HUT77047A - Compositions and treatment for multiple sclerosis - Google Patents

Description

The present invention relates to isolated peptides and combinations of peptides derived from myelin autoantigens such as MBP, MOG, PLP and MAG, which are useful in the treatment of multiple sclerosis, including prophylactic and therapeutic compositions, and multiple sclerosis. procedures for preventing or treating. Preferred compositions of the present invention comprise at least one isolated, purified peptide, free of any other polypeptide or impurity, having the amino acid sequence of a myelin autoantigen having T cell activity. The therapeutic composition of the invention is capable of limiting the autoantigen-specific immune response to the myelin autoantigen in a population of people suffering from or susceptible to multiple sclerosis by reducing, eliminating or reversing the symptoms of the disease. / or prevents or slows the onset or progression of symptoms of the disease. In addition, the compositions and methods of the present invention, when used in the advanced stage of the disease, reverse the current paralysis or other symptoms of the disease when administered in the acute phase of the disease or prevent the disease from returning when administered in remission.

···· ···· '-', r-ft jí-5 W57-: i-g ', fi -! - Jj- γ ·

shed

S.B.G. & K.

International

63 828 / HF

ΠΟ <13

H-1062 Budapest, Andrássy út 113

Phone: 34-24-950, Fax: 34-24-323 r,

Preparations and treatments for the treatment of multiple sclerosis

IMMUNOLOGIC PHARMACEUTICAL CORPORATION, WALTHAM, MA, US

inventors:

SMILEK Dawn, SARATOGA, California, US

SAMONS Michael, BALTIMORE, Maryland, US

GEFTER Malcolm, LINCOLN, Massachusetts, US

HSU Di-Hwei, PALO-ALTO, California, US

SHI Jia-Dong, MOUNTAIN VIEW, California, US

PALIARD Xavier, SAN FRANCISCO, California, US

DEVAUX Brigitte, REDWOOD CITY, California, US

ROTHBARD Jonathan, ATHERTON, California, US FRANZÉN Henry, WATERTOWN, Massachusetts, US

Date of filing: 1995. 10th 25th PRIORITY: 1994. 10th 25th (08 / 328,224), US 1995th 03. 15th (08 / 404.228). US

International Application Number: PCT / US95 / 13682

International Publication Number WO 96/12737

Autoimmune diseases are a serious human health problem and are relatively poorly understood. As we do not currently know which microbial or viral agent is directly responsible, an approach based on the etiology of the disease should be used to prevent, treat, and diagnose these diseases. It always includes endogenous metabolic intermediates, structural components, cells, etc. a complex series of reactions. However, it is inherent in the nature of an autoimmune condition that at least one autoantigen must play a role in the generation of events that result in symptoms. Autoimmune demyelinating diseases such as multiple sclerosis are no exception.

Multiple sclerosis manifests itself as repeated attacks, which refers to lesions in the central nervous system. Attacks take place over the years, disappear, and then recur, seemingly random. The incidence of flares is highest in the first 3-4 years, but the first attack, which may be so slight as to escape the doctor's attention, can hardly be recalled and cannot be followed by another attack for 10-20 years. The magnitude of the recovery period after one episode may vary greatly between two patients. Remission can be complete, especially after early attacks. However, remission is often incomplete, and as the attacks follow, there is a gradual deterioration with increasing degree of permanent damage. The clinical picture of multiple sclerosis is determined by the localization of demyelination points within the central nervous system. Classical features include impaired vision, nystagmus, dysarthria, diminished sense of vibration and position, ataxia and intentional tremor, weakness or paralysis of one or more limbs, spasticity, and bladder problems. Criteria for the diagnosis of clinically determined multiple sclerosis are the reliable knowledge of the occurrence of at least two neurological deficits and the objective clinical observation of lesions at more than one point in the central nervous system. Effective treatment of multiple sclerosis is currently unknown. Current therapeutic efforts are directed to ameliorating the acute episode and preventing the recurrence or progression of the disease (Harrison's Principles of Intermediate Medicine, 12th Edition, Vol. 2, 3082043, McGraw Hill (1991)).

A commonly used animal model of multiple sclerosis is experimental allergic encephalomyelitis (EAE), a central nervous system demyelinating disease in susceptible mouse strains with myelin basic protein (MBP), proteolipid protein (PLP), myelin oligodendrocyte protein (MOG), can be induced by synthetic proteins based on its sequence. MBP is one of the autoantigens suspected to play a role in multiple sclerosis and is both human [Ota et al., Natur. 346, 183-187 (1990)] and rodents [Zamvil et al., Natur. 324, 258-260 (1990). 1986)] systems, · determined their location on the epitope map. Those ·· · ·

peptides, which it thought that MBP (myelin basic protein ) at least one T-cell epitope contain, literature reported [WO 93/21222; INTACT 0 304 279, WO

91/15225; Ott et al., Letters to Natur 346: 183-187 (1990); Wucherpfennig et al., 1994, J. Exp. Med. 170: 279-290. Other polymeric peptides containing the MBP T-cell epitope are also described in U.S. Patent Application Serial Nos. 08 / 328,224, filed October 25, 1994, and May 10, 1994, incorporated herein by reference. U.S. Patent Application Serial No. 08 / 241,246. MOG peptides having cellular activity have been identified in U.S. Application Serial No. 08 / 300,811, which is incorporated herein by reference.

Proteolipid protein (PLP) and myelin-associated glycoprotein (MAG) are also thought to play an autoantigen role in multiple sclerosis. Studies on the pathogenesis of autoimmune response to PLP in multiple sclerosis have been described by Trotter et al., J. Neuroimmunol. 33: 55-62 (1991)]; PLP T cell epitopes have been described by Pelfrey et al., J. Neuroimmunol. 4, 6, 33-42 (1993)]. Studies describing MAG as a potential autoantigen have been reported by Johnson et al., J. Neuroimmunol. 13: 99-108 (1986)].

Experimental autoimmune encephalitis (EAE) is an autoimmune disease mediated by CD4 + T cells ···· ····, which has several clinical and histological properties similar to multiple sclerosis and serves as an experimental model for this and other autoimmune diseases. EAE is an inflammatory disease of the central nervous system that causes paralysis and other neurological disorders. Typically, it can be induced by purified myelin proteins and peptides. However, EAE is widely used to investigate the mechanism of autoimmunity and to investigate potential drugs for autoimmune diseases.

As early as 1965, it was observed that the non-encephalogenic form of EAE can be treated by administration of MBP, presumably by inducing immunological inactivity or tolerance [Alvord, C.E. et al., NY Acad. Sci., 122, 333 (1965); Levine,

NEITHER. et al., Science 161, 1155 (1968); Bemard, C.C.A .: 1977 Clin. Exp Immunol. 29, 100 (1977)]. This early observation has been expanded in recent years, and many researchers have shown that administration of MBP and MBP peptides before birth or in adulthood prevents EAE [Bemard, C.C.A: 1977 Clin. Exp Immunol. 29, 100 (1977); Clayton, J.P. et al., J. Exp. Med. 169, 1681 (1989); Smilek, D.E. et al., 1991, Proceedings of the National Academy of Sciences, USA 88: 9633; Guar, A., et al. (1992) Science 258: 1491; Metzler, B., et al., Int. Immunol. 5, 1159 (1993); Miller, A., et al., J. Neuroimmunol. 46: 73 (1993); Critchfield, J.M. et al., Science 263, 1139 (1994); Miller, A., et al. (1992) Proceedings of the National Academy of Sciences, USA, 82, 421]. In these studies, several different modes of administration are suggested, such as subcutaneous, intraperitoneal, intranasal, intravenous and oral. The induction of immunological inactivity by intravenous peptides in adult animals has been demonstrated by a number of different antigenic systems. For several reasons described below, there are limitations to the clinical use of oral, enteral or aerosol administration of autoantigens, such as, once it has entered the stomach, it is not possible to characterize the active component of a therapeutic preparation because of enzymatic degradation in the stomach. Thus, these methods make it difficult to achieve predictable and reproducible effects, not to mention that further adverse drug reactions in the body are unlikely to predict potential adverse effects.

In most of these examples, the prevention of disease or the induction of tolerance is clonal anergy (Guar, A. et al., Science 258, 1491 (1992)), peripheral deletion (Critchfield, JM et al., Science 263, 1139 (1994)). or account for other forms of antigen-specific tolerance. However, TGF-β-mediated inactive suppression appears to be another mechanism by which orally administered MBP and MBP peptides may inhibit EAE (Miller, A. et al., Proceedings of the National Academy of Sciences, USA, 82, p. 421 (1992)]. MBP peptides as well as substituted MBP peptide analogs were tested for alternative treatments against EAE in PLJ, BIO.PL and (PLJxSJL) F1 mice. MBP Ac-11 is an immunomodulatory encephalogen peptide in these strains and is recognized by the bound ·α ^υ Αβ ^υ [Wraith, DC et al.]. MBP Ac-II has been extensively studied by substitution analysis and the binding requirements for T-cell recognition and major histocompatibility complex (MHC) have been determined. The side chains of Groups 3 and 6 mainly contribute to T-cell recognition, while Groups 4 and 5 contribute mainly to MHC binding. The binding of MBP to Ac-11 Aa ^u Ap ^u can be significantly improved by a variety of different amino acid substitutions in Group 4, including alanine (Ac11 [4A]) and tyrosine (Ac-II [4Y]) [Wraith, DC et al .; Fairchild, PJ et al., Int. Immunol. 5, 1151 (1993)]. These group 4 substitutions, particularly tyrosine, appear to enhance the stability of peptide-MHC complexes formed with these peptides. Acl-II [4A] and Acl-II [4Y] retain the T cell receptor (TCR) contact groups required for antigenicity and are more effective than MBP Acl-11 in stimulating MBP-specific T cells in vitro. Acl-II [4Y] in vivo is also an encephalogen (Acl-II [4A] is mildly encephalogenic for unknown reasons). Both Acl-II [4A] and Acl-II [4Y] have been shown to prevent EAE and are thought to act by an antigen-specific mechanism [Smilek, DE et al., Proceedings of The National Academy of Sciences, USA 88, 9633 (1991); Wraith, DC et al.

Previous studies have shown that when MBP peptides or peptide analogs are administered in incomplete adjuvant just prior to the onset of the disease, it is then e ** · «** · * A ·« ·· I · • · · * ° »9 * · f ·« »tf •» · «♦ · * * prevented the development of EAE [Smilek, DE and others:

Proceedings of the National Academy of Sciences, USA 88, 9633 (1991); Guar, A., et al. (1992) Science 258: 1491]. In another study using lymphocytes from an MBP-specific TCR transgenic mouse, adoptively transposed EAE was prevented by early and aggressive administration of MBP before the onset of clinical symptoms [Critchfield, J.M. et al., Science 263, 1139 (1994)]. These studies show that it may be possible to prevent EAE by injecting MBP peptides after activation of the encephalogenic T cells, but do not answer the question of whether the ongoing paralysis (and possibly the central nervous system is active). inflammation) or reversible relapse following remission can be prevented by this approach. In addition, in some experiments, frequent administration of extremely high doses of MBP or MBP peptide required effective treatment. The authors of the present invention were the first to describe reversal of paralysis and prevention of relapse following remission in their previous application (USSN 08 / 328,224, filed October 25, 1994). Since the prior disclosure of the present inventors, others in the art have been surprised to find that certain MBP-derived peptide analogs can reverse the paralysis currently occurring in EAE (Karin et al., J. Exp. Med. 180, 2227-2237). December 1994)].

The present invention overcomes the above-described obstacles and provides novel peptides, compositions and methods for the treatment of multiple sclerosis, using compositions comprising at least one peptide having the amino acid sequence of MBP T cell activity. In addition, the present invention addresses an unprecedented problem that, in order to be generally applicable to the treatment of multiple sclerosis with peptides or peptide analogues, these peptides or peptide analogs must be effective if used in a late or adult state of the disease, or during remission or relapse, while the unwanted immune response is still ongoing.

Accordingly, it is an object of the present invention to provide peptides and peptide combinations useful for the treatment of multiple sclerosis, including the time of onset of the disease. The invention further relates to the determination of prophylactically and therapeutically effective dosage ranges and routes of administration of proteins, peptides and peptide analogs identified for the effective treatment of MS. The invention further relates to the identification of a treatment that successfully treats the late phase of MS, prevents relapses, stops the disease and / or reverses the progression of MS.

The present invention relates to isolated peptides and peptide combinations derived from myelin autoantigens such as MBP, MOG, PLP and MAG, which are useful in the treatment of multiple sclerosis, including prophylactic and

medications, and methods for treating multiple sclerosis. Preferred compositions of the present invention comprise at least one isolated, purified peptide, free of any other peptide or contaminant, and comprising the amino acid sequence of a myelin autoantigen having T cell activity. The pharmaceutical composition of the invention is capable of suppressing an autoantigen-specific immune response to a myelin autoantigen in a human population suffering from or susceptible to multiple sclerosis, i.e., the symptoms of the disease are reduced, eliminated or reversed, and / or the onset or progression of disease symptoms can be delayed. or it can be prevented. In addition, administration of the compositions and methods of the present invention at an advanced stage of the disease reverses the onset of the paralysis or other symptoms of the disease when administered in the acute phase of the disease, or prevents relapse when administered in remission.

BRIEF DESCRIPTION OF THE DRAWINGS FIG.

Figure 1 shows the complete amino acid sequence of human MBP with the amino acid numbering.

Figure 2 shows preferred peptides from MBP.

Figure 3 shows the overlap peptides used in Example 1 as well as longer peptides.

4a. Figure 3A shows the percentage of total MBP response for the peptides shown in Figure 3. MBP reactivity is calculated based on the percentage of MBP positive microtiter cultures in a group of patients who are positive for one of the MBP peptides. Total MBP positive microtiter cultures were between 89184 in each group of 19-43 patients tested for each peptide.

4b. Figure 3B is a graphical representation of the percentage of MBP responders that recognize all of the peptides shown in Figure 3. Patients were considered MBP responsive when at least one of their microtiter cultures was positive for MBP reactivity. In each of the 19-43 patients tested for all peptides, there were 12-31 MBP responsive patients. The reactivity of the peptide was calculated based on the percentage of patients responding to MBP in each group, who had at least one microtiter culture positive for one MBP peptide.

5a. Figure 5B is a graph of mean clinical values 0-40 days after the disease was induced by intravenous injection of only MBP Acl-II (SEQ ID NO: 65) compared to a control.

5b. Figure 5B is a graph of mean clinical values 0-40 days after the disease was induced by intravenous injection of MBP Acl-II (SEQ ID NO: 65) in combination with MBP 31-47 compared to a control.

5c. graph of mean clinical values 0-40 days after mice induced disease by intravenous injection of ÓVA 323-339 (SEQ ID NO: 69) compared to a control.

6a. graph of mean clinical values at 0 and at least 30 days after administration of either

Acl-II [4Y] (SEQ ID NO: 67) or Acl-11 (SEQ ID NO: 65) injection induced the disease by comparison with controls.

6b. FIG. 3B is a graph of mean clinical values at 0 and at least 30 days after subject induction of disease by injection of 250 nM Acl11 [4Y] (SEQ ID NO: 67) compared to control.

6c. Figure 5B is a graph of the mean clinical values at 0 and at least 30 days after induction of the disease by injection of 2.5 nM of Acl-11 (SEQ ID NO: 65) compared to control.

Figure 7 is a bar graph showing average histological values of peptide-treated mice compared to control mice, with a lower value representing a lower number and severity of inflammatory CNS infiltrations.

Fig. 8 is a bar graph showing the capacity of spleen cells receiving in vivo pulses for the indicated time (1-10 hours) with 250 nM Acl-II [4Y] (SEQ ID NO: 67) to activate a hybridoma in vitro. cell line (1934 hybridoma) derived from an MPB-specific T cell clone.

Figure 9 is a diagram comparing the treatment of mice with 250 nM Acl11 [4Y] (SEQ ID NO: 65) to control, PBS, and OVA 323-337 (SEQ ID NO: 70).

··· ··· ·

Figure 10 is a graph showing a comparison of treatments performed with 25 nM Acl-II [4Y] (SEQ ID NO: 67) in remission versus control.

11a. Figure 5B is a graph showing the comparison of lymphoid proliferation of mice pretreated with 250 nM MBP Acl-II (SEQ ID NO: 65) compared to controls.

11b. Figure 5B is a bar graph showing relative lymphoid interleukin-2 production in response to MBP Acl-II (SEQ ID NO: 67) compared to control mice pre-treated with Ac11 [4Y] (SEQ ID NO: 67).

12a. Figure 4B is a graphical representation of an experiment that shows the effects of interferon-β on EAE in two groups of 10 (SJL x TLP) F! female mice in which EAEt was induced with guinea-pig MBP administered in complete adjuvant plus cough toxin mixture on day 0 and received either incomplete Freund's adjuvant (control) or treated with 2000 units of interferon-β intraperitoneally on day 9, 12

On days 16 and 20 (arrows on the x-axis), the Y-axis shows the mean clinical value (MCS) for each group. 0 = no clinical sign of EAE, l = paralysis, unresponsive tail, 2 = partial hind limb paralysis, 3 = complete hind limb paralysis, 4 = partial or complete paralysis, 5 = dying.

12b. Figure 4A is a graphical representation of an experiment showing the effects of Acl-11 MBP peptide (SEQ ID NO: 65) in two groups of 10 (SJL x TLP) F _X female mice in which EAE is complete with adjuvant plus cough guinea pig MBP administered in toxin mixture on day 0 and either PBS alone (control) or 250 nM Acl-II (SEQ ID NO: 65) was administered intravenously at 10, 13, 17 and At day 21 (indicated by arrows on the X-axis), the average clinical value on the Y-axis is shown for each group, as shown in Figure 1a. 4a.

12c. Figure 4A is a graphical representation of an experiment in which the effects of Acl-11 MBP peptide (SEQ ID NO: 65) co-administered with interferon-β are shown in two divided 10 (SJL x TLP) F1 female mice in which EAE is complete with adjuvant plus guinea-pig MBP administered in a pertussis toxin mixture on day 0 and received either PBS alone (control) or treated with 250 nM Acl-II (SEQ ID NO: 65) as described in Figures 10, 13, 17. on days 21 and 21 (indicated by blank arrows on the X axis) and treated with 2000 units of IFN-β interperitoneally on days 9, 12, 16, and 20 (black arrows on the X axis); values for each group are shown in la.

4a.

Figure 13 is a graphical representation of an experiment showing the effects of varying doses of interferon-β (10,000 and 2,000 units) on induced EAE in two groups of 10 (SJL x TLP) FI female mice in which EAE is complete as an adjuvant. plus a whooping cough injected with a toxin mixture in a guinea pig

MBP was induced on day 0 and either received PBS alone (control) or treated with 10,000 units or 2,000 units of interferon-β on days 9, 13, and 16 (black arrows indicate X on the Y-axis), the Y-axis shows the mean clinical value for each group, la.

4a.

Figure 14 shows various peptides derived from MBP which may be useful in the compositions and methods of the present invention.

Figure 15 is a graphical representation of the positivity index (Y-axis) (mean S.I./MBP-reactive patient) multiplied by the percentage of individuals responding to each peptide (X-axis) derived from the same experimental data as in Figure 4a. and 4b. 1 to 4 and illustrated in Example 1.

Figure 16 shows the mean clinical value for Acl-II [4Y] (Figure 67).

(SEQ ID NO: 1) relative to the therapy initiated in each patient (Day 1 onset of clinical symptoms in each mouse). Mice were treated with PBS (black squares), 250 nM Acl-II [4Y] (SEQ ID NO: 67) intravenously (blank triangles), or 250 nM Acl on days 1, 3, 6 and 9 of the disease. -ll [4Y] subcutaneously (SEQ ID NO: 67) (blank circles). These data show that Acl-II [4Y] (SEQ ID NO: 67) reverses EAE when administered after the onset of paralysis.

Figure 17 shows the mean clinical score when Acl-II [4Y] is administered before symptoms appear. Data are plotted against gpSpinal Cord Homogenate (gpSCH) -induced disease at day 0 and on treatment days. Groups of surviving mice on days 8, 10, 13, and 17 were treated intravenously with 25 nM Acl-11 [4Y] (SEQ ID NO: 67) (empty triangles), subcutaneously treated with 25 nM Acl-11 [4Y] (SEQ ID NO: 67) (black circles), or there are mice that do not receive treatment (blank squares). These data indicate that Acl-II [4Y] (SEQ ID NO: 67) prevents the onset of EAE.

Figure 18 is a graph showing the mean clinical score relative to the initiation of the treatment, using Acl-II [4Y] (SEQ ID NO: 67) as intravenous blank triangles or subcutaneously (black triangles). Blank squares mean control.

Figure 19 is a graphical representation of the mean clinical score versus day of induced disease using 75 pg gpMBP (black circles), 100 μg huMOG (blank triangles), and 75 μg gp MBP and 100 μρ huMOG (black squares). As can be seen, the disease induced by MOG and MBP is much more severe than the disease induced by only one.

Figure 20 is a graph of mean clinical score versus day of induced disease using Aol-II [4Y] (SEQ ID NO: 67) (blank squares) versus PBS control (black squares). This disease is a

It was induced as described in Example 10 using huMOG + gpMBP. These data show that Acl-II [4Y] (Fig. 67).

SEQ ID NO: 2) significantly reduces the mean clinical score compared to the control.

The patents and scientific publications referred to herein are known to those skilled in the art. Cited U.S. Patent Applications, PCT Publications and other publications cited herein are incorporated by reference.

The present invention relates to isolated peptides derived from myelin autoantigens and combinations thereof which are useful in the treatment of multiple sclerosis, and to compositions and methods of treatment for the treatment of multiple sclerosis. Hereafter, the term "treating multiple sclerosis" is intended to mean: preventive treatment of mammals susceptible to multiple sclerosis; treatment at the onset of multiple sclerosis; and treating multiple sclerosis in all advanced stages, including descending-recurrent multiple sclerosis, chronic progressive multiple sclerosis, primary progressive multiple sclerosis, and multiple sclerosis. The pharmaceutical compositions of the present invention comprise at least one purified peptide substantially free of other proteins and contaminants and a defined amino acid sequence of a myelin antigen having cell-stimulating activity, which peptide may also be an isolated peptide. Hereinafter, the term isolated shall mean a peptide which is free from any other polypeptide, impurity, starting reagent or other substance and which is not conjugated to any other molecule.

According to the present invention, the term peptide refers to a defined sequence of amino acids that is smaller than the amino acid sequence of the native protein antigen. Preferably, the peptide of the invention contains at least about seven amino acids, or preferably at least about 12 to 40 amino acids, but more preferably contains 13 to 30 amino acids, and which, when derived from a protein antigen, contains less amino acids than the protein antigen, preferably not more than about 75% of the antigenic residues of the whole protein. The peptides of the present invention have T cell activity. A peptide having T cell activity may have one or more of the following characteristics: a) it is capable of eliciting a T cell response, i.e., stimulating (e.g., proliferation or lymphokine secretion); b) is capable of inducing T-cell non-response or reduced T-cell responsiveness in appropriate T-subpopulations without being involved in stimulating an immune response to the attacking autoantigen (e.g., by anergy, tolerance or apoaptosis); (c) ability to modify the lymphokine secretion profile compared to contact with a natural autoantigen; d) ability to induce Tsuppressor cells; and e) is capable of limiting the symptoms of autoimmune disease by any mechanism; or f) it is derived from an inactive antigen and has the ability to induce suppressor T cells at the site of myelin autoimmune attack, which in turn results in the limiting of the immune response to the site of myelin autoimmune attack.

• · · · ········

Peptides containing at least one T-cell epitope have T-cell activity and are capable of inducing a T-cell response, that is, T-cell stimulation (such as T-cell proliferation or lymphokine secretion) and / or are capable of limiting autoantigen-specific T. cellular response, resulting in autoantigen specific T cell responsiveness, or reduced levels of autoantigen specific T cell responsiveness. A T-cell epitope is the basic element or the smallest unit of T-cell receptor-based recognition, where the epitope contains amino acids essential for receptor recognition. T-cell receptors are thought to play a role in initiating and maintaining an immune response to an antigen or autoantigen. These T-cell epitopes are thought to elicit early immune response events at the level of T-helper cells by binding to a suitable HLA molecule on the surface of the antigen presenting cell and stimulating the corresponding T-cell subpopulation. These events lead to T cell proliferation, lymphokine secretion, local inflammatory reactions, the assembly of additional immune cells at the site, and the B-cell cascade that produces antibodies. In the case of autoimmune disease, the antibodies produced are autoantigens, such as MBP, which result in clinical symptoms of an autoimmune disease.

Peptides of defined amino acid composition containing T cell epitopes can detect any myelin autoantigen, including MBP. One method involves dividing a protein antigen into peptides of desired length, non-overlapping, or overlapping, and then synthesizing, purifying, and examining these peptides to determine whether the peptides contain at least one MBP epitope. , on any number of assays (e.g., T cell proliferation assays, lymphokine secretion assays, and T cell non-response assays). Alternatively, an algorithm is used to predict peptides that are likely to contain T-cell epitopes and then synthesize, purify, and test the algorithm-predicted peptides in T-cell assays or in vivo assays to determine whether these are predicted peptides. whether they cause T-cell proliferation, or lymphokine secretion, or T-cell non-response, and are therefore likely to contain T-cell epitopes. As discussed in several of the documents cited above, human T cell activity can be assayed by culturing T cells isolated from a susceptible individual to an autoantigen, such as MBP, with the antigen-derived peptide, determining that T- cells proliferate in response to the peptide, as measured, for example, by tritiated uptake of thymidine. The stimulation of T cells on peptides can be calculated by dividing the maximum per minute (CPM) of the peptide by the control CPM. A T-cell stimulation index (S.I.) that is twice or preferably three times the background level is considered positive ···· · ······. Positive results are used to analyze the potential therapeutic efficacy of the peptides, discussed below in Example 1. Preferred peptides of the present invention comprise at least one T-cell epitope, preferably at least two or more T-cell epitopes.

One of the algorithms used to predict peptides with T-cell stimulating activity was reported by Rothbar, Rothbard, lst Forum in Virology, Annals of the Pasteur Institute, December 1986, 518-526; Rothbard and Taylor, EMBO 7: 93-100 (1988); EP 0 304 279]. These publications describe the determination of a general method (algorithm), statistical significance and correlation of the pattern with known T-cell epitopes, and the successful use of various protein antigens and autoantigens in previously unknown T-cells. to predict its epitopes. The general pattern of a peptide known to bind well to MHC class II, as described in the aforementioned publications, contains a linear pattern consisting of a charged amino acid or glycine followed by two hydrophobic moieties. After determining whether a peptide conforms to the general pattern, the reactivity of the peptide with T cells can be assayed. Other algorithms used to predict T cell epitopes of previously unspecified proteins include an algorithm described by Margalit et al., J. of Immunol.

138: 2213-2229 (1987)] in the amphipathic helix model. ···; ♦ ·· ·· · »· • · · · · · · · · · ···· ♦ • · · Based on..

In addition, peptides containing cryptic T-cell epitopes can be assayed and also useful in the compositions and methods of the invention. Cryptic T-cell epitopes are determinants of a protein antigen that are equivalent to processing and native protein antigen.

Due to the presentation of an MHC molecule, it is normally not visible to the immune system. However, a peptide containing a cryptic T-cell epitope is capable of rendering T-cells non-responsive, and when an organism is treated with such a peptide, the resulting T-cells will grow in vitro under the influence of the peptide or protein antigen from which the peptide It comes from. Peptides containing at least one T cell epitope derived from a protein antigen are referred to as cryptic peptides. To confirm the presence of cryptic T-cell epitopes, a T-cell proliferation assay known to one of ordinary skill in the art may be used in which antigen-treated T-cells are cultured in vitro in the presence of each peptide to determine its ability to react with the peptide. Cell lines. A peptide is thought to contain at least one T-cell epitope if a T-cell line can be created with that peptide and the T-cells are able to proliferate by stimulating the peptide and the protein antigen from which the peptide is derived.

In addition, it is not necessary that a peptide used in the present invention be a myelin autoantigen such as the amino acid MBP.

acid sequence. Any peptide having a defined amino acid sequence and capable of limiting an antigen-specific immune response against the myelin autoantigen can be used in the methods of the invention. For example, peptides having a defined amino acid sequence may be synthesized that do not rely on the amino acid sequence of the myelin antigen and yet are capable of limiting an antigen-specific immune response, i.e., the peptide mimics a T-cell epitope of myelin autoantigen and causes or impairs the immune response for other reasons because it is derived from an idle antigen. Without wishing to be bound by any theory, we believe that idle antigens, which are also tissue-specific (but not targets for immune or autoimmune attack), may have the property of inducing the production of suppressor T cells at the site of immune attack, which, in turn, results in limiting the immune responses within the immune response range (i.e., to the affected own tissues in autoimmune diseases or in the case of allergies to the nasal mucosa, skin and lungs). Inactive antigens include, but are not limited to, portions of the antigen or autoantigen which are not themselves the target of the immune attack and which have suppressive activity at the site of the immune attack. Hereinafter, the term myelin antigen or myelin autoantigen means inactive antigens which are · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · * * · · · · Have no suppressive activity at the site of myelin autoimmune attack.

In addition, any compound capable of mimicking a peptide capable of limiting an antigen-specific immune response to a myelin autoantigen (i.e., a peptidomimetic) may be used in the present invention. Such a compound is not entirely composed of subunits linked by peptide bonds, but is linked by other bonds (i.e. thiolester bonds, reduced bond analogs, amide bond isosterases), provided that the non-peptide compound mimics a peptide capable of targeting an antigen of interest to us. to limit the antigen-specific immune response shown by effective therapeutic / prophylactic treatment of the symptoms. Peptidomimetics may be based on any of the peptides of the present invention, but may comprise for example a bond analogues (i.e. N-methyl amide bonds: NHC _a2 [CO-NCH ₃ -] C _ai) and reduced bond analogs (NHC _a2 [CO-NH] C _ai ) instead of one or more normal peptide bonds.

Once peptides containing the T-cell epitope have been identified, it is also possible to modify the structure of these peptides according to the present invention, for example, to increase their solubility (particularly desirable when injecting the composition), enhance therapeutic or their prophylactic efficacy (see, for example, discussion of peptides having enhanced MHC binding below); or their stability (e.g., ex viv shelf life and resistance to in vivo proteolytic degradation), or simplify peptide synthesis. A modified peptide or peptide analogue may be prepared in which the amino acid sequence is altered relative to the native protein sequence (from which it is derived) or to the unmodified peptide. alteration from which the modified peptide is derived, such as by amino acid substitution, deletion, or addition, with the aim of modifying immunogenicity, enhancing peptide solubility, or enhancing the ease of peptide synthesis (i.e., automated peptide synthesis).

For example, a peptide may be modified to at least retain, if not enhance, the ability to reduce the autoimmune response in multiple sclerosis (i.e., by inducing T-cell non-response or reduced T-cell responsiveness). In this case, the T cell receptor critical for the T cell receptor can be determined by known techniques (i.e., substitution of individual groups and determination of the presence or absence of T cell reactivity). The groups known to interact with the T cell receptor can be modified by substituting the essential amino acid with another, preferably similar, amino acid (conservative substitution), the presence of which has been shown to enhance, weaken, but not eliminate or not affects cellular activity. In addition, amino acid residues that are not essential for T cell receptor interaction can be modified by substitution with another amino acid whose presence has been shown to enhance, attenuate, but does not eliminate or affect T cell activity but does not eliminate T cell activity. binding to an appropriate MHC. In addition, the pulps of the present invention may be modified by substituting an amino acid that has been shown to be essential for interaction with the MHC protein complex with another, preferably similar, amino acid, the presence of which has been shown to be that enhances, attenuates, but does not eliminate or affect T-cell activity. In addition, amino acid residues that are not essential for interaction with the MHC protein complex but still bind to the MHC protein complex can be modified by replacing them with another amino acid whose incorporation enhances, does not affect or reduces, but does not eliminate, T-cell reactivity. . For the non-essential amino acid, preferred amino acid substitutions include, but are not limited to, substitutions with alanine, glutamic acid or a methyl amino acid. One example of WO 94/06828 discloses substituted peptides in which substantially all of the amino acid residues can be replaced by a conservative amino acid, a non-naturally occurring amino acid or alanine, and yet the substituted peptide is capable of limiting an antigen-specific immune response. In another example, Karin et al. Describe assays using MBP immunodominant rat epitope analogues comprising amino acids 87-99 of SEQ ID NO: 43, as shown in FIG.

J. Exp. Med. 180: 2227-237 (1994)]. The analogs are a series of 13 substituted peptides based on amino acids 87-99 of SEQ ID NO: 43, which are the original SEQ ID NO: 43. »• · · * · ·» · · · «

They differ from amino acids 87-99 by a single alanine substitution at each position along amino acids 87-99 of SEQ ID NO: 43. These assays are designed to show putative sites where the immunomodulatory peptide interacts with MHC and TCR in the Lewis rat, and to identify modified peptides that are more potent for potential therapeutic use. properties. These studies show that when the lysine (K) at position 91 between amino acid 8799 of SEQ ID NO: 43 is replaced by alanine (A) (see 87-99 [K> A] in SEQ ID NO: 36, SEQ ID NO: 14). (Fig. 1A), this precedes and reverses EAE in Lewis rats. Based on this information, it would be expected that substitution of alanine for the only lysine (K) in peptides containing the amino acid sequence 87-99 of SEQ ID NO: 43, i.e., ΜΒΡ-2 (5) ), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 8), 9), MBP-2.5 (SEQ ID NO: 10), and MBP-2.6 (SEQ ID NO: 11) as shown in Figure 2.

As a result of this, the substituted peptides result in increased T cell activity. For example, replacing lysine at position 10 in MBP-2.1 (SEQ ID NO: 6) with alanine (i.e., DENPVVHFFANIVTPRTPPSQGK) (SEQ ID NO: 71) would result in an enhanced T cell activity, which is stronger

results in therapeutic properties compared to the parent MBP-2.1 (SEQ ID NO: 6) peptide.

To enhance stability and / or reactivity, the peptides may also be modified by incorporating one or more polymorphisms in the antigenic amino acid sequence of a protein derived from natural allelic variants. In addition, Damino acids, unnatural amino acids, or non-amino acid analogs may be used as substituents or inserts to produce a modified protein or peptide within the scope of the present invention. In addition, the peptides of the present invention may be modified using the polyethylene glycol (PEG) method of A. Sehon et al. (Wie et al.) To produce a PEG-conjugated protein or peptide. In addition, PEG can be added to the molecule by chemical synthesis of a protein or peptide of the invention. Modification of the peptides or portions thereof may be reduction / alkylation [Tarr in: Methods of Protein Microcharacterization, ed.

Hmana Press, Clifton, NJ, 15-194 (1986)]; acylation [Tarr in:

Methods of Protein Microcharacterization, Ed. J. Silver, Humana Press, Clifton, NJ, 15-194 (1986)]; chemical coupling to a suitable carrier [Mishell and Shiigi, Selected Methods in Cellular Immunology, W.H. Freeman, San Francisco, CA (1980); United States Patent 4,939,239]; or mild formalin treatment [Marsh International Archives of Allergy and Applied Immunology 41,

199-215 (1971)].

To facilitate purification and potentially enhance the solubility of the proteins or peptides of the invention, reporter group (s) may be added to the peptide backbone. For example, polyhistidine can be added to a peptide to purify the peptide by immobilized metal ion affinity chromatography (Hochuli, E. et al., Biotechnology 6: 1321-1326 (1988)). In addition, specific endoprotease cleavage sites may be inserted, if necessary, between the reporter group and the amino acid sequence of a peptide to facilitate purification of peptides that do not contain irrelevant sequences. To potentially promote appropriate antigen processing of T-cell epitopes in a peptide, canonical protease-sensitive sites can be introduced between regions containing at least one T-cell epitope by recombinant DNA techniques or synthetic chemistry. For example, charged amino acid pairs such as KK or RR may be inserted between regions into a peptide during recombinant production of the peptide. The resulting peptide can then be sensitized to cathepsin and / or cleavage of other trypsin-like enzymes to produce portions of the peptides that contain one or more T-cell epitopes.

Another example of modifying these peptides is when cysteine residues are preferably substituted with serine, threonine, leucine or glutamic acid to minimize dimerization of disulfide bridges. In addition, the peptides may be modified to enhance the solubility of the peptide in buffered aqueous solutions, i.e., for use in pharmaceutically acceptable carriers or diluents, by adding functional groups to the peptide, the terminal portions of the peptide, or hydrophobic regions are omitted from peptides. For example, to increase solubility, charged amino acids or charged amino acid pairs or triplets may be added to the C-terminus or N-terminus of the peptide, or both. Charged amino acids include arginine (R), lysine (K), histidine (Η), glutamic acid (E), and aspartic acid (D). To facilitate peptide synthesis, i.e., automated peptide synthesis, it may be necessary to remove or substitute amino acids which make peptide synthesis more difficult or more expensive. For example, if the N-terminus or C-terminus of a peptide is susceptible to cyclization or is degraded during or after peptide synthesis, such amino acids may be deleted or substituted, or alternatively, one or more amino acids may be added to block the less desirable N- terminal or C-terminal amino acid. Such added amino acids are either derived from the natural protein sequence or may be non-natural amino acid residues. The added amino acids may be added to the N-terminus, the C-terminus, or both of a peptide, with the aim of enhancing the T-cell activity of the peptide as defined above. Such an added amino acid may be derived from the native protein sequence or may be a non-natural amino acid residue.

Preferably, the peptide formulations administered according to the present invention comprise a sufficient percentage of myelin autoantigen T cell epitopes (i.e., at least about 20%, more preferably about 30%, more preferably about 40%, and even more preferably about 60% or more) of total T cell reactivity against the myelin autoantigen in a population of individuals responsive to the autoantigen and suffering from multiple sclerosis (e.g., at least 10 individuals, more preferably 20 individuals), and In the present invention, the therapeutic range of administration of the composition to a patient suffering from multiple sclerosis, according to the invention, is to limit the autoimmune response to multiple sclerosis. To determine whether a single peptide (a preferred therapeutic candidate peptide) or a combination of labeled peptides is likely to contain sufficient amount of total myelogen autoantigen T-reactivity to sufficiently restrict the multiple sclerosis autoimmune response in patients with multiple sclerosis, analytical method may be used.

In one analytical method (using MBP as an example), peptides containing the T-cell epitope are ranked according to the number of MBP microtiter lines reacting to the epitope-containing peptides and the number of multiple sclerosis patients responding to them. Because the frequency of MBP-specific T cells in PBL of multiple sclerosis patients may be very low, it is often not possible to screen all peptides in each individual multiple sclerosis patient. Therefore, the following devices are useful in determining useful therapeutic peptides and are described in Example 1 below. PBLs are isolated from blood and then · ·

cultures were started in 96-well microtiter plates. PBLs were isolated from fresh peripheral blood samples (about 75 cm ³ ) from patients with definite multiple sclerosis using a Ficoll density gradient. Microtiter cultures were initiated in RPMI 1640 culture medium per well χ 2 10 ⁵ PBL L and 10 pg / ml of human spinal cord MBP, supplemented with 5% human AB serum, penicillin and streptomycin, and L-glutamine. The cultures were supplemented with interleukin-2 (20 units / ml) and interleukin-4 (5 units / ml) as shown in Figures 6-7. day. After 11-13 days, the microtiter cultures were washed, resuspended in fresh medium and dispensed into 12 fresh microtiter wells. Autologous frozen PBLs are added as antigen-presenting cells at 5 x 10 ⁴ PBL / well. Screening antigens are added in duplicate to 12 replicate wells from each microtiter well. Medium is always used as a negative control and purified human MBP at 10 pg / ml is used as a positive control. Each patient is also assayed for reactivity with up to 4 MBP peptides, each at a concentration of 10 pmol / L. After 48 hours, the reaction mixture was pulsed-gelated with 0.75 pCi ³ H-thymidine, and after a 6-16 hour pulse, cells were harvested. Individual cultures are considered positive for peptides based on the following criteria: excitation index greater than 3.0, change in cpm greater than or equal to 500, and standard error of mean less than change in cpm. In addition, cultures for analysis are considered peptide positive only if -. -. -. -. -.

they react to both MBP and peptide and if they do not react to more than one non-overlapping peptide. Preferably, groups of about 10-50 patients are screened for each MBP peptide and each patient group is screened with up to four peptides. The peptides were then ranked according to the following criteria: 1) percentage of MBP positive microtiter cultures in each patient group (Total MBP reactivity) that were at least still positive for MBP peptides; 2) the percentage of MBP responsive individuals in each of the groups that have been shown to be positive with at least one of the MBP peptides in a microtiter culture, wherein the MBP responsive individual is defined as a patient positive for at least one MBP has proven microtiter culture. Individual peptide candidates are then selected if they 1) contain at least 5%, preferably at least 10%, but most preferably 20% of the total MBP activity; and 2) reactivity therein is present in at least 20%, preferably at least 30%, more preferably at least 50%, and most preferably at least 60% of the MBP responsive individuals. Optionally, other criteria for ranking the peptides may be considered, such as the positivity index for a particular peptide. The positivity index indicates both the strength of the T cell response to a particular peptide (S.I.) and the frequency of a T cell response to a particular peptide in a population of individuals that respond to myelin autoantigens. As shown, for example, in Figure 15, the Positive Index of 141-165 (MBP4) (SEQ ID NO: 14) is about 2500, · · · · · * ·

what it is 1 described below. in the example given data Based on we calculated. MBP-4 (14 . No. sequence) peptide average SKI. the value divided by MBP respondent patients number , multiply it to ΜΒΡ-4 (SEQ ID NO: 14) responsive patients per cent of who are MBP responsive patients

population.

Highly purified peptides containing at least one T-cell epitope amino acid sequence, substantially free of substantially all other polypeptides and contaminants, used in the therapeutic compositions of the present invention may be prepared by synthetic chemical methods using standard techniques. Various methods for chemical synthesis of peptides are known in the art, such as, for example, solid phase synthesis which has been fully or partially automated on a commercially available peptide synthesizer. The synthetically produced peptides can then preferably be purified to homogeneity, more specifically 90%, preferably at least 95%, more preferably at least 97% purity, substantially free of any individual polypeptide and impurity using any number of methods known in the art to purify the protein.

Synthetically produced peptides of the invention, comprising about forty-five amino acids, preferably up to about thirty amino acids, are particularly preferred, since increasing the number of amino acids increases the difficulty of peptide synthesis. Multiple amino acid peptides are prepared by the recombinant DNA technique described below.

Peptides useful in the methods of the present invention may also be produced by recombinant DNA techniques in a host cell transformed with a nucleic acid sequence encoding such a peptide. When produced by recombinant techniques, host cells transformed with nucleic acid encoding the desired peptide are cultured in the appropriate medium for the cells, and the isolated peptides can be purified from the cell culture medium, the host cells, or both, using techniques known in the art to purify peptides and proteins. chromatography, ultrafiltration, electrophoresis, or immuno purification with antibodies specific for the peptide. Peptides produced by recombinant methods may be isolated and purified, preferably to homogeneity, substantially free of other cellular material, other polypeptides, or culture medium, for use according to the methods previously described for synthetic peptides.

Under certain limited conditions, peptides may be produced by chemical or enzymatic cleavage of a highly purified, full-length or native protein where the site of chemical digestion or enzymatic cleavage has been predetermined and the results obtained from the digestion may be reproduced. Peptides having the specified amino acid sequence may be highly purified and isolated, substantially free of any other polypeptide or contaminant present in any of the enzymatic or chemical procedures described above. in the resulting mixture. Peptides which are highly purified and isolated by the process can be prepared by synthetic or recombinant methods.

In addition, the peptides of the present invention may be used in conjugates as disclosed, for example, in U.S. Patent No. 5,130,297 to Sharma et al., Wherein therapeutic agents may be described by the formula X-MHC peptide or MHC peptide X, wherein X is a functional group which may be a toxin or a labeling group; MHC represents an effective portion of the MHC glycoprotein and said glycoprotein is dissociated from the cell surface where it is normally found; peptide means any of the peptides listed herein, more particularly MBP or MOG, more particularly the peptides shown in Figures 2 and 14.

Preferred peptides of the invention further comprise at least one T-cell epitope derived from a full-length protein, more particularly MBP or MOG. The peptides may contain tandem repeats of a single epitope and / or more than one epitope.

Preferred peptides from MBP, which may be useful for therapeutic use, are described below for the identification of peptides with MBP T cell activity (see above for details and Example 1 below). comprising: MBP-1 (SEQ ID NO: 2); MBP-2 (5.

SEQ ID NO: 2); MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15), all of which are illustrated in Figure 2, or any part or modification thereof. These peptides were assayed for T-cell reactivity as described in Example 1 and were found to contain at least one T-cell epitope as indicated by the proportion of MBP-positive microtiter plates that were positive for one of the MBP peptides ( Figure 4a) and the detectable response to each of the preferred peptides in a significant number of MBP patients tested (Figure 4b). MBP-4 (141-165) (SEQ ID NO: 14) is the most reactive of the four peptides, 21% of the total MBP response is attributable to it and can be detected in 64% of the MBP responsive patients tested. Surprisingly, MBP-4 (SEQ ID NO: 14) showed much greater activity than the combined reactivity of MBP 141160 (SEQ ID NO: 28) and MBP 151-170 (SEQ ID NO: 29), as shown in Figure 3. . The present inventors first identified this immunomodulatory peptide, which appears to contain multiple T-cell epitopes. This novel peptide may be particularly advantageous in therapy.

Additionally, MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7) ), MBP-2.3 (Figure 8).

MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), and MBP-3.1 (SEQ ID NO: 11) SEQ ID NO: 13) (as shown in Figure 2) is considered to be a candidate for therapeutic use. These peptides are MBP-1 (Figure 2).

), modified versions of MBP-2 (SEQ ID NO: 5) and MBP-3 (SEQ ID NO: 12) and are expected to have similar T-cell activity as their corresponding parent peptides. These peptides have amino acid deletions , by addition or both, according to the peptide modification techniques described above, mainly to simplify peptide synthesis.

Other peptides that have been shown to be immunodominant (i.e., have MBP T cell activity) or derived from peptides having MBP T cell activity have been identified and identified by other researchers in the field [October 25, 1994 United States Patent Application 08 / 328,224; United States Patent Application No. 08 / 241,246, filed May 10, 1994; WO 93/21222; EP 0 304 279; WO 91/15225; Ott et al., Letters to Natur 346: 183-187 (1990); Wocherpfennig et al., 1994, J. Exp. Med. 170: 279-290; Martin et al., J. of Immunol. 145: 540-548 (1990); Karin et al. (1994) J. Exp. Med. 180: 2227-2237. These peptides can be used in any of the formulations and methods of the present invention, especially when combined with the preferred peptide candidates described above. These peptides include, but are not limited to, the following peptides, or portions thereof, whose amino acid numbering corresponds to the amino acid numbering of human MBP shown in Figure 1, and their amino acid sequence is shown in Figure 14: 13-25 (SEQ ID NO: 31), 31-50 (SEQ ID NO: 18),

61-80 (SEQ ID NO: 21), 82-96 (SEQ ID NO: 32); 8297 (SEQ ID NO: 34), 82-98 (SEQ ID NO: 35), 82-100 (SEQ ID NO: 30), 82-100 [100P] Y (SEQ ID NO: 46),

83-100 (SEQ ID NO: 37), 83-101 (SEQ ID NO: 38),

84-97 (SEQ ID NO: 39), 84-100 (SEQ ID NO: 40),

85-100 (SEQ ID NO: 41), 86-105 (SEQ ID NO: 42),

87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), 88-100 (SEQ ID NO: 44), 88-99 (SEQ ID NO: 45), 111-135 (47 122-140 (SEQ ID NO: 48), 139-170 (SEQ ID NO: 49), 141-160 (SEQ ID NO: 28), 142-166 (SEQ ID NO: 50), 142-168 (SEQ ID NO: 51) 146-160 (SEQ ID NO: 52), and 153-170 (SEQ ID NO: 53).

more preferably peptides 13-25 (SEQ ID NO: 31), 87-99 (SEQ ID NO: 43), 87-99 (SEQ ID NO: 36), 82-100 (SEQ ID NO: 36), 30), 82-100 [100P> Y] (SEQ ID NO: 46), each as shown in Figure 14. Preferred portions or preferred modifications of these peptides preferably have similar or higher T-cell activity in the same or greater percentage of the patients tested and / or have similar or greater therapeutic efficacy in the methods of the invention than the parent peptide, from which the modified peptide is derived.

The present invention provides therapeutic compositions comprising at least one peptide derived from a myelin antigen having T cell activity, or a combination of peptides derived from a myelin antigen, each having T cell activity, and a pharmaceutically acceptable carrier or diluent. . Preferred therapeutic compositions contain a sufficient percentage of myelin antigen T cell activity such that, when administered to a patient with multiple sclerosis within the therapeutic range, preferably in a non-immunogenic form, they are capable of limiting the myelin-specific autoantigen immune response to such antigen-specific immune responses. subjects in the human population. Hereinafter, the term "limitation" is intended to mean, without limiting itself, the prevention of the onset of symptoms of the disease, the reduction, reversal or reversal of the symptoms of multiple sclerosis due to antigen-specific immune response to MBP or other myelin autoantigens. alleviation. Stopping development can be characterized by (a) a shorter period of active disease or aggravation, (b) less severe symptoms or disability, (c) delaying the progression of the disease when the underlying health condition does not decline rapidly, (d) active disease. (e) less relapse or worsening and / or slowing or stopping the progression of the lesion load shown by MRI • ··· ····. The Extended Disability Status Scale (EDSS) rating system and the Neurological Rating Scale are other tools used by professionals in the relevant field. Further, the term "advanced condition" means any point above the pure clinical symptoms of a manifest disease, whether the disease is relapsing remitting multiple sclerosis, chronic progressive multiple sclerosis, multiple sclerosis, or primary progressive multiple sclerosis. In addition to the definition, the term advanced state may include acute phase (s), remission (s), and aggravation (s). Hereinafter, the term acute phase means ongoing attack, acute illness and aggravation, which may be used interchangeably. As used hereinafter, these terms generally refer to a condition in which a subject suffering from a disease, whether diagnosed or not, exhibits active symptoms or signs generally recognized by one of skill in the art as being associated with a specific immune response characteristic of multiple sclerosis. . A relapse term report is an acute phase following remission. Aggravation, when properly applied in the context, can also be interpreted as new and worsening symptoms or signs. Symptoms is a term used to denote the disease in which the patient is suffering. The term "signs" means the signs observed or measured by the diagnostician. However, the · ··· ·· ♦ · symptoms and signs may be used interchangeably, unless otherwise indicated.

Preferably, the therapeutic compositions of the present invention comprise a peptide or a modified peptide or peptide analogue comprising at least one T-cell epitope, and a pharmaceutically acceptable diluent or carrier. These compositions may advantageously comprise an MBP peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3),

MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5),

MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7),

MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9),

MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12), MBP-3.1 (SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15), but more preferably the MBP peptide is selected from the group consisting of MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 14). and MBP-5 (SEQ ID NO: 15), and more preferably, the MBP peptide is MBP-4 (SEQ ID NO: 14).

SEQ ID NO: 2).

The compositions of the invention may contain at least two peptides (i.e., a physical mixture of at least two peptides) and each peptide has T-cell activity and preferably contains at least one T-cell epitope from a myelin autoantigen such as MBP. These compositions may be administered in the form of a therapeutic composition with a pharmaceutically acceptable acceptable carrier or diluent. A therapeutically effective amount of one or more of these compositions may be administered simultaneously or sequentially to a patient with multiple sclerosis. Preferred compositions contain at least one, preferably at least two, of the following peptide residues: MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 2) 5th

MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 9) ), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12), MBP-3.1

SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP5 (SEQ ID NO: 15), as shown in Figure 2, are more preferably selected from the group consisting of the following peptides:

MBP-1.1 (3rd SEQ ID NO: MBP-1.2 (# 4 sequence), MBP-2.1 (6th SEQ ID NO: MBP-2.2 (# 7 sequence), MBP-2.3 (8th SEQ ID NO: MBP-2.4 (# 9) sequence), MBP-2.5 (10 . SEQ ID NO: , MBP-2.6 (11.számú sequence), MBP-3.1 13th SEQ ID NO: MBP-4 (14 . SEQ ID NO

MBP-5 (SEQ ID NO: 15), but more preferably selected from the group consisting of MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 14) ) and MBP-5 (SEQ ID NO: 15). In addition, the compositions of the present invention may further comprise peptides derived from MBP having amino acid numbering. corresponds to the numbering of the human MBP protein shown in Figure 1 and has the amino acid sequence shown in Figure 14: 13-25 (Figure 31).

31-50 (SEQ ID NO: 18), 61-80 (SEQ ID NO: 21);

f ··· (SEQ ID NO: 32); 82-96 (SEQ ID NO: 32); 82-97 (SEQ ID NO: 34), 82-98 (SEQ ID NO: 35), 82-100 (SEQ ID NO: 30).

82-100 [100P> Y] (SEQ ID NO: 46), 83100 (SEQ ID NO: 37), 83-101 (SEQ ID NO: 38), 8497 (SEQ ID NO: 39), 84-100 (SEQ ID NO: 40) 85100 (SEQ ID NO: 41), 86-105 (SEQ ID NO: 42), 8799 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), 88-100 (SEQ ID NO: 36) SEQ ID NO: 44), 88-99 (SEQ ID NO: 45),

111-135 (SEQ ID NO: 47), 122-140 (SEQ ID NO: 48),

139-170 (SEQ ID NO: 49)), 141-160 (SEQ ID NO: 28), 142-166 (SEQ ID NO: 50), 142-168 (SEQ ID NO: 51), 146-160 (SEQ ID NO: 52) , and 153-170 (SEQ ID NO: 53), more preferably, the following peptides include 1325 (SEQ ID NO: 31), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36). ), 82-100 (SEQ ID NO: 30),

82-100 [100P> Y] (SEQ ID NO: 46). Preferably, the compositions of the present invention comprise at least two peptides, at least one of which is MBP-4 (SEQ ID NO: 14), and at least one peptide selected from the group consisting of:

MBP-1 (2nd SEQ ID NO: MBP-1.1 (3rd No. chair- vencia), MBP-1.2 (4th SEQ ID NO: , MBP-2 (5th No. chair- vencia), MBP-2.1 (6th SEQ ID NO: MBP-2.2 (7th No. chair- vencia), MBP-2.3 (8th SEQ ID NO: MBP-2.4 (9th No. chair-

vencia), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12), MBP-3.1 (SEQ ID NO: 13), and MBP-5 (SEQ ID NO: 15) SEQ ID NO.

and additionally contain at least one •• S · 4

below, the MBP- from peptides as described Wow 14th Figure 4-1 shows: 13-25 (31st SEQ ID NO: 31-50 (18th SEQ ID NO: 61-80 (21st SEQ ID NO: 82-92 (32. SEQ ID NO: 82-96 (33. SEQ ID NO: 82-97 (34th SEQ ID NO: 82-98 (35th SEQ ID NO: 82-100 (30. SEQ ID NO: 82-100 [100P> Y] (SEQ ID NO: 46), 83-

100 (SEQ ID NO: 37), 83-101 (SEQ ID NO: 38), 8497 (SEQ ID NO: 39), 84-100 (SEQ ID NO: 40), 85100 (SEQ ID NO: 41), 86-105 (SEQ ID NO: 42). 8799 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36),

88-100 (SEQ ID NO: 44), 88-99 (SEQ ID NO: 45),

111-135 (SEQ ID NO: 47), 122-140 (SEQ ID NO: 48),

139-170 (SEQ ID NO: 49)), 141-160 (SEQ ID NO: 28), 142-166 (SEQ ID NO: 50), 142-168 (SEQ ID NO: 51), 146-160 (SEQ ID NO: 52) , and 153-170 (SEQ ID NO: 53), more preferably, the following peptides include 1325 (SEQ ID NO: 31), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36). ), 82-100 (SEQ ID NO: 30),

82-100 [100P> Y] (SEQ ID NO: 46).

Preferred compositions of the invention include the following peptides: MBP-1 (SEQ ID NO: 2); MBP-2 (5.

SEQ ID NO: 2); MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14).

SEQ ID NO: 15) and MBP-5 (SEQ ID NO: 15);

MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6),

MBP-4 (SEQ ID NO: 12) and MBP-5 (SEQ ID NO: 15);

MBP-1.1 (SEQ ID NO: 3), MBP-2 (SEQ ID NO: 5),

MBP-4 (SEQ ID NO: 12) and MBP-5 (SEQ ID NO: 15);

··· {· ♦ ··

MBP-1 (SEQ ID NO: 2), MBP-2.1 (SEQ ID NO: 6),

MBP-4 (SEQ ID NO: 14) and MBP-5 (SEQ ID NO: 15);

MBP-1 (SEQ ID NO: 2), MBP-2 (SEQ ID NO: 5), MBP-4

(14th No. ) and MBP-5 (15th: MBP-1 .1 (3 . SEQ ID NO: MBP-2 MBP-4 (14th SEQ ID NO MBP-5 MBP-1 .1 (3 . SEQ ID NO: MBP-2 MBP-4 (14th SEQ ID NO: 2); MBP-1 (2nd SEQ ID NO: MBP second MBP-4 (14th SEQ ID NO: 2); MBP-1 .1 (3 SEQ ID NO: , MBP- MBP-4 (14th SEQ ID NO: 2); MBP-1 .1 (3 . SEQ ID NO: MBP-2 MBP-5 (15th SEQ ID NO: 2); MBP-1 .1 (3 . SEQ ID NO: MBP-2 MBP-3 (12th SEQ ID NO: 2); MBP-1 (SEQ ID NO: 2), and chosen peptide: MBP-2 (Figure 5). No. No. ), MBP-2.2 (Figure 7). No.

MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10);

MBP-2.6 (SEQ ID NO: 11);

MBP-1.1 (SEQ ID NO: 3) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11);

·· · »» »• * · ι ···· • * ·. · '

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11);

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2); or MBP-2.1 (SEQ ID NO: 3);

MBP-1.1 (SEQ ID NO: 3), MBP-4 (SEQ ID NO: 14), and one. peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46),

87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14;

MBP-1.1 (SEQ ID NO: 3) and MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP -2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each shown in Figure 2;

MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P] Y (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43) 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14;

MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and

MBP-4 (SEQ ID NO: 141), as well as a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82-1. · - ·

100 [100P> Y] (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14;

MBP-1.1 (SEQ ID NO: 3), MBP-3 (SEQ ID NO: 12),

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP2 .5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each shown in Figure 2.

The present invention further provides a method of treatment comprising administering a combination of therapeutically effective peptides as a single treatment event. This combination of peptides may be administered simultaneously or sequentially in the form of therapeutic compositions containing either only one peptide or multiple peptides. Such a treatment is not necessarily a physical mixture of more than one peptide, but includes a combination of peptides administered simultaneously or sequentially in a single treatment event. Preferred combinations of peptides (in the form of one or more formulations which may contain one or more peptides) that can be administered simultaneously or sequentially in a single treatment event include the following combinations of peptides:

MBP-1 (SEQ ID NO: 2); MBP-2 (SEQ ID NO: 5); MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14) and MBP-5 (SEQ ID NO: 15);

·· · »-) · ·» ·· ·· «·. · · '* · * *

MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6),

MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 12), and

MBP-5 (SEQ ID NO: 15);

MBP-1.1 (SEQ ID NO: 3), MBP-2 (SEQ ID NO: 5),

MBP-4 (12. . SEQ ID NO: and MBP-5 (Figure 15). SEQ ID NO: 2); MBP-1 (2nd SEQ ID NO: , MBP-2.1 (6. SEQ ID NO: MBP-4 (14th , SEQ ID NO: and MBP-5 (Figure 15). SEQ ID NO: 2); MBP-1 (2nd SEQ ID NO: MBP-2 (SEQ ID NO: 5), MBP-4

(# 14) ) and MBP-5 (SEQ ID NO: 15); MBP-1.1 (3rd . SEQ ID NO: MBP-2.1 (# 6 sequence), MBP-4 (14. SEQ ID NO MBP-5 (SEQ ID NO: 15); MBP-1.1 (3rd . SEQ ID NO: MBP-2.1 (# 6 sequence), MBP-4 (14. SEQ ID NO: 2); MBP-1 (2. SEQ ID NO: MBP-2.1 (# 6 sequence), MBP-4 (14. SEQ ID NO: 2); MBP-1.1 (3rd SEQ ID NO: MBP-2 (# 5 sequence), MBP-4 (14. SEQ ID NO: 2); MBP-1.1 (3rd . SEQ ID NO: MBP-2.1 (# 6 sequence), MBP-5 (15. SEQ ID NO: 2); MBP-1.1 (3rd . SEQ ID NO: MBP-2.1 (# 6 sequence),

MBP-3 (SEQ ID NO: 12);

MBP-1 (SEQ ID NO: 2) and selected peptide: MBP-2 (SEQ ID NO: 5), MBP-2.2 (SEQ ID NO: 7), MBP-2.4 (SEQ ID NO: 9 from a group of ), MBP-2.1 (6.

), MBP-2.3 (Figure 8).

sequence), MBP-2.5 (10.

MBP-2.6 (SEQ ID NO: 11);

··· · ··· 4 • 4 • · • · · 4

MBP-1.1 (SEQ ID NO: 3) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11);

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11);

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2); or MBP-2.1 (SEQ ID NO: 3);

MBP-1.1 (SEQ ID NO: 3), MBP-4 (SEQ ID NO: 14), and one. peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46),

87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14;

MBP-1.1 (SEQ ID NO: 3) and MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of MBP-2.2

(7th No. sequence), MBP-2.3 (# 8 ), MBP-2.4 (9th No. sequence) , MBP-2.5 (# 10) ), MBP-2.6 (11th .számú sequence) , each is shown in Figure 2;

MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and

MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P> Y] (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43) cia), 87-99 [91K> A] (SEQ ID NO: 36), each of which is illustrated in SEQ ID NO: 14;

FIG.

MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15) and MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P> Y] (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14;

MBP-1.1 (SEQ ID NO: 3), MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP2 .3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each shown in Figure 2.

In addition, preferred formulations and preferred combinations of MBP peptides, which may be administered simultaneously and / or sequentially, may include the compositions and combinations described above and may include at least one peptide comprising a T-cell epitope derived from myelin oligodendrocyte protein (MOG). , which is thought to be one of the autoantigens involved in multiple sclerosis [Lebar et al., J. of

Immunol. 116; 1439-1446 (1976); Lebar and mtsai: J. Immunol. 66 423-443 (1986); Linington and Lassman: Neuroimmunol. 17, 61-69 ι (1987) ; Lassman and al Neuropathol. (Béri) 75, 566-576 (1988); Hedgehog and mtsai: J Immunol. 146 1490-1495 (1991)]. From MOG from T-

Peptides containing Acta ···· ···· epitopes are disclosed in USSN 08 / 116,824, filed September 3, 1993, and USSN 08 / 300,811, filed September 1, 1994 (which are incorporated herein by reference). ) and which are expected to be effective in the treatment of multiple sclerosis when used with the aforementioned formulations and. administered with the following MBP T-cell epitope-containing peptide combinations of the present invention:

Human MOG 1-13 (SEQ ID NO: 54)

GQFRVIGPRHPIR

Human MOG 103-115 (SEQ ID NO: 55)

HSYQEEAAMELKV

Human MOG 1-121 (SEQ ID NO: 56)

GQFRVIGPRHPIRALVGDEV

ELPCRTSPGKNATGMEVGWY

RPPFSRVVHLYRNGKDQDGD

QAPEYRGRTELLKDAIGEGK

VTLRIRNVRFSDEGGFTCFF

RDHSYQEEAAMELKVEDPFYW

The present inventors identified additional epitope-containing peptides of MOG by analysis similar to that described above and described in Example 1 (unpublished data). These peptides are:

Human MOG 1-20 (SEQ ID NO: 57)

GQFRVIGPRHPIRALVGDEV;

Human MOG 11-30 (SEQ ID NO: 58) ··· · ····

PIRALVGDEVELPCRISPGK;

Human MOG 21-40 (SEQ ID NO: 59)

ELPCRISPGKNATGMEVGWY;

Human MOG 31-50 (SEQ ID NO: 60)

NATGMEVGWYRPPFSRWHL;

Human MOG 141-160 (SEQ ID NO: 61)

TVGLVFLCLQYRLRGKLRAE;

Human MOG 151-170 (SEQ ID NO: 62)

YRLRGKLRAEIENLHRTFDP;

Human MOG 161-180 (SEQ ID NO: 63)

IENLHRTFDPHFLRVPCWKI; and

Human MOG 199-218 (SEQ ID NO: 64)

YNWLHRRLAGQFLEELRNPF.

The present invention further provides modifications or analogs (as discussed above) of MOG peptides containing the above-mentioned T-cell epitope having similar or greater T-cell activity than the parent peptide from which the modified or analog protein is derived.

It is believed that peptides containing both MOG and MBP T-cell epitopes, their modifications, analogs and peptidomimetics based thereon, and combinations of such peptides, which can be administered simultaneously or sequentially, have the advantage to maximize the limiting effect on MBP- and MOG-specific T cells involved in multiple sclerosis. Thus, the range of T cells that may be involved in the autoimmune response to MBP or MOG that may contribute to the clinical appearance of multiple sclerosis ··· · ···· (demyelination) can be targeted to enhance the ability of the compounds of the invention and therapeutic effect. Similarly, peptides containing a T-cell epitope derived from other myelin antigens that function as autoantigens in multiple sclerosis (e.g., proteolipid protein (PLP) and myelin-associated glycoprotein (MAG)) may be suitable in the compositions and methods of the invention.

The therapeutic / prophylactic treatment method of the present invention (which results in reversing, preventing, or delaying the symptoms of an attack by an autoantigen, or reducing, stopping, or ameliorating the symptoms of an attacking autoantigen, i.e., an autoantigen-specific immune response). means administering a therapeutic composition of the invention in the form of a non-immunogenic composition of the invention comprising at least one isolated peptide derived from an autoantigen responsible for the condition to be treated (i.e., MBP, MOG, PLP, MAG). Although not bound by theory, it is believed that the following are true of a therapeutic composition of the invention: a) may cause T-cells to be unresponsive to appropriate T cell subpopulations and thus be inactive for the attacking antigen; stimulating the immune response (by anergy or apoptosis) upon contact of the attacking protein with the antigen; b) modify the lymphokine secretion profile compared to contact with the attacking autoantigen; (c) cause T cell subpopulations that are normally involved in responding to the attacking antigen to be withdrawn from the normal site of contact to the site of administration (this redistribution of T cell subpopulations may attenuate or reduce the immune system of an individual). the ability to stimulate a normal immune response at the site of contact with the attacking antigen, which may result in the disappearance or reversal of symptoms, d) induction of T-cell suppressor cells, or e) induction of suppressor cells by an inactive antigen.

The highly purified and isolated peptides prepared as above may be formulated as human therapeutic formulations of the present invention. When a therapeutic composition of the invention is to be administered by injection (i.e., subcutaneous injection, intravenous injection), it is preferred that the highly purified peptide is dissolved in an aqueous solution at a pharmaceutically acceptable pH (i.e., pH 4-9). so that the composition is liquid and easy to inject. Preferably, the composition further comprises a pharmaceutically acceptable carrier. Hereinafter, a pharmaceutically acceptable carrier is any and all fillers, solvents, dispersants, coatings, antibacterial and antifungal agents, toxicity agents, absorption delaying or enhancing agents, surfactants, micelle-forming agents, and the like. Lipid, liposome, and liquid complexing agent, stabilizing agent, and the like. The use of such media and agents as pharmaceutically acceptable substances is known to those skilled in the art. Unless any conventional media or agent is incompatible with the active ingredient, their use in therapeutic formulations should be considered. Additional active compounds may also be included in the compositions.

As discussed above, for the purposes of injection, the therapeutic compositions of the present invention are preferably sterile aqueous solutions prepared by incorporating the active ingredient (i.e., one or more highly purified and isolated peptides, as described above) in a desired amount. in a suitable carrier with an additive or a combination of additives listed below (or above) followed by sterilization by filtration. Preferred pharmaceutically acceptable carriers include at least one excipient, such as sterile water, sodium phosphate, mannitol, sorbitol or sodium chloride, or any combination thereof. Other pharmaceutically acceptable carriers which may be employed include a solvent or dispersant such as water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), a suitable mixture thereof, and vegetable oils. Suitable fluidity can be maintained, for example, by using coatings, which may be lecithin, by maintaining the desired particle size for the dispersions, and by using surfactants. Microorganisms may be inhibited by, for example, the use of various antibacterial and antifungal agents, such as paraben, chlorobutanol, phenol, ascorbic acid, thyrerosol, and the like. Prolonged absorption of injectable formulations may be achieved by incorporating into the formulation an agent that delays absorption, such as aluminum monostearate and gelatin.

The therapeutic compositions of the present invention are preferably sterile, stable under the conditions of manufacture, storage, transport and must be protected from the attack by microorganisms such as bacteria and fungi. A preferred method of preparing a composition that maintains the integrity of the composition (i.e., prevents infection, prolongs storage time, etc.) is by preparing a lyophilized powder formulation of the peptide and a pharmaceutically acceptable carrier (s), which is then may be reconstituted in a pharmaceutically acceptable carrier, such as sterile water, immediately prior to use. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is vacuum drying, freeze-drying or centrifuging, which results in the addition of the active ingredient plus any other desired additive in the form of a previously sterile filtered powder.

As discussed above, a therapeutic composition of the invention may contain more than one isolated peptide. For the administration of many active peptides, one is therapeutic

JP-1 (2nd. No. chair- -1.2 (4. No. chair- 2.1 (6. No. chair- -2.3 (8. No. chair- MBP-2.5 (10th No. , MBP-3 (12th No. , MBP-4 (14th No.

a composition comprising a multipeptide formulation in a form suitable for administration to humans may be required. A multipeptide formulation contains at least two or more isolated peptides having a defined amino acid sequence and capable of limiting an antigen-specific immune response. Any of the formulations described above containing at least two peptides may be suitable for the preparation of a multipeptide formulation. As discussed above, very preferred peptides for use in a multipeptide formulation include at least two of the following peptides: MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4). stem sequence), MBP-2 (sequence number 5), MBP-2.1 (sequence number 6), MBP-2.2 (sequence number 7), MBP-2.3 (sequence number 8), MBP-2.4 (sequence 9) ), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 11), MBP-3.1 (SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15). A specific factor considered in the preparation of a multipeptide formulation is solubility and stability of all peptides in aqueous solution formulation at physiologically acceptable pH. This requires selecting one or more pharmaceutically acceptable diluents and excipients that are compatible with all peptides in the multipeptide formulation. For example, suitable fillers include sterile water, sodium phosphate, mannitol, and phosphate and mannitol. An additional factor to consider in the preparation of a multipeptide preparation is to prevent dimerization of the peptide, if necessary.

Administration of the above-described therapeutic compositions to a subject in a non-immunogenic form using known techniques can be accomplished at dosages and timing of administration that effectively limit the antigen-specific immune response of MBP in a subject treated with multiple sclerosis. An antigen-specific immune response to an antigen associated with a pathological process in a human being can be clinically determined when possible or subjectively determined (i.e., the patient feels as if some of the symptoms associated with the condition to be treated are ameliorated).

The effective amount of the therapeutic compositions of the present invention may vary depending on a variety of factors, such as the susceptibility, age, sex and weight of the individual patient and the ability of the peptide to limit the antigen-specific immune response in a patient. A therapeutic composition of the invention may be administered in a non-immunogenic form by convenient means such as injection (subcutaneous, intravenous, etc.), oral, sublingual, inhalation, transdermal, rectal or any combination of the routes of administration, which are designed to enhance therapeutic efficacy or by any other route known to administer therapeutic agents. It may be desirable to simultaneously or sequentially administer a therapeutically effective amount of one or more therapeutic compositions of the invention to a patient. Each such formulation, administered simultaneously or sequentially, may contain only one peptide or may comprise a multipeptide formulation as described above.

In order to administer a peptide or peptide composition other than parenterally, it may be necessary to coat the peptide or co-administer with a substance that prevents inactivation. For example, the peptide composition may be administered with enzyme inhibitors or in liposomes. Enzyme inhibitors include the pancreatic trypsin inhibitor, diisopropyl fluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water CGF emulsions and standard liposomes [Strejan et al., J. Neuroimmunol. 27 (1984)]. If a peptide is suitably protected as above, the peptide may be administered orally, for example, with an inert diluent or an assimilable edible carrier. The peptide composition and other additives may be enclosed in a hard or soft gelatin capsule, compressed into tablets, or incorporated directly into the patient's diet. For oral therapeutic applications, the active ingredient may be used in admixture with excipients and may be in the form of ingestible tablets, orodispersible tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, and the like. Such formulations should contain at least 1% of the active ingredient. The percentage composition of the compositions may, of course, vary, but may conveniently be between 5 and 80% of the weight of the unit. In such therapeutically useful formulations, the amount of active ingredient is sufficient to provide a suitable dosage. Preferred compositions of the present invention are prepared so that an oral dosage unit contains from about 10 µg to about 200 mg of the active ingredient. Tablets, troches, pills, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch or gelatin; fillers such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, gaul oil or cherry aroma. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or otherwise alter the physical presentation of the unit dosage form. For example, tablets, lozenges, or capsules may be coated with shellac, sugar, or both. A syrup or elixir may contain an active ingredient, sucrose as a sweetener, methyl and propyl barabens as a preservative, a dye and a flavoring agent such as cherry or orange flavor. Of course, all the materials used to make any unit dose should be of pharmacopoeial quality and the amount of atoxic substance used. In addition, the active ingredient may be incorporated into sustained release formulations and formulations.

For injection (s) (subcutaneous, intravenous, intramuscular, intraperitoneal) of one or more therapeutic compositions of the present invention, preferably 1-3 gg, more preferably about 20 gg-1.5 mg, more preferably about 50 gg-750 gg, or even more preferably about 75-750 gg of the active component (peptide) can be administered in a unit dose. Depending on the mode of treatment described below, doses up to 1500 µg or higher may be used. It is particularly preferred that parenteral formulations be administered in unit dosage form for ease of administration and uniformity of dosage. The term unit dose, as used herein, refers to physically distinguishable units that can be used as unit dose for the patient to be treated; each unit containing a predetermined amount of active ingredient calculated to produce the desired therapeutic effect with the desired pharmaceutically acceptable carrier. The specification of the novel unit dosage forms of the present invention is defined by: a) the unique characteristics of the active ingredient and the therapeutic effect to be achieved; and b) the limitations of the science of mixing, mixing such active ingredients in human therapy.

The dosage regimen may be adjusted to provide the optimum prophylactic or therapeutic response. For example, many divided doses may be administered for days, weeks, months, months, months, months, or years, or incrementally increased or decreased after each injection, as determined by the need of the therapeutic situation. . In a preferred therapeutic regimen, the subcutaneous injections of the therapeutic compositions are administered once daily in an acute phase and then every other day during remission throughout the lifetime of the patient suffering from the disease. Alternatives include weekly, monthly, or other injections. The dose may remain constant with each injection or may decrease or increase with each injection. A continuous, lifelong treatment may be most desirable. Alternatively, after an initial treatment period, a booster injection may be given every three months or every year, which may be a single injection or a series of injections similar to the initial treatment.

Because patients with relapsing, intermittent multiple sclerosis, primary progressive multiple sclerosis, multiple sclerosis, and chronic progressive multiple sclerosis respond to a highly individualized immune system response, a cautious and variable dose regimen should be developed. First, the admission evaluation of the patient who is present must be performed. Complex examinations include examination of visual problems, eye vibration, dysarthria, reduced sensation of vibration and position perception, ataxia and intentional tremor, weakness or paralysis of one or more limbs, tendency to cramps, and bladder problems. Those skilled in the art will use accepted methods, such as EDSS, Neurological Rank Scale, or similar devices known in the art, as well as previously reported disease indicators to determine a baseline. , from which any deviation, including progression of limitation, but preferably limitation, can be measured. Although there is no typical acute or remitting phase of multiple sclerosis, certain syndromes may develop which may be controlled by the experienced practitioner. As mentioned above, the incidence of flare-ups or acute phases is higher in the first 3-4 years of the disease, but the first attack may not be followed by another observable attack for 10-20 years (although the development of lesions detected by MRI alone gives a different clinical picture ). During typical episodes, symptoms may worsen over a period of a few days to two to three weeks and then worsen. Improvement is usually rapid within a few weeks, though over time it may take several months.

Multiple sclerosis is a chronic condition and continuous treatment should be considered. Long-term treatment may be the most effective treatment to prevent the progression of disease and inertia. A dose-based regimen administered every other day or at least once a week or once a month may be appropriate. Reasonable modifications are within the skill of the art. Intervention in the onset of an attack is an important factor in effective treatment.

The severity of the attack should be evaluated in the acute patient. An initial injection may be given at the onset of the acute phase ···· ····. The obvious benefit may be that treatment is initiated as early as possible in the acute phase. If desired, this treatment may be combined with concomitant interferon, steroid and / or other treatments, particularly those designed to reduce inflammation. The patient is observed daily after the first treatment, preferably injection. We recommend that additional treatments be given every other day, or at least every third day, in the acute phase. As with any medication, your doctor may adjust the dose based on the clinical changes that may be needed. All such considerations are within the skill of the skilled artisan, using the recommended dose regimen and dose amounts as guidance. A dose in the range of 75-750 pg per dose provides the clinician with a large margin of maneuver (and not an unreasonable amount). Options include, but are not limited to, daily treatment in the acute phase, followed by remission management as described above. This does not in any way preclude the possibility of using more or more frequent doses if the physician determines that intervention is required.

The present invention describes that advanced sclerosis can be treated with the compositions and methods of the invention. Compositions containing at least one cellular activity and containing a peptide derived from a myelin autoantigen are useful for the treatment of advanced sclerosis. MBP peptides, MOG peptides and combinations thereof are suitable for the treatment of advanced sclerosis. As described above, these peptides include, but are not limited to, MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9)

sequence) MBP-2.5 (10th No. sequence), , MBP-2.6 (11 .számú sequence) , MBP-3 (12th No. sequence), MBP-3.1 13. No. sequence) , MBP-4 (14th No. sequence) , MBP-5 (15. No. sequence) , 13-25 (31st No. sequence) , 31-50 (18. No. sequence) , 61-80 (21st No. sequence) , 82-92 (32. No. sequence) ; 82-96 (33rd No. sequence) ; 82-97 (34. No. sequence) , 82-98 (35th No. sequence), 82-100 (30. No. sequence) , 82-100 [100P> Y] (No. 46) sequence), 83-100 (No 37) sequence), 83-101 (# 38) sequence), 84-97 (# 39) sequence), 84-100 (# 40) sequence), 85-100 (41 and z am sequence), 86-105 (# 42) sequence), 87-99 (# 43) sequence), 87-99 [91K> A] {36. SEQ ID NO:

88-100 (SEQ ID NO: 44), 88-99 (SEQ ID NO: 45),

111-135 (SEQ ID NO: 47), 122-140 (SEQ ID NO: 48),

139-170 (SEQ ID NO: 49), 141-160 (SEQ ID NO: 28), 142-166 (SEQ ID NO: 50), 142-168 (SEQ ID NO: 51), 146-160 (SEQ ID NO: 52) , and 153-170 (SEQ ID NO: 53), preferably MBP-1.1 (SEQ ID NO: 3), MBP2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 14) and SEQ ID NO: 87 (SEQ ID NO: 36,

MBP-5 (SEQ ID NO: 15), 13-25 (SEQ ID NO: 31).

(SEQ ID NO: 43), 87-99 [91K> A]

82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (ref. 46).

) and peptides derived from human MOG: Human MOG 1-13 (SEQ ID NO: 54)

GQFRVIGPRHPIR

Human MOG 103-115 (SEQ ID NO: 55)

HSYQEEAAMELKV

Human MOG 1-121 (SEQ ID NO: 56)

GQFRVIGPRHPIRALVGDEV

E L PCRT S PGKNATGMEVGWY

RPPFSRWHLYRNGKDQDGD

QAPEYRGRTELLKDAIGEGK

VTLRIRNVRFSDEGGFTCFF

RDHSYQEEAAMELKVEDPFYW

Human MOG 1-20 (SEQ ID NO: 57)

GQFRVIGPRHPIRALVGDEV;

Human MOG 11-30 (SEQ ID NO: 58)

PIRALVGDEVELPCRISPGK;

Human MOG 21-40 (SEQ ID NO: 59)

EL PORIS PGKNATGMEVGWY;

Human MOG 31-50 (SEQ ID NO: 60)

NATGMEVGWYRPPFSRWHL;

Human MOG 141-160 (SEQ ID NO: 61)

TVGLVFLCLQYRLRGKLRAE;

Human MOG 151-170 (SEQ ID NO: 62)

YRLRGKLRAEIENLHRTFDP;

s *** · • · ·

Human MOG 161-180 (SEQ ID NO: 63)

IENLHRTFDPHFLRVPCWKI; and

Human MOG 199-218 (SEQ ID NO: 64)

YNWLHRRLAGQFLEELRNPF.

The present inventors have for the first time made the surprising discovery that intervention in the middle of an on-going attack may improve the condition of a patient treated in accordance with the present invention. The minimum is that such treatment does not worsen the patient's condition. The authors further demonstrate that interventions during remission limit the immune response and that the condition is not activated as a result of any such intervention. Thus, not only can the intervention produce an improvement, but it can also be completely safe if the method of the present invention is used. Using the above described EAE model, the present inventors demonstrate that repeated intravenous administration of Acl-11 (SEQ ID NO: 65) immunodominant MBP peptide can successfully treat total MBP protein-induced EAE. Once successfully treated (shown by T cell reactivity) with a natural peptide (an unsubstituted peptide derived from the natural sequence using the methods described to identify T cell epitope-containing peptides from a protein autoantigen), appropriately modified peptides can be used. by comparing the binding activity of the modified peptide with that of the native peptide. Modified peptide with lower binding activity than natural peptide • s ···:

may be a suitable candidate for use in a therapeutic composition of the present invention. Assays that can be used to determine binding affinity can be identified by reference to U.S. Patent Application Serial No. 08 / 300,811, filed September 1, 1994, which is incorporated herein by reference. For example

Acl-11 (SEQ ID NO: 65) treatment was found to be successful. Acl-11 (SEQ ID NO: 65) therapy is then compared to treatment with Acl-II [4Y] (SEQ ID NO: 67) peptide (an analog of Acl-11 (SEQ ID NO: 65)), which has greater affinity and stability. binds to A ^u A ^u [Wraith, DC et al; Fairchild, PJ et al., Int. Immunol. 5, 1151 (1993)]. Applicants have surprisingly found that Acl-II [4Y] (SEQ ID NO: 67) is one hundred times less effective than Acl-11 (SEQ ID NO: 65) and has a longer therapeutic effect, indicating that selected modified peptides may also be used in the therapeutic composition. The present inventors have further demonstrated that the investigated Acl-II [4Y] (SEQ ID NO: 67) peptide in vivo forms stable peptide-MHC complexes in treated mice. This shows that modified peptides that form in vivo stable peptide-MHC complexes are very likely to be suitable peptides for human treatment as their potency can be greatly increased by conservative amino acid exchanges [Karin et al., J. Exp. Med. 2227-2237 (1994). The present inventors have also discovered that the MBP peptide analogue Acl-II [4Y] (SEQ ID NO: 67) reverses the ongoing process.

paralysis when administered in the acute phase of UAE and prevents relapse when administered during remission. This indicates that the selected modified peptides and the selected peptide analogs reverse active symptoms and prevent relapses in patients with multiple sclerosis.

In another model of human disease, the present inventors initiated intravenous peptide treatment after the onset of EAE and in an acute phase. Surprisingly, this therapy reverses the current disease when administered during the acute phase. This observation is the first of its kind. In experiments previously conducted by others, peptide therapy was initiated when mice in the treatment group did not show any signs of EAE before immunization or at the latest onset of the disease. For example, in Gaur et al., A group of 13 mice were treated with a disease-provoking amount of MBP. If only one of the 13 mice showed minimal signs of disease, i.e., one mouse had a clinical score of 1 (see Example 2 for a discussion of the clinical evaluation of mice), then seven mice from the group were injected intraperitoneally with MBP peptide mixture. The other six mice, one of which is an animal showing signs of disease, received no further treatment. In this case, in mice that do not show clinical signs of disease, Gaur et al. Are unable to draw useful conclusions from their data. The presence of a low clinical score of 1 in a mouse cannot be interpreted as an active pathological process in any other mouse. for this

accordingly, Gaur et al. describe treatment prior to the onset of the disease, or more particularly, before the clinical symptoms of the disease occur. In contrast, in order to be well used in the clinical setting used to treat multiple sclerosis in humans, a therapy must be effective even if it is initiated well after the onset of the disease. As a model of appropriate human therapy, the inventive mice of the present invention were treated with 250 nM Acl-II [4Y] (SEQ ID NO: 67) peptide and treatment was initiated after the acute phase of EAE. Figure 5 shows the effect of this therapy. Therapy was initiated individually in each mouse as soon as the mouse showed initial signs of EAE. After developing EAE, mice were assigned to the Acl-II [4Y] (SEQ ID NO: 67) peptide therapy group or one of the three control groups (no treatment, PBS, or OVA 323-337 A ^u A ^u- binding peptide (SEQ ID NO: 70) Figure 9 shows that treatment of ongoing EAE with Acl-II [4Y] (SEQ ID NO: 67) results in drastic changes in disease scores within 48 hours after peptide injection. EAE almost disappeared from these treated mice on the fourth day after disease onset, and the effects of an 18-day peptide therapy continued.

Another surprising development is that the present inventors have discovered that peptide therapy initiated in the remission phase of EAE prevents relapses. Using EAE as a model for human disease, as noted above, recurrent EAE in (PLJ x SJL) FI mice develops with MBP: ···:

after immunization [Fritz, R.B. et al., J. of Immunol.

130: 1024 (1983)]. EAE usually develops 9 to 16 days after immunization and in this model the acute phase of the disease lasts for about 3 to 20 days. Twenty or more percent of mice may die or die during the acute phase, depending on the severity of the disease in the experiment. Most survivors of the acute phase then enter a short remission phase, showing no clinical symptoms for a few days, or showing only very mild clinical symptoms. In some experiments, each mouse goes into remission at about the same time (see Figure 5), but in most cases the length of the acute phase of the disease is much more variable. The remission phase is a first relapse! Phase I followed by the severity of the acute phase of the disease. Subsequently, the surviving mice develop residual chronic paralysis, which persists until the end of the experiment.

In the mouse model, the Acl-II [4Y] (SEQ ID NO: 67) peptide is a very important therapy when it is initiated in the remission phase of EAE. To test the capacity of Acl-II [4Y] (SEQ ID NO: 67) to prevent EAE relapses, mice were observed during the initial period of their paralysis, which lasted 3 to 19 days. As the surviving mice enter the remission period individually (defined as having a clinical score of 1 or 0 for at least two days), they are alternately divided into two groups and intravenous therapy is initiated with 25 nmoles of Acl-II [4Y] (SEQ ID NO: 67). , or as control with PBS. The mice one by one, ....

treated from the second day of their remission phase. Figure 10 shows that intravenous treatment of Acl-II [4Y] (SEQ ID NO: 67) from the onset of the remission phase of EAE drastically reduces the frequency and severity of relapse, indicating that intravenous peptide therapy may be effective, if we start in the late stages of the disease.

The mechanism of intravenous peptide therapy has not been fully elucidated, although it has previously been predicted in several other antigenic systems that intravenous administration of an antigenic peptide prior to immunization will induce antigen-specific non-response in the immune system. As a further indication of the viability of therapeutic intervention in multiple sclerosis patients, the authors of the present invention administered an encephalogenic peptide or peptide analog intravenously and found to reduce in vitro lymphoid proliferation and interleukin-2 production. Mice were treated intravenously with 250 nM MBP Acl-II (SEQ ID NO: 65) prior to immunization with MBP protein. 11a. Figure 10A shows the lymphatic response from these mice on day 10 after immunization. Pre-treatment with immunodominant Acl-11 (SEQ ID NO: 65) MBP peptide prior to immunization without adjuvant will reduce Acl-11 (SEQ ID NO: 65).

In vitro growth T cell response to MBP. Similar results are obtained when the mice are pretreated intravenously with the MBP peptide analogue Acl-II [4Y] (SEQ ID NO: 67) (data not shown). Additionally, Acl-11 MBP (SEQ ID NO: 65)

cia) lymphoid interleukin-2 production in response can be prevented by intravenous pre-treatment with Acl-II [4Y] (SEQ ID NO: 67) (Figure 11b). The results confirm that intravenous pretreatment with Acl-II (SEQ ID NO: 65) or Acl-II [4Y] (SEQ ID NO: 67) induces T-cell non-response to Acl-11 MBP (SEQ ID NO: 65). SEQ ID NO: 2).

Thus, the present inventors have investigated the efficacy of treatment with intravenous MBP peptides and peptide analogs in the treatment of relapsed EAE and made a number of relevant observations. First, and probably most importantly, treating an autoimmune disease with a single autoantigen peptide can be effective, even if it occurs after the symptoms of the disease appear. Specific disease symptoms used to evaluate mice are described in the examples below. An advanced stage of EAE is considered to have an average clinical score of 2 or higher. The results show that intravenous MBP peptides interfere with the encephalogenic activity of auto-aggressively initiated cells, even after the brain-blood barrier is disrupted and lymphocytes are filtered into the central nervous system. It has never happened that the peptides observed activated, exacerbated, or increased the ongoing disease, even temporarily. EAE treated after the onset of acute phase reversed a few days after initiation of therapy, although the treated mice were severely affected at first. Histological studies have confirmed that a clinical response to a peptide ···· ··· · · correlates with a significant reduction in lymphocyte infiltration into the brain and spinal cord. In addition, as discussed below, intravenous administration of Acl-II [4Y] MBP (SEQ ID NO: 67) is effective, even from day 30 after immunization with MBP, in the remission phase of EAE. Thus, once again, it was observed that the initiation of treatment in a seemingly calm phase of the disease did not lead to aggravation, but rather prevented all relapses except the slightest relapses. This result is particularly interesting because there is evidence that recognition of many different MBP epitopes occurs in the late phase of the immune response to MBP and it is believed that these epitopes may contribute to the disease [Lehmann, P.V. et al., Natur. 358, 155 (1992)]. The present invention states that administration of the peptide at a very early stage of the disease may prevent a late immune response to these epitopes. However, it should be noted that a single MBP analogue is effective in preventing relapses when administered after the severe acute phase of EAE is over, if the immune response to MBP and probably other myelin antigen has already advanced.

In the practice of the present invention, the selection of an effective therapeutic agent is preferred and described above. In addition, the present inventors have developed the theory that one of the criteria for selecting the best peptide candidates for natural peptides is that they form in vivo stable complexes with class II MHC, higher T-cell reactivity and MHC-binding activity. Specifically, Applicants have examined the MBP peptide analog which forms in vivo stable complexes with class MH MHC and is more effective in treating EAE than Acl-11 (SEQ ID NO: 65). We have previously shown that Acl-II [4Y] (SEQ ID NO: 67) binds with greater affinity to A ^u A ^u and under in vitro conditions Acl-II [4Y] (SEQ ID NO: 67) and A The complexes formed between ^U A ^U are more stable than those formed between Acl-11 (SEQ ID NO: 65) and A ^U A ^U. Acl-II [4Y] (SEQ ID NO: 67) has also been shown to prevent EAE when inhaled at high doses prior to immunization (Metzler, B., et al., Int. Immunol. 5: 1159 (1993)]. The present invention describes that a modified MBP peptide analog, Acl-II [4Y] (SEQ ID NO: 67), is at least 100-fold more potent therapeutic agent than MBP Acl-11 (SEQ ID NO: 65) and should be administered less frequently. This increased efficacy results in a therapeutic agent that is both more effective and useful in practice. The present inventors have observed that intravenous administration of Acl-II [4Y] (SEQ ID NO: 67) (but not Acl-II [SEQ ID NO: 65]) results in the formation of stable peptide-MHC complexes. The improved efficacy of Ac11 [4Y] (SEQ ID NO: 67) is believed to be associated with the formation of stable peptide-MHC complexes. These complexes can be detected on spleen cells using an MBP Acl-11 (SEQ ID NO: 65) -specific hybridoma within a maximum of ten hours after injection. Accordingly, we believe that the formation of stable peptide-MHC complexes may be a prerequisite for such an efficient peptide. Surprisingly, the in vivo therapeutic effect of Acl-II [4Y] (SEQ ID NO: 67) is present even after peptide-MHC complexes are no longer detectable on spleen cells (see Figures 6a and 9). Peptide-MHC complexes are likely to form antigen-specific functional therapeutic units that exert a long-lasting effect on encephalogenic T cells, and these remain after the complexes are no longer detectable in vivo. It is not known whether such complexes exert their effects peripherally or in the central nervous system. When operating in the central nervous system, complexes can be formed there or cells carrying the complexes migrate through the cerebrovascular barrier.

The present invention provides methods of treating multiple sclerosis comprising administering at least one MBP peptide having T-cell activity in a treatment process, which also comprises an effective amount of interferonβ.

As a result of the work described below, it has been discovered that the combination of at least one peptide derived from a myelin antigen (such as MBP) and IFN-β, when administered in a treatment procedure, has a synergistic effect (Figure 12c), which surprisingly eliminates the clinical symptoms of EAE in mice, and this effect is much greater than the effect when administered alone to alleviate EAE symptoms (Figures 12a-b) and greater than would be expected with peptide and interferon based on a simple summary of its effects.

Because EAE serves as a mouse model for human multiple sclerosis and can be induced by various myelin antigens (e.g., PLP, MBP, MOG), it is expected that a similar effect will be observed in humans. Therefore, the present invention provides a method of treating patients with multiple sclerosis, or people who may be sensitive to the development of multiple sclerosis, comprising administering an effective amount of a composition of the present invention comprising at least one T- derived from a myelin antigen. containing a peptide with cellular activity in a non-immunogenic form, as part of a treatment method that includes administration of interferon-β. Preferred combinations include those of the present invention comprising MBP peptides as described above and MBP peptides in combination with MOG peptides, either concurrently or simultaneously with interferon®.

Administration of a composition of the invention comprising at least one peptide having the T-cell activity of a myelin antigen, in a method of treatment comprising administering interferon, using methods known in the art of administration and dosage size. , with the aim of effectively reducing, eliminating or preventing the symptoms associated with multiple sclerosis. For either peptide or interferon-β79 ············································································································ · The effective amount of the drug, when co-administered in a therapeutic regimen, will vary depending on the factors described above. The active compounds (e.g., MBP peptide or formulations and interferon-β) may be administered by conventional means, such as by injection (subcutaneous, intravenous, etc.), orally, inhalation, transdermally, or rectally, as discussed above. .

For example, injection of, for example, about 1 µg to 3 mg, more preferably about 20 to 500 µg, of a peptide derived from a myelin antigen can be administered in a single dose. Preferably, a unit dose of 100 to 10,000 units of interferon-β may be administered by injection. The dosage ranges of these two compounds may be varied to provide the optimum therapeutic response. For example, interferon-β and a composition of the present invention may be administered at the same time, or preferably at least six hours apart, preferably 12 hours apart, more preferably 24 hours apart. The administration of both the health peptide and interferon-β may continue for several days or weeks, and may be reduced or increased as the therapeutic situation demands.

The present invention provides a novel composition comprising a physical mixture of a T-cell activity peptide derived from a myelin antigen such as MBP or MOG and an interferon-β in a pharmaceutically acceptable carrier or diluent. This composition can be used in a therapeutic treatment of a subject to treat or prevent multiple sclerosis in a subject.

Other autoimmune diseases, such as type I diabetes and rheumatoid arthritis, are considered to be the result of an antigen-specific T cell mediated response to an autoantigen. Different approaches to treating T-cell-mediated autoimmune diseases include administering to a patient whole autoantigens or derived autoantigens containing a T-cell epitope, in order to limit T-cell-mediated T cell-mediated autoantibodies. choose.

In addition to myelin autoantigens, which play a role in multiple sclerosis, a number of antigens (i.e., autoantigens) have been shown to cause disease symptoms in other autoimmune diseases such as diabetes, Graves' disease, muscle wasting, Jopper syndrome, rheumatoid arthritis, : insulin, Rh factor, acetylcholine receptors, thyroid cell receptors, basement membrane proteins, thyroid proteins, ICA-69 (PM-1), glutamic acid decarboxylase (64K or 65K), proteolipid, collagen type,, heat shock protein and carboxypeptidase H ). It is believed that formulations and methods similar to those described above are useful in the treatment of autoimmune diseases such as rheumatoid arthritis, diabetes, muscular dystrophy, Grave's disease, Jopper syndrome, psoriasis and thyroiditis, wherein the disease antigen is a protein antigen.

·· ««!. · _K «*» · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

A number of the above-mentioned autoantigens have been identified and isolated peptides having T cell activity and a defined amino acid sequence, preferably containing at least one T cell epitope and / or inducing T cell non-response or reduced T cell responsiveness. WO 94/07520 discloses peptides believed to be capable of limiting antigen-specific responses to soluble type ΙΙ collagen, a protein believed to play an autoantigen role in rheumatoid arthritis. WO 92/06704 describes methods for identifying peptides of insulin that are thought to contain T cell epitopes and which may be useful in compositions and methods analogous to the present invention for use in the treatment of type I diabetes. . In addition, an antigen or autoantigen that is thought to be responsible for any of the aforementioned diseases can be identified by peptides containing the appropriate T-cell epitope using any of the methods mentioned above and in the examples in which a T-cell epitope containing autoantigen peptides of a protein We identified. Once a peptide containing such a T-cell epitope has been identified for the target autoantigen, these peptides can be used in methods and compositions analogous to those described for the treatment of multiple sclerosis.

The invention is illustrated by the following non-limiting examples.

· »· *> · · ···· * * *« ·

V ·· »·

Example 1

Study of sclerosis tiplex immune response to myelin basic protein and peptides in human population and selection of MBP peptides suitable for therapeutic use

peptide

The peptides were synthesized by standard Fmoc / tBoc chemistry and purified by reverse phase HPLC. Figure 3 shows the MBP peptides used in these assays. The peptide names or amino acid residues are consistent throughout.

Protocol: Analysis of Human PBL for Reactivity with MBP and MBP Peptides

PBLs were purified from fresh peripheral blood samples (approximately 75 cm ³ ) taken from 222 patients with multiple sclerosis using a Ficoll gradient. Microtiter cultures were started with 2 x 10 ⁵ purified human MBP in RPMI 1640 supplemented with 2 x 10 ⁵ PBL per well and 5% human AB serum, penicillin streptomycin and L-glutamine. The cultures were supplemented with interleukin-2 (20 units / ml) and interleukin-4 (5 units / ml) as shown in Figures 6-7. on the sun.

After 11-13 days, the microtiter plates are washed, resuspended in fresh medium and aliquoted into 12 new microtiter wells. Autologous frozen PBLs are added as antigen presenting cells at 5 x 10 ⁵ PBLs per well.

past · · · · · ·

The screening antigens are added in duplicate to the 12 replicate wells from each microtiter culture. Medium is always used as a negative control, and purified human recombinant MBP at a concentration of 10 µg / ml is used as a positive control. Each patient is also tested for reactivity with a maximum of 4 MBP peptides, each at a concentration of 10 µg / L. After 48 hours, the reaction mixtures were pulsed with 0.75 gCi ³ H-thymidine and recovered after 6-16 hours.

Cultures are considered positive for each peptide based on the following criteria: excitation index greater than 3.0, change in cpm greater than or equal to 500, and mean standard error less than change in cpm. In addition, cultures are considered peptide positive for analysis only when they react to both MBP and peptide and when they do not react with more than one overlapping peptide. Reactivity with each peptide was tested in a minimum of 19 and a maximum of 43 patients.

Results:

On average, 6% of the microtiter cultures were positive for MBP reactivity in each patient (range 0-37 positive cultures per patient). At least one microtiter culture was positive for MBP reactivity in 77% of patients, and these patients were considered to be MBP responsive. MBP response showed no association with gender, multiple sclerosis category (RR vs. CP), HLA-DR type, age, or whether the patient was taking Betaserone.

• ·

twenty-membered MBP peptide (Figure 3), which overlaps in 10 amino acids and covers the entire human MBP sequence (18.5 kDa isoform). Two other longer peptides (MBP 83-105 (SEQ ID NO: 5) and MBP 141-165 (SEQ ID NO: 14), Figure 3) were also tested. The reactivity of the MBP peptide is then calculated from the proportion of MBP positive microtiter cultures that have been positive for one of the MBP peptides. Four peptides each caused 10% total MBP reactivity (MBP 11-30 (SEQ ID NO: 2), MBP 81-100 (Figure 23)).

MBP 83-105 (SEQ ID NO: 5) and MBP 141165 (SEQ ID NO: 14)). In addition, reactivity against these peptides could be detected in at least one-third of the MBP-responsive multiple sclerosis patients. In addition, 77% of MBP responsive patients show reactivity to MBP 83-105 (SEQ ID NO: 5) or MBP 141-165 (SEQ ID NO: 14), or both peptides.

Of the four peptides, MBP 141-165 (SEQ ID NO: 14) was found to be the most reactive, accounting for 21% of the total MBP response and found in 64% of the patients responding to the MBP tested. MBP 141-165 (SEQ ID NO: 14) apparently includes T-cell epitopes derived from both MBP 141-160 (SEQ ID NO: 28) and MBP 151-170 (SEQ ID NO: 29), and surprisingly, it exhibits significantly more reactivity than the two twenty-membered peptides. MBP 81-100 (SEQ ID NO: 23) and MBP 83-105 (SEQ ID NO: 5) are very similar and probably similar,

If they do not contain identical T cell epitopes. These correspond to regions previously thought to be related to the HLA-DR2 haplotype. Our results show that both DR2 and non-DR-2 multiple sclerosis patients show good reactivity with these peptides. MBP 11-30 (SEQ ID NO: 2) is an area of peptide reactivity that was previously not thought to be frequently recognized in multiple sclerosis patients.

Each of the other MBP peptides was responsible for less than 5% of the total MBP reactivity and was detected in less than 20% of the MBP reactive patients tested (see Figures 4a and 4b). The highest reactivity in this peptide group was observed with MBP 111-130 (SEQ ID NO: 12), which is responsible for 4.5% of MBP reactivity and is found in 19% of the MBP reactants tested.

Selection of Preferred MBP Peptides

Preferred MBP peptides were selected based on two criteria:

1. Number of multiple sclerosis patients responding to the candidate peptides (at least 75% of the patients responding to the protein antigen recognized by the at least one peptide).

2. T cell response to labeled peptides in multiple sclerosis patients (response to labeled peptides corresponds to 40% of antigen response).

MBP 83-105 (MBP-2 (SEQ ID NO: 5)) and MBP 141165 (MBP-4 (SEQ ID NO: 14)) meet the first criterion (77% of MBP responders recognize one or two of them) ) (see Table 1 below). These two peptides together account for 32% of MBP reactivity (see Table 2 below).

Table 1

Reactivity to ΜΒΡ-2 (SEQ ID NO: 5) and ΜΒΡ-4 (SEQ ID NO: 14): Individual Analysis

The respondent percentage of individuals ΜΒΡ from 2- ΜΒΡ-4 from ΜΒΡ from 2- and / or MBP- 4 with For MBP 11/31 [35.5%] 20/31 [64.5%] 24/31 [77.4%] responders between

Table 2

Reactivity to ΜΒΡ-2 (SEQ ID NO: 5) and ΜΒΡ-4 (SEQ ID NO: 14): Analysis by T-cell line

The MBP posi- curved lines percent MBP positive and MBP-2 MBP positive 141-165 MBP positive and MBP-2 or MBP-4 The MBP posi- 20/184 39/184 59/184 curved lines [10.95%] [21.1%] [32.1%] between

• · · ·

Thus, the addition of MBP 11-30 (SEQ ID NO: 2) meets the criteria, as the three peptides combined represent 42% of MBP reactivity. MBP 111-130 (MBP-3 (SEQ ID NO: 12)) may also be suitable as a preferred peptide for therapeutic use, particularly MBP-1 (SEQ ID NO: 2), ΜΒΡ-2 (SEQ ID NO: 5) ) and ΜΒΡ-4 (SEQ ID NO: 14). MBP 81-100 (SEQ ID NO: 23) appears to be equivalent to MBP 83-105 (SEQ ID NO: 5) and can also be used with other selected peptides.

Example 2

Administration of peptides to mammals for the treatment of EAE as a model for multiple sclerosis

Synthesis of peptides

Peptides were synthesized using an automated peptide synthesizer (ABI 430A Applied Biosciences, Foster City, CA) using standard 9-fluorenylmethoxycarbonyl chemistry. The peptides were purified by high pressure liquid chromatography and the amino acid composition was confirmed. The selected peptide sequences are as follows: MBP Ac-1-11 (SEQ ID NO: 65)

ASQKRPSQRHG; MBP Acl-II [4A] (SEQ ID NO: 66) ASQARPSQRHG;

MBP Acl-II [4Y] (SEQ ID NO: 67) ASQYRPSQRHG; MBP 31-47 (SEQ ID NO: 68) RHRDTGILDSIGRFFSG; Caution 323-339 {69.

SEQ ID NO: 4) ISQAVHAAHAEINEAGR; and Resin 323-337 (SEQ ID NO: 70) ISQAVHAAHAEINEA.

• · ··· · «· ···· · ··· · · · 9 · 9 · 9

9999 9 999 · ··

MBP cleaning

MBP is purified from guinea pig spinal cord (Keystone Biologicals, Cleveland, OH), Smith, M.E. Smith, M.E., J. Neurochem. 16, 83 (1969)]. Briefly, MBP is extracted from the isolated membrane, precipitated with potassium citrate using chloroform and methanol, extracted with acid and lyophilized. SDS-PAGE analysis of this material revealed a major band at the expected molecular weight of 18.5 kDa.

EAE Induction, Evaluation and Peptide Therapy

EAE was induced in F1 mice (PLJ x SJL) purchased from Jackson Laboratory (Bar Harbor, ME). When the mice reach the age of 8-14 weeks, the EAE is 50-100 μg complete

Freund's adjuvant (Gibco Laboratories, Grand Island, NY) supplemented with 400 μg per mouse Mycobacterium tuberculosis H37Ra (Difco Laboratories, Detroit, MI) was induced by emulsified MBP. 200 ng of pertussis toxin (JRH

Biosciences, Lenexa, KS) was administered intravenously at the same time as immunization and 48 hours later. Mice were evaluated for clinical signs using the following scale: 1: tail paralysis; 2: partial paralysis of the hind limb; 3: complete paralysis of the hind limb; 4: paralysis of the first limb; 5: Dying or dead. Mice with a value of 5 are euthanized. After death, mice are excluded from the average cli · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · * · · · · Further calculation of the eigenvalue. The peptides are administered intravenously as described in the Examples below.

Lymphatic gland proliferation and interleukin-2 production! In studies, lumbar and para-aortic lymphocyte lymphocyte suspensions were prepared from mice immunized as above for EAE induction (the pertussis toxin was not included in the reproductive experiments). Lymphocytes were cultured in round-bottom microtiter plates at 5 x 10 ⁵ per well in MBMI peptides and 0.5% fresh normal mouse serum, penicillin-streptomycin, L-glutamine and 5 x 10 ⁵ M-mercaptoethanol in RPMI 1640 medium. Cultures of the growth assay were pulsed for 16 hours with ³ H-thymidine after a 72 hour incubation. In the interleukin-2 assays, culture supernatants are harvested after 24 hours and tested for their ability to promote growth of the interleukin-2 dependent HT2 cell line. To distinguish interleukin-2 production from interleukin-4 production, HT2 biological assays were performed in the presence of 10% culture supernatant containing the monoclonal antibody II.B.ll [0'Hara, J. et al., Natura 315, 333 (1985)], which inhibits interleukin-4 based proliferation of HT2 cells.

The results in Figure 9 show that Ac11 [4Y] (SEQ ID NO: 67) reverses EAE after the onset of paralysis. EAE was induced by MBP in a group of 14 mice. Therapy is started in each mouse after development of clinical symptoms of EAE. The data for each mouse is a single mouse. for day 1 = the onset of clinical symptoms in each mouse). Mice were treated intravenously with PBS (empty circle), 250 nM Acl-II [4Y] (SEQ ID NO: 67) (black squares) on days 1, 4, 11 and 18 of the disease, or 250 nmol / l Caution 323-337 (SEQ ID NO: 70) (black circles). An additional control group received no treatment (empty squares). Small crosses indicate mice that have been killed or killed due to Grade 5 EAE. The untreated group had an MMS of 4.6 and a mortality of 64%. In the PBS-treated group, MMS was 4.4 and mortality was 35%.

In the group treated with Óva 323-337 (SEQ ID NO: 70), the MMS was 4.2 and the mortality was 21%. In the Acl-II [4Y] (SEQ ID NO: 67) treated group, the MMS was 3.2 and the mortality was 7%.

Figure 10 shows that Acl-II [4Y] (SEQ ID NO: 67) prevents EAE relapses when administered in the remission phase of the disease. EAE is induced by MBP. Therapy is started in each mouse on the second day of remission after the initial episode of EAE. Data are plotted for each mouse relative to the onset (Day 1 = second day of remission). Groups of 6-7 surviving mice were treated intravenously on days 1, 4, 7, and 18 after initiation of remission with PBS (open circles) or 25 nM Acl-11 [4Y] (67). (black circles). Small crosses indicate individual mice that have died or were killed due to grade 5 EAE. The onset of the disease before remission lasted 3-18 days (mean 9 days for both groups). At baseline, MMS was similar in both groups of mice (3.0 in PBS-treated group and 3.9 in Acl-II [4Y] (SEQ ID NO: 67)). In the PBS-treated group, MMS was 4.1 and mortality was 33%. In the peptide-treated group, MMS was 0.3 and mortality was 0% after treatment.

Figure 11 shows that Acl-11 (SEQ ID NO: 65) or Acl-II [4Y] (SEQ ID NO: 67) induce T-cell non-response.

the. Groups of 3-4 mice were treated intravenously with either PBS (black circles) or 250 nM Acl-II (SEQ ID NO: 65) (black triangles) at 150 µg.

10 to 5 days prior to immunization with MBP. The lymphoid proliferation assay with MBP Acl-II (SEQ ID NO: 65) was performed on day 9. The controls were PBS pretreatment PPD 108277 / medium 1855 and Acl-11 (SEQ ID NO: 65) pretreatment PPD 88499 / medium 1335.

b. Groups of 4 mice were treated with either PBS or 250 nM Acl-II [4Y] (SEQ ID NO: 67) ten or five days prior to immunization with 150 pg MBP. Interleukin-2 production assays of lymph glands were performed on day 10 with 150 pmol / L Acl-II (SEQ ID NO: 65) or 17 pmol / L Acl-II [4Y].

• ·

Example 3

Administration of peptide in advanced state

Relapsing EAE develops (PLJ x SJL) in FI mice after immunization with MBP [Fritz, R.B. et al., J. of Immunol.

130, 1024 (1983)], which makes this EAE model ideal for testing therapeutic intervention. Although MBP Acl-11 (SEQ ID NO: 65) is an immunomodulatory enkephalogen in (PLJ x SJL) FI mice, the MBP 31-47 (SEQ ID NO: 68) subdominant epitope is also encephalogenic in this strain. To determine whether one or both of these encephalogenic peptides are required for the treatment of MBP-induced EAE, the steps described in Example 2 are followed except that the groups of mice in advanced disease state or MBP Acl-11 ( 65) and MBP 31-47 (SEQ ID NO: 68), or with Acl-II only (SEQ ID NO: 65), by intravenous injection. Control groups of mice were treated with intravenous injection of PBS or with the control peptide Óva 323-339 (SEQ ID NO: 69), an A ^u A ^u- binding peptide that is not related to MBP and is not immunogenic with (PLJ x SJL) FI. mice.

Figure 5 shows that repeated intravenous injection of MBP Acl-11 (SEQ ID NO: 65) either alone (Figure 5a) or in combination with MBP 31-47 (SEQ ID NO: 68) (Figure 5b) reduces Frequency, severity and mortality of UAE. Treatment with the two peptides seemed to be slightly more effective than treatment with MBP Acl-II alone (SEQ ID NO: 65), which is consistent with others. with the observations mentioned above. Mice were treated with six intravenous peptide injections in the acute phase and the first relapse phase. The fate of the mice was then followed until day 125, in the chronic remitting phase, and there was no evidence of subsequent disease occurrence in the MBP-treated group (data not shown). The Óva 323-339 (69.

SEQ ID NO: 5) has no effect on the disease when administered intravenously (Figure 5c). In a separate experiment, intravenous administration of MBP 31-47 (SEQ ID NO: 68) alone was not effective in treating EAE (data not reported)

5a, 5b. and 5c. Figures 1 to 5 show mice induced by MBP

The efficacy of intravenous treatment of UAE. EAE is induced by MBP as mentioned above in groups of 11-16 mice. Mice were treated with 250 mM of each peptide on days 9, 12, 15, 21, 29 and 37. Small crosses, as used in all figures, refer to mice that have been killed or killed because of grade 5 EAE. The control group treated with PBS is indicated by black circles. The results show that the MBP immunomodulatory encephalogen peptide is both necessary and sufficient for the treatment of MBP-induced EAE (PLJ x SLJ) in FI mice, as indicated by a decrease in the severity and mortality of EAE in the treated mice.

Example 4

Multiple Intravenous Injections of Acl-11 (SEQ ID NO: 65) ··································································• · · ··· · ··

Following the preparation steps described in Example 2, several injections of Acl11 (SEQ ID NO: 65) were made. An injection of peptide on day 9 delays disease by two days and reduces mortality from 100% to 63%, but eventually all treated mice develop severe EAE (data not shown). In the acute phase of EAE, three injections of peptide initially treat the disease effectively, but relapse! Phase 2 develops late-onset disease in the group of treated mice (data not shown). Taken together, the results indicate that multiple intravenous injections of MBP peptides are required to treat MBP-induced disease (PLJ x SLJ) in FI mice during acute and first relapse phase of EAE. Thus, multiple injections of Acl-11 (SEQ ID NO: 65) are required to reduce the severity of the disease over a long period. Figure 6 shows that Acl11 [4Y] (SEQ ID NO: 67) treats EAE at a lower dose than Acl-11 (SEQ ID NO: 65) and has a longer effect on the disease. EAE was induced by MBP in groups of 8-10 mice. 6a. Figures 12 to 15, intravenously with PBS (phosphate buffered saline) (blank circles) on days 12 and 15,

Treatment with 250 nM Acl-II (SEQ ID NO: 65) (black circles) or 250 nM Acl-II [4Y] (SEQ ID NO: 67) (empty triangles). Mice treated with PBS had an MMS of 4.4 and a mortality of 60%. Mice treated with Acl-II (SEQ ID NO: 65) had an MMS of 3.9 and a mortality of 37.5%. Mice treated with Ac11 [4Y] (SEQ ID NO: 67) had a MMS of 2.1 and a mortality of 0%. 6b. 12, 15, 18, 21, 24 and • · ·· * · · «·· ····

On day 27, mice treated with either PBS (open circles) or 2.5 nM Acl-II (SEQ ID NO: 65) (black circles) are seen. Mice treated with PBS had an MMS of 2.9 and a mortality of 20%. Mice treated with the peptide had an MMS of 4.3 and a mortality of 50%.

used in Example 2 with the exception that

Example 5

Treatment with an MBP peptide analog that forms in vivo stable complexes with MHC class

Because peptide-MHC complexes are functional therapeutic units that treat EAE, the authors of the present invention believe that Acl-II [4Y] (SEQ ID NO: 67) will be much more effective in inducing active MBP. In the treatment of EAE as Acl-11 (SEQ ID NO: 65). To verify this hypothesis, steps were taken to change the timing and dose of injections. 6a. Figure 2A shows that only two injections of Acl-II [4Y] (SEQ ID NO: 67) in the early phase of the disease produce a longer duration of action than two injections of Acl-11 (SEQ ID NO: 65). In addition, FIG. Figure 6c shows that repeated intravenous administration of Acl-II [4Y] (SEQ ID NO: 67) is very effective in treating EAE at a dose of 2.5 nM (Figure 6c). Histological tests were then performed. Histological sections were made from EAE brains and spinal cord and stained with hematoxylin and eosin (CVD, Inc., West Sacramento, CA). Sections are evaluated on the basis of inflammatory infiltrations, and the originator does not know the origin of the section. The efficacy of Acl11 [4Y] (SEQ ID NO: 67) was determined by histological examination of brains and spinal cord from peptide and PBS-treated mice, showing that peptide-treated mice significantly reduced the number and severity of inflammatory CNS infiltrations (Figure 7). ). Figure 7 shows that mice treated with Acl-II [4Y] (SEQ ID NO: 67) had reduced inflammatory infiltration. The improved efficiency of Acl-II [4Y] (SEQ ID NO: 67) was evident.

The improved efficiency of Acl-II [4Y] (SEQ ID NO: 67) was evident in the above example. According to the authors of the present invention, stable carrier peptide-MHC complexes are formed between A ^U A ^U and intravenously injected Acl-II [4Y] (SEQ ID NO: 67), thereby providing improved efficacy. These in vivo formed complexes can be detected by the 1934 hybridoma derived from an encephalogenic MBP-specific T cell clone. The steps described in Example 2 above were performed except that injection times and volumes were varied as follows. The 1934 T-cell hybridoma is specific for MBP-Acl-II (SEQ ID NO: 65), as described by Wraith, DC et al., (1989, Cell 59, 247). Briefly, hybridoma cells are incubated at 5 x 10 ⁴ per well in flat bottom microtiter plates with MBP peptides or analogs. As antigen presenting cells, 5 x 10 ⁵ , 3,000 rads (PLJxSJL) F1 spleen cells were added to the wells. The medium is the same as · · · · · · · · · · · ····················································································· · which was used in lymphoid proliferation assays, with the exception that 10% fetal calf serum was added to normal mouse serum. The supernatants were harvested after 24 hours and tested for their ability to support HT2 cell growth. Spleen was then removed from mice at various times after injection with 250 nM Acl11 [4Y] (SEQ ID NO: 67), and splenocytes were used as antigen-presenting cells for the Acl11 specific 1934 hybridoma. No additional peptide was added to the cultures. Figure 8 shows that spleen cells that were pulsed in vivo with Acl-II [4Y] (SEQ ID NO: 67) very efficiently activate the 1934 hybridoma. The activation capacity of the hybridoma is maximal two hours after injection and then begins to decrease 4-6 hours after injection. Activation is minimal at 10 hours after injection of Acl-II [4Y] (SEQ ID NO: 67), and is no longer present after 20 hours (data not shown). As shown in Figure 8, experiments with Acl-II (SEQ ID NO: 65) do not show hybridoma activation with spleen cells from injected mice, even one hour after injection (data not shown). As shown in more detail in Figure 8, in vivo generated peptide-MHC complexes can be detected in Acl-II [4Y] (SEQ ID NO: 67) in mice. Groups of 2 mice were injected intravenously with 250 nM Acl-II [4Y] (SEQ ID NO: 67) at different times (1-10 hours) prior to spleen removal. The splenocytes from the injected mice are examined for the presence of splenocytes.

F * · · ·• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

The results show the capacity of peptide-MHC to activate 1934 cells to produce interleukin-2, based on HT2 proliferation. They support the assumption that stable complexes in vivo contribute to the efficacy of a therapeutic MBP peptide analog.

Example 6

Synthesis of mouse MBP Acl-11 (SEQ ID NO: 65)

The murine MBP Acl-11 (SEQ ID NO: 65) peptide was prepared by standard Fmoc / tBoc synthesis and purified by HPLC. The amino acid sequence of Acl-11 (SEQ ID NO: 65) peptide is as follows:

Alá Ser Gin Lys Arg Pro Ser Gin Arg His Gly

10

Induction of UAE

EAE was induced in 6- to 8-week-old (SJLxPL) F1 female mice (Jackson Labs, Bar Harbos, ΜΕ), and the mice were immunized with 100 μg of purified guinea pig MBP (CFA) in the tail (GIBCO, LAB, Grand Island). , NY) containing 400 μg of Mycobacterium tuberculosis strain H37R (DIFCO Foot, Detroit, MI).

Twenty days after immunization, and 48 hours later, 200 ng of pertussis toxin (JHL BIOSCIENCE, Lenexa, Kansas) was administered. Mice are monitored daily for symptoms of the disease and the severity of the disease is determined by the following scale: 0 = no clinical sign of EAE, l = lame, unresponsive tail, 2 = partial hind limb paralysis, 3 = complete hind limb * <, »· · * *. T t t t t t t t én b b ulás b b én ulás ulás ulás ulás ulás 4 ulás 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 = partial or complete paralysis of the forelegs, Data are expressed as the average of the number of disease severity values determined daily. The mice were observed for 26 days. When a mouse dies in UAE, it is counted as 5 every subsequent day.

Effect of interferon-β on EAE

In a titration experiment to determine the effects of different doses of interferon-β (Figure 13), one group of mice was treated with PBS intraperitoneally on days 9, 13, and 16 (control) after EAE induction, and another group of mice was treated with 10,000 units of interferon-β. On days 9, 13, and 16 (blank circles), a group of mice was treated with 210,000 units of interferon-β on days 9, 13, and 16 (black circles). As shown in Figure 13, the symptoms of EAE at each time point are similar for both doses of interferon-β, indicating that the lower dose is suitable for experiments with interferon-β, and this is the preferred dose because of the higher doses of interferon are less likely to cause toxicity.

Subsequently, 2000 units of interferon-1 were used as described in Figures 12a-12c.

1 to 4, since this dose results in an improvement in the clinical score.

As shown in FIG. 10A, one control group of mice is treated with PBS and another group of mice is treated with 2000 units of interferon 1 in Figures 9, 12, 16 and 20.

on the sun. As shown in FIG. Figure 6B with interferon-β

999 9,999 9

In the 100 treated groups, the symptoms were only slightly less severe than those in the control group.

Effect of mouse MBP Acl-11 (SEQ ID NO: 65) on EAE

The effects of murine MBP Acl-11 (SEQ ID NO: 65) peptide were determined, and the results are shown in Figure 12b. 4A. One group of mice was treated intraperitoneally with PBS on days 10, 13, 17, and 21 (control) after EAE induction, and one group of mice was treated with 250 nM Acl-11 (SEQ ID NO: 65) peptide 10, 13. On days 17 and 21. Mice were observed as described above. As shown in Fig. 12b. As shown in FIG. 5A, mice treated with Acl-II (SEQ ID NO: 65) have less severe symptoms than the control group.

Effect of Acl-11 (SEQ ID NO: 65) and Interferon- on EAE

The effects of treatment with Acl-11 (SEQ ID NO: 65) and interferon-β are shown in Fig. 12c. 4A. One group of mice was treated intraperitoneally with PBS after induction of EAE, and one group of mice was treated intravenously with 250 nM Acl-11 (SEQ ID NO: 65) peptides 10, 13,

On days 17 and 21 (blank arrows), then treated intraperitoneally with 2000 units of interferon-β on days 9, 12, 16 and 20.

As shown in FIG. 12c. As shown in Fig. 1A, the group of mice treated with the combination of peptide and interferon-β had much less symptoms than the control group, and compared to that treated with interferon-only or peptide-only ···· · · · · > ·; · '1 · <·:

101 groups, as shown in Fig. 12a. 12b and 12b. Figures 1 to 5 show the synergistic effect of the combination. As a result, a treatment method using a combination of peptide and interferon-β will further alleviate the severity of the symptoms of EAE.

Example 7

Administration of peptides for the treatment of spinal cord homogenate (SCH) -induced EAE as a model for multiple sclerosis in mammals

Synthesis of peptides

The peptide was prepared by automated peptide synthesis (ABI 430A, Applied Biosciences, Foster City, CA) using standard 9-fluorenylmethyl methoxycarbonyl chemistry. The peptides were purified by HPLC and the amino acid composition was confirmed. The peptides selected are: MBP Acl-11 (SEQ ID NO: 65) ASQKRPSQRHG; MBP

Acl-II [4A] (SEQ ID NO: 66) ASQARPSQRHG; MBP Acl-II [4Y] (SEQ ID NO: 67) ASQYRPSQRHG; MBP 31-47 (SEQ ID NO: 68) RHRDTGILDSIGRFFSG; Caution 323-339 (SEQ ID NO: 69)

ISQAVHAAHAEINEAGR; and Caution 323-337 (SEQ ID NO: 70)

ISQAVHAAHAEINEA.

MBP cleaning

SCH was purified from guinea pig spinal cord [Keystone Biologicals, Cleveland, OH], Smith, M.E. Smith, M.E., J. Neurochem. 16, 83 (1969)]. The · · · · · ··· ··· ·

102

The SCH protein mixture is lyophilized and used according to their dry weight.

EAE Induction, Evaluation and Peptide Therapy

EAE was induced in (PLJ x SJL) FI mice purchased from Jackson Laboratory (Bar Harbor, ME). When the mice reach the age of 8-14 weeks, the EAE is 50-100 µg complete

Freund's adjuvant (Gibco Laboratories, Grand Island, NY) supplemented with 400 µg per mouse of Mycobacterium tuberculosis H37Ra (Difco Laboratories, Detroit, MI) was induced with emulsified SCH. 200 µg of pertussis toxin (JRH Biosciences, Lenexa, KS) was administered intravenously at the same time as immunization and 48 hours later. Mice were evaluated for clinical signs using the following scale: 1: tail paralysis; 2: partial paralysis of the hind limb; 3: complete paralysis of the hind limb; 4: paralysis of the first limb; 5: Dying or dead. Mice with a value of 5 are euthanized. After death, mice were excluded from further calculation of the mean clinical value. The peptides are administered intravenously as described in the Examples below.

The results shown in Figure 16 show that Ac11 [4Y] (SEQ ID NO: 67) reverses EAE after the onset of paralysis. EAE was induced with SCH in a group of 14 mice. Therapy is started in each mouse after development of clinical symptoms of EAE. Data are plotted for each mouse relative to the initiation of therapy (Day 1 = onset of clinical symptoms in each individual mouse). • · · ·········································································································· · · · · · ····· · ··· ···

103 mice). Mice were treated intravenously with PBS (black square), 250 nM Acl11 [4Y] (SEQ ID NO: 67) (empty triangle) or 250 nM on days 1, 3, 6 and 9 of the disease. / 1 Caution with 323-337 (SEQ ID NO: 70) (blank circles). The small star indicates mice that have been killed or killed due to Grade 5 EAE.

Figure 17 shows that Acl-II [4Y] (SEQ ID NO: 67) prevents the occurrence of EAE if administered prior to the onset of the disease symptoms. EAE is induced by SCH. Therapy was initiated in each mouse on the eighth day after disease induction with gpSCH. Data are plotted relative to the initiation of therapy for each individual. Surviving mice on days 8, 10, 13, and 17 were treated with 25 nM Acl-II [4Y] (SEQ ID NO: 67) intravenously (empty triangles) or subcutaneously (black circles). One group received no treatment (empty squares).

The results shown in Figures 16 and 17 show that each route of administration effectively prevents the onset of symptoms.

Example 8

The same procedure was used as in Example 2, but no lymphoid proliferation and interleukin-2 production assays were performed. EAE is induced on day 0 with gpMBP, followed by Acl-II [4Y] (SEQ ID NO: 67) on three groups of mice on days 8, 10, 13 and 17. The results are graphically depicted in Figure 18 for intravenous administration. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·Icing · · · · · · ·

104 (blank triangles), subcutaneous injection (black circles) and one control group (blank circles). Pretreatment (i.e., pre-symptomatic treatment) with Acl-II [4Y] (SEQ ID NO: 67) can prevent EAE disease with gpMBP.

Example 9

CDNA encoding human MOG protein

In a first attempt to produce a human cDNA encoding a MOG protein, a human cDNA library was subjected to polymerase chain reaction (PCR) using 3 'and 5' primers designed based on the rat MOG coding sequence published by Gardinier et al. The human MOG sequence could not be produced in this manner, presumably because the 5 'and / or 3' ends of the human and rat sequences do not have sufficient homology.

Therefore, four rat internal oligonucleotides were designed. Two of these are homologous to the top strand of the gene (94-111 and 166183 (SEQ ID NO: 74), base one starts at ATG), and two are homologous to the lower strand of the gene (538-555). (SEQ ID NO: 74) and primers 685-702). The combination of primers 166-183 (SEQ ID NO: 74) and 538-555 (SEQ ID NO: 75) efficiently amplifies a fragment of approximately 400 base pairs based on the human brain cDNA library. The sequence of these primers is as follows:

a) 166-183: CAGAATCCGGGAAGAATGCCACGGGC (SEQ ID NO: 74) and ······ · ···· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · English English ··· · ··

105

b) 538-555: CAGCGGCCGCACGGAGTTTTCCTCTCAG (SEQ ID NO: 75).

An EcoRI site is located in primer 166-183 (SEQ ID NO: 74) and a NotI site is located in primer 538-555 (SEQ ID NO: 75).

The 400 bp PCR product was cloned into the pVL1393 expression vector by digesting pVL1393 (Pharmingen CA) with EcoRI and NotI, and digesting the amplified product with these restriction endonucleases and ligating the resulting fragments. The inserts were verified by digesting clones from ligated plasmids with EcoRI and Not I restriction endonucleases and sequencing the resulting 400 bp human MOG fragment. The resulting insert is believed to lack 184 bp in the 5 'sequence and 201 bp in the 3' sequence based on the 738 bp size of the rat open reading frame.

Two primers were designed based on the 400 bp system based on positions 346-363 of the upper and lower strands, as follows:

5 '-CAGAATTCTCAGGTTCTCAGATGAAGGA-3' (SEQ ID NO: 76) and

5 '-AAGCGGCCGCTATCCTTCATCTGAGAACCT-3' (SEQ ID NO: 77), which contains an EcoRI site in the first strand and a NotI site in the second strand. The underlined sequences correspond to the MOG sequence.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Add

106

The top and bottom primers of human MOG 346-363 (SEQ ID NOs: 76 and 77) were used in combination with the 5 'and 3' rat primers mentioned above to amplify the missing 5 'and 3' genes from the same human brain cDNA. ends as described above. A PCR product corresponding to the 3 'end of the gene was obtained, but no corresponding 5' end was obtained.

The resulting 3 'fragment was the expected 400 bp and this fragment was cloned into pVL1393 and sequenced.

To generate the 5 'end of the gene, a human bone marrow gt10 library from Clontech, previously amplified and having a titer of 8 x 10 ¹ pfu / ml, was screened according to the manufacturer's specification. The library was plated on 12 large plates at a concentration of 30,000 plaques / plate and the plaques were transferred to nitrocellulose filter plates (2 replicate plates / plate). The 12 filter plates from 12 different plates were hybridized to a ³² P labeled probe corresponding to the first 400 bp fragment of the first cloned human MOG (positions 184-534). Twenty-two strong positive clones were obtained. The colonies corresponding to each positive clone are removed as original agar plugs from the original plates and incubated overnight with dilution buffer to elute the phage from the agar. The tube is centrifuged and the supernatant transferred to another vessel.

The DNA was amplified from each of the pooled phage cultures, or for a gt10 forward primer containing an SstII site: 5'-CTTTTGAGCAAGTTCAGCCTGGTTAAG-3 '(No. 78).

107 ······························································ (· ((·) · · · · · · · · · · · · · · · · · · · · · · · · for a gtlO reverse primer containing an Xhol cleavage site:

5 '-ACCTCGAGGAGGTGGCTTATGAGTATTTCTTCCAGGGTA (SEQ ID NO: 79) and using a human MOG inner primer top or bottom:

5 '-GGTGCGGGAAAGGTGACTCTCAGGATCCGGAAT-3' (SEQ ID NO: 80) or

5 '-ATTCCGGATCCTGAGAGTCACCTTTCCCGCACC-3' (SEQ ID NO: 81).

The last two primers (SEQ ID NOs: 80 and 81) contain a BamHI site (underlined in the sequences) which is naturally found in the human MOG sequence.

The primers are used in four different combinations: 1) forward upper / inner MOG lower; 2) reverse lower / inner MOG lower; 3) inner MOG upper / reverse lower; and 4) internal MOG top / forward top.

The first two combinations gave the 5 'end of the gene (up to the BamHI site) and the last two combinations gave the 3' end of the gene. Both the 5 'and the 3' ends contain untranslated regions. Which two members of each combination result in the desired fragment depends on the orientation of the cDNAs cloned into gt10.

The size of the resulting fragments varied from one pool to another. The five largest 5 'fragments or 3' fragments were subcloned into the S polII and BamHI sites of the SK polylinker or the BamHI and Xhol sites. Three clones from each pool are then sequenced to exclude the presence of PCR errors. this is how we get • · • ·· ·

108 complete sequences of the coding regions of the gene and 174 bp of the 5 'untranslated sequence.

The human MOG gene encodes a 248 amino acid preprotein with 87% homology to the rat protein 246 amino acids. The mature protein contains 218 amino acids. The mature protein begins with glycine and is derived from the 248 amino acid preprotein by cleaving the pre-sequence from the MET start codon preceding the glycine residue at position 1 to the alanine residue.

9A. figure

Expression of truncated human MOG in SF-9 insect cells and

Escherichia coli

SF-9 expression

The PVL1393 transfer vector containing the truncated human MOG cDNA encoding amino acids 1-121 of human MOG (the first 121 amino acids of SEQ ID NO: 48) was co-transfected into SF-9 cells with Baculogold linearized Baculovirus DNA (Pharmingen, San Diego, CA). The culture supernatant containing the recombinant virus was recovered after 4 days. The recombinant virus was plaque-purified and amplified in 3 rounds to obtain a high-virus stock. AF-9 cells were then infected with the virus stock culture at an MOI of 2.0. The supernatant from infected cells was harvested 48 hours after infection and applied to a NiNTA agarose column. The recombinant MOG protein was eluted under non-denaturing conditions,

109

Using 250 mM imidazole for this purpose, it is dialyzed against 5% propionic acid and water and then lyophilized. Protein concentration was estimated by BCA. The purified MOG protein was visualized on a 12.5% polyacrylamide gel stained with Coomassie Blue.

Example 10

Truncated human MOG (huMOG) is prepared as shown in Figures 9 and 9A.

as described in example. MBP (guinea pig) is prepared as described above. The procedures described in Example 2 are described with the exception that EAE is induced in three separate groups of mice with 75 pg gpMBP and 100 pg huMOG (empty triangles) and 75 pg gp MBP and 100 pg huMOG (black squares). ). The graph in Figure 19 illustrates the course of the disease in the cases of this example. The disease induced by both MOG and MBP is much more severe than the disease induced by either alone. The results show that both MOG and MBP contribute to the disease.

Example 11

The disease was induced as described in Example 10 using huMOG + gpMBP (Day 0 = disease induction). Mice were treated with 250 nM Acl11 [4Y] (SEQ ID NO: 67) prior to onset of symptoms and PBS was used as controls at 6, 8, 10, 13, 17, 22 and 27. day (treatment with arrows). As you can see from the graph in Figure 20, 9 ···············································································································································

Treatment with Acl-II [4Y] (SEQ ID NO: 67) (vacancies) significantly reduces the mean clinical score relative to controls (black squares).

One skilled in the art will recognize that numerous equivalents of the present invention can be obtained by routine experimentation. These equivalents are within the scope of the present invention and are protected by the following claims.

The following is a list of the sequences referred to in the invention.

LIST OF SEQUENCES (1) GENERAL INFORMATION:

(i) SUBMITOR:

(THE NAME:

Smilek, Dawn;

Samson, Michael F.;

Gefter, Malcolm;

Hsu, Di-Hwei;

Shi, Jia-Dong;

Paliard, Xavier;

Devaux, Brigitte;

Rothbard, Jonathan; and

Franzen, Henry M..

(ii) TITLE OF THE INVENTION: Preparations and Treatments for Multiple Sclerosis (iii) NUMBER OF SEQUENCES: 81 (iv) TITLE OF DISPATCH:

TITLE 111 (A): LAHIVE & COCKFIELD (B) STREET: 60 State Street, Suite 510 (C) CITY: Boston (D) STATE: Massachusetts (E) COUNTRY: USA (v) COMPUTER FORMAT:

(A) MEDIA TYPE: FLOPPY DISK (B) COMPUTER: IBM PC COMPATIBLE (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: PATENTIN RELEASE # 1.0, VERSION # 1.25 (vi) AS IS :

(THE) THE SUBMISSION NO: PCT / US95 / 13682 (B) THE SUBMISSION DATE: October 25, 1995 (C) CLASSIFICATION vii) A PREVIOUS SUBMISSION DATA: (THE) THE SUBMISSION Serial No. US 08 / 404,228 (B) THE SUBMISSION DATE: March 15, 1995 (THE) THE SUBMISSION Serial No. US 08 / 328,224 (B) THE SUBMISSION DATE: October 25, 1994 (THE) THE SUBMISSION Serial No. US 08 / 300,811 (B) THE SUBMISSION DATE: September 1994 (THE) THE SUBMISSION Serial No. US 08 / 241,246 (B) THE SUBMISSION DATE: May 10, 1994 (THE) THE SUBMISSION Serial No. US 08 / 116,824 (B) THE SUBMISSION DATE: September 1993

(VIII) OFFICER / AGENT INFORMATION:

• »·· ·· * ·

112 (A) NAME: Amy E. Mandragouras (B) REGISTRATION NUMBER: Reg. No. 36,207 (C) REFERENCE / REGISTRATION NUMBER: 094.2 PCT (IMI-052C2PC) (IX) TELECOMMUNICATIONS INFORMATION:

(A) TELEPHONE: (617) 227-7400 (B) TELEFAX: (617) 227-5941

SEQ ID NO: 1 (i) Sequence Characteristics:

(A) Length: 170 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 1

Alá Ser Gin Lys Arg Pro Ser Gin Lys Ar His Gly Ser Lys Tyr Leu Alá

10 15

Thr Alá Ser Thr Met Asp His Alá Arg His Gly Phe Leu Pro Arg His

25 30

Arg Asp Thr Gly Ile Leu Asp Ser Ile Gly Arg Phe Phe Gly Gly Asp

40 45

Arg Gly Alá Pro Lys Arg Gly Ser Gly Lys Asp Ser His His Pro Ala

55 60

Arg Thr Alá His Tyr Gly Ser Leu Pro Gin Lys Ser His Gly Arg Thr ·· 9 99 · 9 ·· * ····· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Tallinn ·ut · ·· «· ··· · ·> 113

65 70 75 80 Gin Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro 85 90 95 Arg Thr Pro Pro Pro Ser Gin Gly Lys Gly Arg Gly Leu Ser Leu Ser 100 105 110 Arg Phe Ser Trp Gly Alá Glu Gly Gin Arg Pro Gly Phe Gly Tyr Gly 115 120 125 Gly Arg Alá Ser Asp Tyr Lys Ser Alá His Lys Gly Phe Lys Gly With 130 135 140 asp Alá Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu Gly Gly Arg asp 145 150 155 160 Ser Arg Ser Gly Ser Pro Met Alá Arg Arg 165 170 SEQ ID NO: 2

(i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 2

Gly Ser Lys Tyr Leu Alá Thr Alá Ser Thr Met Asp His Alá Arg His r ».» ·. «

114 »* · · · • ·« ν · · • »· ♦ · ·» »«. · »····

Gly Phe Leu Pro

SEQ ID NO: 3 (i) Sequence Characteristics:

(A) Length: 19 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 3:

Gly Ser Lys Tyr Leu Alá Thr Alá Ser Thr Met Asp His Alá Arg His

10 15

Gly Phe Leu

SEQ ID NO: 4 (i) Sequence Characteristics:

(A) Length: 21 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal · * ».- · · · ('<·« ··· * φ φ ·· »t · * · · • · · *« «« r »4 * · # *» »··

115 (xi) SEQ ID NO: 4

Gly Ser Lys Tyr Leu Alá Thr Alá Ser Thr Met Asp His Alá Arg His

10 15

Gly Phe Leu Pro Arg

SEQ ID NO: 5 (i) Sequence Characteristics:

(A) Length: 23 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 5

Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr

10 15

Pro Pro Pro Ser Gin Gly Lys

SEQ ID NO: 6 (i) Sequence Characteristics:

(A) Length: 24 amino acids (B) Type: amino acid (D) Topology: linear

116

(ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 6

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr Pro Pro Pro Ser Gin Gly Lys

SEQ ID NO: 7 (i) Sequence Characteristics:

(A) Length: 23 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 7

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr Pro Pro Pro Ser Gin Gly

SEQ ID NO: 8 (i) Sequence Characteristics:

···· ············································ ·

117 (A) Length: 19 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 8

Thr Gin Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr

10 15

Pro Arg Thr

SEQ ID NO: 9 (i) Sequence Characteristics:

(A) Length: 21 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 9

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr Pro Pro Pro Ser

SEQ ID NO: 10 ···· ····

118 (i) Sequence Characteristics:

(A) Length: 25 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 10

Thr Gin Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr

10 15

Pro Arg Thr Pro Pro Pro Ser Gin Gly

25

SEQ ID NO: 11 (i) Sequence Characteristics:

(A) Length: 23 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 11

Thr Gin Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr

10 15

Pro Arg Thr Pro Pro Pro Ser

119

SEQ ID NO: 12 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 12

Leu Ser Arg Phe Ser Trp Gly Al Glu Gly Gin Arg Pro Gly Phe Gly

10 15

Tyr Gly Gly Arg

SEQ ID NO: 13 (i) Sequence Characteristics:

(A) Length: 19 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 13

Leu Ser Arg Phe Ser Trp Gly Al Glu Gly Gin Arg Pro Gly Phe Gly ···· ····

120

Tyr Gly Gly

SEQ ID NO: 14 (i) Sequence Characteristics:

(A) Length: 25 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 14

Phe Lys Gly Val Asp Ala Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu

10 15

Gly Gly Arg Asp Ser Arg Ser Gly Ser

25

SEQ ID NO: 15 (i) Sequence Characteristics:

(A) Length: 25 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal • · · · «···· ···· · · • · · · ·

121 (xi) SEQ ID NO: 15

Pro Ser Gin Gly Lys Gly Arg Gly Leu Ser Leu Ser Arg Phe Ser Trp

10 15

Gly Ala Glu Gly Gin Arg Pro Gly Phe

25

SEQ ID NO: 16 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 16

Ala Ser Gin Lys Arg Pro Ser Gin Lys Arg His Gly Ser Lys Tyr Leu Ala

10 15

Thr Ala Ser Thr

SEQ ID NO: 17 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear • · · · · · · · · · · · · · · · · · · · · · · ··

122 (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 17

Met Asp His Alá Arg His Gly Phe Leu Pro Arg His Arg Asp Thr Gly

10 15

Ile Leu Asp Ser

SEQ ID NO: 18 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 18

Arg His Arg Asp Thr Gly Ile Leu Asp Ser Ile Gly Arg Phe Phe Gly

10 15

Gly Asp Arg Gly

SEQ ID NO: 19 (i) Sequence Characteristics:

(A) Length: 20 amino acids · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

123 (B) Type: Amino Acid (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 19

Ile Gly Arg Phe Phe Gly Gly Asp Arg Gly Al Pro Lys Arg Gly Ser

10 15

Gly Lys Asp Ser

SEQ ID NO: 20 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 20

Alá Pro Lys Arg Gly Ser Gly Lys Asp Ser His His Pro Alá Arg Thr

10 15

Down His Tyr Gly

SEQ ID NO: 21 • · · ·

124 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 21

His His Pro Alá Arg Thr Al His Tyr Gly Ser Leu Pro Gin Lys Ser

10 15

His Gly Arg Thr

SEQ ID NO: 22 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 22

Ser Leu Pro Gin Lys Ser His Gly Arg Thr Gin Asp Glu Asn Pro Val

5 10. 15

Val His Phe Phe • ··· ··· · · · · · · 9 9 9 9 9 ································································•

125

SEQ ID NO: 23 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 23

Gin Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro

10 15

Arg Thr Pro Pro

SEQ ID NO: 24 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 24

Lys Asn Ile Val Thr Pro Arg Thr Pro Pro Ser Gin Gly Lys Gly • · · · · ·

126

Arg Gly Leu Ser

SEQ ID NO: 25 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 25

Pro Ser Gin Gly Lys Gly Arg Gly Leu Ser Leu Ser Arg Phe Ser Trp

10 15

Gly Alá Glu Gly

SEQ ID NO: 26 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 26 »· · · · · ··· ·· * ·

127

Gin Arg Pro Gly Phe Gly Tyr Gly Gly Arg Alá Ser Asp Tyr Lys Ser

10 15

Under His Lys Gly

SEQ ID NO: 27 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 27

Alá Ser Asp Tyr Lys Ser Alá His Lys Gly Phe Lys Gly Val Asp Alá

10 15

Gin Gly Thr Leu

SEQ ID NO: 28 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear (ii) Type of molecule: peptide ······ · · · · · · · · · · · ♦ • 9 * · · · ·· «· * ·· 9 ► · *

128 (v) Fragment Type: Internal (xi) SEQ ID NO: 28

Phe Lys Gly Val Asp Ala Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu

10 15

Gly Gly Arg Asp

SEQ ID NO: 29 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 29

Ser Lys Ile Phe Lys Leu Gly Gly Arg Asp Ser Arg Ser Gly Ser Pro

10 15

Met Alá Arg Arg

SEQ ID NO: 30 (i) Sequence Characteristics:

(A) Length: 19 amino acids (B) Type: amino acid · ··· ·················· *

129 (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 30

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr Pro Pro

SEQ ID NO: 31 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 31

Lys Tyr Leu Alá Thr Alá Ser Thr Met Asp His Alá Arg

10

SEQ ID NO: 32 (i) Sequence Characteristics:

(A) Length: 11 amino acids (B) Type: amino acid ···················································• · · ··· * **

130 (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 32

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn

10

SEQ ID NO: 33 (i) Sequence Characteristics:

(A) Length: 15 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 33

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro

10 15

SEQ ID NO: 34

The sequence features:

(A) Length: 16 amino acids (B) Type: amino acid (D) Topology: linear (·) · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ···· · ··· * ··

131 (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 34

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

SEQ ID NO: 35 (i) Sequence Characteristics:

(A) Length: 17 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 35

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr

SEQ ID NO: 36 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: amino acid, ... J

132 (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 36

Val His Phe Phe Alá Asn Ile Val Thr Pro Arg Thr Pro

10

SEQ ID NO: 37 (i) Sequence Characteristics:

(A) Length: 18 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 37

Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr

10 15

Pro Pro

SEQ ID NO: 38 (i) Sequence Characteristics:

(A) Length: 19 amino acids

(B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 38

Glu Asn Pro Val Val His Phe Phe

Lys Asn Ile Val Thr Pro Arg Thr

Pro Pro Pro

SEQ ID NO: 39 (i) Sequence Characteristics:

(A) Length: 14 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 39

Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10

SEQ ID NO: 40 (i) Sequence Characteristics:

· * · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

134 (A) Length: 17 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 40

Asn Pro Val Val His Phe Phe Lys Asn lle Val Thr Pro Arg Thr Pro

10 15

Pro

SEQ ID NO: 41 (i) Sequence Characteristics:

(A) Length: 16 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 41

Pro Val Val His Phe Phe Lys Asnle Val Thr Pro Arg Thr Pro Pro

10 15

SEQ ID NO: 42 · ··· «·» ·

135 (·) * (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 42

Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr Pro Pro Pro

10 15

Ser Gin Gly Lys

SEQ ID NO: 43 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 43

Val His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr Pro · * · 2 * ·· J «· • · · 4

136 ··· »

SEQ ID NO: 44 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 44

His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr Pro Pro

10

SEQ ID NO: 45 (i) Sequence Characteristics:

(A) Length: 12 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 45

His Phe Phe Lys Asn Ile Val Thr Pro Arg Thr Pro

137 »· · · · · · · · · · · · · · · · · · · ·

SEQ ID NO: 46 (i) Sequence Characteristics:

(A) Length: 19 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 46

Asp Glu Asn Pro Val Val His Phe Phe Lys Asn Ile Val Thr Pro Arg

10 15

Thr Pro Tyr

SEQ ID NO: 47 (i) Sequence Characteristics:

(A) Length: 25 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 47

Leu Ser Arg Phe Ser Trp Gly Alá Glu Gly Gin Arg Pro Gly Phe Gly ·· • '' t * · »<· ·· </ ·

138

Tyr Gly Gly Arg Alá Ser Asp Tyr Lys

25

SEQ ID NO: 48 (i) Sequence Characteristics:

(A) Length: 19 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 48

Arg Pro Gly Phe Gly Tyr Gly Gly Arg Alá Ser Asp Tyr Lys Ser Alá

10 15

His Lys Gly

SEQ ID NO: 49 (i) Sequence Characteristics:

(A) Length: 32 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 49 • bt · ·· * * ·· «> ·«

9 ·· · «* ·· <·· • · · · * t« ···· · Γ · · Γ

139

Lys Gly Phe Lys Gly Val Asp Alá Gin Gly Thr Leu Ser Lys Ile Phe

10 15

Lys Leu Gly Gly Arg Asp Ser Arg Ser Gly Ser Pro Met Alá Arg Arg

25 30

SEQ ID NO: 50 (i) Sequence Characteristics:

(A) Length: 25 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 50

Lys Gly Val Asp Alá Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu Gly

10 15

Gly Arg Asp Ser Arg Ser Gly Ser Pro

25

SEQ ID NO: 51 (i) Sequence Characteristics:

(A) Length: 27 amino acids (B) Type: amino acid

140 (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 51

Lys Gly Val Asp Alá Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu Gly

10 15

Gly Arg Asp Ser Arg Ser Gly Ser Pro Met Alá

25

SEQ ID NO: 52 (i) Sequence Characteristics:

(A) Length: 15 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 52

Alá Gin Gly Thr Leu Ser Lys Ile Phe Lys Leu Gly Gly Arg Asp

10 15

53 (i) Sequence Characteristics:

·· ···· ···· ···· • · · · · · · · · · · · • • · · · · · · · ·· · · ·· ····

141 (A) Length: 18 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 53

Ile Phe Lys Leu Gly Gly Arg Asp Ser Arg Ser Gly Ser Pro Met Alá

10 15

Arg Arg

SEQ ID NO: 54 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 54

Gly Gin Phe Arg Val Ile Gly Pro Arg His Pro Ile Arg

10

SEQ ID NO: 55

142 (i) Sequence Characteristics:

(A) Length: 13 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 55

His Ser Tyr Gin Glu Glu Alá Alá Met Glu Leu Lys Val

10

SEQ ID NO: 56 (il) Sequence characteristics:

(A) Length: 121 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description

Gly Gin Phe Arg Val Ile Gly Pro

5

Gly Asp Glu Val Glu Leu Pro Cys

Thr Gly Met Glu Val Gly Trp Tyr: SEQ ID NO: 56

Arg His Pro Ile Arg Alá Leu Val

15

Arg Thr Ser Pro Gly Lys Asn Alá

30

Arg Pro Pro Phe Ser Arg Val Val · · · ·

143 • ·

His Leu Tyr Arg Asn Gly Lys Asp Gin Asp Gly Asp Gin Alá Pro Glu

55 60

Tyr Arg Gly Arg Thr Glu Leu Leu Lys Asp Alá Ile Gly Glu Gly Lys

70 75 80

Val Thr Leu Arg Ile Arg Asn Val Arg Phe Ser Asp Glu Gly Gly Phe

90 95

Thr Cys Phe Phe Arg Asp His Ser Tyr Gin Glu Glu Alá Alá Met Glu

100 105 110

Leu Lys Val Glu Asp Pro Phe Tyr Trp

115 120

SEQ ID NO: 57 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 57

Gly Gin Phe Arg Val Ile Gly Pro Arg His Pro Ile Arg Alá Leu Val

10 15

Gly Asp Glu Val • · · · ········

144

SEQ ID NO: 58 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 58

Pro Ile Arg Alá Leu Val Gly Asp Glu Val Glu Leu Pro Cys Arg Ile

10 15

Ser Pro Gly Lys

SEQ ID NO: 59 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal • · · · • · · ·

145 (xi) SEQ ID NO: 59

Glu Leu Pro Cys Arg Ile Ser Pro Gly Lys Asn Alá Thr Gly Met Glu

10 15

Val Gly Trp Tyr

SEQ ID NO: 60 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 60

Asn Alá Thr Gly Met Glu Val Gly Trp Tyr Arg Pro Pro Phe Ser Arg

10 15

Val Val His Leu

SEQ ID NO: 61 (i) Sequence Characteristics:

(A) Length: 20 amino acids • ·· · ··· ·

146

(B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 61

Thr Val Gly Leu Val Phe Leu Cys Leu Gin Tyr Arg Leu Arg Gly Lys

10 15

Leu Arg Alá Glu

62 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 62

Tyr Arg Leu Arg Gly Lys Leu Arg Alá Glu Ile Glu Asn Leu His Arg

10 15

Thr Phe Asp Pro

147

SEQ ID NO: 63 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 63 Glu Asn Leu His Arg Thr Phe Asp Pro His Phe Leu Arg Val Pro

5 10 15

Cys Trp Lys lle

SEQ ID NO: 64 (i) Sequence Characteristics:

(A) Length: 20 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 64

Tyr Asn Trp Leu His Arg Arg Leu Alá Gly Gin Phe Leu Glu Glu Leu • · ·

148

Arg Asn Pro Phe

65 (i) Sequence Characteristics:

(A) Length: 11 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 65

Alá Ser Gin Lys Arg Pro Ser Gin Arg His Gly

10

66 (i) Sequence Characteristics:

(A) Length: 11 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 66

149

Alá Ser Gin Alá Arg Pro Ser Gin Arg His Gly

10

SEQ ID NO: 67 (i) Sequence Characteristics:

(A) Length: 11 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 67

Alá Ser Gin Tyr Arg Pro Ser Gin Arg His Gly

10

SEQ ID NO: 68 (i) Sequence Characteristics:

(A) Length: 17 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 68

150

Arg His Arg Asp Thr Gly Ile Leu Asp Ser Ile Gly Arg Phe Phe Ser

10 15

Gly

SEQ ID NO: 69 (i) Sequence Characteristics:

(A) Length: 17 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide (v) Fragment type: internal (xi) Sequence description: SEQ ID NO: 69

Ile Ser Gin Alá Val His Alá Alá His Alá Glu Ile Asn Glu Alá Gly

10 15

Arg

SEQ ID NO: 70 (i) Sequence Characteristics:

(A) Length: 15 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: peptide • ··· ·· 9 «

151 (v) Fragment Type: Internal (xi) SEQ ID NO: 70

Ile Ser Gin Alá Val His Alá Alá His Alá Glu Ile Asn Glu Alá

10 15

SEQ ID NO: 71 (i) Sequence Characteristics:

(A) Length: 24 amino acids (B) Type: Amino acid (D) Topology: Linear (ii) Molecule type: Peptide (v) Fragment type: Internal (xi) Sequence description: SEQ ID NO: 71

Asp Glu Asn Pro Val Val His Phe Phe Alá Asn Ile Val Thr Pro Arg

10 15

Thr Pro Pro Pro Ser Gin Gly Lys

SEQ ID NO: 72 (i) Sequence Characteristics:

(A) Length: 12 amino acids (B) Type: amino acid

152 (D) Topology: Linear (ii) Molecule Type: Peptide (v) Fragment Type: Internal (xi) Sequence Description: SEQ ID NO: 72

His Phe Phe Alá Asn Ile Val Thr Pro Arg Thr Pro

10

SEQ ID NO: 73 (i) Sequence Characteristics:

(A) Length: 18 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: cDNA (xi) Sequence description: SEQ ID NO: 73

GAAAGGCTCC ACACACCG 18

SEQ ID NO: 74 (i) Sequence Characteristics:

(A) Length: 26 base pairs (B) Type: Nucleic acid (C) Fiber type: Single-stranded (D) Topology: Linear · «« · · * »* ····

153 (ii) Type of molecule: cDNA (xi) Sequence description: SEQ ID NO: 74

CAGAATCCGG GAAGAATGCC ACGGGC 26

SEQ ID NO: 75 (i) Sequence Characteristics:

(A) Length: 28 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: cDNA (xi) Sequence description: SEQ ID NO: 75

CAGCGGCCGC ACGGAGTTTT CCTCTCAG 28

SEQ ID NO: 76 (i) Sequence Characteristics:

(A) Length: 28 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: cDNA (xi) Sequence description: SEQ ID NO: 76 · <► · 999 »

154

CAGAATTCTC AGGTTCTCAG ATGAAGGA 28

SEQ ID NO: 77 (i) Sequence Characteristics:

(A) Length: 30 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: cDNA (xi) Sequence description: SEQ ID NO: 77

AAGCGGCCGC TATCCTTCAT CTGAGAACCT 30

SEQ ID NO: 78 (i) Sequence Characteristics:

(A) Length: 27 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Molecule type: cDNA (xi) Sequence description: SEQ ID NO: 78

CTTTTGAGCA AGTTCAGCCT GGTTAAG «Υ» · · * »·

155

SEQ ID NO: 79 (i) Sequence Characteristics:

(A) Length: 39 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: cDNA (xi) Sequence description: SEQ ID NO: 79

ACCTCGAGGA GGTGGCTTAT GAGTATTTCT TCCAGGGTA 39

SEQ ID NO: 80 (i) Sequence Characteristics:

(A) Length: 33 base pairs (B) Type: nucleic acid (C) Fiber type: single-stranded (D) Topology: linear (ii) Type of molecule: cDNA (xi) Sequence description: SEQ ID NO: 80

GGTGCGGGAA AGGTGACTCT CAGGATCCGG AAT 33 (i) Sequence Characteristics:

SEQ ID NO: 81 · «· <. · V · · · · · · · · · · · · · · · · · · ·

156 (A) Length: 33 base pairs (B) Type: Nucleic acid (C) Fiber type: Single-stranded (D) Topology: Linear (ii) Molecule type: cDNA (xi) Sequence description: SEQ ID NO: 81

ATTCCGGATC CTGAGAGTCA CCTTTCCCGC ACC 33

Claims (42)

PATENT CLAIMS BP-1 (2. No. chair- -1.2 (4. No. chair- 2.1 (6. No. chair- -2.3 (8. No. chair- MBP-2.5 (10th No. , MBP-3 (12th No. 1, MBP-4 (14th No. A composition for treating multiple sclerosis in a mammal comprising at least one peptide, said peptide being selected from the group consisting of MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4) vencia), MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9) ), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 11), MBP-3.1 (SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP- 5 (SEQ ID NO: 15), each peptide has the formula shown in Figure 2, or modifications or analogs or peptidomimetics thereof. The composition of claim 1, comprising at least one peptide selected from the group consisting of MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 14), and MBP- (SEQ ID NO: 14). 5 (SEQ ID NO: 15), each peptide follows the formula in Figure 2. The composition of claim 1, wherein the at least one peptide is MBP-4 (SEQ ID NO: 14). A composition for treating multiple sclerosis in a mammal comprising at least one MBP-derived peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4) , MBP-2 (5. MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7); MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9); • · · · J 158), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12), MBP-3.1 SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP5 (SEQ ID NO: 15), each peptide having the formula shown in Figure 2, said composition having at least 40% MBP T-cell reactivity. in a population of individuals with MBP-responsive T cells. A composition for treating multiple sclerosis in a mammal, comprising at least two MBP peptides from the following group: MBP-1 (2. SEQ ID NO: MBP-1.1 (3rd No. sequence), MBP-1.2 (4. SEQ ID NO: , MBP-2 (5th No. sequence), MBP-2.1 (6. SEQ ID NO: MBP-2.2 (7th No. sequence), MBP-2.3 (8. SEQ ID NO: MBP-2.4 (9th No. sequence), MBP-2.5 (10 . SEQ ID NO: , MBP-2.6 (11 .számú sequence), MBP-3 (12. SEQ ID NO: MBP-3.1 13th No. sequence), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15), each peptide has the formula shown in Figure 2. The composition of claim 5, wherein said at least two peptides are selected from the group consisting of MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 14) and MBP-5 (SEQ ID NO: 15), each peptide having the formula shown in Figure 2. 7. The composition of claim 5, wherein said at least two peptides comprise MBP-4. The composition of claim 5, further comprising a peptide of the following amino acid sequence group: 13 · ·· · ···· 159 25 (SEQ ID NO: 31) , 31-50 (18 . No. sequence), 61-80 (SEQ ID NO: 21), 82-92 (32nd No. sequence); 82-96 (SEQ ID NO: 33); 82-97 (34th No. sequence), 82-98 (SEQ ID NO: 35), 82-100 (30th No. sequence), 82-100 [100Ρ> Υ] (SEQ ID NO: 46), 83-100 (SEQ ID NO: 37), 83-101 (SEQ ID NO: 38), 84-97 (SEQ ID NO: 39), 84-100 (SEQ ID NO: 40), 85-100 (SEQ ID NO: 41), 86-105 (SEQ ID NO: 42), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), 88-100 (SEQ ID NO: 44), 88-99 (SEQ ID NO: 45), 111-135 (SEQ ID NO: 47), 122-140 (48) 139-170 (SEQ ID NO: 49), 141-160 (SEQ ID NO: 28), 142-166 (SEQ ID NO: 50), 142-168 (SEQ ID NO: 51), 146-160 (SEQ ID NO: SEQ ID NO: 53) and 153-170 (SEQ ID NO: 53), each of which is a 14. The composition of claim 5, further comprising at least one peptide selected from the group consisting of 13-25 (SEQ ID NO: 31); 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36); 82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46), each as shown in Figure 14. A composition for treating multiple sclerosis in a mammal comprising at least two peptides of MBP origin, at least one of which is selected from MBP-4 (SEQ ID NO: 14) and at least one peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2). ), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5) 161 • · · · · · · • · 4 ·· • · · • ·. · 1 · « • · · · • • • · • · No. ), MBP-2.6 (SEQ ID NO: 11), MBP-3 (12th No. MBP-3.1 SEQ ID NO: 13), MBP-5 (15th No. 13-25 (SEQ ID NO: 31); 87-99 (43rd No. 87-99 [91K> A] (SEQ ID NO: 36); 82 -100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46). A composition for treating multiple sclerosis in a mammal, comprising at least two MBP peptides as follows group: MBP-1 (SEQ ID NO: 2), MBP-1.1 (3rd No. sequence) , MBP-1.2 (SEQ ID NO: 4) , MBP-2 (5th No. sequence) , MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (7th No. sequence) , MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (9th No. sequence) , MBP-2.5 (SEQ ID NO: 10) , MBP-2.6 (11th No. sequence), MBP-3 (SEQ ID NO: 12), MBP-3.1 13th No. sequence), MBP-4 (SEQ ID NO: 14), and MBP-5 (15th 2), each peptide has the formula shown in Figure 2 and said composition has at least 40% of MBP T cell reactivity in a population of individuals having MBP responsive T cells. The composition of claim 5, wherein said composition comprises a sufficient percentage of total T-cell reactivity against MBP so that administering the composition to a patient with multiple sclerosis results in a restriction of the autoimmune response to multiple sclerosis. A composition for the treatment of multiple sclerosis in a mammal, comprising at least two T-cell epitope-containing peptides of MBP, said composition being selected from the group consisting of: 162 MBP-1 (SEQ ID NO: 2); MBP-2 (SEQ ID NO: 5); MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14) and MBP-5 (SEQ ID NO: 15); MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 12) and MBP-5 (15th SEQ ID NO: 2); MBP-1 .1 (SEQ ID NO: 3). , MBP- 2 (5. SEQ ID NO: MBP-4 (SEQ ID NO: 12) and MBP-5 (15th SEQ ID NO: 2); MBP-1 (SEQ ID NO: 2), MBP-2. 1 (6. SEQ ID NO: MBP-4 (SEQ ID NO: 14) and MBP-5 (15th SEQ ID NO: 2); MBP-1 (SEQ ID NO: 2), MBP-2 (SEQ ID NO: 5) . SEQ ID NO: 4, MBP-4 (14th SEQ ID NO: 5) and MBP-5 (15th No. sequence); MBP-1 .1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-4 (SEQ ID NO: 14) and MBP-5 (15th SEQ ID NO: 2); MBP-1 .1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-4 (SEQ ID NO: 14); MBP-1 (SEQ ID NO: 2), MBP second 1 (6. SEQ ID NO: MBP-4 (SEQ ID NO: 14); MBP-1 .1 (SEQ ID NO: 3), , MBP- 2 (5. SEQ ID NO: MBP-4 (SEQ ID NO: 14); MBP-1 . 1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-5 (SEQ ID NO: 15); MBP-1 . 1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-3 (SEQ ID NO: 12); MBP-1 (SEQ ID NO: 2) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (8. «· ··· 163), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11); MBP-1.1 (SEQ ID NO: 3) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (# 7 sequence), MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (# 9) sequence), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (11.számú sequence); MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11); MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2); or MBP-2.1 (SEQ ID NO: 3); MBP-1.1 (SEQ ID NO: 3), MBP-4 (SEQ ID NO: 14), and one. peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14; MBP-1.1 (SEQ ID NO: 3) and MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP -2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each shown in Figure 2; MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and MBP-4 (SEQ ID NO: 14) and a tube ···· ···· Peptide selected from 164 ports: 82-100 (SEQ ID NO: 30), 82100 [100P> Y] (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36) SEQ ID NO: 4), each shown in Figure 14; MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P] Y (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43) 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14; MBP-1.1 (SEQ ID NO: 3), MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP2 .5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each as shown in Figure 2. The composition of claim 5, comprising at least one peptide having T cell activity derived from the human myelin oligodendrocyte (MOG) protein. 16. The composition of claim 16, wherein said MOG-derived peptide is selected from the group consisting of: Human MOG 1-13 (SEQ ID NO: 54) GQFRVIGPRHPIR Human MOG 103-115 (SEQ ID NO: 55) HSYQEEAAMELKV Human MOG 1-121 (SEQ ID NO: 56) · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · r to 165 GQFRVIGPRHPIRALVGDEV ELPCRTSPGKNATGMEVGWY RPPFSRVVHLYRNGKDQDGD QAPEYRGRTELLKDAIGEGK VTLRIRNVRFSDEGGFTCFF RDHSYQEEAAMELKVEDPFYW Human MOG 1-20 (SEQ ID NO: 57) GQFRVIGPRHPIRALVGDEV; Human MOG 11-30 (SEQ ID NO: 58) PIRALVGDEVELPCRISPGK; Human MOG 21-40 (SEQ ID NO: 59) ELPCRISPGKNATGMEVGWY; Human MOG 31-50 (SEQ ID NO: 60) NATGMEVGWYRPPFSRWHL; Human MOG 141-160 (SEQ ID NO: 61) TVGLVFLCLQYRLRGKLRAE; Human MOG 151-170 (SEQ ID NO: 62) YRLRGKLRAEIENLHRTFDP; Human MOG 161-180 (SEQ ID NO: 63) IENLHRTFDPHFLRVPCWKI; and Human MOG 199-218 (SEQ ID NO: 64) YNWLHRRLAGQFLEELRNPF. The composition of claim 14, further comprising at least one peptide derived from MOG having T-cell activity. 18. An isolated peptide derived from MBP, said peptide being selected from the group consisting of MBP-1.1 (Figure 3). «· 166 No. sequence), MBP-1.2 (4. SEQ ID NO: MBP-2.1 (6 No. sequence), MBP-2.2 (7. SEQ ID NO: MBP-2.3 (8 No. sequence), MBP-2.4 (9. SEQ ID NO: MBP-2.5 (10 No. sequence), MBP-2.6 (11 .), MBP-3.1 13 No. sequence), MBP-4 (14. SEQ ID NO: and MBP- (SEQ ID NO: 15), each peptide has the formula shown in Figure 2, or modifications or analogs thereof. The isolated peptide of claim 18, wherein the peptide is MBP-4 (SEQ ID NO: 14) or an analog thereof. 20. An analog of the peptide of claim 18, wherein at least one amino acid is replaced by alanine, glutamic acid or a methyl amino acid. 21. A peptide selected from the group consisting of MBP- 2 (SEQ ID NO: 5) , MBP-2.1 (# 6 sequence), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (# 8 sequence), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (# 10) sequence), MBP 2.6 (SEQ ID NO: 11), each peptide 2 visible in which lysine (K) is replaced by alanine (A). 22. A peptide analogue of MBP-2.1 (SEQ ID NO: 6) in which lysine (K) at position 10 is replaced by alanine and the amino acid sequence of said analogue is: DENPVVHFFANIVTPRTPPSQGK (SEQ ID NO: 71). 23. A peptidomimetic of a peptide selected from the group consisting of: MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4) ·· «· * * · · · * •» · · · ··· · * · 167 cia), MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6) cia), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8) cia), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10) vencia), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12), MBP-3.1 (SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15). SEQ ID NO: 4) wherein at least one normal peptide bond is replaced by a non-peptide bond, a peptide bond analog, or a reduced bond analog. 24. A peptide selected from the group consisting of MBP1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5), MBP- 2.1 (6. No. ), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8). No. ), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10). No. ), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12). No. MBP-3.1 SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14). No. ) and MBP-5 (SEQ ID NO: 15), and that modifying by adding at least one charged amino acid residue to the N-terminus or C-terminus of said peptide, or both, to enhance the solubility of said peptide in aqueous media. 25. A peptide selected from the group consisting of MBP1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5), MBP- 2.1 (6. No. ), MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8). No. ), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10). No. ), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12). No. MBP-3.1 SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14). · «·· ···· 168), and MBP-5 (SEQ ID NO: 15), and modified by adding at least one amino acid residue to the N-terminus or C-terminus of said peptide, or both, to enhance the cellular activity of said peptide; said peptide is derived from the natural MBP protein sequence. 26. A method of treating multiple sclerosis in a mammal, comprising administering to said mammal the composition of claim 1 in an amount capable of limiting the autoimmune response in multiple sclerosis. 27. The method of claim 26, wherein said administration is selected from the group consisting of intravenous injection in a non-immunogenic form, subcutaneous injection in a non-immunogenic form, oral administration, inhalation administration, sublingual administration, transdermal administration. administration, rectal administration, or any combination thereof. 28. The method of claim 26, wherein said administration is by subcutaneous administration in a non-immunogenic form. 29. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, comprising administering to said mammal the composition of claim 1 in an amount sufficient to prevent the symptoms of multiple sclerosis. 169 30. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, comprising administering to said mammal the composition of claim 5 in an amount sufficient to prevent the symptoms of multiple sclerosis. 31. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, comprising administering to said mammal the composition of claim 10 in an amount sufficient to prevent the symptoms of multiple sclerosis. 32. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, comprising administering to said mammal the composition of claim 14 in an amount sufficient to prevent the symptoms of multiple sclerosis. 33. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, comprising administering to said mammal the composition of claim 15 in an amount sufficient to prevent the symptoms of multiple sclerosis. 34. A method of preventing multiple sclerosis in a mammal susceptible to multiple sclerosis, characterized in that said mammal according to claim 1 ···· ··· · At least two different formulations of 170 formulations are administered simultaneously or sequentially in amounts sufficient to prevent the symptoms of multiple sclerosis. 35. A method of treating multiple sclerosis in a mammal, comprising administering simultaneously or sequentially, in a single treatment episode, a combination of peptides derived from MBP, selected from the following peptide combinations: MBP-1 (SEQ ID NO: 2); MBP-2 (SEQ ID NO: 5); MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14) and MBP-5 (SEQ ID NO: 15); MBP-1.1 (SEQ ID NO: 3), MBP-2.1 (SEQ ID NO: 6), MBP-4 (SEQ ID NO: 12) and MBP-5 (15th SEQ ID NO: 2); MBP-1 .1 (SEQ ID NO: 3), , MBP- 2 (5. SEQ ID NO: MBP-4 (SEQ ID NO: 12) and MBP-5 (15th SEQ ID NO: 2); MBP-1 (SEQ ID NO: 2), MBP second 1 (6. SEQ ID NO: MBP-4 (SEQ ID NO: 14) and MBP-5 (15th SEQ ID NO: 2); MBP-1 (SEQ ID NO: 2), MBP-2 (SEQ ID NO: 5) . SEQ ID NO: 4, MBP-4 (14th SEQ ID NO: 5) and MBP-5 (15th No. sequence) ; MBP-1 . 1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-4 (SEQ ID NO: 14) and MBP-5 (15th SEQ ID NO: 2); MBP-1 .1 (SEQ ID NO: 3), MBP-2 .1 (6 . SEQ ID NO: MBP-4 (SEQ ID NO: 14); MBP-1 (SEQ ID NO: 2), MBP second 1 (6. SEQ ID NO: MBP-4 (SEQ ID NO: 14); ·· ···· · ·· «· ···· 9 · · * »·« «« «« «« · · · 171 MBP first 1 (SEQ ID NO: 3), MBP 2 (5th No. sequence), MBP-4 (SEQ ID NO: 14); MBP first 1 (SEQ ID NO: 3), MBP-2 .1 (6 . No. sequence), MBP-5 (SEQ ID NO: 15); MBP first 1 (SEQ ID NO: 3), MBP-2 .1 (6 . No. sequence), MBP-3 (SEQ ID NO: 12); MBP-1 (SEQ ID NO: 2), and a < from the group below selected peptide: MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6). MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8); MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10); MBP-2.6 (SEQ ID NO: 11); MBP-1.1 (SEQ ID NO: 3) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11); MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7), MBP -2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11); MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2); or MBP-2.1 (SEQ ID NO: 3); MBP-1.1 (SEQ ID NO: 3), MBP-4 (SEQ ID NO: 14), and one. peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82-100 [100P> Y] (SEQ ID NO: 46) • «··· ·» ··· ···· 172 87-99 (SEQ ID NO: 43), 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14; MBP-1.1 (SEQ ID NO: 3) and MBP-4 (SEQ ID NO: 14), and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP-2.3 (SEQ ID NO: 8), MBP -2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each shown in Figure 2; MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P] Y (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43) ), 87-99 [91K> A] (SEQ ID NO: 36); FIG. MBP-1.1 (SEQ ID NO: 3), MBP-5 (SEQ ID NO: 15), and MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of 82-100 (SEQ ID NO: 30), 82100 [100P] Y (SEQ ID NO: 46), 87-99 (SEQ ID NO: 43) 87-99 [91K> A] (SEQ ID NO: 36), each shown in Figure 14; MBP-1.1 (SEQ ID NO: 3), MBP-3 (SEQ ID NO: 12), MBP-4 (SEQ ID NO: 14) and a peptide selected from the group consisting of MBP-2.2 (SEQ ID NO: 7), MBP2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP2 .5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), each as shown in Figure 2. 36. Multipeptide preparation for therapeutic administration to patients with multiple sclerosis, which * ·· · 173 contains at least two MBP peptides, each peptide being soluble and stable at physiologically acceptable pH, and peptides below from group MBP-1 (Figure 2). No. sequence) , MBP-1.1 (3rd SEQ ID NO: MBP-1.2 (4. No. sequence) , MBP-2 (5th SEQ ID NO: MBP-2.1 (6. No. sequence) , MBP-2.2 (7th SEQ ID NO: MBP-2.3 (8. No. sequence) , MBP-2.4 (9th SEQ ID NO: MBP-2.5 (10. No. sequence) , MBP-2.6 (11 .), MBP-3 (12. No. sequence) , MBP-3.1 13th SEQ ID NO: MBP-4 (14. No. SEQ ID NO: 15) and MBP-5 (SEQ ID NO: 15). 37. A method of treating advanced multiple sclerosis in a mammal, comprising administering to said mammal a pharmaceutical composition comprising at least one peptide having T cell activity derived from a myelin antigen, or an analog of the peptide, which effectively limits the symptoms of multiple sclerosis. 38. The method of claim 37, wherein said myelin antigen is selected from the group consisting of myelin basic protein (MBP), myelin oligodendrocyte protein (MOG), proteolipid protein (PLP), and myelin-associated glycoprotein (MAG). . 39. The method of claim 37, wherein said administration is in the acute phase of multiple sclerosis. ·· ···· 174 40. The method of claim 37, wherein said administration is in remission of multiple sclerosis disease symptoms. 41. The method of claim 37, wherein said peptide comprises a peptide analogue having MHC-binding affinity, which MHC-binding affinity is higher than the MHC-binding affinity of the peptide from which the analogue is derived. 42. A method of treating advanced multiple sclerosis in a mammal, comprising administering to said mammal a pharmaceutical composition comprising at least one MBP peptide and said peptide selected from the group consisting of MBP-1 (SEQ ID NO: 2). ), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5), MBP-2.1 (SEQ ID NO: 6), MBP-2.2 (SEQ ID NO: 7) ), MBP-2.3 (SEQ ID NO: 8), MBP-2.4 (SEQ ID NO: 9), MBP-2.5 (SEQ ID NO: 10), MBP-2.6 (SEQ ID NO: 11), MBP-3 (SEQ ID NO: 12) ), MBP-3.1 (SEQ ID NO: 13), MBP-4 (SEQ ID NO: 14), and MBP-5 (SEQ ID NO: 15), each as shown in Figures 2 or 14, or an analog of said peptide in an amount sufficient to limit the symptoms of multiple sclerosis. 43. The method of claim 42, wherein the at least one peptide is selected from the group consisting of MBP-1 (SEQ ID NO: 2), MBP-1.1 (SEQ ID NO: 3), MBP-1.2 (SEQ ID NO: 4), MBP-2 (SEQ ID NO: 5),