibitory action. In addition, the obtained compound or a salt thereof is also useful as a test drug for examining prolactin secretion function, and also as an animal drug such as a milk secretion promoter for livestock mammals such as cows, goats and pigs, Further, it is expected that useful substances are produced in the livestock mammals and the secretory substances are secreted into milk to produce useful substances. Furthermore, since the obtained compound or its salt has a placental function regulating action, it prevents or prevents choriocarcinoma, hydatidiform mole, invasive mole, miscarriage, fetal growth deficiency, abnormal glucose metabolism, abnormal lipid metabolism, or induced labor. It is also useful as a therapeutic. The prolactin secretion regulating activity of the compound or a salt thereof obtained using the screening method or the screening kit is described in Neuroendocrinology, 62, 1995, 198-206,
Or, Neuroscience Letters 203, 1996, 164-170
The method can be carried out by the method described on a page or the like or a method analogous thereto, and is preferably carried out by the method described in Examples described later.

When the obtained compound or a salt thereof is used as the above-mentioned medicine or veterinary medicine, it may be carried out according to a conventional method. For example, tablets, capsules, elixirs, microcapsules, and the like, optionally coated with sugar, aseptic, or aseptic solution or suspension in water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections. For example, the compound or a salt thereof can be a physiologically acceptable carrier, flavoring agent,
It can be prepared by mixing with excipients, vehicles, preservatives, stabilizers, binders and the like in the unit dosage form generally required for accepted pharmaceutical practice. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. And a lubricating agent such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, and a flavoring agent such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil and the like. . Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. , For example, alcohol (eg, ethanol),
It may be used in combination with a polyalcohol (eg, propylene glycol, polyethylene glycol), a nonionic surfactant (eg, polysorbate 80 ( ^TM ), HCO-50). The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. Also, a buffer (for example,
Phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, Phenol, etc.), antioxidants and the like. The prepared injection is usually aseptically filled in a suitable ampoule. The preparations obtained in this way are safe and low toxic, so that they can be used, for example, in mammals (eg, humans,
Mouse, rat, guinea pig, rabbit, sheep, pig,
Cattle, cats, dogs, monkeys, baboons, chimpanzees, etc.). The dose of the obtained compound or a salt thereof varies depending on symptoms and the like,
In the case of oral administration, generally about 0.1 to 100 mg, preferably about 1.0 to 50 m / day for an adult hypothyroid patient (for a body weight of 60 kg) per day.
g, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose should be
For example, in the form of an injection, an adult patient with hypothyroidism (for a body weight of 60 kg) usually has a daily dose of about 0.01 to 30 per day, although it varies depending on the symptoms, administration method and the like.
mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg may be administered by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

(3) A screening method and a screening kit for a compound or a salt thereof that promotes or suppresses the activity of the polypeptide of the present invention are described in detail below. Characterized by using the polypeptide of the present invention,
The method for screening a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention is preferably
The present invention is characterized by using the polypeptide of the present invention and the receptor protein of the present invention or its partial peptide, its amide or its ester or its salt (hereinafter sometimes abbreviated as the receptor protein of the present invention). A method for screening a compound or a salt thereof that promotes or inhibits the activity of a polypeptide.

[0048] Specifically, the screening method comprises:
(I) the polypeptide of the present invention in the case of contacting the polypeptide of the present invention with the receptor protein of the present invention; and (ii) the polypeptide of the present invention in the case of contacting the polypeptide of the present invention with the receptor protein of the present invention and a test compound. Is measured and compared. Specifically, in the above screening method, for example, (i) and (ii)
Wherein the cell stimulating activity of the polypeptide of the present invention and the test compound or the amount of the polypeptide of the present invention and the test compound binding to the receptor protein of the present invention are measured and compared. .
Cell stimulating activity of the polypeptide of the present invention can be determined by a method known per se, for example, Dockray, GJ et al., Nature, 30
5, 328-330, 1983, Fukusumi, S., et al., Biochem. B
iophys. Res.Commun., 232, 157-163, 1997, Hinuma,
S., et al., Nature, 393, 272-276,1998, Tatemoto,
K., et al. Biochem. Biophys. Res. Commun., 251, 47
It can be measured according to the method described in 1-476, 1998. or the like or a method analogous thereto.

The binding amount of the polypeptide of the present invention and the test compound to the receptor protein of the present invention can be measured, and the cell stimulating activity can be measured by the method described below or a method analogous thereto. As the test compound, for example,
Peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc., and these compounds may be novel compounds or known compounds There may be. To carry out the above-mentioned screening method, a preparation of the polypeptide of the present invention is prepared by suspending the polypeptide of the present invention in a buffer suitable for screening. The buffer has a pH of about 4 to 10 (preferably, a pH of about 6 to 10).
Any buffer may be used as long as it does not inhibit the reaction between the polypeptide of the present invention and the receptor protein of the present invention, such as the phosphate buffer and Tris-HCl buffer of 8). For example, the present invention relates to a test compound which increases the cell stimulating activity in the case of the above (ii) by about 20% or more, preferably about 30% or more, more preferably about 50% or more as compared with the above (i). On the other hand, as a compound which promotes the cell stimulating activity of the polypeptide of the above, the cell stimulating activity in the case of the above (ii) is about 20% or more, preferably about 30% or more as compared with the case of the above (i), More preferably, a test compound that inhibits about 50% or more can be selected as a compound that inhibits the cell stimulating activity of the polypeptide of the present invention. Before conducting these tests,
The test is carried out by the method of (1) described in “Measurement of the amount of binding of the polypeptide of the present invention and the test compound to the receptor protein of the present invention” or a method analogous thereto, and the test compound binds to the receptor protein of the present invention. It is preferable to confirm that Further, as one indicator for judging that the test compound is a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention, the polypeptide of the present invention and the test compound against the receptor protein of the present invention may be used. The activity of inhibiting the binding amount and the binding between the labeled form of the polypeptide of the present invention can be mentioned. For example, Hosoya, M. et al. Biochem. Biophys. Res.
Commun. 194 (1), 133-143 , in the binding assay system as described in 1993, 1 × 10 ^-2 coupling the test compound that inhibits 10% or more of the labels at the following concentrations M is the present invention It is likely that the compound or its salt promotes or inhibits the activity of the polypeptide. However, since the binding inhibitory activity is a relative value measured based on the binding of the label, it was determined that the test compound was a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of the present invention. It is not required to do so.

The screening kit of the present invention contains the polypeptide of the present invention. The screening kit of the present invention is a receptor for the polypeptide of the present invention,
That is, the receptor protein of the present invention (specifically, a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37 or a salt thereof,
Or a partial peptide thereof, an amide thereof, an ester thereof or a salt thereof). Examples of the screening kit of the present invention include:
These include:

1. Screening reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
One containing 05% bovine serum albumin (manufactured by Sigma). Sterilized by filtration through a 0.45 μm filter, 4 ° C
Or may be prepared at the time of use. Receptor standard CHO cells expressing the receptor protein of the present invention
Passage into a 12-well plate at 5 × 10 ⁵ / well, 37 ° C.
Cultured for 2 days in 5% CO ₂ and 95% air. Labeled ligand An aqueous solution of the polypeptide of the present invention labeled with commercially available [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc., is stored at 4 ° C. or −20 ° C. When used, dilute to 1 μM with the measurement buffer. Ligand standard solution The polypeptide of the present invention is dissolved to a concentration of 1 mM in PBS containing 0.1% bovine serum albumin (manufactured by Sigma) and stored at -20 ° C.

2. Assay Method CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate are washed twice with 1 ml of assay buffer, and then 490 μl of assay buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of a labeled ligand is added, and the mixture is reacted at room temperature for 1 hour. To determine the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand is added instead of the test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled ligand bound to the cells was 0.2N NaOH
1% SDS, 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
Radioactivity was measured using Percent Maximum Binding
(PMB) is obtained by the following equation (Equation 1). [Equation 1] PMB = [(B−NSB) / (B ₀ −NSB)] × 10
0 PMB: Percent Maximum Binding B: Value when a sample is added NSB: Non-specific Binding (Non-specific binding amount) B ₀ : Maximum binding amount Compound or compound obtained by using the screening method or screening kit of the present invention or The salt is a compound selected from the test compounds described above, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, and the like, A compound that promotes or inhibits the activity (eg, cell stimulating activity, etc.) of the polypeptide of the present invention. As the salt of the compound, those similar to the aforementioned salts of the polypeptide of the present invention are used.

(4) Measurement of Binding Amount and Cell Stimulating Activity of the Polypeptide of the Present Invention and the Test Compound to the Receptor Protein of the Present Invention Using the receptor protein of the present invention or constructing a recombinant receptor protein expression system By using a receptor binding assay system using the expression system, it binds to the receptor protein of the present invention and has a cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular C
a ²⁺ release, intracellular cAMP production, intracellular cGMP production,
A compound having an activity of promoting or inhibiting inositol phosphate production, fluctuation of cell membrane potential, phosphorylation of intracellular protein, activation of c-fos, decrease of pH, etc. (for example, peptide, protein, non-peptide compound, Amount of synthetic compounds, fermentation products, etc.) and cell stimulating activity.

In the measuring method, for example, when the receptor protein of the present invention is brought into contact with a test compound,
It is characterized in that the amount of a test compound bound to the receptor protein of the present invention, the cell stimulating activity and the like are measured.
More specifically, when a labeled test compound is brought into contact with the receptor protein of the present invention, a method for measuring the amount of binding of the labeled test compound to the protein is measured. A method for measuring a binding amount of a labeled test compound to the cell or the membrane fraction, which is in contact with a cell containing the receptor protein of the present invention or a membrane fraction of the cell, Binding of the labeled test compound to the receptor protein when the labeled test compound is brought into contact with the receptor protein expressed on the cell membrane by culturing a transformant containing the DNA encoding the receptor protein of the present invention. A measuring method characterized by measuring the amount of the test compound, comprising the receptor protein of the present invention. Cell-stimulating activity via a receptor protein when brought into contact with cells (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential Fluctuation, phosphorylation of intracellular protein, activation of c-fos, activity of promoting or suppressing pH reduction, etc.), and a method for determining a ligand for the receptor protein of the present invention, and When a test compound is brought into contact with a receptor protein expressed on a cell membrane by culturing a transformant containing a DNA encoding the receptor protein of the present invention, cell stimulating activity via the receptor protein (for example, arachidonic acid Release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP Production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to promote or suppress pH reduction, etc.). Features.

In particular, it is preferable to conduct the above-mentioned tests after conducting the above-mentioned tests to confirm that the test compound binds to the receptor protein of the present invention.
First, as the receptor protein used in this measurement method,
Any receptor protein containing the above-described receptor protein of the present invention may be used, but a receptor protein expressed in large amounts using animal cells is suitable. The above-described expression method is used for producing the receptor protein of the present invention, but it is preferable to express the DNA encoding the receptor protein in mammalian cells or insect cells. DN encoding the desired protein part
Usually, complementary DNA is used for the A fragment, but the present invention is not necessarily limited thereto. For example, a gene fragment or a synthetic DNA may be used. In order to introduce a DNA fragment encoding the receptor protein of the present invention into a host animal cell and express them efficiently, the DNA fragment is converted into a nuclear polyhedrosis virus belonging to a baculovirus using an insect as a host. An NPV) polyhedrin promoter, a SV40-derived promoter,
It is preferable to incorporate the gene into the downstream of a retrovirus promoter, metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SRα promoter, or the like. The amount and quality of the expressed receptor can be examined by a method known per se.
For example, the literature [Nambi, P .; Et al., The Journal of
Biological chemistry (J. Biol. Chem.), 267
Volume, 19555-19595, 1992]. Therefore, in the measurement method, the receptor protein of the present invention may be a receptor protein purified according to a method known per se, or may be a cell containing the receptor protein or a cell membrane fraction thereof. You may.

When cells containing the receptor protein of the present invention are used in the measurement method, the cells may be immobilized with glutaraldehyde, formalin, or the like. The immobilization method can be performed according to a method known per se. The cell containing the receptor protein of the present invention refers to a host cell expressing the receptor protein of the present invention. As the host cell, Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells and the like are used. The cell membrane fraction refers to a fraction abundant in cell membrane obtained by disrupting cells and then obtained by a method known per se. As a method for crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or a polytron (manufactured by Kinematica), crushing with ultrasonic waves, spouting cells from a thin nozzle while applying pressure with a French press, etc. Crushing and the like. For fractionation of cell membranes, fractionation by centrifugal force, such as fractionation centrifugation and density gradient centrifugation, is mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (generally about 1 to 10 minutes), and the supernatant is further centrifuged at a higher speed (15,000 to 30000 rpm) for 30 minutes.
After centrifugation for 2 minutes to 2 hours, the obtained precipitate is used as a membrane fraction. The membrane fraction is rich in the expressed receptor protein and membrane components such as cell-derived phospholipids and membrane proteins. The amount of the receptor protein in the cells containing the receptor protein or in the membrane fraction thereof is preferably from 10 ³ to 10 ⁸ molecules per cell, and more preferably from 10 ⁵ to 10 ⁷ molecules per cell. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system, but also to measure a large number of samples in the same lot. . In order to carry out the above methods (1) to (4), an appropriate receptor protein fraction and a labeled test compound are required. As the receptor protein fraction, a natural receptor protein fraction or a recombinant receptor fraction having an activity equivalent thereto is desirable. Here, “equivalent activity” refers to equivalent ligand binding activity, signal transduction action, and the like.

The labeled test compounds include [ ³ H],
Angiotensin, bombesin, cannabinoid, cholecystokinin, glutamine, serotonin, melatonin, neuropeptide Y, opioid, purine, vasopressin, oxytocin, PACAP, secretin, labeled with [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc. Glucagon, calcitonin, adrenomedullin, somatostatin, G
HRH, CRF, ACTH, GRP, PTH, VIP
(Vasoactive Intestinal and Retained Polypeptide), somatostatin, dopamine,
Motilin, amylin, bradykinin, CGRP (calcitonin gene-related peptide), leukotriene, pancreatastin, prostaglandin, thromboxane, adenosine, adrenaline, α and β-chemokines (eg, IL-8, GRO
α, GROβ, GROγ, NAP-2, ENA-78,
PF4, IP10, GCP-2, MCP-1, HC1
4, MCP-3, I-309, MIP1α, MIP-1
β, RANTES, etc.), endothelin, enterogastrine, histamine, neurotensin, TRH, pancreatic polypeptide or galanin, etc. are preferred.

Specifically, a receptor preparation is first prepared by suspending a cell containing the receptor protein of the present invention or a membrane fraction of the cell in a buffer suitable for the determination method. The buffer may be any buffer such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer, which does not inhibit the binding between the ligand and the receptor protein. Further, in order to reduce non-specific binding, CHAPS, Tween
Surfactants such as -80 ^™ (Kao-Atlas), digitonin, deoxycholate and various proteins such as bovine serum albumin and gelatin can also be added to the buffer. Furthermore, PMSF, leupeptin, and E-6 are used to suppress the degradation of receptors and ligands by proteases.
4 (manufactured by Peptide Research Institute), and a protease inhibitor such as pepstatin can also be added. 0.01ml ~ 1
0 ml of the receptor solution is added to a certain amount (5000 cpm).
５００500,000 cpm) of [ ³ H], [ ¹²⁵ I],
^[14 C], coexist test compound labeled with a ^[35 S]. A reaction tube containing a large excess of an unlabeled test compound is also prepared to determine the non-specific binding amount (NSB).
The reaction is carried out at about 0 ° C. to 50 ° C., preferably about 4 ° C. to 37 ° C.
About 20 minutes to 24 hours, preferably about 30 minutes to 3 hours
Perform for hours. After the reaction, the mixture is filtered with a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. A test compound in which the count (B-NSB) obtained by subtracting the non-specific binding amount (NSB) from the total binding amount (B) exceeds 0 cpm can be selected as a compound that promotes the activity of the polypeptide of the present invention.

In order to carry out the above-mentioned methods for determining a ligand for the receptor protein of the present invention,
Cell stimulating activity via the receptor protein (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation , C-fos activation, pH lowering, etc. promoting or suppressing activities) can be measured using a known method or a commercially available measuring kit. Specifically, first, cells containing the receptor protein are cultured in a multiwell plate or the like. Replace in advance with a fresh medium or an appropriate buffer that is not toxic to the cells, add the test compound, etc., incubate for a certain period of time, extract the cells or collect the supernatant, and use the resulting product for each method. Quantify according to When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. In addition, the activity such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production amount has been increased by forskolin or the like. The kit for determining a ligand that binds to the receptor protein of the present invention comprises the receptor protein of the present invention,
It contains a cell containing the receptor protein of the present invention, or a membrane fraction of a cell containing the receptor protein of the present invention.

Examples of the measurement kit include the following. 1. Assay reagent Assay buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
One containing 05% bovine serum albumin (manufactured by Sigma). Sterilized by filtration through a 0.45 μm filter, 4 ° C
Or may be prepared at the time of use. G protein-coupled receptor protein preparation CHO cells expressing the receptor protein of the present invention
Passage into a 12-well plate at 5 × 10 ⁵ / well, 37 ° C.
Cultured for 2 days in 5% CO ₂ and 95% air. Labeled test compound A commercially available compound labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], or the like, or labeled by an appropriate method. Store at 0 ° C. and dilute to 1 μM with measurement buffer before use. Test compounds that are poorly soluble in water are dissolved in dimethylformamide, DMSO, methanol and the like. Unlabeled test compound The same as the labeled compound is prepared at a concentration 100 to 1000 times higher.

[0061] 2. Assay Method CHO cells expressing the receptor protein of the present invention cultured on a 12-well tissue culture plate are washed twice with 1 ml of assay buffer, and then 490 μl of assay buffer is added to each well. 5 μl of the labeled test compound is added and reacted at room temperature for 1 hour. To determine the amount of non-specific binding, add 5 μl of an unlabeled test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled test compound bound to the cells was 0.2N NaO
Dissolve in H-1% SDS and mix with 4 ml of liquid scintillator A (Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
The radioactivity is measured using.

In the present specification and drawings, when bases, amino acids, and the like are represented by abbreviations, IUPAC-IUB
Abbreviations from the Commission on Biochemical Nomenclature or common abbreviations in the field,
An example is given below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine I: inosine R: adenine (A) or guanine (G) Y: thymine (T) or cytosine (C) M: adenine (A) or cytosine (C) K: guanine (G) or thymine (T) S: guanine (G) or cytosine (C) W: adenine (A) or thymine (T) B: guanine (G), guanine ( G) or thymine (T) D: adenine (A), guanine (G) or thymine (T) V: adenine (A), guanine (G) or cytosine (C) N: adenine (A), guanine (G) , Cytosine (C) or thymine (T) or unknown or other base RNA: ribonucleic acid mRNA: messenger ribonucleic acid d TP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxycytidine triphosphate ATP: adenosine triphosphate EDTA: ethylenediaminetetraacetic acid SDS: sodium dodecyl sulfate BHA: benzhydrylamine pMBHA : P-methylbenzhydrylamine Tos: p-toluenesulfonyl Bzl: benzyl Bom: benzyloxymethyl Boc: t-butyloxycarbonyl DCM: dichloromethane HOBt: 1-hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: tri Fluoroacetic acid DIEA: diisopropylethylamine Gly: glycine Ala or A: alanine Val or V: valine L eu or L: leucine Ile or I: isoleucine Ser or S: serine Thr or T: threonine Cys or C: cysteine Met or M: methionine Glu or E: glutamic acid Asp or D: aspartic acid Lys or K: lysine ArgR Arginine His or H: Histidine Phe or F: Phenylalanine Tyr or Y: Tyrosine Trp or W: Tryptophan Pro or P: Proline Asn or N: Asparagine Gln or Q: Glutamine pGlu: Pyroglutamic acid

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence (human type) of the polypeptide of the present invention obtained in Reference Example 1 described later. [SEQ ID NO: 2] This shows the base sequence of DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 3] This shows the base sequence of primer F5 used in Reference Example 1 described later. [SEQ ID NO: 4] This shows the base sequence of primer F6 used in Reference Example 1 described later. [SEQ ID NO: 5] This shows the base sequence of primer F1 used in Reference Example 1 described later. [SEQ ID NO: 6] This shows the base sequence of primer R5 used in Reference Example 1 described later. [SEQ ID NO: 7] This shows the base sequence of primer hR1 used in Reference Example 3 described later. [SEQ ID NO: 8] This shows the amino acid sequence (human type) of the polypeptide of the present invention obtained in Reference Example 3 described later. [SEQ ID NO: 9] This shows the base sequence of DNA encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 8. [SEQ ID NO: 10] This shows the base sequence of primer bF6 used in Reference Example 4 described later. [SEQ ID NO: 11] This shows the base sequence of primer bF7 used in Reference Example 4 described later. [SEQ ID NO: 12] This shows the base sequence of primer bR6 used in Reference Example 4 described later. [SEQ ID NO: 13] This shows the base sequence of primer bR7 used in Reference Example 4 described later. [SEQ ID NO: 14] This shows the amino acid sequence (bovine type) of the polypeptide of the present invention obtained in Reference Example 4 described later. [SEQ ID NO: 15] DN encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 14
1 shows the nucleotide sequence of A. [SEQ ID NO: 16] This shows the base sequence of primer rLPR1 used in Reference Example 5 described later. [SEQ ID NO: 17] This shows the base sequence of primer rLPF1 used in Reference Example 5 described later. [SEQ ID NO: 18] This shows the amino acid sequence (rat type) of the polypeptide of the present invention obtained in Reference Example 5 described later (before recloning). [SEQ ID NO: 19] DN encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 18
1 shows the nucleotide sequence of A. [SEQ ID NO: 20] This shows the base sequence encoding RFGK sequence. [SEQ ID NO: 21] This shows the base sequence encoding the RFGR sequence. [SEQ ID NO: 22] This shows the base sequence encoding RSGK sequence. [SEQ ID NO: 23] This shows the base sequence encoding RSGR sequence. [SEQ ID NO: 24] This shows the base sequence encoding the RLGK sequence. [SEQ ID NO: 25] This shows the base sequence encoding the RLGR sequence. [SEQ ID NO: 26] This shows the base sequence of primer FF2 used in Reference Example 6 described later. [SEQ ID NO: 27] This shows the base sequence of primer rR4 used in Reference Example 6 described later. [SEQ ID NO: 28] This shows the base sequence of primer mF1 used in Reference Example 6 described later. [SEQ ID NO: 29] This shows the base sequence of primer mF3 used in Reference Example 6 described later. [SEQ ID NO: 30] This shows the base sequence of primer mR1 used in Reference Example 6 described later. [SEQ ID NO: 31] This shows the base sequence of primer moF used in Reference Example 6 described later. [SEQ ID NO: 32] This shows the base sequence of primer moR used in Reference Example 6 described later. [SEQ ID NO: 33] This shows the amino acid sequence (mouse type) of the polypeptide of the present invention obtained in Reference Example 6 described later. [SEQ ID NO: 34] DN encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 33
1 shows the nucleotide sequence of A. [SEQ ID NO: 35] Novel G protein-coupled receptor protein rO derived from rat brain stem periphery obtained in Reference Example 7 described below
The nucleotide sequence of primer 1 used for cloning cDNA encoding T7T022L is shown. [SEQ ID NO: 36] Novel G protein-coupled receptor protein rO derived from rat brain stem periphery obtained in Reference Example 7 described below
The nucleotide sequence of primer 2 used for cloning the cDNA encoding T7T022L is shown. [SEQ ID NO: 37] Novel G protein-coupled receptor protein rO derived from rat brain stem periphery obtained in Reference Example 7 described below
2 shows the amino acid sequence of T7T022L. [SEQ ID NO: 38] Novel G protein-coupled receptor protein rO derived from rat brain stem periphery obtained in Reference Example 7 described below
2 shows the nucleotide sequence of cDNA encoding T7T022L. [SEQ ID NO: 39] This shows the amino acid sequence of the peptide obtained in Reference Example 7 (3) described later. [SEQ ID NO: 40] This shows the amino acid sequence of the peptide obtained in Reference Example 7 (4) described later. [SEQ ID NO: 41] This shows the amino acid sequence of the peptide obtained in Reference Example 7 (5) described later. [SEQ ID NO: 42] This shows the base sequence encoding the peptide containing the 81st (Met) to 92nd (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 43] This shows the base sequence encoding a peptide containing the 101st (Ser) to 112th (Ser) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 44] This shows the base sequence encoding a peptide containing the amino acid sequence at positions 124 (Val) to 131 (Phe) of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 45] This shows the base sequence encoding the peptide containing the 1st (Met) to 92nd (Phe) amino acid sequences of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 46] This shows the base sequence encoding the peptide containing the 1st (Met) -112nd (Ser) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 47] This shows the base sequence encoding the peptide containing the 1st (Met) to 131st (Phe) amino acid sequences of the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 48] Primer ra used in Reference Example 5
1 shows the nucleotide sequence of tF2. [SEQ ID NO: 49] Primer ra used in Reference Example 5
1 shows the nucleotide sequence of tR. [SEQ ID NO: 50] This shows the amino acid sequence (rat type) of the polypeptide of the present invention obtained in Reference Example 5 described later (after recloning). [SEQ ID NO: 51] DN encoding the polypeptide of the present invention having the amino acid sequence represented by SEQ ID NO: 50
1 shows the nucleotide sequence of A. [SEQ ID NO: 52] Primer bF used in Reference Example 9
1 shows the nucleotide sequence of F. [SEQ ID NO: 53] Primer bF used in Reference Example 9
1 shows the base sequence of R. [SEQ ID NO: 54] This shows the amino acid sequence of the protein (polypeptide) represented by hOT7T022 obtained in Reference Example 11. [SEQ ID NO: 55] This shows the base sequence of DNA encoding the protein (polypeptide) represented by hOT7T022 having the amino acid sequence represented by SEQ ID NO: 54. [SEQ ID NO: 56] This shows the base sequence of DNA encoding the protein (polypeptide) represented by hOT7T022 having the amino acid sequence represented by SEQ ID NO: 54. [SEQ ID NO: 57] This shows the base sequence of primer 1 used in Reference Example 11. [SEQ ID NO: 58] This shows the base sequence of primer 2 used in Reference Example 11. [SEQ ID NO: 59] Primer # used in Example 4
1 shows the base sequence of Example 1. [SEQ ID NO: 60] Primer # used in Example 4
2 shows the nucleotide sequence of 2. [SEQ ID NO: 61] Primer # used in Example 4
3 shows the nucleotide sequence of SEQ. [SEQ ID NO: 62] Primer # used in Example 4
4 shows the base sequence of Example 4.

The transformant Esc obtained in Reference Example 2 described later
herichia coli JM109 / phRF1 was obtained on April 14, 1999.
Deposited from the Ministry of International Trade and Industry at the National Institute of Advanced Industrial Science and Technology (NIBH) under the deposit number FERM BP-6702 and from the Fermentation Research Institute (IFO) as the deposit number IFO 16265 from March 5, 1999. I have. The transformant Escherichia coli obtained in Reference Example 7 described later (Escher
ichia coli) DH10B / pAK-rOT022L,
Deposit number FERM B with the National Institute of Biotechnology and Industrial Technology (NIBH) from the Ministry of International Trade and Industry on November 2, 1998.
As P-6558, deposited with the Fermentation Research Institute (IFO) on October 16, 1998, deposit number IFO 162
No. 11 has been deposited. The transformant Escherichia coli JM109 / pbRF2 obtained in Reference Example 9 described below
Deposit No. FERM BP-68 from the Institute of Biotechnology and Industrial Technology (NIBH) of the Ministry of International Trade and Industry from August 2, 2009
In 1999, the Institute of Fermentation (IFO)
Deposit No. IFO 16288 since June 18, 2008. Transformant E obtained in Reference Example 8 described later
scherichia coli JM109 / phRF2 was established on August 2, 1999 by the Ministry of International Trade and Industry,
IBH) under accession number FERM BP-6812.
It has been deposited with the Fermentation Research Institute (IFO) under the deposit number IFO 16289 since June 18, 1999. The transformant Escherichia obtained in Reference Example 6 described later
coli JM109 / pmLP4 was submitted to the Fermentation Research Institute (IFO) on August 2, 1999 by the Fermentation Research Institute (IFO) under the deposit number FERM BP-6813 at the National Institute of Advanced Industrial Science and Technology (NIBH). It has been deposited as accession number IFO 16290 from the 18th. The transformant Escherichia coli JM109 /
prLPL6 was deposited on August 2, 1999 with the National Institute of Advanced Industrial Science and Technology (NIBH) under the Ministry of International Trade and Industry under the deposit number F.
ERM BP-6814, deposited with the Fermentation Research Institute (IFO) on June 18, 1999 as deposit number IF
It has been deposited as O16291. Reference Example 1 described later
Escherichia coli DH5α / pC
R2.1-hOT022T was deposited on November 8, 1999 at the Fermentation Research Institute (IFO) under the deposit number FERM BP-6930 at the National Institute of Advanced Industrial Science and Technology (NIBH), Ministry of International Trade and Industry. It has been deposited as the deposit number IFO16330 from March 27. The transformant Escherichia coli DH5α obtained in Reference Example 11 described later
/ pCR2.1-hOT022G has been available on November 8, 1999 from the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH).
Deposit No. FERM BP-6931 and deposited with the Fermentation Research Institute (IFO) from October 27, 1999 as deposit No. IFO16331. The transformant Escherichia coli MM29 obtained in Example 5 described later.
4 (DE3) / pTFCRFRP-1 was submitted to the Fermentation Research Institute (IFO) as a deposit number FERM BP-7313 at the National Institute of Advanced Industrial Science and Technology (NIBH) on September 28, 2000. Deposit number I from September 19
Deposited as FO 16476. The anti-rat-type RFRP-1 monoclonal antibody and IF3 obtained in Reference Example 12 described below have been used since February 21, 2001 by the National Institute of Advanced Industrial Science and Technology
H) has been deposited with the Fermentation Research Institute (IFO) under the accession number IFO 50527 from January 16, 2001 under the accession number FERM BP-7463.

[0065]

EXAMPLES The present invention will now be described more specifically with reference to Reference Examples and Examples, but the present invention is not limited thereto. Genetic manipulation using Escherichia coli is based on molecular cloning (Molecular clonin
g) was followed. Reference Example 1 cDN from human fetal brain poly (A) ⁺ RNA fraction
Synthesis of A and bioactive peptide cD by RT-PCR
Amplification of NA Human fetal brain poly (A) ⁺ RN purchased from Clonetech
OligodT primer (GibcoBRL) was added as a primer to 1 μg of the A fraction, and cDNA was synthesized using Moroni murine leukemia virus reverse transcriptase (GibcoBRL) using an attached buffer. The product after the reaction was extracted with phenol: chloroform (1: 1), precipitated with ethanol, and then dissolved in 30 μl of TE. Amplification by PCR was performed using 1 μl of the prepared cDNA as a template and the following two primers (F5 and F6). F5: 5'-GGGCTGCACATAGAGACTTAATTTTAG-3 '(SEQ ID NO: 3) F6: 5'-CTAGACCACCTCTATATAACTGCCCAT-3' (SEQ ID NO: 4) The composition of the reaction solution was determined using synthetic DNA primers (F5 and F).
6) 20 pM each, 0.25 mM dNTPs, Ex T
0.5 μl of aq DNA polymerase and 5 μl of a buffer attached to the enzyme were used, and the total reaction solution volume was 50 μl. The cycle for amplification was 98 ° C for 10 seconds and 63 ° C for 20 seconds using a thermal cycler (Perkin-Elmer).
A cycle of 72 seconds and 40 seconds was repeated 40 times. Further, amplification by nested PCR was performed using 1 μl of the PCR product as a template and the following two primers (F1 and R5). F1: 5′-GCACATAGAGACTTAATTTTAGATTTAGAC-3 ′ (SEQ ID NO: 5) R5: 5′-CATGCACTTTGACTGGTTTCCAGGTAT-3 ′ (SEQ ID NO: 6) The composition of the reaction solution was a synthetic DNA primer (F1 and R
5) 20 pM each, 0.25 mM dNTPs, Ex T
0.5 μl of aq DNA polymerase and 5 μl of a buffer attached to the enzyme were used, and the total reaction solution volume was 50 μl. The cycle for amplification was 98 ° C. for 10 seconds and 60 ° C. for 2 seconds using a thermal cycler (Perkin Elmer).
A cycle of 0 second, 72 ° C. and 40 seconds was repeated 40 times.
Confirmation of the amplification product was performed by 1.2% agarose electrophoresis and ethidium bromide staining.

Reference Example 2 Plasmid vector of PCR product
Subcloning into DNA and base of inserted cDNA part
Sequence analysis of novel bioactive peptide candidate clones
Selection The reaction product after PCR performed in Reference Example 1 was 1.2% agar.
DNA of the desired size, separated using a low-speed gel
After confirming the amplification of the fragment,
DNA was recovered using it (Quiagen). TA Claw
Recovery according to the prescription of the Nning Kit (Invitrogen)
The obtained DNA is converted into a plasmid vector pCR. ^TMSubscribe to 2.1
Loaned. Escherichia coli JM109 competent ce
ll (Takara Shuzo) for transformation and cDNA insertion
Clones with the incoming fragment were amplified with ampicillin, IPTG and
Selection in LB agar medium containing X-gal, white color
Isolated using a sterile toothpick and
Transformant Escherichia coli JM1
09 / phRF1 was obtained. Ampicillary individual clones
Overnight in an LB medium containing the
Plasmid DNA was prepared using a device (Kurabo).
Using a part of the prepared DNA, cut with EcoRI
And confirm the size of the inserted cDNA fragment.
Was. A part of the remaining DNA was further treated with RNase,
Extracted with chloroform and ethanol and precipitated by ethanol
Concentrated. The reaction for determining the nucleotide sequence is DyeDeoxy Ter
Using minator Cycle Sequencing Kit (ABI)
Decoding was performed using a fluorescent automatic sequencer. Obtained
Base sequence information is available from DNASIS (Hitachi
Ginering Co., Ltd.). The determined base sequence
As shown in FIG. The determined base sequence was homologated based on Figure 1.
G. Search and sequence analysis showed that the transformant E. coli
Inserted into the plasmid carried by JM109 / phRF1
CDNA fragment encodes a novel bioactive peptide
I found out.

Reference Example 3 Obtaining a Splicing Variant of Physiologically Active Peptide cDNA from Human Fetal Brain cDNA Using 1 ml of the human fetal brain cDNA prepared in Reference Example 1 as a template, the following two primers (F5, hR1) were used. To perform amplification by PCR. F5: 5'-GGGCTGCACATAGAGACTTAATTTTAG-3 '(SEQ ID NO: 3) hR1: 5'-CAGCTTTAGGGACAGGCTCCAGGTTTC-3' (SEQ ID NO: 7) The composition of the reaction solution was 20 p each for synthetic primers (F5 and hR1).
M, 0.25 mM dNTPs, 0.5 ml of ExTaq DNA polymerase and a buffer attached to the enzyme, and the total reaction solution volume was 50 ml. The cycle for amplification is 98 ° C for 10 seconds, 65 ° C for 20 seconds, 72 ° C using a thermal cycler (PerkinElmer).
・ Repeated 20 seconds cycle 40 times. Confirmation of the amplification product was performed by 1.2% agarose electrophoresis and ethidium bromide staining. After confirming the amplification of the PCR product, the reaction product was purified using QIA quick PCR purification Kit (Quiagen) and sequenced. Reaction for base sequence determination is BigDye Deoxy Terminatoe Cycle Sequence Kit
(ABI), fluorescence automatic sequencer (ABI377)
And decrypted it. Information analysis of the obtained base sequence was performed by DNAS
Performed using IS (Hitachi System Engineering).
As a result, the 3 ′ terminal side is different from the cDNA obtained in Reference Example 2.
cDNA was obtained. Therefore, the cDNA obtained in this reference example
Was found to be a splicing variant of the cDNA obtained in Reference Example 2. The determined base sequence (SEQ ID NO:
The amino acid sequence predicted as 9) (SEQ ID NO: 8) is shown in FIG.

[0068] Reference Example 4 bovine pituitary poly (A) ⁺ bioactive peptide cDNA of obtaining bovine hypothalamus poly from RNA (A) ⁺ acquisition of bovine type bioactive peptide cDNA from RNA is Marathon cDNA Amplification Kit ( Clo
ntech). The following four primers (bF6, bF7, bR6, and bR7) were synthesized using the bovine hypothalamus cDNA prepared according to the manual attached to the Kit as a template, and combined with the two primers AP1 and AP2 attached to Kit to perform PCR.
Was performed. bF6: 5'-GCCTAGAGGAGATCTAGGCTGGGAGGA-3 '(SEQ ID NO: 10) bF7: 5'-GGGAGGAACATGGAAGAAGAAAGGAGC-3' (SEQ ID NO: 11) bR6: 5'-GATGGTGAATGCATGGACTGCTGGAGC-3 '(SEQ ID NO: 12) bR7: 5'- TTCCTCCCAAATCTCAGTGGCAGGTTG-3 ′ (SEQ ID NO: 13) For amplification on the 5 ′ side (N-terminal region), a first PCR reaction was first performed using synthetic primers (bR6 and AP1). Each primer 20pM and 0.25mMdNTPs, Klen Taq DNA polymeras
e Total reaction volume is 2 ml with 0.5 ml and buffer provided with enzyme.
It was 5 ml. The cycle for amplification was performed by using a thermal cycler (Perkin Elmer) for 5 cycles of 98 ° C for 10 seconds and 72 ° C for 2 minutes, followed by 5 cycles of 98 ° C for 10 seconds and 70 ° C for 2 minutes. 25 cycles of 10 seconds at 68 ° C for 2 minutes and 30 seconds
I repeated it. Next, the first PCR reaction solution was diluted 10-fold, and 1 ml thereof was used as a template to perform a second PCR using primers (bR7 and AP2). 20pM and 0.25mM for each primer
The total reaction volume was 25 ml using dNTPs, 0.5 ml of Klen Taq DNA polymerase and a buffer attached to the enzyme. The cycle for amplification was performed using a thermal cycler (PerkinElmer) at 98 ° C for 10 seconds and at 72 ° C for 2 minutes.
Cycle, then 98 ° C for 10 seconds, 70 ° C for 2 minutes 5 times, 98
The cycle of 10 seconds at 68 ° C for 2 minutes and 30 seconds was repeated 35 times. For the 3'-side (C-terminal region) amplification, first use the first PC
The R reaction was performed using synthetic primers (bF6 and AP1).
Each primer 20pM and 0.25mM dNTPs, Klen Taq polymera
The total reaction volume is 0.5 ml with se
It was 25 ml. The cycle for amplification uses a thermal cycler (Perkin Elmer) at 98 ° C for 10 seconds and at 72 ° C for 2 seconds.
The cycle was repeated 5 times per minute, followed by 5 cycles of 98 ° C. for 10 seconds and 70 ° C. for 2 minutes, and 25 cycles of 98 ° C. for 10 seconds and 68 ° C. for 2 minutes and 30 seconds. Next, add the first PCR reaction solution to 10
A second PCR was performed with the primer (bF7 and AP2) using 1 ml thereof as a template. Each primer 20pM and 0,
The total reaction volume was 25 ml with 25 mM dNTPs, 0.5 ml of Klen Taq DNA polymerase and the buffer attached to the enzyme. The cycle for amplification was performed using a thermal cycler (PerkinElmer) at 98 ° C for 10 seconds and at 72 ° C for 2 minutes.
Cycle, then 98 ° C for 10 seconds, 70 ° C for 2 minutes 5 times, 98
A cycle of 10 seconds at 68 ° C and 2 minutes and 30 seconds at 35 ° C was repeated 35 times. Confirmation of the 5'-side and 3'-side amplification products was performed by 1.2% agarose electrophoresis and ethidium bromide staining. After confirming the amplification of the PCR product, the reaction product is
Purification was performed using the uick PCR purification Kit (Quiagen), and the sequence was determined. The reaction for sequencing is Bi
g Dye Deoxy Terminator Cycle Sequence Kit (ABI) was used, and decoding was performed using a fluorescent automatic sequencer (ABI377). Information analysis of the obtained base sequence was performed using DNASIS (Hitachi System Engineering). FIG. 4 shows the determined nucleotide sequence (SEQ ID NO: 15) and the predicted amino acid sequence (SEQ ID NO: 14).

[0069] Rat-type physiologically active peptide c from Example 5 rat brain poly (A) ⁺ obtain rat brain poly bioactive peptide cDNA from RNA (A) ⁺ RNA
DNA is obtained from the Marathon cDNA Amplification Kit (Clonte
ch). Using the rat brain cDNA prepared according to the manual attached to the Kit as a template, the following two primers rLPR1: 5′-CCCTGGGGCTTCTTCTGTCTTCTATGT-3 ′ (SEQ ID NO: 16) rLPF1: 5′-AGCGATTCATTTTATTGACTTTAGCA-3 ′ (SEQ ID NO: 17) ) Was synthesized and amplified by PCR in combination with two types of primers, AP1 and AP2 attached to Kit. For amplification on the 5 'side (N-terminal region), first perform the first PCR reaction with rLPR1 and AP.
This was performed using one primer set. Each primer 20
The total reaction volume was 25 ml with 0 pM, each 0.1 mM dNTP, 0.25 ml of Klen Taq DNA polymerase and the buffer attached to the enzyme. The cycle for amplification was performed using a thermal cycler (Perkin Elmer), 5 cycles of 98 ° C for 10 seconds and 72 ° C for 2 minutes, followed by a cycle of 98 ° C for 10 seconds and 70 ° C for 2 minutes.
Five cycles of 98 ° C for 10 seconds and 68 ° C for 2 minutes and 30 seconds were repeated 25 times. Next, using the first PCR reaction solution as a template, a second PCR was performed using the first primer set and the same reaction solution composition. The cycle for amplification is 98 ° C
5 cycles of 2 seconds at 72 ° C for 2 minutes, followed by 10 seconds at 98 ° C for 7 seconds.
The cycle of 0 ° C for 2 minutes was repeated 5 times, and the cycle of 98 ° C for 10 seconds and (68 ° C for 2 minutes and 30 seconds) were repeated 38 times. For amplification on the 3 'side (C-terminal region), first perform the first PCR reaction with rLPF1 and AP.
This was performed using one primer set. Reaction solution composition is 5 '
This was the same as in the case of amplification on the side (N-terminal region). The cycles for amplification are 98 ° C for 10 seconds and 72 ° C for 2 minutes.
Cycle, then 98 ° C for 10 seconds, 70 ° C for 2 minutes 5 times, 98
A cycle of 10 seconds at 65 ° C for 20 seconds at 72 ° C for 2 minutes was repeated 25 times. Next, using the first PCR reaction solution as a template, r
A second PCR was performed with LPF1 and AP2 primers. The composition of the reaction solution was the same as in the first PCR. The cycle for amplification uses a thermal cycler (PerkinElmer),
5 cycles of 98 ° C for 10 seconds and 72 ° C for 2 minutes, followed by 98 ° C
・ 10 seconds, 5 cycles of 70 ° C for 2 minutes, 98 ° C for 10 seconds, 65 ° C
・ A cycle of 20 seconds, 72 ° C., 2 minutes was repeated 38 times. Five'
The confirmation of the amplification products on the 3 ′ side and the 3 ′ side was performed by 1.2% agarose electrophoresis and ethidium bromide staining. Transfer the PCR product band to the QIA quick Gel Extraction Kit (Q
uiagen) and sequenced. The nucleotide sequence was determined in the same manner as in Reference Example 3. FIG. 5 shows the determined nucleotide sequence (SEQ ID NO: 19) and the predicted amino acid sequence (SEQ ID NO: 18). Further, based on this sequence, two primers ratF2: 5'-AATGGAAATTATTTCATCAAAGCGATTCAT-3 '(SEQ ID NO: 48) ratR: 5'-CACCTATACTGACAGGAATGATGGCTCTCC-3' (SEQ ID NO: 49) around the start codon and the stop codon Was synthesized. AMV reve from rat hypothalamus poly (A) ⁺ RNA
Using cDNA synthesized using rse transferase (Takara Shuzo) and random 9 mer (Takara Shuzo) as a template, 98 ° C for 10 seconds, 68 ° C
-A PCR reaction in which a 40-second cycle was repeated 33 times was performed. Using this reaction solution as a template, 98 ° C for 10 seconds, 68 ° C
Perform a PCR reaction that repeats 1 minute cycle 38 times,
A PCR product of about 690 bp was obtained. This is called TA cloning Kit (In
Introduced into the cloning vector pCR2.1 TOPO according to the manual of Invitrogen) and introduced into E. coli JM109 to obtain a transformant E. coli JM109 / prLPL6. The nucleotide sequence was determined in the same manner as in Reference Example 3 (SEQ ID NO: 51), and the amino acid sequence (SEQ ID NO: 50) was predicted.

Reference Example 6 Mar from mouse brain poly (A) ⁺ RNA
Acquisition and sequence confirmation of mouse-type bioactive peptide cDNA by athon PCR method Mouse-type bioactive peptide cDN from mouse brain poly (A) ⁺ RNA
To obtain A, first, ¹ μg of mouse brain poly (A) ⁺ RNA
igo d (T) primer 2.5 pmol (Takara Shuzo), 0.5 mM dNTPs, 10
In the presence of mM DTT, cDNA was synthesized using SuperScriptII RNase H-reverse transcriptase (GIBCO BRL) at 42 ° C. for 1 hour. Using this as a template, primers FF2: 5'-GACTTAATTTTAGATTTAGACAAAATGGAA-3 '(SEQ ID NO: 26) rR4: 5'-TTCTCCCAAACCTTTGGGGCAGGTT-3' (SEQ ID NO: 27) and KlenTaq DNA polymerase (Clontech) at 98 ° C 39 cycles of 10 seconds, 56 ° C 20 seconds, 72 ° C 25 seconds
Repeated PCR reactions were performed. Further, using the same primer set, a PCR reaction was repeated 25 times at a cycle of 98 ° C. for 10 seconds, 60 ° C. for 20 seconds, and 72 ° C. for 25 seconds. Band with QIA quick Gel Ex
Purification was performed using a traction Kit (Quiagen), and the nucleotide sequence was determined in the same manner as in Reference Example 3. As in Reference Example 5, Marathon cDNA Amplifica was obtained in order to obtain 5 ′ and 3 ′ sequences of the obtained mouse-type bioactive peptide cDNA fragment.
Mouse Kit poly (A) ⁺ RNA1 using the Action Kit (Clontech)
cDNA was synthesized from μg and used as a template. The following three primers mF1: 5'-ACAGCAAAGAAGGTGACGGAAAATACTC-3 '(SEQ ID NO: 28) mF3: 5'-ATAGATGAGAAAAGAAGCCCCGCAGCAC-3' (SEQ ID NO: 29) mR1: 5'-GTGCTGCGGGGCTTCTTTTCTCATCTAT-3 '(SEQ ID NO: 30) And combine it with the AP1 primer included in the kit to perform PCR.
Was done. For amplification on the 5 'side (N-terminal region), first, the first PCR reaction was performed using a primer set of mR1 and AP1. For the 3'-side (C-terminal region) amplification, the first PC
The R reaction was performed with a primer set of mF1 and AP1. Each primer 200pM and each 0.1mMdNTP, Klen Taq polymerase 0.2
5 ml and buffer supplied with enzyme for a total reaction volume of 25 ml
And The cycle for amplification is 98 ° C for 10 seconds and 72 ° C for 2 minutes 5 times, followed by 98 ° C for 10 seconds and 70 ° C for 2 minutes 5 times, 98 ° C for 10 seconds and 68 ° C for 2 minutes and 30 seconds. The cycle was repeated 25 times. Next, a second PCR was performed using the first PCR reaction solution as a template. For the 5′-side amplification, the same primer set as in the first PCR was used, and for the 3′-side amplification, mF3 and AP1 primer sets were used, and a reaction solution was prepared with the same reaction solution composition as in the first PCR. The PCR reaction was performed 5 times at 98 ° C for 10 seconds and 72 ° C for 2 minutes, followed by 5 cycles at 98 ° C for 10 seconds and 70 ° C for 2 minutes.
The cycle of 98 ° C. for 10 seconds and 68 ° C. for 2 minutes 30 seconds was repeated 38 times. Confirmation of 5'-side and 3'-side amplification products is 1.
Performed by 2% agarose electrophoresis and ethidium bromide staining. QIA quick Gel Extra for PCR product band
Purification was performed using a ction Kit (Quiagen), and sequencing was performed. The nucleotide sequence was determined in the same manner as in Reference Example 3. Further, based on the obtained sequence, two primers moF: 5'-TTTAGACTTAGACGAAATGGA-3 '(SEQ ID NO: 31) moR: 5'-GCTCCGTAGCCTCTTGAAGTC-3' (SEQ ID NO: 32) were synthesized and shown above. Super from mouse brain poly (A) ⁺ RNA
ScriptII RNase H- PCR using cDNA synthesized with reverse transcriptase as a template, full-length mouse-type bioactive peptide cDNA
The fragment containing was amplified. Reaction is KlenTaq DNA polymerase
(Clontech), 98 ° C for 10 seconds, 56 ° C for 20 seconds, 72 ° C
The 15 second cycle was repeated 35 times. Approximately 600 bp of the by-product was detected by 2% agarose electrophoresis and ethidium bromide staining, and the band was identified by QIA quick Gel Ex.
Purification using traction Kit (Quiagen), cloning vector pCR2.1-TOPO (TOPO TA cloning kit, Invit
rogen) and introduced into Escherichia coli JM109 to obtain a transformant E. coli JM109 / pmLP4. The nucleotide sequence was analyzed in the same manner as in Reference Example 3, and the determined nucleotide sequence (SEQ ID NO: 34) and the predicted amino acid sequence (SEQ ID NO: 3)
3) is shown in FIG.

REFERENCE EXAMPLE 7 (1) Cloning of cDNA encoding G protein-coupled receptor protein in rat brain stem periphery and determination of nucleotide sequence Two primers, primer 1 (SEQ ID NO: : 35) and primer 2 (SEQ ID NO: 36). The composition of the reaction solution in the reaction was 1/10 of the above cDNA.
Using the amount as a template, the Advantage cDNA
Polymerase Mix (CLONTECH)
1/50 volume, Primer 1 (SEQ ID NO: 35) and Primer 2 (SEQ ID NO: 36) were each added at 0.2 μM, dN
200 μM of TPs and the attached buffer were added to the enzyme to make a liquid volume of 50 μl. The PCR reaction was 94
After 2 minutes at 94 ° C, 3 cycles of 94 ° C for 30 seconds, 72 ° C for 2 minutes, 3 cycles of 94 ° C for 30 seconds, 68 ° C for 2 minutes, 94 ° C for 30 seconds, 64 ° C 30 seconds,
The cycle of 68 ° C for 2 minutes is repeated 30 times, and finally 6
An extension reaction was performed at 8 ° C. for 8 minutes. The reaction product after the PCR reaction is transferred to a TA cloning kit (Invitrogen).
Plasmid vector pCR2.1 (In
(vitrogen). This was introduced into Escherichia coli DH5α, clones having cDNA were selected in LB agar medium containing ampicillin, and the sequences of the individual clones were analyzed. :
38) was obtained. A novel G protein-coupled receptor protein containing an amino acid sequence (SEQ ID NO: 37) derived from this cDNA was named rOT7T022L.
CDNA encoding the G protein-coupled receptor protein rOT7T022L from the rat brain stem perimeter of the present invention
The plasmid pAK-rOT022L into which (SEQ ID NO: 38) was subcloned was introduced into Escherichia coli DH10B according to a method known per se, and a transformant: Escherichia coli DH10B / pA
K-rOT022L was obtained.

(2) G protein-coupled receptor protein r
Establishment of OT7T022L-expressing CHO cells 1 × 10 ⁶ CH in a 10 cm diameter tissue culture dish
Odhfr ⁻ cells were seeded and cultured for 24 hours. (1)
ROT7T022L expression vector pAK-r obtained in
Using 20 μg of OT022L, a DNA / liposome complex was formed using a gene transfer kit by the liposome method (Gene Transfer, Nippon Gene). The medium was replaced with a fresh one, to which a complex of DNA / liposome was added and incubated overnight. The medium was replaced with a fresh one, followed by culturing for another day, and then replaced with a medium for selecting a transformant, followed by culturing for 2 days. Further, the cells in the petri dish were collected by trypsin-EDTA treatment, and recultured in a state where the cell density was low, thereby increasing the ratio of transformants. Thereby, the cell line C stably expressing rOT7T022L at a high level was obtained.
A clone of HO-rOT7T022L was obtained.

(3) Met-Pro-His-Ser-Phe-Ala-Asn-Leu-
Synthesis of Pro-Leu-Arg-Phe-NH ₂ (SEQ ID NO: 39) A commercially available p-methyl BHA resin (Applied Biosystems, currently manufactured by Perkin Elmer) 0.5 mm mole was used as a peptide synthesizer (430A manufactured by Applied Biosystems). ) And swollen with DCM, then the first amino acid
Boc-Phe was activated by the HOBt / DCC method and introduced into p-methyl BHA resin. The resin is treated with 50% TFA / DCM and Boc
The group was removed to release the amino group and neutralized with DIEA.
The next amino acid Boc-Arg (Tos) was condensed to this amino group by the HOBt / DCC method. After confirming the completion of the reaction by checking the presence or absence of unreacted amino groups with the ninhydrin test, similarly, Boc-Leu, Boc-Pr
o, Boc-Leu, Boc-Asn, Boc-Ala, Boc-Phe, Boc-Ser (Bz
l), Boc-His (Bom), Boc-Pro and Boc-Met were sequentially condensed. 50% TFA / DC with all sequence amino acids introduced
M, and remove the Boc group on the resin.
ro-His (Bom) -Ser (Bzl) -Phe-Ala-Asn-Leu-Pro-Leu-Arg (T
0.73 g of os) -Phe-pMBHA-resin was obtained. 0.25g of this resin
Reaction was carried out at 0 ° C. for 60 minutes in a Teflon-made hydrogen fluoride reactor together with 5.1 g of cresol and 15 ml of hydrogen fluoride. Hydrogen fluoride was distilled off under reduced pressure, 100 ml of diethyl ether was added to the residue, and the mixture was stirred, filtered on a glass filter and dried. This was suspended and stirred in 50 ml of a 50% aqueous acetic acid solution, the peptide was extracted, separated from the resin, and concentrated to about 5 ml under reduced pressure. The mixture was developed with aqueous acetic acid, and the main fractions were collected and freeze-dried. Next, the crude peptide was dissolved in 1.5 ml of 5% thioglycolic acid / 50% acetic acid, and kept at 50 ° C. for 12 hours to reduce the oxidized Met peptide. Then, LiChroprep (trade name) RP-18 (MER)
0.1% TFA on a reversed phase column packed with CK
Purification by gradient elution using water and a 33% acetonitrile aqueous solution containing 0.1% TFA was repeated, and the portion eluted at around 27% acetonitrile concentration was collected and freeze-dried.
26 mg of a white powder were obtained. (M + H) ⁺ 1428.7 (theoretical value: 1428.8) by mass spectrometry HPLC elution time 18.0 minutes Column conditions Column: Wakosil (trade name) 5C18 (4.6 x 100 mm) Eluent: Solution A (5 containing 0.1% TFA) % Acetonitrile water) Using solution B (55% acetonitrile water containing 0.1% TFA), linear concentration gradient elution from solution A to solution B (25 minutes) Flow rate: 1.0 ml / min

(4) Val-Pro-Asn-Leu-Pro-Gln-Arg-Phe-
Synthesis of NH ₂ (SEQ ID NO: 40) In the same manner as in Reference Example 7 (3) above, Boc-Phe, Boc-Arg
(Tos), Boc-Gln, Boc-Pro, Boc-Leu, Boc-Asn, Boc-Pr
o, Boc-Val is sequentially condensed and Boc-Val-Pro-Asn-Leu-Pro-Gl
0.43 g of n-Arg (Tos) -Phe-pMBHA-resin was obtained. This resin
Similarly, 0.22 g of the product was treated with hydrogen fluoride and purified by column chromatography to obtain 46 mg of the desired product as a white powder. (M + H) ⁺ 969.5 (theoretical 969.6) by mass spectrometry HPLC elution time 11.8 min Column conditions Column: Wakosil (trade name) 5C18 (4.6 x 100 mm) Eluent: Liquid A (5 containing 0.1% TFA) % Acetonitrile water) Using solution B (55% acetonitrile water containing 0.1% TFA), linear concentration gradient elution from solution A to solution B (25 minutes) Flow rate: 1.0 ml / min

(5) Ser-Ala-Gly-Ala-Thr-Ala-Asn-Leu-
Synthesis of Pro-Arg-Ser-NH ₂ (SEQ ID NO: 41) Boc-Ser (Bzl), Bo
c-Arg (Tos), Boc-Leu, Boc-Pro, Boc-Leu, Boc-Asn, Boc
-Ala, Boc-Thr (Bzl), Boc-Ala, Boc-Gly, Boc-Ala, Boc
-Ser (Bzl) is sequentially condensed and Boc-Ser (Bzl) -Ala-Gly-Ala-Th
r (Bzl) -Ala-Asn-Leu-Pro-Leu-Arg (Tos) -Ser (Bzl) -pMBHA
-Resin 0.62g was obtained. In a similar manner, 0.23 g of this resin was treated with hydrogen fluoride and purified by column chromatography to obtain 71 mg of the target substance as a white powder. By mass spectrometry (M + H) ⁺ 1156.4 (theoretical 1156.6) HPLC elution time 11.8 min Column conditions Column: Wakosil (trade name) 5C18 (4.6 x 100 mm) Eluent: Solution A (5 containing 0.1% TFA) % Acetonitrile water) Using solution B (55% acetonitrile water containing 0.1% TFA), linear concentration gradient elution from solution A to solution B (25 minutes) Flow rate: 1.0 ml / min

(6) rOT7T022L (SEQ ID NO: 37), peptide MPHSFANLPLRFamide (SEQ ID NO: 39) and peptide VPNLPQRFamide
Reaction experiment using the site sensor of (SEQ ID NO: 40) The CHO cells expressing the rOT7T022L receptor obtained in the above-mentioned Reference Example 7 (2) were seeded at a density of 2.7 × 105 cells / capsule in a capsule for a site sensor, and overnight. After culturing, the cells were mounted on the workstation of the cytosensor. Assay medium (low buffered RPMI 1640 me containing 0.1% bovine serum albumin) set in the flow path of cytosensor
dium) is supplied to the cells in a cycle of pump ON (80 seconds) and pump OFF (40 seconds).
It was calculated as the ication rate. The time course of the acidification rate was monitored, and when the value became stable, the cells were exposed to the cells for 7 minutes and 2 seconds by switching the flow path. The value of the Acidification Rate in each well was normalized to the value of the three cycles immediately before exposure of the peptide as 100%, and the cell response was compared.
T022L-expressing CHO cells consist of the peptide MPHSFANLPL
RFamide (SEQ ID NO: 39) and peptide VP
It was revealed that NLPQRFamide (SEQ ID NO: 40) showed a strong dose-dependent response (FIG. 8).

Reference Example 8 Preparation of Transformant Having cDNA of Human New Physiologically Active Peptide Candidate Splicing Variant D of size
After confirming the amplification of the NA fragment, QuigenPCRpurificati
DNA was recovered using on kit (Quiagen). According to the prescription of TA Cloning Kit (Invitrogen),
The recovered DNA was subcloned into the plasmid vector pCR ^™ 2.1. This is Escherichia coli JM109competen
After transformation into t cell (Takara Shuzo), cDN
Clones having the A insert were selected in LB agar medium containing ampicillin, IPTG and X-gal, and only white clones were isolated using a sterile toothpick. Each clone was cultured overnight in an LB medium containing ampicillin, and plasmid DNA was prepared using an automatic plasmid extractor (Kurabo Industries). A portion of the prepared DNA was digested with EcoRI to confirm the size of the inserted cDNA fragment. A part of the remaining DNA was further treated with RNase, extracted with phenol / chloroform, and concentrated by ethanol precipitation. The reaction for determining the nucleotide sequence is DyeDeoxy TerminatorCycle Sequencin
This was performed using g Kit (ABI) and decoded using a fluorescent automatic sequencer to obtain a transformant Escherichia coli JM109 / phRF2.

Reference Example 9 Bovine New Bioactive Peptide cDNA
Preparation of a Transformant Containing the DNA Using 1 ml of the bovine hypothalamus cDNA prepared in Reference Example 4 as a template, amplification was performed by PCR using the following two primers (bFF, bFR). bFF: 5'-TTCTAGATTTTGGACAAAATGGAAATT-3 '(SEQ ID NO: 52) bFR: 5'-CGTCTTTAGGGACAGGCTCCAGATTTC-3' (SEQ ID NO: 53) The composition of the reaction solution was 20 p each for synthetic primers (bFF and bFR).
M, 0.25 mM dNTPs, 0.5 ml of ExTaq DNA polymerase and the buffer attached to the enzyme, and the total reaction solution volume was 50 ml.
The cycle for amplification uses a thermal cycler (PerkinElmer), 98 ° C for 10 seconds, 65 ° C for 20 seconds, 72 ° C for 20 seconds.
The second cycle was repeated 40 times. Confirmation of amplification product 1.
Performed by 2% agarose electrophoresis and ethidium bromide staining. The reaction product after the PCR performed in Reference Example 3 was separated using a 1.2% agarose gel, and after confirming the amplification of the DNA fragment of the target size,
DNA was recovered using a purification kit (Quiagen). According to the prescription of a TA cloning kit (Invitrogen), the recovered DNA was used for plasmid vector pCR.
Subcloned into ^TM 2.1. This is E. coli JM10
After transfection into 9 competent cells (Takara Shuzo), clones containing cDNA inserts were ampicillin,
Selection was performed on LB agar medium containing IPTG and X-gal, and only white clones were separated using a sterilized toothpick. Individual clones were converted to LB containing ampicillin.
The cells were cultured overnight in a medium, and plasmid DNA was prepared using an automatic plasmid extraction device (Kurabo). D prepared
Cleavage with EcoRI was performed using NA, and the size of the inserted cDNA fragment was confirmed. Further, the prepared DNA was treated with RNase, extracted with phenol / chloroform, and concentrated by ethanol precipitation. The reaction for determining the nucleotide sequence is DyeDeoxy Terminator Cycle Sequenci.
Using a ng Kit (ABI) and decoding using a fluorescent automatic sequencer, a transformant Escherichia coli JM109 / pbRF2 was obtained.

Reference Example 10 Peptide MPHSFALP
LRFamide (SEQ ID NO: 39) and Peptide V
ROT7T0 of PNLPQRFamide (SEQ ID NO: 40)
CAM against CHO cells expressing 22L (SEQ ID NO: 37)
P production inhibitory activity Peptide MPHSFA synthesized in Reference Example 7 (3) and (4)
Experiments using the site sensor of Reference Example 7 (6) confirmed that NLPLRFamide (SEQ ID NO: 39) and VPNLPQRFamide (SEQ ID NO: 40) specifically react with the rOT7T022L receptor. Next, rOT7T022L expressing C of the peptide described above
CAMP production inhibitory activity on HO cells was measured. The rOT7T022L-expressing CHO cells obtained in Reference Example 7 (2) were
Wrap in a 24-well plate at a concentration of ⁵ cells / well,
Cultured for days. 0.05% BS in Hanks buffer (HBSS)
After washing the cells with a buffer containing A and 0.2 mM IBMX, the cells were left in the same buffer for 30 minutes at 37 ° C. After 30 minutes, various concentrations of the above-mentioned peptide were added simultaneously with the assay buffer obtained by adding Forskolin 10 ⁻⁶ M to the above buffer, and the cells were incubated at 37 ° C. for 30 minutes.
After 30 minutes, the cAMP concentration in the cells in each well was measured according to the method of cAMP EIA Kit (Amersham). As a result, as shown in FIG. 9, the peptides MPHSFANLPLRFamide (SEQ ID NO: 39) and VPNLPQRFamide (SEQ ID NO: 40) were rOT7T
It exhibited an inhibitory effect on cAMP production on 022L receptor-expressing CHO cells, and its IC ₅₀ value was 0.5 nM and 0.7 nM, respectively.

REFERENCE EXAMPLE 11 Cloning of cDNA encoding G protein-coupled receptor protein of human hypothalamus and determination of nucleotide sequence Using human hypothalamus cDNA (CLONTECH) as a template, two primers, primer 1: 5'- GTCGACATGG AGGGGGAG
CC CTCCCAGCCT C-3 '(SEQ ID NO: 57) and Primer 2: 5'-ACTAGTTCAG ATATCCCAGG CTGGAATGG-3'
(SEQ ID NO: 58) was used to carry out a PCR reaction. The composition of the reaction solution in the reaction was prepared by using 1/10 of the above cDNA as a template and using Advantage-HF Polymerase Mix (CLONT
ECH) 1/50 volume, 0.2 μM each of primer 1 (SEQ ID NO: 57) and primer 2 (SEQ ID NO: 58), dNTPs 2
A buffer attached to 00 μM, 4% Dimethyl Sulfoxide, and the enzyme was added to make a liquid volume of 25 μl. The PCR reaction is
After 2 minutes at 94 ° C, three cycles of 94 ° C for 20 seconds, 72 ° C for 1 minute 30 seconds, and a cycle of 94 ° C for 20 seconds, 67 ° C for 1 minute 30 seconds
A cycle of 94 ° C. for 20 seconds, 62 ° C. for 20 seconds, 72 ° C. for 68 minutes at 1 minute and 30 seconds was repeated 38 times, and an extension reaction at 68 ° C. for 7 minutes was finally performed. The reaction product after the PCR reaction was subcloned into a plasmid vector pCR2.1 (Invitrogen) according to the procedure of a TA cloning kit (Invitrogen). This was introduced into Escherichia coli DH5α, and a clone having cDNA was selected on an LB agar medium containing ampicillin. As a result of analyzing the sequence of each clone, a cDNA sequence encoding a novel G protein-coupled receptor protein (SEQ ID NO: 55)
And 56) were obtained. These two types of sequences differ by one nucleotide at residue 597, but the derived amino acid sequence is the same (SEQ ID NO: 57), and a novel G protein-coupled receptor protein containing this amino acid sequence was named hOT7T022. . In addition, two transformants were used in Escherichia
coli) DH5α / pCR2.1-hOT022T (containing the cDNA represented by SEQ ID NO: 55), and (Escherichia col
i) It was named DH5α / pCR2.1-hOT022G (containing the cDNA represented by SEQ ID NO: 56).

Reference Example 12 Anti-rat type RFRP-1 monochrome
Preparation of null antibody C-terminal 12 amino acids of rat type RFRP-1 (C-terminal carboxyl group amidated: 83rd (Val) to 94th (Phe) of the amino acid sequence represented by SEQ ID NO: 50) (Amino acid sequence), a monoclonal antibody was prepared using a peptide (C-VPHSAANLPLRF-NH ₂ ) in which one Cys residue was added to the N-terminus as an antigen. 0.6 mg of the antigen peptide was conjugated to bovine serum albumin (BSA) using maleimide. Mice were immunized by injecting 100 μg of this conjugate subcutaneously three times, and then immunized by injection of 50 μg of the conjugate into the tail vein as the final immunization. Four days after the final immunization, spleen cells were collected from the mice, and mouse myeloma cells (P3-X63Ag8-U1: Matsumoto et al, BBRC
(1999) vol. 257, 264-268) and polyethylene glycol. After the cell fusion, the hybridoma cells, 1F3, were selected, and a culture supernatant of 1F3 was obtained by mass culture using INTREGRACL-1000. From this culture supernatant, HiTrap
Anti-rat RF using rProtein A column (Pharmacia)
An RP-1 monoclonal antibody was obtained. Mouse mAb isotyping
When examined using a kit (Amersham), this monochrome
The subtype of the null antibody was IgG1 kappa chain.

Reference Example 13 Construction of Competitive EIA First, the peptide used as an antigen in Reference Example 12 was conjugated to horseradish peroxidase (HRP) using maleimide to prepare HRP-rat RFRP-1. . This HRP-
Competitive EIA was constructed using rat RFRP-1 and the anti-rat RFRP-1 monoclonal antibody obtained in Reference Example 12. Coat with anti-mouse IgGAM (Cappel) 1.5 μg / well and use Block AC
E (Dainippon Pharmaceutical) 96-well plate blocked with buffer (2 mM EDTA, 0.4% BSA, 0.1 M NaCl, 0.1% mi
50 μl of an anti-rat RFRP-1 monoclonal antibody diluted with a physiological phosphate buffer (PBS) containing cro-O-protect) was added, and 50 ml of a sample dissolved in the same buffer was also added. After incubating at 4 ° C for 16 hours, buffer
50 μl of HRP-rat RFRP-1 diluted in was added to each well. After incubating for 2 hours at room temperature, 0.1% Tween20 (Sigm
After washing the plate with PBS containing a), H
RP activity in TMB microwell peroxidase system (Kirkeg
aard & Perry Labs)
Was measured. FIG. 11 shows the change in absorbance when the RFRP-1 related peptide was added as a sample.

Example 1 Effect of Ligand Polypeptide on Pituitary Hormone Level in Plasma The effect of the third ventricle administration of the peptide represented by SEQ ID NO: 39 on pituitary hormone level in plasma was examined.
Adult Wistar male rats (body weight at surgery: about 290-35)
0 g) was anesthetized by intraperitoneal administration of pentobarbital 50 mg / kg, and fixed to a rat stereotaxic apparatus. The incisor bar was 3.3 mm below the interoral line. The skull was exposed and a hole was drilled in the bone using a dental drill to implant the guide cannula. In addition, anchor screws were buried in one place around it. A stainless steel guide cannula, AG-12 (inner diameter 0.4 mm, outer diameter 0.5 mm, Acom) was inserted so that its tip was located above the third ventricle. According to the atlas of Paxinos and Watson (1986), the localization coordinates were AP: +7.2 mm (from the interaural line), L: 0.0 mm, H: +2.0 mm (from the interaural line). The guide cannula was fixed to the skull with flash glue, dental cement and anchor screws. The guide cannula is a stainless steel dummy cannula, AD-12 (0.35mm outside diameter, Acom)
And fixed with a cap nut (Acom).
After the operation, the rats were kept in individual cages for at least one week, and after waiting for post-operative recovery, the experiment was performed.

On the day before the experiment, the rats subjected to the above operation were anesthetized by intraperitoneal administration of pentobarbital at 50 mg / kg, and fixed in a supine position on a dissecting pad. A catheter (SP35, Natsume Seisakusho) was inserted into the right jugular vein. The next day, 400 μl of blood was collected from the jugular vein catheter. In order to prevent blood coagulation, 20 μl of physiological saline containing 200 units / ml of heparin was previously placed in the syringe. The cap nut and dummy cannula attached to the rat skull were removed, and a Teflon (registered trademark) tube (length 50 cm, inner diameter 0.1 mm, outer diameter 0.4 m) was used instead.
AMI13 (0.17 mm inner diameter, 0.35 mm outer diameter, Acom) connected to a stainless steel microinjection cannula connected to the ACOM. The length of the microinjection cannula was adjusted such that its tip 1 mm was exposed from the guide cannula. Connect one end of the Teflon tube to the micro syringe pump,
A total of 10 μl of PBS or PBS in which the peptide represented by SEQ ID NO: 39 was dissolved was injected into the third ventricle at a flow rate of 5 μl / min. One minute after the completion of the injection, the microinjection cannula was removed, and the dummy cannula was fixed again with the cap nut. Immediately before the start of intracerebroventricular administration and 10, 2 from the start of intraventricular administration.
At 0, 30, 40 and 60 minutes, 400 μl of blood was collected from the cannula inserted into the jugular vein. The collected blood was centrifuged (5,000 rpm, 10 minutes) using a micro high-speed cooling centrifuge (MR-150, Tommy Seiko), and the supernatant (plasma) was collected. The amount of prolactin contained in the plasma was measured using a radioimmunoassay. The results are shown as mean ± SEM. E. FIG.
M. It was expressed by. Student's tt was used to test whether there was a significant difference between the PBS-administered group in which the peptide represented by SEQ ID NO: 39 was dissolved and the control group administered only PBS.
est was used. The determination was statistically significant when the risk rate was 5% or less in a two-sided test. As shown in FIG. 10, the amount of plasma prolactin tended to increase from 10 minutes after administration of 10 nmol of the peptide represented by SEQ ID NO: 39 to the third ventricle, and significantly increased at 20, 30, and 40 minutes. In addition, a significant difference from the control group was observed even 60 minutes after administration. In addition, plasma GH, LH, ACTH, and TSH levels did not show any significant changes.

Example 2 Endogenous RFRP from bovine hypothalamus
Purification of -1 In the competitive EIA constructed in Reference Example 13, RFRP-1-like immunoreactivity was found in the crude peptide fraction from the bovine hypothalamus. Using this RFRP-1-like immune activity as an index, endogenous RFRP-1 was purified from bovine hypothalamus. First, 2.0 kg of the cryopreserved bovine hypothalamus was boiled in ultrapure water (Milli-Q water), acetic acid was added to 1 M, and homogenized with a polytron. After stirring overnight, the supernatant was obtained by centrifugation. Trifluoroacetic acid (TFA) was added to the supernatant to a concentration of 0.05%, and a C18 column (Prep C
18 125Å; Waters). The peptide bound to the column was eluted stepwise with 10, 30, 50% acetonitrile containing 0.5% TFA. The 30% acetonitrile fraction was diluted with twice the amount of 20 mM ammonium acetate (pH 4.7) and applied to an ion exchange column HiPrep CM-Sepharose FF (Pharmacia). Peptide bound to ion exchange column
20 mM ammonium acetate containing 10% acetonitrile (pH 4.7)
Stepwise eluted with 0.1, 0.2, 0.5, 1.0 M NaCl in. It contained the most RFRP-1-like immune activity.
To the 1M NaCl fraction was added 3 volumes of cold acetone, and the precipitate was removed by centrifugation, and the supernatant was concentrated by evaporation. 0.1% TFA was added to the concentrated supernatant, and a reverse-phase HPLC column RESO
Further separation was performed on URCE RPC (Pharmacia). RES
The separation of OURCE RPC was performed with a concentration gradient of 10-30% acetonitrile, and the main RFRP-1-like activity was eluted at approximately 22% acetonitrile. This active fraction was 0.2-0.6 M NaCl in 20 mM ammonium acetate (pH 4.7) containing 10% acetonitrile.
Exchange column TSK gel CM-SW
(Toso), the main RFRP-1-like activity,
Eluted at approximately 0.3M NaCl. 0.1% of TFA was added to the fraction of the CM-2SW column containing the RFRP-1-like immune activity, and the fraction was further fractionated with a reversed-phase column diphenyl 219TP52 (Vydac). When separated by a concentration gradient of 21-25% acetonitrile, RFRP-1-like immunoreactivity was eluted with 23% acetonitrile. The fraction containing the RFRP-1-like immune activity was subjected to reverse-phase column μRPC C2 / C18 SC using a concentration gradient of 22-23% acetonitrile.
Final purification at 2.1 / 10 yielded a single peak consistent with RFRP-1-like immunoreactivity (FIG. 12).

Example 3 N-Terminal Amino Acid Sequence Analysis of Final Purified Sample and Measurement of Molecular Weight by Mass Spectrometry The N-terminal amino acid of the final purified sample obtained in Example 2 was analyzed using a protein sequencer (model 491cLC; Applied Biosy
stems), SLTFEEVKDXAPK-
An amino acid sequence represented by IKMNKPV- (X represents an amino acid residue that could not be identified) was obtained. Also, ESI-
When the molecular weight of the final purified sample was measured using MS (Thermoquest), a value of 3997.0 was obtained. From these analysis results, the final purified preparation from bovine hypothalamus was SEQ ID NO: 14
58th (Ser) to 9th of the amino acid sequence represented by
The peptide was found to be the second (Phe) consisting of 35 amino acids.

Example 4 A peptide having the amino acid sequence of the 56th position (Ser) to the 92nd position (Phe) of the amino acid sequence represented by SEQ ID NO: 1 wherein the carboxyl group at the C-terminus has been amidated (hereinafter referred to as “the peptide”) Preparation of structural gene of hRFRP-1 (37) (SEQ ID NOS: 59 to 62) ) (# 2: SEQ ID NO:
16, # 3: SEQ ID NO: 17; manufactured by Amersham-Pharmacia Biotech), and a structural gene of hRFRP-1 (37) was prepared by a method known per se. a) Phosphorylation of DNA oligomer 1 μg of each of the two types of oligomers excluding # 1 and # 4 to be 5 ′ end was added to 100 μL of a phosphorylation reaction solution [50 mM Tris-HCl (pH
7.6), 10 mM MgCl ₂ , 1 mM spermidine, 10 mM dithiothreitol, 0.1 mg / mL bovine serum albumin, 1 mM ATP, 10 mM
Unit T4 polynucleotide kinase (Nippon Gene)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. After phenol treatment, the aqueous layer was collected, twice the amount of ethanol was added, and the mixture was cooled to -70 ° C.
A was precipitated. b) Ligation of DNA fragments Phosphorylated DNA fragments obtained in a) above and # 1 and # 4
Combine 1 μg each, 10 mM Tris / HCl, 2 mM
In addition to EDTA (pH 8.0), it was adjusted to 120 μL. After keeping the mixed solution at 80 ° C. for 10 minutes, annealing was performed by gradually cooling to room temperature. Ligation reaction was performed using TaKaRa DNA Ligation Kit ver.2 (Takara Shuzo). After 30 μL of the solution II included in the kit was added to 30 μL of the annealing solution and mixed well, 60 μL of the solution I included in the kit was added, and reacted at 37 ° C. for 1 hour to perform ligation. After the phenol treatment, the aqueous layer was collected, and twice the amount of ethanol was added.
After cooling to -70 ° C, the DNA was precipitated by centrifugation. c) Phosphorylation of 5 'end Precipitated TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA)
Dissolve in 10 μL and add 100 μL of phosphorylation reaction solution [50 mM Tris-
HCl (pH 7.6), 10 mM MgCl ₂ , 1 mM spermidine, 10 mM dithiothreitol, 0.1 mg / mL bovine serum albumin, 1 mM
ATP, 10 units T4 polynucleotide kinase (Nippon Gene)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. After phenol treatment, the aqueous layer was collected and
Add twice the volume of ethanol, cool to -70 ° C, and centrifuge.
DNA was precipitated and dissolved in 20 μL of TE buffer.

Example 5 Preparation of hRFRP-1 (37) Expression Plasmid pTFC (JP-A-2000-27) was used as an expression vector.
No. 0871) was digested with NdeI and AvaI (Takara Shuzo) for 4 hours at 37 ° C., and the 4.4 kb DNA fragment was subjected to QIAquick Gel electrophoresis by 1% agarose gel electrophoresis.
Extract using Extraction Kit (Qiagen), 25μ
dissolved in 1 TE buffer. NdeI of this pTFC,
The AvaI fragment and the structural gene of hRFRP-1 (37) prepared as described above were subjected to a ligation reaction using TaKaRa DNA ligation kit ver.2 (Takara Shuzo). This reaction solution was added to 10
E. coli JM109 competent cells (Toyobo) were transformed with μl, seeded on an LB agar medium containing 10 μg / ml tetracycline, cultured overnight at 37 ° C., and the resulting tetracycline-resistant colonies were selected. This transformant was cultured overnight in an LB medium, and the QIAprep8 Miniprep Ki
Plasmid pTFCRFRP-1 was prepared using t (Qiagen). The nucleotide sequence of the hRFRP-1 (37) structural gene was confirmed using an Applied Biosystems model 377 DNA sequencer. Escherichia coli MM294 (DE3) was transformed with the plasmid pTFCRFRP-1, and RFRP-1-CS2
3 fusion protein expression strain Escherichia coli M
M294 (DE3) / pTFCRFRP-1 was obtained (FIG. 13).

Example 6 1 L of an LB medium (1% peptone, 0.5% yeast extract, 0.5% sodium chloride) containing 5.0 mg / L of tetracycline was transformed with the transformant obtained in Example 5. Using 3 in a 2 liter flask
The cells were cultured with shaking at 7 ° C. for 8 hours. The obtained culture solution was added to a 19-liter main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride, 0.05%). % Magnesium sulfate, 0.02% antifoam, 0.00025% ferrous sulfate, 0.00025% thiamine hydrochloride, 1.5% glucose, 1.5% casamino acid) Then, aeration and agitation culture was started at 30 ° C. When the turbidity of the culture broth reached about 500 Klet units, isopropyl-β-D-thiogalactopyranoside was added to a final concentration of 12 mg / L, and cultivation was continued for 4 hours. After completion of the culture, centrifuge the culture solution, and
Was obtained and stored frozen at -80 ° C.

Example 7 Acquisition of hRFRP-1 (37) A 500 g of the cells obtained in Example 6 was added to a 6 M guanidine hydrochloride, 0.2 M Tris / HCL (pH 8.0) solution 100
After stirring for about 4 hours, centrifugation (1000
0 rpm, 60 minutes), and the supernatant was subjected to 0.6 M arginine, 1 mM dithiothreitol, 50 mM Tris / H
It was diluted with 29 L of CL (pH 8.0). After standing at 10 ° C. overnight, AF-Heparin Toyop was adjusted to pH 6.0 with concentrated hydrochloric acid and equilibrated with 50 mM phosphate buffer (pH 6.0).
earl 650M column (11.3cmID × 13cmL, Tosoh)
, Adsorbed and washed, and eluted with 50 mM phosphate buffer, 2 M NaCl, pH 6.0.
0 ml of the polypeptide of the present invention (hRFRP-1 (37) -CS2
Three fusion protein fractions were obtained. The eluate was concentrated using a Pellicon mini cassette (Millipore) while adding 0.1 M acetic acid to obtain a 0.1 M acetic acid solution of the hRFRP-1 (37) -CS23 fusion protein. After urea was added to this solution to a final concentration of 6M, 445 mg of 1-cyano-4-dimethylaminopyridinium salt (DMAP-CN) was added and reacted at room temperature for 15 minutes. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (46 mm ID × 600 mmL, Pharmacia) equilibrated with 10% acetic acid, and 10% acetic acid used for equilibration was developed at a flow rate of 6 ml / min.
An S-cyanated hRFRP-1 (37) -CS23 fusion protein fraction was obtained. The eluate was concentrated and desalted using a Pellicon mini cassette (Millipore), and the hRFRP-1 (37) -C
A desalted solution of the S23 fusion protein was obtained. After adding urea to this desalted solution to a final concentration of 6 M,
Add 25% aqueous ammonia to a concentration of M, and add
For 15 minutes. After the completion of the reaction, pH 6.0 with acetic acid.
To obtain hRFRP-1 (37). SP-5PW equilibrated with the reaction solution 50 mM MES buffer containing 3M urea (pH4.5) (5.5cmID × 30cmL, Tosoh)
, Adsorbed and washed, then 0-50% B (B = 50
Elution was performed with a step gradient of mM MES buffer + 1 M NaCl + 3 M urea to obtain hRFRP-1 (35) (elution time: 6).
0 minutes). This hRFRP-1 (37) fraction was further equilibrated with 0.1% trifluoroacetic acid (TFA) to ODS-120T (2
The solution was passed through a 1.5 mm ID × 300 mm L, Tosoh, adsorbed and washed, and then 30-60% B (B: 80% acetonitrile / 0.1%).
Elution was performed with a step gradient of 1% TFA), and the hRFRP-1 (37) fractions were pooled (elution time: 45 minutes), followed by lyophilization.
hRFRP-1 (37) freeze-dried powder was obtained.

Example 8 Comparison of Agonist Activity of Various RF Amide Peptides on CHO Cells Expressing Human OT7T022 Receptor Human OT7T022 receptor-expressing CHO cells obtained by a method according to the method described in WO 00/29441 were subjected to 3 × 10 ⁵ cells / well
Were seeded on a 24-well plate at a density of, and cultured overnight. The cells were placed in Hanks buffer (HBSS) with 0.05% BSA and 0.2m
After washing with a buffer containing M IBMX, preincubation was performed at 37 ° C. for 30 minutes with the same buffer. Next, add 0.05% BSA to Hanks buffer (HBSS).
The buffer was replaced with a buffer containing 0.2 mM IBMX or a buffer containing only 1 μM forskolin, a buffer containing 1 μM forskolin and various concentrations of peptides, and incubated at 37 ° C. for 30 minutes. After the incubation, the intracellular cAMP in each well
Was extracted and quantified according to the method of cAMP EIA Kit (Amersham). For each concentration of the peptide, the rate at which the increase in intracellular cAMP level due to forskolin treatment was suppressed was calculated, and a dose-response curve as shown in FIG. 14 was obtained.
Each ED ₅₀ values of peptides, hRFRP-1-12 (SEQ ID NO:
1, a peptide having the 81st (Met) to 92nd (Phe) amino acid sequence (○)) (4.5 nM), hRFRP-1
-37 (peptide (■) having the 56th amino acid sequence (Ser) to 92nd amino acid sequence (Phe) of SEQ ID NO: 1) (2
1 nM), rRFRP-1-37 (58th of SEQ ID NO: 50 (S
er) to a peptide having an amino acid sequence from the 94th (Phe) (◇)) (30 nM), hRFRP-2-12 (SEQ ID NO:
1, a peptide having an amino acid sequence from the 101st (Phe) to the 112th (Ser) (▲)), hRFRP-3-8
(124th (Val) to 131st of SEQ ID NO: 1)
Peptide having the amino acid sequence of the (Phe) (□)
(9.9 nM), PQRFamide (peptide represented by Pro-Gln-Arg-Phe-NH ₂ (NH)) (1000 nM or more), LPLRFamide
In (peptide represented by Leu-Pro-Leu-Arg- Phe-NH 2 (●)) (36 nM), NPFF ( peptide represented by Asn-Pro-Phe-Phe ( △)) (140 nM) there were.

Example 9 Human OT7T02 with RFRP peptide
(2) Examination of the effect of pertussis toxin on receptor activation. The human OT7T022 receptor-expressing CHO cells obtained in Example 8 were
After seeding a 24-well plate at a density of × 10 ⁵ cells / well and culturing overnight, 100 ng / ml pertussis toxin (pertussis toxi
n, SIGMA) or a control medium, and further cultured overnight. The cells were washed with a buffer obtained by adding 0.05% BSA and 0.2 mM IBMX to Hanks buffer (HBSS), and then pre-incubated with the same buffer at 37 ° C. for 30 minutes. Next, cells were added to a buffer containing only 0.05% BSA and 0.2 mM IBMX in Hank's buffer (HBSS) (black column) or a buffer containing only 1 μM forskolin (white column) and 1 μM forskolin And 0.1 μM RFRP-1-12
(Peptide having the 81st (Met) to 92nd (Phe) amino acid sequence of SEQ ID NO: 1) was replaced with a buffer (hatched column) and incubated at 37 ° C. for 30 minutes. After the incubation, extraction and quantification of intracellular cAMP in each well was performed using cAMP EIA.
This was performed according to the method of Kit (Amersham). As a result, as shown in FIG. 15, in the cells treated with pertussis toxin, the cAMP production inhibitory activity by RFRP-1-12 disappeared. Gi is the α subunit
(Inhibitory) or conjugated to Go.

[0093]

Industrial Applicability The polypeptide of the present invention has a promoting and suppressing effect on prolactin secretion. That is, since the polypeptide of the present invention has a prolactin secretion-promoting action, as is clear from the above-mentioned examples, it can be used as a preventive and therapeutic drug for various diseases related to prolactin secretion deficiency. On the other hand, since the polypeptide of the present invention has a strong affinity for its receptor protein, when the dose is increased, the polypeptide is desensitized to prolactin secretion.
As a result of n), it also has the effect of suppressing prolactin secretion. In this case, it can be used as an agent for preventing and treating various diseases related to prolactin hypersecretion. Therefore, the polypeptide of the present invention may be used as a prolactin secretagogue, for various diseases related to prolactin secretion such as ovarian hypofunction, seminal vesicle growth deficiency, osteoporosis, climacteric disorder, lactation deficiency, hypothyroidism, and renal failure. Useful as prophylactic and therapeutic agents. In addition, the polypeptide of the present invention may be used as a prolactin secretion inhibitor, such as hyperprolactinemia, pituitary gland tumor, mesencephalic tumor, menstrual abnormalities, stress, autoimmune diseases, prolactinoma, infertility, impotence, amenorrhea, and milk leakage. Disease, acromegaly, Chiari-Frommel syndrome, Argonz-del Castilo syndrome, Forbes
It is useful as a prophylactic and therapeutic agent for various diseases related to prolactin secretion, such as Albright (Forbes-Albright) syndrome, breast cancer, lymphoma or Sheehan syndrome or spermatogenesis abnormalities. The polypeptide of the present invention is particularly useful as a prophylactic and therapeutic agent for hyperprolactinemia, lactation deficiency, autoimmune disease, and breast cancer. In addition, the polypeptide of the present invention is also useful as a test drug for examining prolactin secretion function, and also as an animal drug such as a milk secretion promoter for livestock mammals such as cows, goats and pigs. Is expected to be applied to the production of useful substances by producing useful substances in the livestock mammals and secreting them into milk.

[0094]

[Sequence Listing] [Sequence Listing] <110> Takeda Chemical Industries, Ltd. <120> Prolactin secretion modulator containing RFRP <130> B01087 <150> JP 12-065752 <151> 2000-03-06 <150> JP 12- 378001 <151> 2000-12-07 <160> 62 <210> 1 <211> 180 <212> PRT <213> Human <400> 1 Met Glu Ile Ile Ser Ser Lys Leu Phe Ile Leu Leu Thr Leu Ala Thr 1 5 10 15 Ser Ser Leu Leu Thr Ser Asn Ile Phe Cys Ala Asp Glu Leu Val Met 20 25 30 Ser Asn Leu His Ser Lys Glu Asn Tyr Asp Lys Tyr Ser Glu Pro Arg 35 40 45 Gly Tyr Pro Lys Gly Glu Arg Ser Leu Asn Phe Glu Glu Leu Lys Asp 50 55 60 Trp Gly Pro Lys Asn Val Ile Lys Met Ser Thr Pro Ala Val Asn Lys 65 70 75 80 Met Pro His Ser Phe Ala Asn Leu Pro Leu Arg Phe Gly Arg Asn Val 85 90 95 Gln Glu Glu Arg Ser Ala Gly Ala Thr Ala Asn Leu Pro Leu Arg Ser 100 105 110 Gly Arg Asn Met Glu Val Ser Leu Val Arg Arg Val Pro Asn Leu Pro 115 120 125 Gln Arg Phe Gly Arg Thr Thr Thr Ala Lys Ser Val Cys Arg Met Leu 130 135 140 Ser Asp Leu Cys Gln Gly Ser Met His Ser Pro Cys Ala Asn Asp Le u 145 150 155 160 Phe Tyr Ser Met Thr Cys Gln His Gln Glu Ile Gln Asn Pro Asp Gln 165 170 175 Lys Gln Ser Arg 180 <210> 2 <211> 540 <212> DNA <213> Human <400> 2 ATGGAAATTA TTTCATCAAA ACTATTCATT TTATTGACTT TAGCCACTTC AAGCTTGTTA 60 ACATCAAACA TTTTTTGTGC AGATGAATTA GTGATGTCCA ATCTTCACAG CAAAGAAAAT 120 TATGACAAAT ATTCTGAGCC TAGAGGATAC CCAAAAGGGG AAAGAAGCCT CAATTTTGAG 180 GAATTAAAAG ATTGGGGACC AAAAAATGTT ATTAAGATGA GTACACCTGC AGTCAATAAA 240 ATGCCACACT CCTTCGCCAA CTTGCCATTG AGATTTGGGA GGAACGTTCA AGAAGAAAGA 300 AGTGCTGGAG CAACAGCCAA CCTGCCTCTG AGATCTGGA AGAAATATGGA GGTGAGCCTC 360 GTGAGACGTG TTCCTAACCT GCCCCAAAGG TTTGGGAGAA CAACAACAGC CAAAAGTGTC 420 TGCAGGATGC TGAGTGATTT GTGTCAAGGA TCCATGCATT CACCATGTGC CAATGACTTA 480 TTTTACTCCA TGACCTGCCA GCACCAAGAA ATCCAGAATC CCGATCAAAA ACAGTCAAGG 540 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 3 GGGCTGCACA TAGAGACTTA ATTAG 27 <212> DNA <213> Artificial Sequence <220><223><400> 4 CTAGACCACC TCTATATAAC TGCCCAT 27 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220><223><400> 5 GCACATAGAG ACTTAATTTT AGATTTAGAC 30 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 6 CATGCACTTT GACTGGTTTC CAGGTAT 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 7 CAGCTTTAGG GACAGGCTCC AGGTTTC 27 <210> 8 <211 > 196 <212> PRT <213> Human <400> 8 Met Glu Ile Ile Ser Ser Lys Leu Phe Ile Leu Leu Thr Leu Ala Thr 1 5 10 15 Ser Ser Leu Leu Thr Ser Asn Ile Phe Cys Ala Asp Glu Leu Val Met 20 25 30 Ser Asn Leu His Ser Lys Glu Asn Tyr Asp Lys Tyr Ser Glu Pro Arg 35 40 45 Gly Tyr Pro Lys Gly Glu Arg Ser Leu Asn Phe Glu Glu Leu Lys Asp 50 55 60 Trp Gly Pro Lys Asn Val Ile Lys Met Ser Thr Pro Ala Val Asn Lys 65 70 75 80 Met Pro His Ser Phe Ala Asn Leu Pro Leu Arg Phe Gly Arg Asn Val 85 90 95 Gln Glu Glu Arg Ser Ala Gly Ala Thr Ala Asn Leu Pro Leu Arg Ser 100 105 110 Gly Arg Asn Met Glu Val Ser Leu Val Arg Arg Val Pro Asn Leu Pro 115 120 125 Gln Arg Phe Gly Arg Thr Thr Thr Al a Lys Ser Val Cys Arg Met Leu 130 135 140 Ser Asp Leu Cys Gln Gly Ser Met His Ser Pro Cys Ala Asn Asp Leu 145 150 155 160 Phe Tyr Ser Met Thr Cys Gln His Gln Glu Ile Gln Asn Pro Asp Gln 165 170 175 Lys Gln Ser Arg Arg Leu Leu Phe Lys Lys Ile Asp Asp Ala Glu Leu 180 185 190 Lys Gln Glu Lys 195 <210> 9 <211> 588 <212> DNA <213> Human <400> 9 ATGGAAATTA TTTCATCAAA ACTATTCATT TTATTGACTT TAGCCACTTC AAGCTT 60 ACATCAAACA TTTTTTGTGC AGATGAATTA GTGATGTCCA ATCTTCACAG CAAAGAAAAT 120 TATGACAAAT ATTCTGAGCC TAGAGGATAC CCAAAAGGGG AAAGAAGCCT CAATTTTGAG 180 GAATTAAAAG ATTGGGGACC AAAAAATGTT ATTAAGATGA GTACACCTGC AGTCAATAAA 240 ATGCCACACT CCTTCGCCAA CTTGCCATTG AGATTTGGGA GGAACGTTCA AGAAGAAAGA 300 AGTGCTGGAG CAACAGCCAA CCTGCCTCTG AGATCTGGAA GAAATATGGA GGTGAGCCTC 360 GTGAGACGTG TTCCTAACCT GCCCCAAAGG TTTGGGAGAA CAACAACAGC CAAAAGTGTC 420 TGCAGGATGC TGAGTGATTT GTGTCAAGGA TCCATGCATT CACCATGTGC CAATGACTTA 480 TTTTACTCCA TGACCTGCCA GCACCAAGAA ATCCAGAATC CCGATCAAAA ACAGTCAAGG 540 AGACTGCTAT TCAAGAAAAT AGATGAT GCA GAATTGAAAC AAGAAAAA 588 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 10 GCCTAGAGGA GATCTAGGCT GGGAGGA 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 11 GGGAGGAACA TGGAAGAAGA AAGGAGC 27 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 12 GATGGTGAAT GCATGGACTG CTGGAGC 27 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 13 TTCCTCCCAA ATCTCAGTGG CAGGTTG 27 <210> 14 <211> 196 <212> PRT <213> Bovine <400> 14 Met Glu Ile Ile Ser Leu Lys Arg Phe Ile Leu Leu Met Leu Ala Thr 1 5 10 15 Ser Ser Leu Leu Thr Ser Asn Ile Phe Cys Thr Asp Glu Ser Arg Met 20 25 30 Pro Asn Leu Tyr Ser Lys Lys Asn Tyr Ser Glu Pro Arg 35 40 45 Gly Asp Leu Gly Trp Glu Lys Glu Arg Ser Leu Thr Phe Glu Glu Val 50 55 60 Lys Asp Trp Ala Pro Lys Ile Lys Met Asn Lys Pro Val Val Asn Lys 65 70 75 80 Met Pro Pro Ser Ala Ala Asn Leu Pro Leu Arg Phe Gly Arg Asn Met 85 90 95 Glu Glu Glu Arg Ser Thr Arg Ala Met Ala His Leu Pro Leu Arg Leu 100 105 110 Gly Lys Asn Arg Glu Asp Ser Leu Ser Arg Trp Val Pro Asn Leu Pro 115 120 125 Gln Arg Phe Gly Arg Thr Thr Thr Ala Lys Ser Ile Thr Lys Thr Leu 130 135 140 Ser Asn Leu Leu Gln Gln Ser Met His Ser Pro Ser Thr Asn Gly Leu 145 150 155 160 Leu Tyr Ser Met Ala Cys Gln Pro Gln Glu Ile Gln Asn Pro Gly Gln 165 170 175 Lys Asn Leu Arg Arg Arg Gly Phe Gln Lys Ile Asp Asp Ala Glu Leu 180 185 190 Lys Gln Glu Lys 195 <210> 15 <211> 588 <212> DNA <213> Bovine <400> 15 ATGGAAATTA TTTCATTAAA ACGATTCATT TTATTGATGT TAGCCACTTC AAGCTTGTTA 60 ACATCAAACA TCTTCTGCAC AGACGAATCA AGGATGCCAG AGATCTAGATCAGAGAAGA TAAAAGATTG GGCTCCAAAA ATTAAGATGA ATAAACCTGT AGTCAACAAA 240 ATGCCACCTT CTGCAGCCAA CCTGCCACTG AGATTTGGGA GGAACATGGA AGAAGAAAGG 300 AGCACTAGGG CGATGGCCCA CCTGCCCATGAGACTGAGA CAGATCCATCAGTCAGCAGATCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCGCTCTCTCTCGATCAGTCGATCGATCAGTCAGTCGATCGATCGATCGATCAGTCGATCGATCAGTCGATCGATCGATCCATCGATCGATCCATCGATCGATCGATCAGTCAGTCAGTCGATCCATCGATCCATCGATCCATCCATCGATCGATCCATCGATCCATCCATCTCTCTCTCTCTCGATCGATCCATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCATC AGCAG TCCATGCATT CACCATCTAC CAATGGGCTA 480 CTCTACTCCA TGGCCTGCCA GCCCCAAGAA ATCCAGAATC CTGGTCAAAA GAACCTAAGG 540 AGACGGGGAT TCCAGAAAAT AGATGATGCA GAATTGAAAC AAGAAAAA 588 <210> 16 <211> 27 <212> DNA <213> CT <CT> TCCTGG 210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220><223><400> 17 AGCGATTCAT TTTATTGACT TTAGCA 26 <210> 18 <211> 203 <212> PRT <213> Rat <400> 18 Met Glu Ile Ile Ser Ser Lys Arg Phe Ile Leu Leu Thr Leu Ala Thr 1 5 10 15 Ser Ser Phe Leu Thr Ser Asn Thr Leu Cys Ser Asp Glu Leu Met Met 20 25 30 Pro His Phe His Ser Lys Glu Gly Tyr Gly Lys Tyr Tyr Gln Leu Arg 35 40 45 Gly Ile Pro Lys Gly Val Lys Glu Arg Ser Val Thr Phe Gln Glu Leu 50 55 60 Lys Asp Trp Gly Ala Lys Lys Asp Ile Lys Met Ser Pro Ala Pro Ala 65 70 75 80 Asn Lys Val Pro His Ser Ala Ala Asn Leu Pro Leu Arg Phe Gly Arg 85 90 95 Asn Ile Glu Asp Arg Arg Ser Pro Arg Ala Arg Ala Asn Met Glu Ala 100 105 110 Gly Thr Met Ser His Phe Pro Ser Leu Pro Gln Arg P he Gly Arg Thr 115 120 125 Thr Ala Arg Arg Ile Thr Lys Thr Leu Ala Gly Leu Pro Gln Lys Ser 130 135 140 Leu His Ser Leu Ala Ser Ser Glu Ser Leu Tyr Ala Met Thr Arg Gln 145 150 155 160 His Gln Glu Ile Gln Ser Pro Gly Gln Glu Gln Pro Arg Lys Arg Val 165 170 175 Phe Thr Glu Thr Asp Asp Ala Glu Arg Lys Gln Glu Lys Ile Gly Asn 180 185 190 Leu Gln Pro Val Leu Gln Gly Ala Met Lys Leu 195 200 <210> 19 <211> 609 <212> DNA <213> Rat <400> 19 ATGGAAATTA TTTCATCAAA GCGATTCATT TTATTGACTT TAGCAACTTC AAGCTTCTTA 60 ACTTCAAACA CCCTTTGTTC AGATGAATTA ATGATGCCCC ATTTTCACAG CAAAGAAGGT 120 TATGGAAAAT ATTACCAGCT GAGAGGAATC CCAAAAGGGG TAAAGGAAAG AAGTGTCACT 180 TTTCAAGAAC TCAAAGATTG GGGGGCAAAG AAAGATATTA AGATGAGTCC AGCCCCTGCC 240 AACAAAGTGC CCCACTCAGC AGCCAACCTT CCCCTGAGGT TTGGGAGGAA CATAGAAGAC 300 AGAAGAAGCC CCAGGGCACG GGCCAACATG GAGGCAGGGA CCATGAGCCA TTTTCCCAGC 360 CTGCCCCAAA GGTTTGGGAG AACAACAGCC AGACGCATCA CCAAGACACT GGCTGGTTTG 420 CCCCAGAAAT CCCTGCACTC CCTGGCCTCC AGTGAATCGCTCAGCATG GAAA TTCAGAGTCC TGGTCAAGAG CAACCTAGGA AACGGGTGTT CACGGAAACA 540 GATGATGCAG AAAGGAAACA AGAAAAAATA GGAAACCTCC AGCCAGTCCT TCAAGGGGCT 600 ATGAAGCTG 609 <210> 20 <211> 12 <212> DNA <213> 20 <210><MG> 400 <211> 12 <212> DNA <213> Artificial Sequence <220><223><400> 21 MGNTTYGGNM GN 12 <210> 22 <211> 12 <212> DNA <213> Artificial Sequence <220><223><400> 22 MGNWSNGGNA AR 12 <210> 23 <211> 12 <212> DNA <213> Artificial Sequence <220><223><400> 23 MGNWSNGGNM GN 12 <210> 24 <211> 12 <212> DNA <213 > Artificial Sequence <220><223><400> 24 MGNYTNGGNA AR 12 <210> 25 <211> 12 <212> DNA <213> Artificial Sequence <220><223><400> 25 MGNYTNGGNM GN 12 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220><223><400> 26 GACTTAATTT TAGATTTAGA CAAAATGGAA 30 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220><223><400> 27 TTCTCCCAAA CCTTTGGGGC AGGTT 25 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220><223><400> 28 ACAGCAAA GA AGGTGACGGA AAATACTC 28 <210> 29 <211> 28 <212> DNA <213> Artificial Sequence <220><223><400> 29 ATAGATGAGA AAAGAAGCCC CGCAGCAC 28 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220><223><400> 30 GTGCTGCGGG GCTTCTTTTC TCATCTAT 28 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220><223><400> 31 TTTAGACTTA GACGAAATGG A 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220><223><400> 32 GCTCCGTAGC CTCTTGAAGT C 21 <210> 33 <211> 188 <212> PRT <213> Mouse <400> 33 Met Glu Ile Ile Ser Leu Lys Arg Phe Ile Leu Leu Thr Val Ala Thr 1 5 10 15 Ser Ser Phe Leu Thr Ser Asn Thr Phe Cys Thr Asp Glu Phe Met Met 20 25 30 Pro His Phe His Ser Lys Glu Gly Asp Gly Lys Tyr Ser Gln Leu Arg 35 40 45 Gly Ile Pro Lys Gly Glu Lys Glu Arg Ser Val Ser Phe Gln Glu Leu 50 55 60 Lys Asp Trp Gly Ala Lys Asn Val Ile Lys Met Ser Pro Ala Pro Ala 65 70 75 80 Asn Lys Val Pro His Ser Ala Ala Asn Leu Pro Leu Arg Phe Gly Arg 85 90 95 Thr Ile Asp Glu Lys Arg Ser Pro Ala Ala Arg Val Asn Met Glu Ala 100 105 110 Gly Thr Arg Ser His Phe Pro Ser Leu Pro Gln Arg Phe Gly Arg Thr 115 120 125 Thr Ala Arg Ser Pro Lys Thr Pro Ala Asp Leu Pro Gln Lys Pro Leu 130 135 140 His Ser Leu Gly Ser Ser Glu Leu Leu Tyr Val Met Ile Cys Gln His 145 150 155 160 Gln Glu Ile Gln Ser Pro Gly Gly Lys Arg Thr Arg Arg Gly Ala Phe 165 170 175 Val Glu Thr Asp Asp Ala Glu Arg Lys Pro Glu Lys 180 185 <210> 34 <211> 564 <212> DNA <213> Mouse <400> 34 ATGGAAATTA TTTCATTAAA ACGATTCATT TTATTGACTG TGGCAACTTC AAGCTTCTTA 60 ACATCAAACA CCTTCTGTAC AGATGAGTTC ATGATGCCTC ATTTTCACAG CAAAGAAGGT 120 GACGGAAAAT ACTCCCAGCT GAGAGGAATC CCAAAAGGGG AAAAGGAAAG AAGTGTCAGT 180 TTTCAAGAAC TAAAAGATTG GGGGGCAAAG AATGTTATTA AGATGAGTCC AGCCCCTGCC 240 AACAAAGTGC CCCACTCAGC AGCCAACCTG CCCCTGAGAT TTGGAAGGAC CATAGATGAG 300 AAAAGAAGCC CCGCAGCACG GGTCAACATG GAGGCAGGGA CCAGGAGCCA TTTCCCCAGC 360 CTGCCCCAAA GGTTTGGGAG AACAACAGCC AGAAGCCCCA AGACACCCGC TGATTTGCCA 420 CAGAAACCCC TGCACTCACT GGGCTCCAGC GAGTTGCTCT ACGTCATGATCCTGCCAGC AGAGTCCTGG TGGAAAGCGA ACGAGGAGAG GAGCGTTTGT GGAAACAGAT 540 GATGCAGAAA GGAAACCAGA AAAA 564 <210> 35 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 35 AGTCGACAGT ATGGAGGCGG AGCCCTC 27 <210> 36 <211>212> DNA <213> Artificial Sequence <220><223><400> 36 GACTAGTTCA AATGTTCCAG GCCGGGATG 29 <210> 37 <211> 432 <212> PRT <213> Rat <400> 37 Met Glu Ala Glu Pro Ser Gln Pro Pro Asn Gly Ser Trp Pro Leu Gly 5 10 15 Gln Asn Gly Ser Asp Val Glu Thr Ser Met Ala Thr Ser Leu Thr Phe 20 25 30 Ser Ser Tyr Tyr Gln His Ser Ser Pro Val Ala Ala Met Phe Ile Ala 35 40 45 Ala Tyr Val Leu Ile Phe Leu Leu Cys Met Val Gly Asn Thr Leu Val 50 55 60 Cys Phe Ile Val Leu Lys Asn Arg His Met Arg Thr Val Thr Asn Met 65 70 75 80 Phe Ile Leu Asn Leu Ala Val Ser Asp Leu Leu Val Gly Ile Phe Cys 85 90 95 Met Pro Thr Thr Leu Val Asp Asn Leu Ile Thr Gly Trp Pro Phe Asp 100 105 110 Asn Ala Thr Cys Lys Met Ser Gly Leu Val Gln Gly Met Ser Val Ser 115 120 125 Ala Ser Val Phe Thr Leu Val Ala Ile Ala Val Glu Arg Phe Arg Cys 130 135 140 Ile Val His Pro Phe Arg Glu Lys Leu Thr Leu Arg Lys Ala Leu Phe 145 150 155 160 Thr Ile Ala Val Ile Trp Ala Leu Ala Leu Leu Ile Met Cys Pro Ser 165 170 175 Ala Val Thr Leu Thr Val Thr Arg Glu Glu His His Phe Met Leu Asp 180 185 190 Ala Arg Asn Arg Ser Tyr Pro Leu Tyr Ser Cys Trp Glu Ala Trp Pro 195 200 205 Glu Lys Gly Met Arg Lys Val Tyr Thr Ala Val Leu Phe Ala His Ile 210 215 220 Tyr Leu Val Pro Leu Ala Leu Ile Val Val Met Tyr Val Arg Ile Ala 225 230 235 240 Arg Lys Leu Cys Gln Ala Pro Gly Pro Ala Arg Asp Thr Glu Glu Ala 245 250 255 Val Ala Glu Gly Gly Arg Thr Ser Arg Arg Arg Ala Arg Val Val His 260 265 270 Met Leu Val Met Val Ala Leu Phe Phe Thr Leu Ser Trp Leu Pro Leu 275 280 285 Trp Val Leu Leu Leu Leu Ile Asp Tyr Gly Glu Leu Ser Glu Leu Gln 290 295 300 Leu His Leu Leu Ser Val Tyr Ala Phe Pro Leu Ala His Trp Leu Ala 305 310 315 320 Phe Phe His Ser Ser Ala Asn Pro Ile Ile Tyr Gly Tyr Phe Asn Glu 325 330 335 Asn Phe Arg Arg Gly Phe Gln Ala Ala Phe Arg Ala Gln Leu Cys Trp 340 345 350 Pro Pro Trp Ala Ala His Lys Gln Ala Tyr Ser Glu Arg Pro Asn Arg 355 360 365 Leu Leu Arg Arg Arg Val Val Val Asp Val Gln Pro Ser Asp Ser Gly 370 375 380 Leu Pro Ser Glu Ser Gly Pro Ser Ser Gly Val Pro Gly Pro Gly Arg 385 390 395 400 400 Leu Pro Leu Arg Asn Gly Arg Val Ala His Gln Asp Gly Pro Gly Glu 405 410 415 Gly Pro Gly Cys Asn His Met Pro Leu Thr Ile Pro Ala Trp Asn Ile 420 425 430 <210> 38 <211> 1299 <212> DNA <213> Rat <400> 38 ATGGAGGCGG AGCCCTCCCA GCCTCCCAAC GGCAGCTGGC CCCTGGGTCA GAACGGGAGT 60 GATGTGGAGA CCAGCATGGC AACCAGCCTC ACCTTCTCCT CCTACTACCA ACACTCCTCT 120 CCGGTGGCAG CCATGTTCAT CGCGGCCTAC GTGCTCATCT TCCTCCTCTG CATGGTGGGC 180 AACACCCTGG TCTGCTTCAT TGTGCTCAAG AACCGGCACA TGCGCACTGT CACCAACATG 240 TTTATCCTCA ACCTGGCCGT CAGCGACCTG CTGGTGGGCA TCTTCTGCAT GCCCACAACC 300 CTTGTGGACA ACCTTATCAC TGGTTGGCCT TTTGACAACG CCACATGCAA GATGAGCGGC 360 TTGGTGCAGG GCATGTCCGT GTCTGCATCG GTTTTCACAC TGGTGGCGATC CGCTGTCGATCGATCTGTCGATCGATCTGTCGATCGATCGCTGCTGATCTTGCTCGCGTGCTCGTCTGATC GGCGCTGTTC 480 ACCATCGCGG TGATCTGGGC TCTGGCGCTG CTCATCATGT GTCCCTCGGC GGTCACTCTG 540 ACAGTCACCC GAGAGGAGCA TCACTTCATG CTGGATGCTC GTAACCGCTC CTACCCGCTC 600 TACTCGTGCT GGGAGGCCTG GCCCGAGAAG GGCATGCGCA AGGTCTACAC CGCGGTGCTC 660 TTCGCGCACA TCTACCTGGT GCCGCTGGCG CTCATCGTAG TGATGTACGT GCGCATCGCG 720 CGCAAGCTAT GCCAGGCCCC CGGTCCTGCG CGCGACACGG AGGAGGCGGT GGCCGAGGGT 780 GGCCGCACTT CGCGCCGTAG GGCCCGCGTG GTGCACATGC TGGTCATGGT GGCGCTCTTC 840 TTCACGTTGT CCTGGCTGCC ACTCTGGGTG CTGCTGCTGC TCATCGACTA TGGGGAGCTG 900 AGCGAGCTGC AACTGCACCT GCTGTCGGTC TACGCCTTCC CCTTGGCACA CTGGCTGGCC 960 TTCTTCCACA GCAGCGCCAA CCCCATCATC TACGGCTACT TCAACGAGAA CTTCCGCCGC 1020 GGCTTCCAGG CTGCCTTCCG TGCACAGCTC TGCTGGCCTC CCTGGGCCGC CCACAAGCAA 1080 GCCTACTCGG AGCGGCCCAA CCGCCTCCTG CGCAGGCGGG TGGTGGTGGA CGTGCAACCC 1140 AGCGACTCCG GCCTGCCATC AGAGTCTGGC CCCAGCAGCG GGGTCCCAGG GCCTGGCCGG 1200 CTGCCACTGC GCAATGGGCG TGTGGCCCAT CAGGATGGCC CGGGGGAAGG GCCAGGCTGC 1260 AACCACATGC CCCTCACCAT CCCGGCCTGG AACATTTGA 1299 <210 > 39 <211> 12 <21 2> PRT <213> Artificial Sequence <220><223> the C-terminus of the polypeptide is amide (-CONH ₂ ) form <400> 39 Met Pro His Ser Phe Ala Asn Leu Pro Leu Arg Phe 1 5 10 <210 > 40 <211> 8 <212> PRT <213> Artificial Sequence <220><223> the C-terminus of the polypeptide is amide (-CONH ₂ ) form <400> 40 Val Pro Asn Leu Pro Gln Arg Phe 1 5 <210> 41 <211> 11 <212> PRT <213> Artificial Sequence <220><223> the C-terminus of the polypeptide is amide (-CONH ₂ ) form <400> 41 Ser Ala Gly Ala Thr Ala Asn Leu Pro Arg Ser 1 5 10 <210> 42 <211> 36 <212> DNA <213> Human <400> 42 ATGCCACACT CCTTCGCCAA CTTGCCATTG AGATTT 36 <210> 43 <211> 36 <212> DNA <213> Human <400> 43 AGTGCTGGAG CAACAGCCAA CCTGCCTCTG AGATCT 36 <210> 44 <211> 24 <212> DNA <213> Human <400> 44 GTTCCTAACC TGCCCCAAAG GTTT 24 <210> 45 <211> 276 <212> DNA <213> Human <400> 45 ATGGAAATTA TTTCATCAAA ACTATTCATT TTATTGACTT TAGCCACTTC AAGCTTGTTA 60 ACATCAAACA TTTTTTGTGC AGATGAATTA GTGATGTCCA ATCTTCACAG CAAAGAAAAT 120 TATGACAAAT ATTCTGAGCC TAGA GGATAC CCAAAAGGGG AAAGAAGCCT CAATTTTGAG 180 GAATTAAAAG ATTGGGGACC AAAAAATGTT ATTAAGATGA GTACACCTGC AGTCAATAAA 240 ATGCCACACT CCTTCGCCAA CTTGCCATTG AGATTT 276 <210> 46 <211> 336 <212> DNA <213> Human <400> 46 ATGGAAATTA TTTCATCAAA ACTATTCATT TTATTGACTT TAGCCACTTC AAGCTTGTTA 60 ACATCAAACA TTTTTTGTGC AGATGAATTA GTGATGTCCA ATCTTCACAG CAAAGAAAAT 120 TATGACAAAT ATTCTGAGCC TAGAGGATAC CCAAAAGGGG AAAGAAGCCT CAATTTTGAG 180 GAATTAAAAG ATTGGGGACC AAAAAATGTT ATTAAGATGA GTACACCTGC AGTCAATAAA 240 ATGCCACACT CCTTCGCCAA CTTGCCATTG AGATTTGGGA GGAACGTTCA AGAAGAAAGA 300 AGTGCTGGAG CAACAGCCAA CCTGCCTCTG AGATCT 336 <210> 47 <211> 393 <212> DNA <213> Human <400> 47 ATGGAAATTA TTTCATCAAA ACTATTCATT TTATTGACTT TAGCCACTTC AAGCTTGTTA 60 ACATCAAACA TTTTTTGTGC AGATGAATTA GTGATGTCCA ATCTTCACAG CAAAGAAAAT 120 TATGACAAAT ATTCTGAGCC TAGAGGATAC CCAAAAGGGG AAAGAAGTCAT CAATTTTGAG 180 GAATTAAAAG ATTGGGGATGATCAGATGATCAGATGATCAGATGATCAGATGATCAGATTA AGTGCTGGAG CAACAGCCAA CCTGCCTCTG AGATCTGGA AGAAATATGGA GGTGAGCCTC 360 GTGAGACGTG TTCCTAACCT GCCCCAAAGG TTT 393 <210> 48 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 48 CCCTGGGGCT TCTTCT TCTATGTGT27 TCTATGT27 26 <212> DNA <213> Artificial Sequence <220><223><400> 49 AGCGATTCAT TTTATTGACT TTAGCA 26 <210> 50 <211> 203 <212> PRT <213> Rat <400> 50 Met Glu Ile Ile Ser Ser Lys Arg Phe Ile Leu Leu Thr Leu Ala Thr 1 5 10 15 Ser Ser Phe Leu Thr Ser Asn Thr Leu Cys Ser Asp Glu Leu Met Met 20 25 30 Pro His Phe His Ser Lys Glu Gly Tyr Gly Lys Tyr Tyr Gln Leu Arg 35 40 45 Gly Ile Pro Lys Gly Val Lys Glu Arg Ser Val Thr Phe Gln Glu Leu 50 55 60 Lys Asp Trp Gly Ala Lys Lys Asp Ile Lys Met Ser Pro Ala Pro Ala 65 70 75 80 Asn Lys Val Pro His Ser Ala Ala Asn Leu Pro Leu Arg Phe Gly Arg 85 90 95 Asn Ile Glu Asp Arg Arg Ser Pro Arg Ala Arg Ala Asn Met Glu Ala 100 105 110 Gly Thr Met Ser His Phe Pro Ser Leu Pro Gln Arg Phe Gly Arg Thr 115 120 125 Thr Ala Arg Arg Ile Thr Lys Thr Leu Ala Gly Leu Pro Gln Lys Ser 130 135 140 Leu His Ser Leu Ala Ser Ser Glu Leu Leu Tyr Ala Met Thr Arg Gln 145 150 155 160 His Gln Glu Ile Gln Ser Pro Gly Gln Glu Gln Pro Arg Lys Arg Val 165 170 175 Phe Thr Glu Thr Asp Asp Ala Glu Arg Lys Gln Glu Lys Ile Gly Asn 180 185 190 Leu Gln Pro Val Leu Gln Gly Ala Met Lys Leu 195 200 <210> 51 <211> 609 <212> DNA <213> Rat <400 > 51 ATGGAAATTA TTTCATCAAA GCGATTCATT TTATTGACTT TAGCAACTTC AAGCTTCTTA 60 ACTTCAAACA CCCTTTGTTC AGATGAATTA ATGATGCCCC ATTTTCACAG CAAAGAAGGT 120 TATGGAAAAT ATTACCAGCT GAGAGGAATC CCAAAAGGGG TAAAGGAAAG AAGTGTCACT 180 TTTCAAGAAC TCAAAGATTG GGGGGCAAAG AAAGATATTA AGATGAGTCC AGCCCCTGCC 240 AACAAAGTGC CCCACTCAGC AGCCAACCTT CCCCTGAGGT TTGGGAGGAA CATAGAAGAC 300 AGAAGAAGCC CCAGGGCACG GGCCAACATG GAGGCAGGGA CCATGAGCCA TTTTCCCAGC 360 CTGCCCCAAA GGTTTGGGAG AACAACAGCC AGACGCATCA CCAAGACACT GGCTGGTTTG 420 CCCCAGAAAT CCCTGCACTC CCTGGCCTCC AGTGAATTGC TCTATGCCAT GACCCGCCAG 480 CATCAAGAAA TTCAGAGTCC TGGTCAAGAG CAACCTAGGA AACGGGTGTT CACGGAAACA 540 GATGATGCAG AAAGGAAACA AGAAAAAATA GGAAACCTCC AGCCAGTCCT TCAAGGGGCT 600 ATGAAGCTG 609 <210> 52 <211> 27 <212> DNA <213> Artificial Sequence <220><223><400> 52 TTCTAGATTT TGGACAAAAT GGAAATT 27 <210> 53 <211>212> DNA <213> Artificial Sequence <220><223><400> 53 CGTCTTTAGG GACAGGCTCC AGATTTC 27 <210> 54 <211> 430 <212> PRT <213> Human <400> 54 Met Glu Gly Glu Pro Ser Gln Pro Pro Asn Ser Ser Trp Pro Leu Ser 1 5 10 15 Gln Asn Gly Thr Asn Thr Glu Ala Thr Pro Ala Thr Asn Leu Thr Phe 20 25 30 Ser Ser Tyr Tyr Gln His Thr Ser Pro Val Ala Ala Met Phe Ile Val 35 40 45 Ala Tyr Ala Leu Ile Phe Leu Leu Cys Met Val Gly Asn Thr Leu Val 50 55 60 Cys Phe Ile Val Leu Lys Asn Arg His Met His Thr Val Thr Asn Met 65 70 75 80 Phe Ile Leu Asn Leu Ala Val Ser Asp Leu Leu Val Gly Ile Phe Cys 85 90 95 Met Pro Thr Thr Leu Val Asp Asn Leu Ile Thr Gly Trp Pro Phe Asp 100 105 110 Asn Ala Thr Cys Lys Met Ser Gly Leu Val Gln Gly Met Ser Val Ser 115 120 125 Ala Ser Val Phe Thr Leu Val Ala Ile Ala Val Glu Arg Phe Arg Cys 130 135 140 Ile Val His Pro Phe Arg Glu Lys Leu Thr Leu Arg Lys Ala Leu Val 145 150 155 160 Thr Ile Ala Val Ile Trp Ala Leu Ala Leu Leu Ile Met Cys Pro Ser 165 170 175 Ala Val Thr Leu Thr Val Thr Arg Glu Glu His His Phe Met Val Asp 180 185 190 Ala Arg Asn Arg Ser Tyr Pro Leu Tyr Ser Cys Trp Glu Ala Trp Pro 195 200 205 Glu Lys Gly Met Arg Arg Val Tyr Thr Thr Val Leu Phe Ser His Ile 210 215 220 Tyr Leu Ala Pro Leu Ala Leu Ile Val Val Met Tyr Ala Arg Ile Ala 225 230 235 240 Arg Lys Leu Cys Gln Ala Pro Gly Pro Ala Pro Gly Gly Glu Glu Glu Ala 245 250 255 Ala Asp Pro Arg Ala Ser Arg Arg Arg Ala Arg Val Val His Met Leu 260 265 270 Val Met Val Ala Leu Phe Phe Thr Leu Ser Trp Leu Pro Leu Trp Ala 275 280 285 Leu Leu Leu Leu Ile Asp Tyr Gly Gln Leu Ser Ala Pro Gln Leu His 290 295 300 Leu Val Thr Val Tyr Ala Phe Pro Phe Ala His Trp Leu Ala Phe Phe 305 310 315 320 Asn Ser Ser Ala Asn Pro Ile Ile Tyr Gly Tyr Phe Asn Glu Asn Phe 325 330 335 Arg Arg Gly Phe Gln Ala Ala Phe Arg Ala Arg Leu Cys Pro Arg Pro 340 345 350 Ser Gly Ser His Lys Glu Ala Tyr Ser Glu Arg Pro Gly Gly Leu Leu 355 360 365 His Arg Arg Val Phe Val Val Val Arg Pro Ser Asp Ser Gly Leu Pro 370 375 380 Ser Glu Ser Gly Pro Ser Ser Gly Ala Pro Arg Pro Gly Arg Leu Pro 385 390 395 400 Leu Arg Asn Gly Arg Val Ala His His Gly Leu Pro Arg Glu Gly Pro 405 410 415 Gly Cys Ser His Leu Pro Leu Thr Ile Pro Ala Trp Asp Ile 420 425 430 <210> 55 <211> 1290 <212> DNA <213> Human <400> 55 ATGGAGGGGG AGCCCTCCCA GCCTCCCAAC AGCAGTTGGC CCCTAAGTCA GAATGGGACT 60 AACACTGAGG CCACCCCGGC TACAAACCTC ACCTTCTCCT CCTACTATCA GCACACCTCC 120 CCTGTGGCGG CCATGTTCAT TGTGGCCTAT GCGCTCATCT TCCTGCTCTG CATGGTGGGC 180 AACACCCTGG TCTGTTTCAT CGTGCTCAAG AACCGGCACA TGCATACTGT CACCAACATG 240 TTCATCCTCA ACCTGGCTGT CAGTGACCTG CTGGTGGGCA TCTTCTGCAT GCCCACCACC 300 CTTGTGGACA ACCTCATCAC TGGGTGGCCC TTCGACAATG CCACATGCAA GATGAGCGGC 360 TTGGTGCAGG GCATGTCTGT GTCGGCTTCC GTTTTCACAC TGGTGGCCAT TGCTGTGGAGA 420 AGGTTCGCGACT GCATCGGCGACTCGCTCCCT CTCGTC 480 ACCATCGCCG TCATCTGGGC CCTGGCGCTG CTCATCATGT GTCCCTCGGC CGTCACGCTG 540 ACCGTCACCC GTGAGGAGCA CCACTTCATG GTGGACGCCC GCAACCGCTC CTACCCTCTC 600 TACTCCTGCT GGGAGGCCTG GCCCGAGAAG GGCATGCGCA GGGTCTACAC CACTGTGCTC 660 TTCTCGCACA TCTACCTGGC GCCGCTGGCG CTCATCGTGG TCATGTACGC CCGCATCGCG 720 CGCAAGCTCT GCCAGGCCCC GGGCCCGGCC CCCGGGGGCG AGGAGGCTGC GGACCCGCGA 780 GCATCGCGGC GCAGAGCGCG CGTGGTGCAC ATGCTGGTCA TGGTGGCGCT GTTCTTCACG 840 CTGTCCTGGC TGCCGCTCTG GGCGCTGCTG CTGCTCATCG ACTACGGGCA GCTCAGCGCG 900 CCGCAGCTGC ACCTGGTCAC CGTCTACGCC TTCCCCTTCG CGCACTGGCT GGCCTTCTTC 960 AACAGCAGCG CCAACCCCAT CATCTACGGC TACTTCAACG AGAACTTCCG CCGCGGCTTC 1020 CAGGCCGCCT TCCGCGCCCG CCTCTGCCCG CGCCCGTCGG GGAGCCACAA GGAGGCCTAC 1080 TCCGAGCGGC CCGGCGGGCT TCTGCACAGG CGGGTCTTCG TGGTGGTGCG GCCCAGCGAC 1140 TCCGGGCTGC CCTCTGAGTC GGGCCCTAGC AGTGGGGCCC CCAGGCCCGG CCGCCTCCCG 1200 CTGCGGAATG GGCGGGTGGC TCACCACGGC TTGCCCAGGG AAGGGCCTGG CTGCTCCCAC 1260 CTGCCCCTCA CCATTCCAGC CTGGGATATC 1290 <210> 56 <211> 1290 <212> DNA <213> Human <400> 56 ATGGAGGGGG AGCCCTCCCA GCCTCCCAAC AGCAGTTGGC CCCTAAGTCA GAATGGGACT 60 AACACTGAGG CCACCCCGGC TACAAACCTC ACCTTCTCCT CCTACTATCA GCACACCTCC 120 CCTGTGGCGG CCATGTTCAT TGTGGCCTAT GCGCTCATCT TCCTGCTCTG CATGGTGGGC 180 AACACCCTGG TCTGTTTCAT CGTGCTCAAG AACCGGCACA TGCATACTGT CACCAACATG 240 TTCATCCTCA ACCTGGCTGT CAGTGACCTG CTGGTGGGCA TCTTCTGCAT GCCCACCACC 300 CTTGTGGACA ACCTCATCAC TGGGTGGCCC TTCGACAATG CCACATGCAA GATGAGCGGC 360 TTGGTGCAGG GCATGTCTGT GTCGGCTTCC GTTTTCACAC TGGTGGCCAT TGCTGTGGAA 420 AGGTTCCGCT GCATCGTGCA CCCTTTCCGC GAGAAGCTGA CCCTGCGGAA GGCGCTCGTC 480 ACCATCGCCG TCATCTGGGC CCTGGCGCTG CTCATCATGT GTCCCTCGGC CGTCACGCTG 540 ACCGTCACCC GTGAGGAGCA CCACTTCATG GTGGACGCCC GCAACCGCTC CTACCCGCTC 600 TACTCCTGCT GGGAGGCCTG GCCCGAGAAG GGCATGCGCA GGGTCTACAC CACTGTGCTC 660 TTCTCGCACA TCTACCTGGC GCCGCTGGCG CTCATCGTGG TCATGTACGC CCGCATCGCG 720 CGCAAGCTCT GCCAGGCCCC GGGCCCGGCC CCCGGGGGCG AGGAGGCTGC GGACCCGCGA 780 GCATCGCGGC GCAGAGCGCG CGTGGTGCAC ATGCTGGTCA TGGTGGCGCT GTTCTTCACG 840 CTGTCC TGGC TGCCGCTCTG GGCGCTGCTG CTGCTCATCG ACTACGGGCA GCTCAGCGCG 900 CCGCAGCTGC ACCTGGTCAC CGTCTACGCC TTCCCCTTCG CGCACTGGCT GGCCTTCTTC 960 AACAGCAGCG CCAACCCCAT CATCTACGGC TACTTCAACG AGAACTTCCG CCGCGGCTTC 1020 CAGGCCGCCT TCCGCGCCCG CCTCTGCCCG CGCCCGTCGG GGAGCCACAA GGAGGCCTAC 1080 TCCGAGCGGC CCGGCGGGCT TCTGCACAGG CGGGTCTTCG TGGTGGTGCG GCCCAGCGAC 1140 TCCGGGCTGC CCTCTGAGTC GGGCCCTAGC AGTGGGGCCC CCAGGCCCGG CCGCCTCCCG 1200 CTGCGGAATG GGCGGGTGGC TCACCACGGC TTGCCCAGGG AAGGGCCTGG CTGCTCCCAC 1260 CTGCCCCTCA CCATTCCAGC CTGGGATATC 1290 <210> 57 <211> 31 <212> DNA <213> Artificial Sequence <220><223><400> 57 GTCGACATGG AGGGGGAGCC CTCCCAGCCT C 31 <210> 58 <211> 29 <212> DNA <213> Artificial Sequence <220><223><400> 58 ACTAGTTCAG ATATCCCAGG CTGGAATGG 29 <210> 59 <211> 57 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 59 TATGAGCCTG AACTTTGAAG AACTGAAAGAT TGGGGTCCGA AAAATGTGAT TAAAATG 57 <210> 60 <211> 61 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 60 AGCACCCCGG CGGTGAAT AA AATGCCGCAT AGCTTTGCGA ATCTGCCGCT GCGTTTGC 60 C 61 <210> 61 <211> 62 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 61 GGTGCTCATT TTAATCACAT TTTTCGGACC CCAATCTTTC AGTTCTTCAA AGTTCAGGCT 60 CA 62 <210> 62 <211> 58 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 62 TCGGGGCAAA AACGCAGCGG CAGATTCGCA AAGCTATGCGG CATTTTATTC ACCGCCGG 58

[0095]

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence of the DNA encoding the polypeptide (human type) of the present invention obtained in Reference Example 2, and the amino acid sequence deduced from the nucleotide sequence.

FIG. 2 shows a diagram showing a hydrophobicity plot of the polypeptide of the present invention.

FIG. 3 shows the nucleotide sequence of DNA encoding the polypeptide (human type) of the present invention obtained in Reference Example 3, and the amino acid sequence deduced from the nucleotide sequence.

FIG. 4 shows the nucleotide sequence of the DNA encoding the polypeptide (bovine type) of the present invention obtained in Reference Example 4, and the amino acid sequence deduced from the nucleotide sequence.

FIG. 5 shows the nucleotide sequence of the DNA encoding the polypeptide of the present invention (rat type) obtained in Reference Example 5, and the amino acid sequence deduced from the nucleotide sequence.

FIG. 6 shows a comparison of the amino acid sequences of the polypeptides of the present invention obtained in Reference Examples 3, 4, and 5.

FIG. 7 shows the amino acid sequence of the polypeptide (mouse type) of the present invention obtained in Reference Example 6 and the nucleotide sequence of DNA encoding the polypeptide.

FIG. 8: rOT7 by site sensor performed in Reference Example 7
The figure which shows the reactivity of the peptide with respect to T022L receptor expression CHO cell. In the figure, ●-● indicates MPHSFANLPL
RFamide (SEQ ID NO: 39), {-} is VPNL
This shows PQRFamide (SEQ ID NO: 40).

FIG. 9 shows r of MPHSFANLPLRFamide (SEQ ID NO: 39) and VPNLPQRFamide (SEQ ID NO: 40) performed in Reference Example 10.
The figure which shows cAMP production inhibitory activity with respect to OT7T022L expression CHO cell. In the figure, □-□ indicates MPHSFANLPLRFamide (SEQ ID NO: 39) and ●-● indicates VPNLPQRFamide (SEQ ID NO: 4).
0).

FIG. 10 shows the results of measurement of the amount of prolactin contained in plasma performed in Example 1. In the figure, ●-● is SEQ ID NO:
The amount of prolactin in the PBS-administered group in which the peptide represented by 39 was dissolved, and −- ○ indicate the prolactin amount in the control group to which only PBS was administered. In addition, the administration time was set to 0 minutes, * indicates a risk rate: p <0.05, and ** indicates a risk rate: p <0.01.

FIG. 11 shows the results of the reactivity of the RF amide-related peptide in competitive EIA using the anti-rat RFRP-1 monoclonal antibody 1F3 performed in Reference Example 13. On a 96-well plate coated with an anti-mouse IgGAM antibody, 50 μl of anti-rat type RFRP-1 monoclonal antibody 1F3, peptide 5 at the concentration shown on the horizontal axis
0 μl was added. After incubating at 4 ° C for 16 hours,
Add RP-rat RFRP-1 and incubate at room temperature for 2 hours.
I did it. After washing the plate, HRP activity was measured as absorbance at 450 nm. B indicates the absorbance when the peptide was added, and B ₀ indicates the absorbance when the peptide was not added. In the figure,-●-indicates a peptide (VPHSAANLPLRF-NH) in which the C-terminal carboxyl group of the 83rd amino acid sequence (Val) to the 94th amino acid sequence (Phe) of the amino acid sequence represented by SEQ ID NO: 50 is amidated. ₂ ),-▲-indicates a peptide (LPLRF-NH) in which the C-terminal carboxyl group of the amino acid sequence from the 90th (Leu) to the 94th (Phe) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 50 is amidated. ₂ ),-■-is the 124th (Va) of the amino acid sequence represented by SEQ ID NO: 1.
l) A peptide in which the C-terminal carboxyl group of the 131st amino acid sequence (Phe) is amidated (VPNLPQRF-
NH ₂ ),-◆-is a peptide in which the C-terminal carboxyl group of the amino acid sequence from the 128th (Pro) to 131st (Phe) of the amino acid sequence represented by SEQ ID NO: 1 is amidated (PQRF- NH ₂ ).

12 shows a chromatogram of the final purification of endogenous RFRP-1 from bovine hypothalamus performed in Example 2. FIG. FIG. 4 shows a chromatogram of μRPC C2 / C18 SC 2.1 / 10 in the final purification stage. The vertical axis indicates the absorbance at 215 nm and the elution concentration of acetonitrile, and the horizontal axis indicates the elution time. The black column in the figure shows the RFRP-1-like immunoreactivity of each fraction measured by competitive EIA using the anti-rat RFRP-1 monoclonal antibody 1F3.

FIG. 13 shows a construction diagram of a plasmid pTFCRFRP-1 obtained in Example 4.

FIG. 14 is a view showing the activity of suppressing the increase in intracellular cAMP level by forskolin treatment of various peptides performed in Example 8. In the figure,-○-indicates hRFRP-1-12 (the eighth of SEQ ID NO: 1).
A peptide having an amino acid sequence from the 1st (Met) to the 92nd (Phe)),-■-is hRFRP-1-37 (SEQ ID NO:
1, a peptide having an amino acid sequence from the 56th position (Ser) to the 92nd position (Phe)),-◇-is rRFRP-1-37 (the 58th (Ser) to 94th position (P
Peptide having the amino acid sequence of he), - ▲ - is hRFRP-
2-12 (No. 101 (Phe) to No. 1 of SEQ ID NO: 1)
A peptide having the twelfth (Ser) amino acid sequence,
□-indicates hRFRP-3-8 (124th sequence of SEQ ID NO: 1 (Val))
Or a peptide having the amino acid sequence of the 131-th (Phe), - ◆ - peptide represented by PQRFamide (Pro-Gln-Arg- Phe-NH 2, - ● - is LPLRFamide (Leu-Pro-Leu- Ar
The peptide represented by g-Phe-NH ₂ ,-▲-is NPFF (Asn-Pro
-Phe-Phe).

FIG. 15: Human with RFRP peptide performed in Example 9
CAM effects of pertussis toxin on OT7T022 receptor activation
The figure which expressed using P production suppression effect as an index is shown.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification code FI Theme coat ゛ (Reference) A61P 5/06 A61P 13/12 4C086 5/14 15/08 4H045 13/12 15/12 15/08 15 / 14 15/12 173 15/14 19/00 173 25/22 19/00 35/00 25/22 37/02 35/00 C07K 14/47 37/02 16/18 C07K 14/47 C12Q 1/68 A16 / 18 G01N 33/15 Z C12Q 1/68 33/50 Z G01N 33/15 C12P 21/02 C 33/50 21/08 // C12P 21/02 C12N 15/00 ZNAA 21/08 A61K 37/02 (72 Inventor Shuji Hinuma 1-7-9 Kasuga, Tsukuba City, Ibaraki Prefecture 1402, Takeda Kasuga Heights 1402 Person Hiromi Yoshida 1444-23 F-ta (Reference) 2G045 AA40 DA12 DA13 DA36 FA26 FA29 FB02 FB03 GC10 4B024 AA01 AA11 BA63 BA80 CA04 CA07 DA02 DA06 EA04 GA11 GA13 GA18 GA19 HA03 4B063 QA01 QA13 QA17 QA19 QQ43 QQ53 QR55 QR10 QS25 AG01 CA20 AG20 CC24 CE03 CE08 CE10 CE12 CE20 DA01 DA13 4C084 AA02 AA07 AA13 AA17 BA01 BA02 BA22 NA14 ZA052 ZA812 ZA972 ZB262 ZC032 ZC062 ZC112 4C086 AA01 EA16 MA01 MA04 NA14 ZA05 ZA81 ZA97 ZB26 ZC17 A10 ZB26 A10 ZA26 ZA26 ZA26 ZA26 A10 ZB26 GA01 GA10 GA15 GA21 GA22 GA25 GA26

Claims (38)

[Claims] 1. A method for regulating prolactin secretion, comprising a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Agent. 2. The method of claim 2, wherein the substantially identical amino acid sequence is SEQ ID NO:
8, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 33
Or the agent according to claim 1, which is an amino acid sequence represented by SEQ ID NO: 50. 3. A partial peptide of a polypeptide characterized by having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Prolactin secretion regulator. 4. The method according to claim 3, which comprises a partial peptide comprising the amino acid sequence from the 81st position (Met) to the 92nd position (Phe) of SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Prolactin secretion regulator. 5. The method according to claim 3, which comprises a partial peptide comprising the amino acid sequence from position 101 (Ser) to position 112 (Ser) of SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Prolactin secretion regulator. 6. The method according to claim 3, which comprises a partial peptide comprising the amino acid sequence from position 124 (Val) to position 131 (Phe) of SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Prolactin secretion regulator. 7. The method according to claim 3, which comprises a partial peptide comprising the amino acid sequence from position 56 (Ser) to position 92 (Phe) of SEQ ID NO: 1, or an amide or ester thereof or a salt thereof. Prolactin secretion regulator. 8. The amide of a partial peptide of a polypeptide, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or a salt thereof. Prolactin secretion regulator. 9. A partial peptide of a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, wherein the carboxyl group at the C-terminal is amidated, or a salt thereof. The prolactin secretion regulator according to claim 8. 10. A prolactin secretion promoter.
Or the prolactin secretion regulator according to claim 3. (11) a prolactin secretion inhibitor;
Or the prolactin secretion regulator according to claim 3. 12. The prolactin secretagogue according to claim 10, which is a preventive or therapeutic agent for ovarian hypofunction, seminal vesicle dysplasia, osteoporosis, climacteric disorder, lactation dysfunction, hypothyroidism, renal failure. 13. Hyperprolactinemia, pituitary gland tumor, diencephalon tumor, dysmenorrhea, stress, autoimmune disease, prolactinoma, infertility, impotence, amenorrhea, milk leakage, acromegaly, Chiari Frommel ( Chiari-Fromme
l) Syndrome, Argonz-del Castillo (Argonz-del)
Castilo syndrome, Forbes
The prolactin secretion inhibitor according to claim 11, which is a prophylactic or therapeutic agent for -Albright) syndrome, breast cancer lymphoma or Sheehan's syndrome or spermatogenesis abnormality. 14. The prolactin secretion regulator according to claim 1 or 3, which is a milk secretion enhancer for livestock mammals. 15. The prolactin secretion regulator according to claim 1, which is a test agent for a prolactin secretion function. (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a amide thereof, an ester thereof, or a salt thereof; ii) using a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof. Do
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (i) SEQ ID NO: 1
Or a amide or an ester or a salt thereof, or (ii) an amino acid sequence represented by SEQ ID NO: 1. (I) an amino acid represented by SEQ ID NO: 1 comprising a partial peptide of a polypeptide or an amide or an ester or a salt thereof, wherein the partial peptide has the same or substantially the same amino acid sequence as A polypeptide characterized by containing the same or substantially the same amino acid sequence as its sequence, its amide or its ester or its salt, or (ii) SEQ ID NO:
A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or A salt thereof, or (ii) a partial peptide of a polypeptide, or an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. A compound containing a compound that promotes or inhibits the activity or a salt thereof It kuching secretion regulators. (I) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a amide thereof, an ester thereof, or a salt thereof Or (ii)
A partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or an ester or a salt thereof, and (iii) SEQ ID NO: A protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 37;
Or its partial peptide or its amide or its ester or its salt,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (II) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a polypeptide thereof A salt, or (ii) identical or identical to the amino acid sequence represented by SEQ ID NO: 1. A partial peptide of a polypeptide characterized by containing the same amino acid sequence or an amide or an ester or a salt thereof, and (iii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 37 (I) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, comprising a protein or a salt thereof, or a partial peptide thereof, an amide thereof, an ester thereof or a salt thereof, Or a amide or an ester or a salt thereof, or (ii) SEQ ID NO: 1.
A partial peptide of the polypeptide, or a compound or a salt thereof which promotes or inhibits the activity of the partial peptide of the polypeptide or an amide or an ester thereof or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by Obtained using a screening kit,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. And a prolactin secretion regulator. (18) The 81st sequence of SEQ ID NO: 1 (Me
t) a peptide having an amino acid sequence from the 92nd position (Phe) or an amide or an ester or a salt thereof, (2) an amino acid sequence from the 101st position (Ser) to the 112th position (Ser) (3) a peptide having an amino acid sequence from position 124 (Val) to position 131 (Phe) of SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof ( 4) a peptide having the amino acid sequence of positions 56 (Ser) to 92 (Phe) of SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof;
(5) The 81st (Met) to the 9th of SEQ ID NO: 14
A peptide having the second (Phe) amino acid sequence, an amide thereof, an ester thereof, or a salt thereof;
(6) a peptide having the 101st (Ser) to 112th (Leu) amino acid sequence of SEQ ID NO: 14, or an amide or ester thereof, or a salt thereof;
(7) 58th (Ser) to 9th of SEQ ID NO: 14
A peptide having the second (Phe) amino acid sequence, an amide thereof, an ester thereof, or a salt thereof;
(8) No. 83 (Val) to No. 9 of SEQ ID NO: 33
A peptide having the fourth (Phe) amino acid sequence, an amide thereof, an ester thereof, or a salt thereof;
(9) a peptide having the amino acid sequence of positions 118 (Phe) to 125 (Phe) of SEQ ID NO: 33, an amide thereof, an ester thereof, or a salt thereof;
(10) a peptide having the amino acid sequence at positions 58 (Ser) to 94 (Phe) of SEQ ID NO: 33, or an amide or ester or salt thereof, or (11) a 58th amino acid of SEQ ID NO: 50 ( A peptide having an amino acid sequence from Ser) to the 94th position (Phe), an amide thereof, an ester thereof, or a salt thereof; (19) an amide of the peptide according to (18) or a salt thereof; 20. The peptide according to claim 18, wherein the C-terminal carboxyl group is amidated, the amide thereof, the ester thereof or the salt thereof. 21. A DNA encoding the peptide according to claim 18. 22. (1) the 241st to 276th nucleotide sequence of SEQ ID NO: 2; (2) the 3rd nucleotide sequence of SEQ ID NO: 2
The base sequence from the 01st to the 336th, (3) the 370th to the 393rd base sequence of SEQ ID NO: 2,
(4) the 166th to 276th nucleotide sequence of SEQ ID NO: 2, (5) the 241st to 276th nucleotide sequence of SEQ ID NO: 15, (6) the 301st to 276th nucleotide sequences of SEQ ID NO: 15. The 336th nucleotide sequence, (7) a peptide having the 172nd to 276th amino acid sequence of SEQ ID NO: 15, or an amide or ester or a salt thereof, (8) a second amino acid sequence of SEQ ID NO: 34
47th to 282nd nucleotide sequences, (9) 352nd to 375th nucleotide sequences of SEQ ID NO: 34, (10) 172nd to 2nd nucleotide sequences of SEQ ID NO: 34
22. The DNA according to claim 21, which has the 82nd nucleotide sequence or (11) the 172nd to 282nd nucleotide sequences of SEQ ID NO: 51. 23. An antibody against the peptide according to claim 18 or an amide or ester thereof or a salt thereof. 24. The DNA according to claim 21 or 2).
A diagnostic agent comprising the antibody according to 3. 25. An antisense DNA having a base sequence complementary or substantially complementary to the DNA according to claim 21, and having an action capable of suppressing the expression of said DNA. 26. An agent comprising the peptide according to claim 18 or an amide or ester thereof or a salt thereof. 27. A pharmaceutical comprising the peptide according to claim 18 or an amide or ester thereof or a salt thereof. (28) the prolactin secretion regulator;
7. The medicament according to 7. 29. A compound which promotes or inhibits the activity of the peptide according to claim 18, or an amide or ester thereof or a salt thereof, wherein the peptide or the amide or ester thereof or the salt thereof is used. Or a method of screening for a salt thereof. 30. Use of a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37, or a salt thereof, or a partial peptide thereof, an amide thereof, an ester thereof, or a salt thereof. 30. The screening method according to claim 29, wherein: 31. A compound or a compound thereof which promotes or inhibits the activity of the peptide of claim 18 or an amide or ester thereof or a salt thereof, comprising the peptide of claim 18 or an amide or ester thereof or a salt thereof. Salt screening kit. (32) a compound which promotes or inhibits the activity of the peptide or the amide or ester thereof or the salt thereof according to (18) which can be obtained by using the screening method according to (29) or the screening kit according to (31); Or its salt. 33. A polypeptide for producing a medicament having a prolactin secretion regulating action, which comprises (1) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. Or its amide or its ester or its salt, or (2) a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or its amide Or use of its ester or its salt. 34. (1) A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a amide thereof, an ester thereof, or a salt thereof, or 2) administering to a mammal a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester or salt thereof; A method for regulating prolactin secretion. 35. A method for producing a medicament having a prolactin secretion regulating action, comprising: (i) a polysaccharide comprising the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Peptide or its amide or its ester or its salt, or (ii)
A partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or an ester or a salt thereof, (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (i) the amino acid represented by SEQ ID NO: 1 A polypeptide characterized by containing an amino acid sequence identical or substantially identical to the sequence, an amide thereof, an ester thereof or a salt thereof, or (ii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. (I) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, comprising a partial peptide of a polypeptide characterized by containing the same amino acid sequence as described above, or an amide or ester or salt thereof. Or a amide thereof, an ester thereof, or a salt thereof, or (ii) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. A partial peptide of a polypeptide or an amide thereof, characterized by containing Is a compound that promotes or inhibits the activity of an ester or a salt thereof or a kit for screening a salt thereof. (I) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 Or a polypeptide thereof, an amide thereof, an ester thereof, or a salt thereof, or (ii) SEQ ID NO: 1.
A partial peptide of the polypeptide, or a compound or a salt thereof which promotes or inhibits the activity of the partial peptide of the polypeptide or an amide or an ester thereof or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by use. 36. (I) (i) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 for producing a medicament having a prolactin secretion regulating action. Or a amide thereof, an ester thereof, or a salt thereof, or (ii) a portion of a polypeptide characterized by containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. Peptide or its amide or its ester or its salt, and (iii) a protein or its salt containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 37, or its partial peptide or its amide Or (i) using SEQ ID NO: 1 or an ester or a salt thereof. A polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence or its amide or its ester or its salt, or (ii) the same as the amino acid sequence represented by SEQ ID NO: 1. Or a method for screening a compound or a salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof or a salt thereof, which comprises substantially the same amino acid sequence, or (II) (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: An amino acid identical or substantially identical to the amino acid sequence represented by 1 A partial peptide of a polypeptide characterized by containing a sequence, an amide or an ester or a salt thereof, and (iii) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 37 (I) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, comprising a protein or a salt thereof, a partial peptide thereof, an amide thereof, an ester thereof or a salt thereof. Or an amide or ester thereof or a salt thereof, or (ii) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. Partial peptide of polypeptide or its amide or ester or its (I) a compound that promotes or inhibits the activity of a salt or a salt thereof, which is obtained by using a kit for screening the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1; Characteristic polypeptide or its amide or its ester or its salt, or (ii) SEQ ID NO: 1
A partial peptide of the polypeptide, or a compound or a salt thereof which promotes or inhibits the activity of the partial peptide of the polypeptide or an amide or an ester thereof or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by use. (I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a amide thereof, an ester thereof, or a salt thereof, or ii) using a partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a salt thereof. Do
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (i) SEQ ID NO: 1
Or a amide or an ester or a salt thereof, or (ii) an amino acid sequence represented by SEQ ID NO: 1. (I) an amino acid represented by SEQ ID NO: 1 comprising a partial peptide of a polypeptide or an amide or an ester or a salt thereof, wherein the partial peptide has the same or substantially the same amino acid sequence as A polypeptide characterized by containing the same or substantially the same amino acid sequence as its sequence, its amide or its ester or its salt, or (ii) SEQ ID NO:
A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. (I) a polypeptide, or an amide or ester thereof, characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 obtained by using the screening kit of A salt thereof, or (ii) a partial peptide of a polypeptide, or an amide or ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. A compound or a salt thereof that promotes or inhibits the activity is administered to mammals. Prolactin secretion adjustment method, characterized by. 38. (I) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a amide thereof, an ester thereof, or a salt thereof Or (ii)
A partial peptide of a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or an ester or a salt thereof, and (iii) SEQ ID NO: A protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 37;
Or its partial peptide or its amide or its ester or its salt,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. Or (II) (i) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof, or a polypeptide thereof A salt, or (ii) identical or identical to the amino acid sequence represented by SEQ ID NO: 1. A partial peptide of a polypeptide characterized by containing the same amino acid sequence or an amide or an ester or a salt thereof, and (iii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 37 (I) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, comprising a protein or a salt thereof, or a partial peptide thereof, an amide thereof, an ester thereof or a salt thereof, Or a amide or an ester or a salt thereof, or (ii) SEQ ID NO: 1.
A partial peptide of the polypeptide, or a compound or a salt thereof which promotes or inhibits the activity of the partial peptide of the polypeptide or an amide or an ester thereof or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by Obtained using a screening kit,
(I) a polypeptide characterized by containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide or ester thereof or a salt thereof, or (ii) SEQ ID NO: A compound or salt thereof which promotes or inhibits the activity of a partial peptide of a polypeptide, an amide or an ester thereof, or a salt thereof, which comprises the same or substantially the same amino acid sequence as the amino acid sequence represented by 1. A method for regulating prolactin secretion, comprising administering to a mammal.