JPH10504039A - Compositions and treatments for multiple sclerosis - Google Patents

Abstract

  (57) [Summary] The present invention relates to isolated peptides derived from myelin autoantigens (eg, MBP, MOG, PLP, and MAG) suitable for treating multiple sclerosis, including prophylactic and therapeutic compositions. Peptide combinations and methods for preventing or treating multiple sclerosis are provided. A preferred composition of the invention comprises at least one isolated and purified peptide, which is free of all other polypeptides or contaminants, the peptide comprising the amino acid sequence of a myelin autoantigen having T cell activity including. Therapeutic compositions of the invention are capable of down-regulating an autoantigen-specific immune response to myelin autoantigen in a human population suffering from or suspected of having multiple sclerosis, resulting in disease Symptoms are reduced, eliminated, or reversed, and / or the onset or progression of disease symptoms is arrested or slowed. In addition, when administered during the advanced stages of the disease, the compositions and methods of the present invention may reverse ongoing paralysis or other signs of the disease when administered during the acute phase of the disease, or may be in remission. When administered to prevent recurrence.

Description

DETAILED DESCRIPTION OF THE INVENTION               Compositions and treatments for multiple sclerosisRelated application   This application is related to US Ser. No. 08 / 328,2, filed Oct. 25, 1994. No. 24 is a continuation-in-part application. The present application is also based on a US application filed on September 1, 1994. It is also a continuation-in-part application of National Patent No. 08 / 300,811. No. 08 / 116,824 filed Sep. 3, 2013 is there. This application is further directed to U.S. patent application Ser. No. 08/24, filed May 10, 1994. No. 1,246 is a continuation-in-part application. The earlier application is incorporated herein by reference in its entirety. It is taken in.Background of the Invention   Autoimmune diseases are a major human health problem and relatively poorly understood There are many points. Microbial or bacterial that seems to be a direct cause Prevention, treatment, and diagnosis of such diseases are not possible because there is no culprit. Must be based on the etiology of the case. The disease always involves endogenous metabolic intermediates and It involves a series of complex reactions, including structural and structural components and bacteria. However, self-exempt Implicit in the nature of the epidemic is that at least one self-antigen has this symptom. Is a concept that must be involved in producing a series of phenomena. For example Autoimmune demyelinating diseases such as multiple sclerosis are no exception.   MS usually takes the form of recurrent seizures that reflect lesions in the central nervous system (CNS). You. Seizures recur, seem to be random over many years, remit, and And recur. The frequency of relapses during the first 3-4 years of the disease Maximum, but may be too mild to be considered for medical treatment, and The first seizure, which can hardly recur, should not be affected by the next seizure for 10 to 20 years. There is. The extent of recovery after the onset of symptoms varies significantly between patients. Remission is especially the first May be perfect after a seizure; however, remission is incomplete and Seizures occur one after another, worsening gradually with the extension of permanent defect status Frequently, progression of the pathology results. MS clinical picture Is determined by the location of the demyelinating foci in the CNS. The classic features are visual impairment, Eye vibration, paralytic dysarthria, decreased perception of vibration and position, and ataxia and And intention tremor, weakness or paralysis of one or more extremities, spasticity, and bladder Bladder disorder. The criteria for the diagnosis of clinically distinct MS are at least two gods Manifestation of symptoms of transcutaneous deficits and objective clinical signs of more than one lesion in the CNS Must include a reliable medical history. Effective treatments for MS Not known at all. At present, the onset of acute medical conditions has improved and the disease has recurred. Or therapeutic efforts to prevent progression. (Harriso n's Principles of Internal Medicine, 12th Edition, Vol. 2, pp. 2038-2043, McG raw Hill, 1991).   An animal model commonly used in human multiple sclerosis is experimental allergic cerebral spine Myelitis (EAE), which includes myelin basic protein (MBP), proteolipi Protein (PLP), myelin oligodendrocyte protein (MOG), or these Immunization with Synthetic Peptides Based on the Sequence of Myelin-Related Protein A central god that can be induced in Us strains It is a transmyelinating demyelinating disease. MBP is hypothesized in multiple sclerosis (MS) One of the self-antigens identified and is human (Ota et al., Natu re, 346: 183-187 (1990)) and rodents (Zamville). t al. , Nature, 324: 258-260 (1986)). The pitope is mapped. At least one T cell epitope of MBP Are considered to contain WO 93/21222, EP 0   No. 304 279, WO 91/15225, Ota et al. , Letters to Nature, 346: 183-187 (1990); Wucherpfenning et al. J. Exp. Med. , 170 : 279-290 (1994). Other MBP T cell A pitope-containing peptide is disclosed in US Patent No. 08 / 328,224 (January 1994). U.S. Patent Application Serial No. 08 / 241,246, filed October 25) and U.S. Patent No. 08 / 241,246 (1994). (Filed May 10, 2010), which are hereby incorporated by reference in their entirety. Incorporated). MOG protein having T cell activity is In US patent application Ser. No. 08 / 300,811 which is incorporated herein by reference. Have been identified.   Proteolipid protein (PLP) and myelin-related glycoprotein (MAG) Has been suggested as a possible autoantigen in multiple sclerosis. For multiple sclerosis Studies describing the etiology of the autoimmune response to PLP in Trotter   et al. J. Neuroimmunol. 33: 55-62 (199). 1); the T cell epitope of PLP is Pelfrey e t al. J. Neuro immunol. , 46: 33-42 (1993). Multiple hard Studies describing MAG as a possible autoantigen in keratosis have been reported by Johnson et al. J. Neuroimmunol. , 13: 99-108 (198 6).   Experimental autoimmune encephalomyelitis (EAE) is a CD4 + T cell-mediated autoimmune disease Which is similar to multiple sclerosis in some aspects of clinical and histological characteristics. And serve as an experimental model for this and other autoimmune diseases One. EAE is an inflammatory disease of the central nervous system that can cause paralysis and other neurological abnormalities. Sprinkle. It is typically induced with purified myelin proteins and peptides. You. Nevertheless, this EAE model was designed to examine the mechanisms of autoimmunity. And to explore promising therapeutics for autoimmune diseases Used.   As early as 1965, EAE was cured by administration of MBP in a non-encephalitis-inducing form. The finding has been obtained that this is probably due to immunological unresponsiveness; That is, it seems to be due to induction of tolerance (Alvord, EC, et a. l. Ann. NY Acad Sci. , 1965, 122: 333, Lev. ine, S.M. E. FIG. , Et al. , Science, 1968, 161: 115. 5, Bernard, C.I. C. A. , 1977 Clin. Exp. Immun ol. , 1977, 29: 100). This early finding has evolved over the past few years And many investigators reported that MBP and MBP peptides to neonates and adults Has been shown to avoid EAE (Bernard, CC). A. , 1977 Clin. Exp. Immunol. , 1977, 29: 100, Clayton, J.M. P. , Et al. J. Exp. Med . 1989, 169: 1681, Smilek, D .; E. FIG. , Et al. , P rc. Nat'l. Acad. Sci. 1991, 88: 9633, Gua. r, A. , Et al. Science, 1992, 258: 1491, Me. tzler, B .; et al. , Int. Immunol, 1993, 5:11 59, Miller, A .; et al. J. Neuroimmunol. , 1 993, 46:73, Citchfield, J. M .; M. , Et al. , Sc ence, 1994, 263: 1139; Miller, A .; , Et al. Proc. Nat'l. Acad. Sci. USA, 1992, 89:42. 1). These studies suggest various routes of administration, including subcutaneous, Includes intramembrane, intranasal, intravenous, and oral administration. Intravenous peptide Induces immunological unresponsiveness in adult animals upon administration is shown in a wide variety of antigen systems Have been. For many of the reasons described herein, oral administration of autoantigens, There are constraints on the clinical applicability of enteral or aerosol administration, For example, once it is taken up into the stomach, it results from subsequent enzymatic degradation in the stomach. Disability characterized by the active ingredient of a therapeutic composition. Therefore, it is predictable Achieving a recognizable and reproducible therapeutic effect using these methods; and The unpredictable consequences of further processing of the drug in the body It can also be difficult to describe the potential for adverse side effects.   The mechanism of disease prevention or tolerance induction in most of these cases is Lone anergy (Gaur et al., Supra), peripheral lack Loss (peripheral deletion) (Citchfield e t al. ), Or other forms of antigen-specific tolerance I have. However, TGF-β-mediated bystander suppression is an additional mechanism. By this mechanism, MBP and M administered orally. The BP peptide may inhibit EAE (Miller et al., Supra). Proc. Nat'l Acad. Sci. ). MBP peptide and location The converted MBP peptide analog is PLJ, B10. PL and (PLJ × (SJL) is being investigated as another therapeutic agent for EAE in F1 mice. MBP Ac1-11 is an immunodominant encephalitis-inducing peptide for each of these strains. And Aα^uAβ^u(Wraith, DC et. Al.)   al. , Above). MBP Ac1-11 studied extensively by displacement analysis And T cell recognition and major histocompatibility complex (MHC) binding The requirements for are well established. Residues 3 and 6 have mainly T cell recognition While contributing to insight, the side chains of residues 4 and 5 primarily contribute to MHC binding. Aα^u Aβ^uThe binding of MBPAc1-11 to a variety of amino acid substitutions at residue 4 (this It is composed of alanine (Ac1-11 [4A]) and tyrosine (Ac1-11 [4Y]. ]))) (Wraith, DC) . , Et al. See above, Fairchild, P .; J. et al. , Int . Immunol. 1993, 5: 1151). Residue 4 substitution, especially with tyrosine Are responsible for the stability of the peptide-MHC complex formed with these peptides. Seems to improve. Ac1-11 [4A] and Ac1-11 [4Y] T cells required for antigenicity Retains sceptor (TCR) contact residues and in vitro MBP-specific T cells More potent than MBP Ac1-11 in stimulating vesicles. Ac1-11 [4 Y] is also encephalitogenic in vivo (Ac1-11 [4A] is unknown for reasons) But not very encephalogenic). Ac1-11 [4A] and Ac1-11 Both [4Y] have been shown to evade EAE, and antigen-specific mechanisms (Smilek, et. Al., Supra, Wraith, D .; C. et al. , Above).   Previous studies have shown that MB administered in incomplete adjuvant immediately before disease onset Subsequent progression of EAE was avoided by the P peptide or peptide analog ( Smilek, et al. See, Gaur et al., Supra. , Above). MBP -Another study using lymphocytes from specific TCR transgenic mice Adopted EAE is early and aggressive for intravenous MBP prior to onset of clinical signs (Citchfield, et al. Supra). This In these studies, MBP peptide was injected after encephalitis-induced T cells were activated. It has been shown that it is possible to avoid EAE by doing Studies have shown that paralysis (and possibly progressive) Whether central nervous system inflammation) can be reversed or relapse after remission It does not state whether it can be avoided. In addition, other research In some of the previous experiments by the investigators, extremes of MBP or MBP peptides were Frequently higher doses were required for effective treatment. The present inventor Example (US Patent Application filed October 25, 1994 and continued herewith) 08/328, 224) was the first inventor to describe a relapse of paralysis as well as a relapse after remission. there were. Other researchers working in the art also filed for the inventors' previous case applications. Prevents progressive paralysis in EAE by injecting certain MBP-derived peptide analogs Are surprised to find what they can do (Karin et al., J. Exp. Med. , 180: 2227-2237 (December 1994)).   The present invention overcomes the shortcomings described above and includes the T cell activity of MBP. Using a preparation comprising at least one peptide having an amino acid residue of the sequence Novel peptides, compositions, and methods for treating multiple sclerosis are provided. In addition, the present invention provides for the general applicability of peptides or peptides. Treatment for multiple sclerosis with peptide analogues is in the later stages of the course, Stages of progression (either remission or relapse, during which undesired Immune response is ongoing) must be effective when administered It deals with unresolved issues.   Peptides and peptide combinations suitable as therapeutics for multiple sclerosis It is an object of the present invention to provide a combination, which prevents the onset of this disease. Are also included. Further identified proteins and peptides for effective treatment of MS And a prophylactically and therapeutically effective drug regimen for peptide analogs, and It is another object of the invention to identify the mode of administration. MS in late stage Sow treatment, prevent paralysis, prevent disease, and / or reverse the progression of MS It is yet another object of the present invention to identify the treatment to be effected.Summary of the Invention :   The present invention relates to a prophylactic and therapeutic combination for preventing or treating multiple sclerosis. Myelin self suitable for treating multiple sclerosis, including products and methods Isolated from antigens (eg, MBP, MOG, PLP, and MAG) Provided are peptides and peptide combinations. Preferred compositions of the present invention include At least one unit, substantially free of any other polypeptides or contaminants; Isolated and purified peptide, which is a myelin having T cell activity Contains the amino acid sequence of the autoantigen. Therapeutic compositions of the invention suffer from multiple sclerosis. In a human population that is or is suspected of having It is possible to down-regulate the autoantigen-specific immune response, Results in a reduction, elimination or regression of the disease symptoms and / or the onset of the disease symptoms The disease or progression is prevented or slowed. Additionally, administration at the stage of disease progression When administered during the acute phase of the disease, the compositions and methods of the present invention Reversed paralysis or other signs of disease during treatment or given during remission If so, prevent recurrence.BRIEF DESCRIPTION OF THE FIGURES   FIG. 1 shows the full-length amino acid sequence of human MBP, which is further referred to herein. The numbering of amino acid residues is shown.   FIG. 2 shows the amino acid sequence of a preferred peptide derived from MBP.   FIG. 3 shows the overlapping peptide used in Example 1 as well as the longer peptide. 3 shows the acid sequence.   FIG. 4a shows the percentage of total MBP response for each peptide shown in FIG. Is a graph display. MBP activity was also determined for one of the MBP peptides MBP in individual patients of each group that showed a positive rating Calculated based on the percentage of positive microtiter cultures. Total MBP Positive microtiter cultures were 19-43 for each group tested for each peptide. In human patients, it ranged from 89 to 184.   FIG. 4b shows the percentage of MBP responders recognizing each peptide shown in FIG. It is a graph display of a rate. Patients will have a small fraction of each microtiter culture. If at least one has a positive rating for MBP reactivity, I considered it. Of the 19-43 patients in each group tested for each peptide, 1 There were 2-31 MBP responders. Peptide reactivity is the MBP peptide At least one microtiter culture that showed a positive rating for one of the Was calculated based on the percentage of MBP responders in each group.   FIG. 5a shows the intravenous (IV) of MBP Ac1-11 alone when compared to the control. . ) Average clinical rating of mice treated with injections over a period of 0-40 days after disease induction It is a graph of a value.   FIG. 5b shows MBP Ac1-11 and MBP31-47 as compared to control. 0-4 after induction of disease in mice treated with intravenous (IV) injection of the combination of FIG. 4 is a graph of the average clinical rating over a period of 0 days.   FIG. 5c shows OVA 323-339 intravenous (IV. ) Average clinical rating of injection-treated mice over a period of 0-40 days after disease induction It is a graph of.   FIG. 6a shows Ac1-11 [4Y] or Ac1-11 when compared to control. 0 to at least after disease induction in subjects treated with any of the following 250 nmol injections: FIG. 5 is a graph of the average clinical rating over a 30 day period.   FIG. 6b shows 2.5 nmol of Ac1-11 [4Y] when compared to the control. Clinic over a period from day 0 to at least 30 days after disease induction in mice treated with It is a graph of a rating value.   FIG. 6c shows a mouse treated with 2.5 nmol of Ac1-11 as compared to a control. Of average clinical ratings over a period from day 0 to at least 30 days after disease induction in cancer It is.   FIG. 7 shows the average histological score of peptide-treated mice versus control-treated mice. Is a bar graph showing lower ratings for inflammatory central nervous system (C NS) means reduced number and severity of infiltrated lesions.   FIG. 8 shows that mice were injected 0-10 days after injection of 250 nmol of Ac1-11 [4Y]. 4 is a bar graph depicting relative T cell activation over time.   FIG. 9 shows 250 nM versus control PBS and OVA 323-337. 7 is a graph comparing treatment of mice with Ac1-11 [4Y].   FIG. 10 shows that control was initiated during remission with 25 nmol Ac1-11 [4Y] relative to control. 7 is a graph showing a comparison of different treatments.   FIG. 11a shows that with 250 nmol MBP Ac1-11 as compared to the control. In vitro lymph node proliferation in mice treated with intravenous (IV) pretreatment (3H- (Indicated as thymidine incorporation).   FIG. 11b shows the pre-treatment with Ac1-11 [4Y] as compared to the control. Relative lymph node IL2 production in response to MBP Ac1-11 It is a bar graph shown.   FIG. 12a shows two groups of 10 (SJL × TLP) F₁EA in adult female mice FIG. 9 is a graphical representation of an experiment showing the effect of IFN-β on E; In these mice, EAE was measured on day 0 with complete adjuvant plus moles of pertussis toxin. Induced with Mott MBP and incomplete Freund's Administered alone (control) or on days 9, 12, 16, and 20 Treated with intraperitoneal administration (ip) of 2000 units of IFN-β (x-axis) (Indicated by an arrow), the Y-axis is the average clinical rating for each group (MCS), 0 = no clinical signs of EAE, 1 = lameness, tail unresponsiveness, 2 = partial paralysis of hind legs, 3 = complete paralysis of hind legs, 4 = partial to complete paralysis of front legs, And 5 = moribund.   FIG. 12b shows two groups of 10 (SJL × TLP) F₁MB in adult female mice FIG. 2 is a graphical representation of an experiment showing the effect of P-peptide Ac1-11; EAE is a complete adjuvant plus guinea pig MBP in pertussis venom on day 0 Induced and administered PBS (control) or 10, 13, 17, or And whether treatment with intravenous 250 nmol of Ac1-11 on day 21 ( (indicated by arrows on the x-axis), the Y-axis being described for FIG. Mean clinical rating for each group.   FIG. 12c shows two groups of 10 (SJL × TLP) F₁EA in adult female mice Of MBP peptide Ac1-11 administered in combination with IFN-β in E FIG. 4 is a graphical representation of an experiment showing the effect, in which EAE was completely complete on day 0 in these mice. Induced with guinea pig MBP in adjuvant plus pertussis venom and PBS ( Control) or 250 nM on days 10, 13, 17, and 21. (Shown by the white arrow on the x-axis). ) And 9, 12, Intraperitoneal administration (ip) of 2000 units of IFN-β on days 16 and 20 Either to treat (indicated by the solid arrow on the x-axis), 1 represents the average clinical rating described for 1a.   FIG. 13 shows two groups of 10 (SJL × TLP) F₁Induction EA in adult female mice E at different doses of IFN-β (10,000 units and 2,000, respectively) Is a graph showing the effect of the guinea pig MBP plasmid on day 0. Induced by pertussis toxin and given PBS (control) or 9,13 On day 16, intraperitoneal administration of 10,000 units and 2000 units of IFN-β (Ip) treatment (indicated by solid arrows on the x-axis) The Y axis represents the average clinical rating described for FIG. 1a.   FIG. 14 shows various MBP-derived products that may be suitable for the compositions and methods of the present invention. 2 shows a peptide.   FIG. 15 is shown in FIGS. 4 a and 4 b and described in Example 1. % Of individuals responding to each peptide (x-axis) derived from the same experimental data Of the positive index (y-axis) (mean SI / MBP responder) Display.Detailed description of the invention   The invention and the scientific literature cited herein will be useful to those skilled in the art. Knowledge is confirmed. United States patents, PCT publications, and other references cited herein. Publications, which have already been published, are incorporated herein by reference. .   SUMMARY OF THE INVENTION The present invention relates to a single myelin autoantigen derived from Isolated peptides and their combinations and multiple occurrences Provided are therapeutic compositions and methods for treating multiple sclerosis. For use herein When used, the term "treating multiple sclerosis" is: a mammal susceptible to MS Treatment for early onset of MS; and relapsing-remitting MS, chronic progression M of all "advanced stages", including tolerant MS, primary progressive MS, and benign MS Including treatment for S. The therapeutic composition of the present invention may comprise substantially all other proteins or Is a specified distribution of myelin antigen that is free of contaminants and has T cell stimulating activity. Comprising at least one purified peptide comprising a sequence of amino acid residues, and May also be an isolated peptide. As used herein Sometimes the term "isolated" refers to all other polypeptides, contaminants, starting reagents, Or a peptide that does not contain other substances and is not bound to any other molecule Means   According to the present invention, a "peptide" is an amino acid that is unique when compared to the amino acids of a natural protein antigen. Means a specified sequence of fewer amino acid residues. The peptide of the present invention is probably Is at least about 7 amino acid residues in length, and preferably at least about 12 ~ 40 amino acid residues in length, and more preferably at least 13-30 Includes the length of the amino acid residue, and when derived from a protein antigen, Fewer protein antigens and preferably about 7% of the total protein antigens It preferably contains no more than 5% amino acid residues. Used according to the invention Some peptides have T cell activity. Peptides having “T cell activity” are as follows: May retain any one or more of the following sexes: a) T cell response (Eg, stimulation (ie, proliferation or lymphokine secretion): b) producing a T cell unresponsiveness in the appropriate T cell subpopulation, Or the ability to reduce T-cell responsiveness (so that those T-cell subpopulations Ceases to be involved in stimulating an immune response to jade self-antigens (for example, Via anergy, tolerance or apoptosis)); c) naturally occurring self Ability to alter lymphokine secretion profile when compared to exposure to self antigen D) the ability to cause induction of T suppressor cells; and e) any of Down-regulation of autoimmune disease symptoms Or f) is derived from a bystander antigen and is myelin autoimmune Retains the ability to induce suppressor T cells at the site of the attack, which in turn This results in a down-regulation of the immune response at the site of an Erin autoimmune attack.   Peptides comprising at least one T cell epitope have T cell activity, and T cell response, eg, T cell stimulation (ie, T cell proliferation or Cain secretion) and / or autoantigen-specific T cells Autologous cells that may result in reduced cell response or self-antigen-specific T cell response levels It is possible to downregulate antigen-specific T cell responses. T thin Vesicle epitope is the basic factor, or minimum unit, of recognition by T cell receptors. In this case, this epitope contains amino acids essential for receptor recognition. T Cell epitopes help initiate and perpetuate immune responses to antigens or self-antigens It is believed to be involved. These T cell epitopes are Binding to appropriate HLA molecules on the surface and stimulating appropriate T cell subpopulations Thought to trigger the initial immune response phenomenon at the level of T helper cells Have been. Due to these phenomena, T cell proliferation, Lymphokine secretion, local inflammatory response, recruitment of additional immune cells to the site, And activation of the B-cell cascade leading to antibody production. Autoimmune disease In the case of the disease, the antibodies produced are self-antibodies against self-antigens such as MBP. The body, and the autoantibodies cause clinical symptoms of an autoimmune disease.   A peptide having the specified amino acid composition and comprising a T cell epitope is identified as M Any myelin autoantigen may be identified, including BP. One The method comprises dividing the protein antigen into non-redundant or redundant peptides of a desired length, The peptides are then synthesized, purified, and tested for any number of assays. A (T cell proliferation assay, lymphokine secretion assay, and T cell Investigation of non-response) is used to identify at least one T cell epitope of MBP Determining whether or not the tide contains. In another approach, T cell epithelium Algorithms are used to predict peptides likely to contain After that, the peptide predicted by the algorithm is synthesized, purified, and Tested by T cell assays or in vivo studies Peptide predicted to be T cell proliferation or lymphokine secretion or T cell To generate a response and therefore likely to contain a T cell epitope decide. As discussed in many of the references cited above, human T cell activity is For example, T cells obtained from an individual sensitive to a self-antigen such as MBP Incubate with a peptide derived from the antigen and respond to the peptide to form a T cell. Vesicle growth (measured by cellular uptake of tritiated thymidine, for example) Can be checked by determining whether or not to occur. Pep The stimulation index for the response by T cells to tide is the control count (CPM) Divided as the maximum count per minute (CPM) in response to a peptide Can be calculated. Equal to or twice the background level And preferably more than 3 fold T cell stimulation is considered "positive". Positive result is true Peptide potential therapeutic efficacy as discussed later in the specification and in Example 1 (ap eptide potential therapeutic effecti Venes) analysis. Preferred Peptides Useful According to the Invention Is at least one T cell epitope and preferably at least two Contains a higher number of T cell epitopes.   One algorithm for predicting peptides with T cell stimulatory activity is R othbard, 1st Forum in Virology, Annals   of the Pasteur Institute, pp 518-526 (December 1986), Rothbard and Taylor, Embo, 7: 93-100 (1988), and EP 0 304 279. Have been. These references describe the binding of peptides to class II MHC. General pattern (algorithm), its statistical significance, and known T cells Identify the association of that pattern with epitopes, as well as various protein In predicting previously unidentified T cell epitopes of the original and autoantigens The successful use case is reported. Class II M as reported in the literature already mentioned The general pattern for peptides known to bind well to HC is , A charged amino acid residue or glycine, followed by two hydrophobic residues To include a straight line pattern Will be After determining whether a peptide fits the general pattern, The peptide can be tested for T cell reactivity. Previously unspecified Other algorithms that have been used to predict T cell epitopes of existing proteins Are described in Margalit et al. J. Immunol. , 138: 22 13-2229 (1987), which includes It is based on a medium helix model.   Additional peptides containing “latent T cell epitopes” may be determined, and It is also useful in the methods and compositions of the present invention. Latent T cell epitopes Due to processing and presentation of natural protein antigens to appropriate MHC molecules Determinants in protein antigens that are not normally involved in the immune system. But Thus, peptides containing latent T cell epitopes can cause T cells to become unresponsive And when a subject receives a first immunization with the peptide, T cells obtained from the subject are the peptide or the protein from which the peptide has been obtained. Will proliferate in response to white matter antigens in vitro. Derived from a certain protein antigen Peptides containing at least one latent T cell epitope are referred to herein as "latent Peptides ". To confirm the presence of a latent T cell epitope, Establish individual peptide-reactive T cell lines known in the art For the purpose, T cells primed with the antigen are cultured in vitro in the presence of each peptide. May be used. Peptides define a T cell line Can be established using the peptide and the T cell Peptides can grow upon challenge with the resulting protein antigen In some cases, It is considered to contain at least one latent T cell.   In addition, the peptides used according to the method of the invention may be, for example, MBP. It is not necessary to derive from the amino acid sequence of such a myelin autoantigen. Identified -Specific Immune Response to Myelin Autoantigen Containing Amino Acid Residues of Different Sequences Any peptide capable of down-regulating It may be used according to the method. For example, identification not based on the myelin antigen amino acid sequence Down-regulation of an antigen-specific immune response containing A peptide capable of performing a translation may be synthesized, for example, The peptide mimics the T cell epitope of myelin autoantigen and Is it possible to down-regulate the immune response to Causes down regulation of the immune response for other reasons, one example of which is Peptides such as those derived from standard antigens. Tied to any logic If not, it is also tissue-specific (but not the target of an immune or autoimmune attack) No) Bystander antigen induces suppressor T cells at site of immune attack May retain its ability, which in turn may be localized to the immune attack (eg, autoimmune "Self" tissue affected in disease cases or nasal mucosa in allergy cases Down-regulation of the immune response in membranes, skin, and lungs) Good. Bystander antigens are not limited, but are themselves immune attacks Antigens or autoantibodies that are not targets and retain inhibitory activity at the site of the immune attack Includes self-antigen part. As used herein, the term "myelin antigen" or Indicates that "myelin autoantigen" retains inhibitory activity at the site of myelin autoimmune attack Bystander antigens may be included.   In addition, down-regulation of antigen-specific immune responses to myelin autoantigens Any compound that mimics a peptide capable of performing a Accordingly, it may be used (eg, a peptidomimetic). Such compounds are Although the whole does not have to be composed of subunits linked by peptide bonds, However, the non-peptide compound may induce an antigen-specific immune response against the antigen of interest. If unregulation is possible (this is an effective cure for symptoms) Other linkages (e.g., thiol ester linkages, as indicated by therapeutic / prophylactic treatment) , A reduced bond analog, an amide bond isosterase) Good. Peptidomimetics can be based on any of the peptides of the invention. But instead of one or more normal peptide bonds e.g. peptide bonds Analog (in one example, N-methylamide bond NH-C_a2[-CO-NCH_Three− ] C_a1) And reduced analog (NH-C_a2[-CH_Two-NH-] C_{a 1} ) May be included.   Once the T cell epitope-containing peptide has been isolated, it may be necessary to increase its solubility. (This is particularly desirable if the composition is to be injected), therapeutic or Is to enhance the prophylactic effect (the following peptide agents with enhanced MHC binding) See Nalog's discussion) or increased stability (eg, ex vivo) Shelf life and resistance to proteolysis in vivo) or pepti For such purposes as the simplicity of the synthesis of such It is also possible to modify the structure of a simple peptide. Modified peptide or peptide Peptide analogs can be produced and such peptides or peptide In the case of a nalog, the modified amino acid is compared to the native protein sequence from which it was obtained. Compared to the unmodified peptide from which the modified peptide is to be obtained The amino acid sequence alters immunogenicity or improves peptide solubility Or enhance the simplicity of peptide synthesis (eg, automated peptide synthesis) They have been modified for purposes such as amino acid substitution, deletion, or addition.   For example, a peptide could be used to improve autoimmune response in MS, if not improved. At least the ability to down-regulate the answer is retained (eg, T To enhance cell unresponsiveness or decrease T cell responsiveness), and Can be modified to still retain the ability to bind to MHC proteins . In this case, the binding residues important for the T-cell receptor use known techniques. (Eg, the substitution of each residue, as well as the presence of T cell reactivity). Determination of presence or absence). Essential for interacting with T cell receptors Residues that have been shown to be compatible with other amino acid residues, preferably similar amino acid residues. (Conservative substitution) by substituting essential amino acids with May enhance or decrease T cell activity, but may abolish that activity. Alternatively, it has been shown that the activity may not be affected). It In addition, amino acid residues that are not essential for T cell receptor interaction Uptake may increase or decrease T-cell activity, but may remove that activity May have no effect on its activity, but remove binding to the appropriate MHC Can be modified by substitution with another amino acid that does not. in addition In addition, the peptide of the present invention is essential for interaction with the MHC protein complex. Is replaced by another amino acid, preferably a similar amino acid. It can be modified by substitution with an acid residue (conservative substitution) Enhances or reduces T cell activity, but either removes that activity or Has not been shown to have an effect on In addition, MHC protein complex Not essential for interaction with coalescence, but still MHC protein complex Uptake of amino acid residues that bind to the body may enhance T cell reactivity, It may have no effect on its activity, or it may have its activity reduced, Modification by substitution with another amino acid that does not eliminate its activity Can be. Preferred amino acid substitutions for non-essential amino acids are not limited None, but includes substitutions with alanine, glutamic acid, or methyl amino acids. one By way of example, WO 94/06828 states that essentially all amino acid residues are retained. Substituted with an existing amino acid, an amino acid not found in nature, or alanine That describes a substituted peptide that may Pide can still downregulate antigen-specific immune responses Noh. In another example, Karin et al. J. Exp. Med . 180: 2227-2237 (1994) are shown in FIGS. Using an analog of the immunodominant rat epitope of MBP having a number of amino acid residues Describes the study. These analogs have each of the 87-99 peptides 87-9 that differs from the original 87-99 peptide by a single alanine substitution at position A series of 13 substituted peptides based on 9 sequences. These studies are immunodominant Hypothetical peptide interacts with HC and TCR in Lewis rats Site with improved desired characteristics for possible therapeutic use at the same time Set up to elucidate Was measured. These studies show that the peptide at position 91 of the 87-99 peptide (K) with alanine (A) (see 87-99 [K> A] in FIG. 14). Shows that EAE is prevented and reversed in Lewis rats Was. Based on this information, the amino acid sequence (ie, MBP-2, MBP-2 . 1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, And 87-99 sequences within MBP-2.6 and MBP-2.6 (all of which are shown in FIG. 2). (Ie, MBP-2, MBP-2.1, MBP-2.2, MBP -2.3, MBP-2.4, MBP-2.5, and MBP-2.6 (all of them) 2) is the only lysine (K) present within Substitution of alanine (A) further increases the T cell activity of the substituted peptide. It is expected that For example, the MBP-2.1 peptide (ie, DENPVVHFFALysine (K) at position 10 of NIVTPRTPPPSQGK) MBP-2.1 substituted with alanine in place of the “parent” MBP-2.1 peptide Shows increased T cell activity when compared to Tide, and thus increased therapeutic properties May be brought.   For the purpose of enhancing stability and / or reactivity, naturally occurring allelic variants Incorporates one or more polymorphisms into the amino acid sequence of a protein antigen resulting from The peptide can also be modified to cause In addition, D-amino acids, Naturally, the scope of the present invention by substituting or adding amino acids or non-amino acid analogs The modified protein or peptide contained therein can be produced. In addition The light peptide is A.I. Sehon and co-workers (Wie et al., Supra) Modified using the polyethylene glycol (PEG) method of Form the body Protein or peptide can be produced. In addition, PEG is a book It can be added during the chemical synthesis of the protein or peptide of the invention. peptide Alternatively, the modification of the portion is further carried out by reduction / alkylation (Tarr in: Meth ods of Protein Microcharacterization J. E. FIG. Silver ed. Humana Press, Lifton , NJ. pp. 155-194 (1986)): acylation (Tarr, supra): Chemical coupling to a suitable carrier (Mischel and Shiigi , Eds. , Selected Methods in Cellular I Munology, WH Freeman, San Francisco, C A (1980): U.S. Pat. No. 4,939,239); Processing (Marsh International Archives of Allergy and Applied Immunology, 41:19 9-215 (1971)).   Facilitates and, if possible, purifies the protein or peptide of the present invention. To increase their solubility, a reporter group (if any) is added to the peptide backbone. Or a plurality) can be added. For example, polyhistidine is Metal ion affinity chromatography immobilized on peptide by addition to tide (Hochuli, E. et al., Bio / Technology, 6: 1321-1325 (1988)). In addition, To facilitate the isolation of peptides that do not contain irrelevant sequences, In this case, a specific endoprotease cleavage site is added to a reporter group and a certain peptide. It can be introduced between the amino acid sequence. T cell episode within a peptide To facilitate proper antigen processing of the tope, if possible, Canonical protease sensitivity between regions containing at least one T cell epitope Sites can be created recombinantly or synthetically. For example, charged amino acids Pairs (in one example, KK or RR) are added to the peptide during recombinant construction of a peptide. It can be incorporated between regions within the tide. If the resulting peptide contains one For producing portions of a peptide comprising multiple T cell epitopes And / or may be rendered susceptible to other trypsin-like enzyme cleavage.   Another example of modification of a peptide is dimer formation via disulfide bonds. Of cysteine residues for minimization, preferably serine, threonine, leu Substitution with syn or glutamic acid. In addition, peptides, By adding a functional group to the terminal portion of the peptide of By not including a hydrophobic moiety within, for example, a pharmaceutically acceptable carrier Increase the solubility of the peptide for use in aqueous buffer solutions such as excipients The peptide may be modified to cause For example, to increase solubility Charged amino acids, or charged amino acid pairs or triplets, It may be added at the boxyl end or the amino end, or both. Charged net Examples of noric acids include arginine (R), lysine (K), histidine (H), glutamine Acid (E), and aspartic acid (D). For example, automatic peptide synthesis For the simplification of peptide synthesis as described above, peptide synthesis is made more difficult and A that may increase the synthesis cost It may be desirable to remove or replace the amino acid. For example, the peptide The amino acid at the N-terminus or C-terminus is cyclizable, or a peptide If degradation may occur during or after synthesis, such The amino acid may be deleted or substituted, or alternatively one or more Additional amino acids to add the less desirable amino terminus or carboxyl The amino acid at the terminal end may be “blocked”. Amino acids added in this way are natural May be derived from the protein sequence of the present invention or can be an unnatural amino acid residue Is one of Additional amino acids increase the activity of the previously identified peptide T cells. The amino-terminal, carboxy-terminal, or You may add to either of them. Such additional amino acids are naturally occurring proteins It may be from the sequence or may be an unnatural amino acid residue.   The peptide composition administered in accordance with the present invention provides a sufficient percentage of myelin autoantigen. Of T cell epitopes, ie, against the myelin autoantigen Population that responds to and has multiple sclerosis (eg, at least 10 individuals , And more preferably at least 20 individuals) At least about 20%, more preferably about 3%, of the total T cell reactivity to 0%, more preferably about 40%, and even more preferably about 60% or more. Higher percentages are included in the composition, so that the M Dow of MS autoimmune response by treatment of administering the composition to an individual suffering from S Regulation is brought about. Peptide (preferably cure Therapeutic candidate peptide) or a combination of candidate peptides is MS Downregulation of MS autoimmune response in a substantial percentage of the population suffering from Percentage of total T cells of myelin autoantigen sufficient to perform Numerous analytical schemes to determine whether reactivity is likely to be involved May be used.   According to one analytical scheme (using MBP as an example), T cell epithelium -Containing peptides respond to epitope-containing peptides by MBP microtiter -Graded according to the number of cultures and the number of MS patients responding to them. M MBP-specific T cell frequency can be very low in PBL of S patients, It may not be possible to test all MBP peptides in all MS patients It is often. Therefore, the following approach to determining the most useful therapeutic peptides Suitable and this is described in more detail in Example 1. Is PBL blood? And culture is started in 96-well microtiter plates. P BL was obtained from fresh peripheral blood samples (approximately 75 cc) from patients with defined MS. Purify using a Ficoll density gradient. Microtiter culture 2 × 10 per well^FivePBL, as well as 5% human AB serum, penicillin- RPMI 1640 supplemented with streptomycin and L-glutamine Start with 10 μg / ml purified human spinal cord MBP in culture medium. IL in culture 2 (20 units / ml) and IL4 (5 units / ml) starting on day 6-7 Complement. After 11 to 13 days, the microtiter culture is washed and freshly cultivated. Resuspend in the ground and distribute into 12 new microtiter wells. Frozen 5 x 10 per well^FourAdded as antigen-presenting cells in PBL I do. Screening antigen from each microtiter culture Add to duplicate replicate wells to make duplicate assay samples. Always use medium as negative control And use 10 μg / ml purified human recombinant MBP as a positive control . Each patient was also tested for reactivity for up to four MBP peptides, and Tide concentration is 10 μM. After 48 hours, the assay was run at 0.75 μCi.^ThreeH-H Pulse with minidine and collect after a 6-16 hour pulse. Following culture 2. Assess positive for each peptide according to the criteria of: Stimulating finger above 0 Number, change in cpm equal to or greater than 500, and change in CPM Standard error of the mean below. In addition, for analytical purposes, the cultures are Respond to both BP and its peptide and if they have more than one non-redundant pair Only evaluate as "peptide-positive" if it does not respond to the peptide. About 10 Groups of 50 patients are tested for each MBP peptide, and patients in each group are It is preferred to test for as high as 4 peptides. Then these peptides Are graded according to the following criteria: 1) MBP-positive microphones in each group of patients Percentage of the titer culture (total MBP reactivity) (this culture One of the peptides is also evaluated as positive); 2) the MBP peptide At least one microtiter culture that evaluates positive for one of the Percentage of MBP-responsive patients in each group for Responsive patients have at least one microphone that is evaluated as positive for MBP Identified as a patient for Rotiter culture). Then the individual peptide symptoms The complements are: 1) they are at least 5%, more preferably at least 10%, and Most preferably contain at least 20% total MBP reactivity; and 2) Reactivity to the peptide At least 20%, more preferably at least 30%, of MBP-responsive patients %, More preferably at least 40%, more preferably at least 50%, and And most preferably if it is found at least 60%. Depending on the case May take into account additional criteria for peptide grading, for example Is the positive index for a given peptide. This positive index is the myelin self Intensity of T cell response to a peptide in a population of individuals responding to antigen (S . I. ) And the frequency of T cell responses to a peptide. For example As shown in FIG. 15, the positive index of 141 to 165 (MBP-4) is about 2500. Which was calculated using the data described in Example 1 herein. M Average S.P. of peptide MBP-4 per BP responding patient. I. Respond to the MBP The percentage of individuals responding to MBP-4 in the patient population was multiplied.   Highly purified, free of all other polypeptides and contaminants, at least The amino acid residues of the specified sequence containing one T cell epitope, Peptides used in therapeutic compositions are synthetically synthesized by chemical synthesis using standard techniques. May be produced. Various methods for chemically synthesizing peptides are known in the art. It is fully automated, for example, with a commercially available peptide synthesizer. Or a semi-automated solid-phase synthesis method. Synthetically produced peptides , More particularly at least 90%, preferably until uniform, more preferably Preferably at least 95%, and even more preferably at least 97% purity To be substantially free of all other polypeptides and contaminants, Use any number of techniques known in the literature for protein purification And may be purified.   Up to about 45 amino acid residues in length, and most preferably up to about 30 amino acids in length. Particularly desirable are synthetically produced peptides of the invention containing a length of a amino acid residue Because increasing the length may provide a barrier to peptide synthesis It is. Longer peptides are produced by recombinant DNA technology described below. May be.   Peptides useful in the methods of the invention also include nucleic acid sequences encoding such peptides. May be produced using recombinant DNA technology in host cells transformed with. Recombination If produced by a conventional technique, transform with the nucleic acid encoding the desired peptide. The isolated host cells are cultured in a medium suitable for the cells, and the isolated peptide To purify peptides and proteins from culture media, host cells, or both. Can be purified using techniques known in the art. The procedure can be ion exchange chromatography, ultrafiltration, electrophoresis, or the desired peptide. Starting with immunoprecipitation with antibodies specific for the tide. Recombinantly produced peptides Is preferably homogeneous and substantially cellular, other polypeptides, or Described previously for synthetically produced peptides to be free of culture medium It may be isolated and purified according to the methods described.   Under certain limited circumstances, peptides can be converted to highly purified full-length proteins or May be produced by chemical or enzymatic cleavage of natural proteins and these proteins The site of chemical digestion or enzymatic cleavage of white matter is predetermined and obtained. Digests are reproducible. A peptide having the specified amino acid sequence Purified and isolated synthetic or recombinantly produced peptides Any of the above According to the method of any other polypeptide present in the enzymatic or chemical digest Highly purified and isolated to be substantially free of peptides or contaminants Can be.   In addition, the peptides of the present invention can be used, for example, in US Pat. No. 5,130,297 ( Sharma et al. ) Can be used as the complex disclosed in In the disclosure of the present invention, the therapeutic agent has the formula: X-MHC-peptide or MHC-pepti Do-X (wherein X represents a functional moiety selected from a toxin or a labeling group) MHC stands for the active part of the MHC glycoprotein, said glycoprotein being in its normal state Are dissociated from existing cell surfaces; and “peptides” are listed herein. Any of the listed peptides, more particularly MBP or MOG, And more particularly (representing the peptides shown in FIGS. 2 and 14). .   Furthermore, preferred peptides according to the invention are full-length proteins, more particularly MB It contains at least one T cell epitope of P or MOG. These pepti Contains a single epitope and / or tandem repeats of more than one epitope Is fine.   Methods for identifying peptides comprising the T cell activity of MBP described herein According to the law (see discussion above and Example 1 below), Preferred peptides that come and are candidates for therapeutic use are the following peptides Including: MBP-1, MBP-2, MBP-3, MBP-4, and MBP-5 (All of which are shown in FIG. 2) or any of these parts or Are any of these modifications. These peptides were converted to T as described in Example 1. When tested for cell activity, these peptides showed at least one T cell Epitope (This is indicated by the ratio of MBP-positive microtiter cultures) Furthermore, it has been shown that one of the MBP peptides also shows a positive evaluation ( FIG. 4a) plus, in addition, a favorable percentage as a significant percentage of MBP patients. The detectable response for each of the peptides was also examined (FIG. 4b). MBP-4 (1 41 to 165) are the most reactive of the above four peptides, and the total MBP response , And is detected in 64% of MBP-responsive patients tested. M BP-4 surprisingly surpassed MBP 141-160 and MBP 15 shown in FIG. It showed dramatically higher reactivity when compared to the combined reactivity with 1-170. The present invention Some have identified this immunodominant peptide, which appears to contain multiple T-cell epitopes. He is the first inventor to define.   In addition, MBP-1. 1, MBP-1. 2, MBP-2. 1, MBP-2 . 2, MBP-2. 3, MBP-2. 4, MBP-2. 5, MBP-2. 6, you And MBP-3. 1 (shown in FIG. 2) is also a candidate peptide suitable for therapeutic use It is believed that there is. These peptides were MBP-1, MBP-2 and M, respectively. Modified versions of BP-3 and Ts similar to those of their respective "parent" peptides It is expected to have cellular activity. These peptides are mainly used for peptide synthesis. For the purpose of simplification, amino acid deletion and addition Addition, or both.   Has been shown to be immunodominant (ie, has T cell activity of MBP), Alternatively, other plasmids derived from a peptide known to have T cell activity of MBP The peptide has been identified by the present inventor or other researchers in the field (See, for example, U.S. Pat. No. 08 / 328,244) No. 08 / 241,246, filed Oct. 25, 1994; No. (filed May 10, 1994); WO 93/21222; No. 0 304 279; WO 91/15225; Ota et   al. , Letters to Nature, 346: 183-187 (1 990); Wucherpfening et al. J. Exp. Med . , 170: 279-290 (1994); Martin et al. J. Immunol. , (1990) 145: 540-548); Karin et.   al. J. Exp. Med. , 180: 2227-2237 (1994), Please refer to). Such peptides are also particularly preferred peptides described above. For therapeutic use in the compositions and methods of the present invention when combined with a drug candidate. May be suitable. Such peptides include, but are not limited to, those shown in FIG. 14 has the number of residues corresponding to the amino acid residues of the human MBP protein, and is shown in FIG. Including all or part of the following peptides having individual amino acid sequences They are: 13-25, 31-50, 61-80, 82-92, 82-96, 82 -97, 82-98, 82-100, 82-100 [100 P> Y], 83- 100, 83 to 101, 84 to 87, 84 to 100, 84 to 100, 85 to 10 0, 86-105, 87-99, 87-99 [91 K> A], 88-100, 88-99, 111-135, 122-140, 139-170, 141-16 0, 142-166, 142-168, 146-160, and 153-170 And even more preferably comprising the following peptides: 13-25, 87-99. , 87-99 [91 K> A], 82-100, 82-100 [100 P> Y (All of these are shown in FIG. Is). Preferred portions or preferred variants of these peptides were tested In the same or higher percentage of patients, T is similar to or greater than that of the "parent" peptide from which the peptide was obtained. "Parent" pepti having cellular activity and / or from which modified peptides thereof have been obtained Have a therapeutic effect in the present invention that is similar to or better than that of Is preferred.   One aspect of the present invention relates to at least one derived from a myelin antigen having T cell activity. A single peptide or a combination of peptides derived from the myelin antigen (each Peptides have T cell activity), and a pharmaceutically acceptable carrier or excipient. A therapeutic composition comprising a form is provided. A preferred therapeutic composition is myelin autoantigen And a composition comprising a sufficient percentage of T cell activity of When administered to MS patients in therapy (possibly in non-immunogenic form) Myelin autoantigen-specific in a population of human subjects for an antigen-specific immune response It is possible to down regulate the immune response. Used herein `` Down-regulation '' is not limited to Preventing the first expression of, an antigen against MBP or other myelin autoantigen Reducing disease symptoms of multiple sclerosis caused by specific immune response And more specifically, reduction, regression, non-progression, or alleviation of symptoms. Non-progress Without limitation, (a) shorter-term active disease or exacerbation, (b) ) Less severe symptoms or disability, (c) delayed disease progression (where (Basic health does not decline rapidly), (d) during active illness or exacerbations Stretching or elongation of the length of time between (eg, longer remission periods), (e) Fewer recurrences or exacerbations and / or (f) detected by MRI Slowing or inhibiting the progression of the affected lesion area (legion load) It may be a feature. the Expanded Disability Stat us Scale (EDSS) rating system and Neurological Rating Scale is used by those skilled in the relevant arts. Another evaluation means. As used herein, “advanced stage” refers to the disease. Is relapsing-remission MS, chronic progressive MS, benign MS, or primary progressive MS Any time beyond the apparent clinical signs of overt disease, if any. In addition to this definition, “advanced phase” refers to acute phase (single or multiple), remission Or multiple times) and exacerbations (one or more times). In this specification When used, the term "acute phase" refers to ongoing seizures, acute illnesses, active illnesses, And exacerbations, and are used interchangeably. As used herein In some cases, these terms generally refer to patients with the disease (whether diagnosed or not). (Igai) has been identified by those skilled in the art as being related to the specific immune response characteristics of multiple sclerosis. Means a condition that presents a generally understood activity symptom or sign. "recurrence" Is understood to mean the acute phase that later leads to remission. The term exacerbation is appropriate When used in context, means a new or worsening symptom or sign Can be interpreted as follows. "Symptoms" are signs of a disease that a patient complains of. "Signs Is a sign observed or judged by the diagnostician. However, the term "symptom" And "symptoms" should be used interchangeably unless otherwise indicated.   The therapeutic composition of the present invention may comprise at least one T cell epitope-containing Peptides or modified peptides or peptide analogs and pharmaceutically acceptable It is preferred to include an acceptable carrier or excipient. Such compositions are preferred Or MBP peptides selected from the following group of peptides, which are: MBP-1, MBP-1. 1, MBP-1. 2, MBP-2, MBP-2. 1, MBP-2. 2, MBP-2. 3, MBP-2. 4, MBP-2. 5, MBP- 2. 6, MBP-3, MBP-3. 1, MBP-4, and MBP-5, , MBP peptide is MBP-1. 1, MBP-2. 1, MBP-4 and MB More preferably, it is selected from P-5 and the MBP peptide is MBP-4 Is even more preferred.   A composition of the invention may include at least two peptides (eg, at least Physical mixture of two peptides), each peptide has T cell activity, and Contains at least one T-cell epitope of a myelin autoantigen such as MBP Is preferred. A pharmaceutically acceptable carrier or excipient is used for such a composition. Can be administered in the form of a therapeutic composition comprising One or more of this A therapeutically effective amount of such a composition is administered simultaneously or sequentially to an individual suffering from MS. Can be A preferred composition is at least one selected from the following peptide group: Containing one peptide and preferably containing at least two peptides , They are: MBP-1, MBP-1. 1, MBP-1. 2, MBP-2, MB P-2. 1, MBP-2. 2, MBP-2. 3, MBP-2. 4, MBP-2. 5, MBP-2. 6, MBP-3, MBP-3. 1, MBP-4, and MBP -5 (all of which are shown in FIG. 2), and were selected from the following group of peptides: It is even more preferred that Et al .: MBP-1. 1, MBP-1. 2, MBP-2. 1, MBP-2. 2, M BP-2. 3, MBP-2. 4, MBP-2. 5, MBP-2. 6, MBP-3 . 1, MBP-4, and MBP-5, and are selected from the following group of peptides: Most preferably, they are: MBP-1. 1, MBP-2. 1, M BP-4 and MBP-5. In addition, the composition of the present invention further comprises MBP having the number of residues corresponding to the amino acid residues of the human MBP protein shown in Individual amino acid sequences shown in FIG. I.e .: 13-25, 31-50, 61-80, 82-92, 82-96, 82-97, 82-98, 82-100, 82-100 [100 P> Y], 8 3-100, 83-101, 84-97, 84-100, 84-100, 85 100, 86-105, 87-99, 87-99 [91 K> A], 88-10 0, 88-99, 111-135, 122-140, 139-170, 141- 160, 142-166, 142-168, 146-160, and 153-1 70, and the following peptides: 13-25, 87-99, 87- 99 [91 K> A], 82-100, 82-100 [100 P> Y]. Is even more preferred. The composition of the invention comprises at least two peptides Preferably, in this case at least one peptide is MBP-4, and The at least one peptide is of the following group of peptides: MBP-1, MBP -1. 1, MBP-1. 2, MBP-2, MBP-2. 1, MBP-2. 2, M BP-2. 3, MBP-2. 4, MBP-2. 5, MBP-2. 6, MBP-3 , MBP-3. 1, and MBP-5 (all of which are shown in FIG. 2) And further shown in FIG. At least one of the following peptides derived from BP: 13-25, 31 -50, 61-80, 82-92, 82-96, 82-97, 82-98, 82 -100, 82-100 [100 P> Y], 83-100, 83-101, 8 4-97, 84-100, 85-100, 86-105, 87-99, 87-9 9 [91 K> A], 88-100, 88-99, 111-135, 122-1 40, 139 to 170, 141 to 160, 142 to 166, 142 to 168, 1 46-160, and 153-170, and at least one The following peptides: 13-25, 87-99, 87-99 [91 K> A], 82 to 100, 82 to 100 [100 P> Y]. preferable.   A preferred composition of the present invention comprises the following peptides, which are: MBP-1, MBP-2, MBP-3, and MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, MBP-3, MBP-4, and MBP-5 ; MBP-1. 1, MBP-2, MBP-4, and MBP-5; MBP-1, MBP-2. 1, MBP-4, and MBP-5; MBP-1, MBP-2, MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, and MBP-4; MBP-1, MBP-2. 1, and MBP-4; MBP-1. 1, MBP-2, and MBP-4; MBP-1. 1, MBP-2. 1, and MBP-5; MBP-1. 1, MBP-2. 1, and MBP-3; MBP-1, and: MBP-2, MBP-2. 1, MBP-2. 2, MBP- 2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. Group consisting of six One peptide selected from; MBP-1. 1, and: MBP-2, MBP-2. 1, MBP-2. 2, MB P-2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. From six One peptide selected from the group consisting of: MBP-4, and: MBP-2, MBP-2. 1, MBP-2. 2, MBP- 2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. Group consisting of six One peptide selected from; MBP-4, and: MBP-1 or MBP-1. Selected from the group consisting of 1 One peptide to be obtained; MBP-1. 1, MBP-4, and: 82-100, 82-100 [100   P> Y], 87 to 99, and 87 to 99 [91 K> A] (all shown in FIG. 14). A peptide selected from the group consisting of: MBP-1. 1 and MBP-4, and: MBP-2. 2, MBP-2. 3 , MBP-2. 4, MBP-2. 5, or MBP-2. 6 (all shown in FIG. 2) A peptide selected from the group consisting of: MBP-1. 1, MBP-5, MBP-4, and: 82-100, 82-1 00 [100 P> Y], 87-99, and 87-99 [91 K> A] (all One of the peptides selected from the group consisting of: MBP-1. 1, MBP-5, MBP-4, and: MBP-2. 2, MBP -2. 3, MBP-2. 4, MBP-2. 5, or MBP- 2. One peptide selected from the group consisting of 6 (all shown in FIG. 2); MBP-1. 1, MBP-5, MBP-4, and: 82-100, 82-1 00 [100 P> Y], 87-99, and 87-99 [91 K> A] (all One of the peptides selected from the group consisting of: MBP-1. 1, MBP-3, MBP-4, and: MBP-2. 2, MBP -2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. 6 (All figures 1) a peptide selected from the group consisting of: It is.   The present invention further provides a therapeutically effective combination of peptides as a single therapeutic injection. Therapeutic methods that include administering bodily bleeds are also contemplated. Such a combination of peptides Therapeutic compositions comprising only one peptide or comprising several peptides May be administered simultaneously or sequentially. Such treatment is more than one pep It need not be a physical mixture of the tide, but may be a single therapeutic injection. And combinations of peptides administered simultaneously or sequentially. Single therapeutic infusion Combinations of peptides that can be administered simultaneously or sequentially as products Product (in the form of one or more compositions, each containing one or more peptides) Takes the following combinations of peptides, which are: MBP-1, MBP-2, MBP-3, and MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, MBP-3, MBP-4 and M BP-5; MBP-1. 1, MBP-2, MBP-4, and MBP-5; MBP-1, MBP-2. 1, MBP-4, and MBP-5; MBP-1, MBP-2, MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, MBP-4, and MBP-5; MBP-1. 1, MBP-2. 1, and MBP-4; MBP-1, MBP-2. 1, and MBP-4; MBP-1. 1, MBP-2, and MBP-4; MBP-1. 1, MBP-2. 1, and MBP-5; MBP-1. 1, MBP-2. 1, and MBP-3; MBP-1, and: MBP-2, MBP-2. 1, MBP-2. 2, MBP- 2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. Group consisting of six One peptide selected from; MBP-1. 1, and: MBP-2, MBP-2. 1, MBP-2. 2, MB P-2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. From six One peptide selected from the group consisting of: MBP-4, and: MBP-2, MBP-2. 1, MBP-2. 2, MBP- 2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. Group consisting of six One peptide selected from; MBP-4, and: MBP-1 or MBP-1. Selected from the group consisting of 1 One peptide to be obtained; MBP-1. 1, MBP-4, and: 82-100, 82-100 [100   P> Y], 87 to 99, and 87 to 99 [91 K> A] (all shown in FIG. 14). A peptide selected from the group consisting of: MBP-1. 1 and MBP-4, and: MBP-2. 2, MBP-2. 3 , MBP-2. 4, MBP-2. 5, or MBP-2. 6 (all shown in FIG. 2) A peptide selected from the group consisting of: MBP-1. 1, MBP-5, MBP-4, and: 82-100, 82-1 00 [100 P> Y], 87-99, and 87-99 [91 K> A] (all One of the peptides selected from the group consisting of: MBP-1. 1, MBP-5, MBP-4, and: MBP-2. 2, MBP -2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. 6 (All figures 1) a peptide selected from the group consisting of: MBP-1. 1, MBP-5, MBP-4, and: 82-100, 82-1 00 [100 P> Y], 87-99, and 87-99 [91 K> A] (all One of the peptides selected from the group consisting of: MBP-1. 1, MBP-3, MBP-4, and: MBP-2. 2, MBP -2. 3, MBP-2. 4, MBP-2. 5, or MBP-2. 6 (All figures 1) a peptide selected from the group consisting of: It is.   In addition, MBP peptides that can be administered simultaneously and / or sequentially Preferred compositions and preferred combinations are those of the preceding compositions or combinations. And in addition to that, myelin oligodendrocyte proteins White matter (MOG), self involved in multiple sclerosis At least one T-cell epithelium derived from another protein considered to be one of the antigens; Tope-containing peptides may also be included (Lebar et al. J. Immu nol. (1976) 116: 1434-1446; Lebar et al. J. Exp. Immunol (1986) 66: 423-443; Linin gton and Lassman, J.M. Neuroimmunol. (198 7) 17: 61-69: Lassman et al. , Acta Neuor pathol. (Bell) (1988) 75: 566-576; and Su net et al. J. Immunol. (1991) 146: 1490-14. 95). Pep that may contain a T cell epitope derived from MOG U.S. Patent No. 08 / 116,824 (filed September 3, 1993) And US patent application Ser. No. 08 / 300,811 (filed on Sep. 1, 1994). (These privileges are incorporated herein by reference), and And a composition as described above for the MBP T cell epitope-containing peptide according to the invention. Multiple sclerosis when prepared and / or administered in combination with a combination The following are expected to be effective for the treatment of: Human MOG1-13 GQFRVIGPRHPIR Human MOG103-115 HSYQEEAAMELKV Human MOG1-121 GQFRVIGPRHPIRALVGDEV                           ELPCRTSPGKNATGMEVGWY                           RPPFSRVVHLYRNGKDQDGD                           QAPEYRGRTELLKDAIGEGK                           VTLRIRNVRFSDEGGFTCFF                           RDHSYQEEAAMELKVEDPFYW It is. An additional epitope-containing peptide of MOG has been And using an experimental analytical method similar to that described in Example 1 (data not disclosed). Such peptides have been identified as: Human MOG1-20 GQFRVIGPRHPIRALVGDEV Human MOG11-30 PIRALVGDEVELPCRISPGK Human MOG21-40 ELPCRISPGKNATGMEVGWY Human MOG31-50 NATGMEVGWYRPPFSRVVHL Human MOG141-160 TVGLVFLCLQYRLRGKLRAE Human MOG151-170 YRLRGKLRAEIENLHRTFDP Human MOG161-180 IENLHRTFDPHFLRVPCWKI and Human MOG199-218 YNWLHRRLAGQFLEELRNPF including. The present invention further provides a modified version of the above T cell epitope-containing MOG peptide. Or analogs (discussed in the first part), these modifications Product or analog is the parent peptide from which the variant or analog has been obtained. It maintains similar or greater T cell activity.   Both MOG and MBP T-cells can be administered simultaneously or sequentially. Vesicle epitope-containing peptides, their modifications, their analogs, or Peptidomimetics based on them, and combinations of such peptides are , MBP-specific T cells and MOG-specific T cells involved in autoimmune responses in MS Benefits of maximizing down-regulation effects in both cells Have. In this manner, MBs leading to clinical manifestations of MS (demyelination) One that may be involved in the autoimmune response to either P or MOG Ream T thin The vesicle may be a target for down-regulation, The treatment enhances the therapeutic effect of the compounds and compositions of the present invention. Similarly, M Other myelin antigens (eg, proteolipid protein) T cell epithelium derived from white matter (PLP) and myelin-associated glycoprotein (MAG) Tope-containing peptides may also be suitable for the compositions and methods of the present invention.   Therapeutic / prophylactic therapy according to the present invention, whereby a certain bad autoantigen Reverse or prevent and delay the onset of the disease symptoms caused, or Decreased, non-progressive, or slowed disease symptoms caused by a bad self antigen Sum (ie, down-regulation of the autoantigen-specific immune response) )) Are self-antigens (eg, MBP, MOG, PLP, MAG). Administration of the therapeutic composition of the present invention in a non-immunogenic form. Limited to any logic Although not intended to be administered, administration of the therapeutic composition of the present invention may This leads to a T cell unresponsiveness of the T cell subpopulation (so that those cells respond to bad antigens). Become unresponsive and stimulate an immune response upon exposure to the bad antigen Is not concerned (for example, via anergy or apoptosis) B) Lymphokine secretion profile as compared to exposure to bad self antigens C) T cell subpopulations normally involved in responding to bad antigens Is removed from the normally exposed site to the site of administration of the composition (T cell subpopulation This redispersion stimulates a normal immune response at the normal site of exposure to bad antigens The immune system of an individual is improved or diminished, and Leads to regression); d) leads to the induction of T suppressor cells Or e) results in induction of suppressor cells via bystander antigen It is thought that there may be.   The highly purified and isolated peptides discussed above are suitable for human therapy. May be formulated into the therapeutic compositions of the invention. The therapeutic composition of the present invention may be injected (eg, For example, if the composition is to be administered by subcutaneous injection or intravenous injection), The highly purified peptide has been shown to be mobile and easy to pass through the needle. Aqueous solution at pH where the tide is pharmaceutically acceptable (i.e. pH range of about 4-9) Preferably, it is soluble in the interior. The composition is further pharmaceutically acceptable It is preferable to include a carrier. "Pharmaceutically acceptable" as used herein Carrier '' means any or all of the excipients, solvents, dispersing media, coatings Agents, antibacterial and antifungal agents, toxity agents, buffers, Reagents for delaying or enhancing absorption, surfactants, micelle forming agents, lipids, It contains a posome, a reagent for forming a liquid complex, and a stabilizer. Pharmacology The use of such media and reagents for active substances is known in the art. I have. As long as any conventional medium or reagent is incompatible with the active compound With that exception, their use in therapeutic compositions is contemplated. Supplement Active compounds can also be incorporated into the compositions.   As discussed above, the therapeutic compositions of the present invention suitable for injectable use include active compounds. (Ie, one or more highly purified and isolated Peptide) is one of the prescription ingredients listed before and after Or appropriate shaping with their combination The drug should be incorporated into the drug in the required amount and, if necessary, be sterilized by filtration. And a sterile aqueous solution prepared by Preferred pharmaceutically acceptable The carrier used is at least one excipient (eg, water, sodium phosphate, Or sorbitol or sodium chloride, or any combination thereof Combinations). Other pharmaceutically acceptable carriers that may be suitable include, for example, , Water, ethanol, polyol (for example, glycerol, propylene glycol Solvents and dispersing media, including Suitable mixtures thereof, and vegetable oils. The appropriate liquidity is, for example, Cotin Particles (in one example, lecithin), required particles in the case of dispersants It can be maintained by maintaining the size and by using surfactants. Fine Avoidance of biological activity is controlled by various antibacterial and antifungal agents (for example, parabens, chlorobutane). Attained by tanol, phenol, ascorbic acid, tilmersol, etc.) be able to. Sustained absorption of injectable compositions is an attempt to delay absorption in the composition. Including drugs (eg, aluminum monostearate and gelatin) You can achieve more.   Preferred therapeutic compositions of the present invention are sterilized, manufactured, stored, distributed, and used. And should be stable under the conditions of Should be protected against contamination activities. Preferred for producing a therapeutic composition Techniques that maintain the integrity of the composition (ie, prevent contamination, Prolonged storage, etc.) depends on whether the composition is pharmaceutically acceptable immediately prior to use. May take the form of a lyophilized powder that is reconstituted in the body (eg, sterile water) , Peptides and The preparation of a pharmaceutically acceptable carrier (s). In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is vacuum Dry, freeze-dried or spin-dried. The powder of the ingredients plus any additional desired ingredients is their pre-destruction Obtained from the bacterial filtration solution.   As discussed above, the therapeutic compositions of the present invention comprise more than one isolated peptide. May contain tide. Treatment including multipeptide preparations suitable for pharmaceutical administration to humans A therapeutic composition may be desirable for administration of some active peptides. This multi pepti At least two or more with the specified amino acid sequence Down-regulation of an antigen-specific immune response containing a number of isolated peptides It is possible to take action. In the preceding part, which contains at least two peptides Any of the listed compositions may be suitable as a multipeptide formulation. As discussed in the previous section, very suitable for use in multipeptide formulations Preferred peptides include at least two of the following peptides, which are: MBP -1, MBP-1. 1, MBP-1. 2, MBP-2, MBP-2. 1, MBP -2. 2, MBP-2. 3, MBP-2. 4, MBP-2. 5, MBP-2. 6 , MBP-3, MBP-3. 1, MBP-4, and MBP-5. Mar Special considerations when preparing thipeptide preparations are at physiologically acceptable pH. To maintain the solubility and stability of all peptides in the formulation in aqueous solutions of Including. This means that one of the multipeptide preparations is compatible with all peptides. Or select multiple pharmaceutically acceptable solvents and excipients You. For example, suitable excipients are sterile water, sodium phosphate, mannitol, Or it contains both sodium phosphate and mannitol. For multi-peptide preparations Additional considerations in the prevention of dimerization of the peptide, if necessary, is there.   Administration of the above-described therapeutic composition in non-immunogenic form to an individual uses known techniques. Downregulation of MBP antigen-specific immune response in individuals treated for MS Can be performed at doses and for periods of time effective to cause . Down-regulation of antigen-specific immune responses to antigens associated with disease states in humans Regulation may be determined clinically as far as possible, or objectively ( That is, some or all of the symptoms associated with the disease state being treated. The patient feels as if the patient has been alleviated).   An effective amount of a therapeutic composition of the present invention is, for example, the degree of sensitivity of the individual to the antigen. The age, sex, and weight of the individual and the antigen specificity in the individual Factors such as the ability of the peptide to down-regulate the immune response May change. The therapeutic compositions of the invention are administered in a conventional manner in a non-immunogenic form. May be administered, for example, by injection (subcutaneous injection, intravenous injection, etc.), oral Administration, sublingual administration, inhalation administration, transdermal application, intrarectal application, or enhanced therapeutic effect Any combination of administration routes or therapeutic agents designed to Any other route of administration known in the art to provide. An individual Simultaneously or simultaneously with a therapeutically effective amount of one or more therapeutic compositions of the present invention. It may be desirable to administer sequentially. Like this for simultaneous or sequential administration Each of the compositions may comprise only one peptide or as described above It may contain one multipeptide preparation.   For administering a peptide or peptide composition by an administration method other than parenteral administration To coat the peptide with a substance to prevent inactivation of the peptide. Or co-administration of such substances and their peptides It may be. For example, peptide compositions can be used with enzyme inhibitors or in liposomes May be co-administered within. Enzyme inhibitors include spleen trypsin inhibitor, diisotope Propyl fluorophosphate (DPE), and trasylol. Liposomes Including water-in-oil-in-water CGF emulsion, as well as ordinary liposomes (Strejan   et al. (1984) J. Am. Neuroimmunol.   7:27). If the peptide is appropriately protected as described above, the peptide can be It may be administered orally with an inert excipient or an assimilable edible carrier. Peptide group The composition and other ingredients are further contained within a hard or soft capsule. Compressed into tablets, or incorporated directly into the individual's diet. No. For oral therapeutic administration, incorporate the active compound with excipients; and Oral tablets, buccal tablets, troches, capsules, elixirs, suspensions Preparations, syrups, wafer preparations and the like. Such composition Preparations and preparations should contain at least 1% by weight of active compound. Composition And the percentage of preparation may, of course, be varied and the dosage may vary. It may be convenient to have between about 5% and 80% of the weight of the order. Such treatment The amount of the active compound in a chemically useful composition will depend on the appropriate dosage being obtained. It's a stuff. A preferred composition or preparation according to the present invention comprises a single oral dose It is prepared so that a site contains between about 10 μg and about 200 mg of active compound. tablet Troches, pills, And capsules and the like may include the following: binders (eg, Excipients (eg ragacanth gum, acacia, corn starch, or gelatin); Disintegrators (eg corn starch, potato starch) Lubricants (eg, magnesium stearate); And a sweetener (eg, sucrose, lactose, or saccharin) Is a flavor / odorant (eg, peppermint, winter green oil, or cherry flavor) ). If the dosage unit form is a capsule, then it may be In addition, a liquid carrier may be included. As a coating or otherwise Various other materials for modifying the physical form of a given dosage unit may be present. An example For example, tablets, pills, or capsules can be made of shellac, sugar, or both. It may be coated. Syrups or elixirs may be used as active compounds, Sucrose as a flavoring agent, methyl and propylparaben as a preservative, dye And flavoring and flavoring agents (eg cherry or orange flavor) It's fine. Of course used to prepare any dosage unit form Any substance is pharmaceutically pure and substantially non-toxic in the amounts used. Should be. In addition, the active compound is incorporated into sustained-release preparations and formulations May be.   Injection (subcutaneous injection, intravenous injection (I) of one or more therapeutic compositions of the invention . V. ), Intramuscular injection (I. M. ) Intraperitoneal injection) Preferably about 1 μg to 3 mg, and more preferably about 20 μg to 1. 5 mg, And even more preferably from about 50 μg to 750 μg, and even more preferably About 75 μg to about 750 μg of each activity A component (peptide) may be administered. 15 depending on the treatment described below Higher doses, as high as 00 μg or more, may be used. Convenience of administration and It is especially advantageous to formulate parenteral compositions in dosage unit form for uniformity of dosage and administration. It is advantageous. A "unit dose" form, as used herein, receives treatment Meaning physically separated units suitable as a single dose for prospective human subjects Each unit associated with a desired pharmaceutical carrier to produce the desired therapeutic effect. It contains a predetermined amount of active compound issued. Novel dosage unit forms of the invention Details of (a) the unique properties of the active compounds and the specific therapeutic effects to be achieved And (b) the art of formulating such active compounds for the treatment of human subjects Directed by and directly dependent on domain specific limitations.   Dosage treatment may be adjusted to provide the optimum prophylactic or therapeutic response. For example, several divided doses for days, weeks, months, or years May be administered over a period of time, or the In such cases, the dose may be increased or decreased at a fixed rate for each subsequent administration. One favor In other treatments, a subcutaneous injection of the therapeutic composition is administered once daily during the acute phase, and During remission, it is administered once every other day for the life of the individual suffering from the disease. Another The law may include injections weekly, monthly, or other cycles. dose May remain constant for each injection, or may increase or decrease with each subsequent injection May decrease. Sustained, lifetime treatment programs may be most desirable . Alternatively, booster injections are administered at intervals of about 3 months to about 1 year after the initial treatment period And may require only a single injection, or may be similar to that of the initial treatment. Another series of injections may be required.   Recurrent-regressive MS, primary progressive MS, benign MS, and chronic progressive MS Due to the rather unique immune system response of individuals suffering from these, careful and varied dosing regimens Will need to be developed. First, the intake evaluation of the patient under examination must be completed. Must. A thorough examination is, among other things, visual impairment, eye tremor, paralytic dysfunction Harm, vibration and hyposensitivity of position, ataxia and intention tremor, weakness or if Or by searching for paralysis, spasticity, and bladder disorders in multiple limbs . Those skilled in the art will appreciate, for example, EDSS, Neurological Rating Sc approved tools, such as ale, or similar paths known in the art Tool and use the previously discussed signs of impairment conditions to determine a baseline. Use and then any changes (including disability progression, but down Regulation is preferred) will be measured. Typical MS acute phase Although the remission period does not exist at all, the prescribed pattern is clear. This will be an indicator for a skilled practitioner. As mentioned earlier, The frequency of the acute phase is most frequent in the first 3 to 4 years of the disease, but also after the first attack Another observable seizure may not occur for 10-20 years (but MRI (A lesion area detected only by) may show a different clinical picture.) During a typical episode, the symptoms worsen over a period of a few days to a few weeks, and To remit. Recovery is usually rapid over a period of several weeks, but sometimes May span months.   MS is a chronic disease, and continuous treatment is contemplated. Long-term treatment described May be the most effective treatment to stop disease and disability progression . Every other day, at least once a week or one month A single administration regimen may be appropriate. Reasonable modifications are within the skill of the artisan. I will. Intervention at the onset of seizures may be an important component of effective treatment Have been.   The severity of seizures must be assessed for patients in the acute phase. First note The shot may be administered at the onset of the acute phase. Start treatment as early in the acute phase as possible It will be an obvious benefit. If desired, the therapy can be -Reduce interferon, steroids and / or other treatments, especially inflammation Could be combined with what was designed to do so. First time patient Observe daily after treatment, preferably by injection. During the acute phase, additional treatment It is suggested that it be given daily or at least once every three days. Any drug As with material therapy, the treating physician will be based on clinical changes that indicate a need for modification. The dose should be modified. Dosing schedules and guidelines suggested as guidelines Any such determination using dosage and quantity is within the skill of those in the art. for A dose range of about 75 to about 750 μg per dose is well tolerated by the treating physician Give a range (and not an outrageous value). Options are limited Not including daily treatment during the acute phase, after which the remissions described above A series of treatments for is continued. This requires intervention by the treating physician. When needed, never consider the possibility of more frequent or more frequent dosing It is not excluded.   The present invention provides a method for treating "advanced" multiple sclerosis according to the compositions and methods of the present invention. It discloses that it can be treated. At least one pep having T cell activity Composition comprising a tide and derived from myelin autoantigen Is suitable for treating advanced stage MS. The MBP peptide described in the preceding part, Compositions of MOG peptides, and combinations thereof, treat advanced stage MS Suitable for These peptides are not limited as described above. Iga: MBP-1, MBP-1. 1, MBP-1. 2, MBP-2, MBP-2 . 1, MBP-2. 2, MBP-2. 3, NBP-2. 4, MBP-2. 5, M BP-2. 6, MBP-3, MBP-3. 1, MBP-4, MBP-5, 13 ~ 25, 31-50, 61-80, 82-92, 82-97, 82-98, 82- 100, 82 to 100 [100 P> Y], 83 to 100, 83 to 101, 84 ~ 97, 84 ~ 100, 85 ~ 100, 86 ~ 105, 87 ~ 99, 87 ~ 99 [91 K> A], 88-100, 88-99, 111-135, 122-14 0, 139 to 170, 141 to 160, 142 to 166, 142 to 168, 14 6-160, and 153-170, and preferably MBP-1. 1, MBP -2. 1, MBP-4, MBP-5, 13-25, 87-99, 87-99 [9 1 K> A], 82-100, 82-100 [100 P> Y], and human Peptides derived from MOG: Human MOG1-13 GQFRVIGPRHPIR Human MOG103-115 HSYQEEAAMELKV Human MOG1-121 GQFRVIGPRHPIRALVGDEV                           ELPCRTSPGKNATGMEVGWY                           RPPFSRVVHLYRNGKDQDGD                           QAPEYRGRTELLKDAIGEGK                           VTLRIRNVRFSDEGGFTCFF                           RDHSYQEEAAMELKVEDPFYW Human MOG1-20 GQFRVIGPRHPIRALVGDEV Human MOG11-30 PIRALVGDEVELPCRISPGK Human MOG21-40 ELPCRISPGKNATGMEVGWY Human MOG31-50 NATGMEVGWYRPPFSRVVHL Human MOG141-160 TVGLVFLCLQYRLRGKLRAE Human MOG151-170 YRLRGKLRAEIENLHRTFDP Human MOG161-180 IENLHRTFDPHFLRVPCWKI and Human MOG199-218 YNWLHRRLAGQFLEELRNPF including.   The inventor believes that intervention during an ongoing seizure may actually be treated according to the methods of the present invention. Is the first inventor to make the surprising discovery of improving the symptoms of a subject . At minimum, such interventions do not exacerbate the subject's symptoms. Plus Applicants believe that interventions during remission downregulate the immune response, and Indicates that the condition is not activated as a result of any such intervention ing. Therefore, not only may this intervention lead to improvement, It also appears to be completely safe when administered according to the methods of the invention. Destination Using the EAE model described in US Pat. EAE was administered to the neck by repeated intravenous administration of the immunodominant MBP peptide Ac1-11. Proven to be treated well. "Natural peptide" (a protein self-antibody In order to identify a T cell epitope-containing peptide derived from a source, the description is provided herein. Excellent treatment using native sequence-derived unsubstituted peptides according to the method described) Once the method (meaning T cell reactivity) is indicated, the appropriately modified peptide Natural peptides and modified peptides Can be identified by comparing the binding affinities of the compounds. Natural peptides The modified peptide having a lower binding affinity as compared with the therapeutic composition of the present invention. Would be a suitable candidate peptide. Assays to determine binding affinity No. 08 / 300,811 filed Sep. 1, 1994, which is hereby incorporated by reference. Is incorporated herein by reference). For example, Ac1-11 therapy has been found to be a successful case. Ac1-11 treatment The method was then followed by an analog of Ac1-11 and higher affinity and higher Aα in stability^uAβ^uCompared with therapy with Ac1-11 [4Y] (Wr aith, D .; C. et al. , Supra, and Fairchild, P .; J . et al. , Above). Interestingly, the Applicant noted that Ac1-11 [4Y] Is effective at 100-fold lower dose compared to Ac1-11, and its cure The therapeutic effect was found to last longer and the modification selected by these It has been shown that peptides may also be suitable for therapeutic compositions. In addition, the applicant has In the mice tested by the special peptide Ac1-11 [4Y] 10 shows that a stable peptide-MHC complex is formed in vivo. this child Thus, the modified peptide that forms a stable peptide-MHC complex in vivo is Seems likely to be a suitable peptide for the treatment of Because their potency may be greatly increased by conservative amino acid substitutions (Ka line et al. J. Exp. Med. , 180: 2227-2237. (1994). Applicants have determined that this MBP peptide analog A c1-11 [4Y] shows ongoing paralysis when administered during the acute phase of EAE Going backwards and in remission It was also found that when administered to, it prevents recurrence. This allows you to Modified peptides and selected peptide analogs are useful in humans with MS It is shown that active symptoms can be reversed and recurrence can be prevented.   In yet another model for the course of human disease, Applicants post-expression of EAE and Intravenous peptide therapy during the acute phase was started. Surprisingly, this therapy Administration during the acute phase reversed the ongoing disease. This finding is of this kind This is the first observation of a thing. In past experiments performed by other researchers, peptide Therapy was performed while the majority of mice in the treatment group did not yet show any signs of EAE. It started before the onset of disease, or at the latest at the time when the onset of the disease was near. For example, Ga In ur et al., supra, a group of 13 mice was subjected to MBP disease induction therapy. So When only one of the 13 mice showed minimal signs of disease (ie, (When one mouse had a clinical rating of 1) (to discuss clinical rating in mice) See Example 2 for details), and MBP was added to 7 of those mice. The peptide mixture was injected intraperitoneally. The remaining six mice (one of which was diseased) Animals that showed signs) received no additional treatment. in this case, For mice that did not show clinical signs of disease, Gaur et al. No meaningful conclusion can be drawn about it. In one mouse The presence of a low clinical rating of 1 indicates an active disease in any of the other mice. It cannot be interpreted as indicating a case. Therefore, Gaur et al. Prior and most specifically, treatment prior to the clinical manifestation of the disease is disclosed. What is it In contrast, it is useful in clinical settings for the treatment of humans with MS For some purposes, treatment may begin well long after the onset of the disease process. Even if you start it will need to be effective. A model for appropriate human treatment Applicants have reported that 250 nmol of Ac1-11 [4Y] after the acute onset of EAE. The mice were administered peptide therapy using. FIG. 5 shows the effect of the treatment. this Therapy was performed separately for each mouse when the mouse exhibited early signs of EAE. Started. Mice are Ac1-11 [4Y when they develop EAE. ] Peptide therapy group and each of three control groups (no treatment, PBS or Aα^uA β^u(Binding peptide OVA 323-337). FIG. 9 shows the progress 48 hours after the first injection of the peptide due to treatment with Ac1-11 [4Y] of EAE Shows dramatic improvement in apparent disease ratings within minutes . In these treated mice, almost complete EAE development by day 4 after expression Resolution was seen and the effect of peptide therapy for a period of 18 days was sustained.   As yet another surprising new fact, the Applicant has discovered that the statics initiated during the remission phase of EAE Intravenous peptide therapy was found to prevent recurrence. Will be listed again However, when EAE is used as a model for human disease as described above, (PL (J × SJL) F1 mice develop recurrent EAE upon immunization with MBP ( Fritz, R .; B. Et al. J. Immunol. , 1983, 13 0: 1024). EAE usually develops between 9 and 16 days after immunization and The acute phase of the disease in this model lasts about 3-20 days. Of those mice Twenty percent or more of these rates indicate a decrease in the severity of the disease in the experiment. Depending on the acute phase, it may die or become moribund. Survive the acute phase Most of the mice that subsequently enter a short period of remission and show mild relief of the disease for several days. Or no clinical signs. In some experiments, all mice Almost at the same time, remission (as illustrated in Figure 5), but in most cases, The length of the sexual period is more variable. After the remission phase, the first relapse phase occurs, This is generally equivalent in severity to the acute phase of the disease. Live after all Stretched mice develop chronic post-paralysis, which persists until the end of the experiment.   In a mouse model, peptide Ac1-11 [4Y] starts during the remission phase of EAE This is a remarkably effective treatment. Ac1-11 [4Y] predicts EAE recurrence Follow-up of mice throughout the initial onset of paralysis to investigate their protective ability A survey was performed (this lasted 3 to 19 days). Surviving mice are individually relaxed To enter into solution phase (as a decrease in clinical rating to 1 or 0 for at least 2 days) Identified), the mice were alternately divided into two groups, and 25 nmol of A Intravenous therapy with c1-11 [4Y] or control PBS was started. Mouse A separate treatment was given, which started on day 2 of remission. Figure 10 shows that during the remission phase of EAE Incidence and severity of recurrence with initiated intravenous treatment with Ac1-11 [4Y] Is shown to decrease dramatically, and intravenous peptide therapy is late in the disease process. It can be effective even if started.   Although the mechanism of intravenous peptide therapy has not yet been fully elucidated, In many antigen systems, the immune system is administered by intravenous administration of the antigenic peptide before immunization. Have been suggested to induce antigen-specific unresponsiveness. Administered to MS patients As a more detailed indicator of the potential of a therapeutic agent, Applicants have identified encephalitogenic peptides or Represents the peptide analog as I. V. Administration And thereby reduces lymph node proliferation and IL2 production in vitro I found something to do. Mice were given 10 to 5 days before immunization with MBP protein. 250 nmol of MBP Ac1-11 was administered intravenously. FIG. 11 a shows after immunization 4 shows the lymph node amplification response from these treated mice measured on day 10. Immunity Intravenous with immunodominant MBP peptide Ac1-11 without pre-adjuvant adjuvant Pretreatment results in subsequent in vitro proliferative T cells directed against MBPAc1-11. Cell response is reduced. Mice were treated with the MBP peptide analog Ac1-11 [4Y]. Similar results were obtained with pre-treatment with intravenous injection (data not disclosed) ). In addition, IL2 production in lymph nodes in response to MBP Ac1-11 is This was avoided by intravenous pretreatment at 1-11 [4Y] (FIG. 11b). these According to the results, intravenous prophylaxis with MBP Ac1-11 or Ac1-11 [4Y] It was found that the pretreatment induced T cell unresponsiveness to MBP Ac1-11. Proven.   Accordingly, Applicants have recognized that intravenous MBP peptides and peptides in treating recurrent EAE. The effect of treatment with peptide analogs was investigated and a number of unique findings were obtained. No. First, and perhaps most importantly, a single autoantigenic peptide Treatment of autoimmune disease in the United States, even if treatment is initiated after the onset of disease symptoms Can be effective. Specific disease signs used to assess mice are described herein. Examples are discussed. Average clinical rating of level 2 or higher (A Mean Clinical Scales) identified as advanced EAE did. These results indicate that the intravenous MBP peptide disrupts the blood-brain barrier. And even after lymphocytic infiltration into the central nervous system It has been shown to block the encephalitis-inducing activity of challenge sensitized cells. At any time The peptide may activate, exacerbate, or There was no finding of rekindling, even if it included transient ones. EAE treated after the onset of the acute phase showed that the treated mice were originally severe Even if she was affected by any of the symptoms, she reversed within a few days of her initial treatment. Histological investigation Clinical response to peptide therapy significantly reduces brain and spinal cord lymphocyte infiltration It was confirmed that the correlation was small. Further, as discussed herein, MBP Intravenous (IV) administration of Ac1-11 [4Y] is 13 days after immunization with MBP It is effective even if it is started at a later stage (this is the remission phase of EAE). Was. Therefore, once again, treatment during the apparent stationary phase of the disease Starting does not cause relapse and, in addition, completely avoids any paralysis (Although the mildest paralysis may remain, which is excluded). As a result Is particularly interesting because recognition of a wide variety of MBP epitopes There is evidence that the immune response occurs late, and that these epitopes It is proposed that they may contribute (Lehmann, P. V. Et al. , Nature, 1992, 358: 155). The present invention The administration of peptides very early in this disease process may be It suggests that the development of the immune response may be avoided. However, EA After resolution of the severe acute phase of E, during which MBP and possibly other myelin antigens The immune response to the drug may have already progressed). It is worth noting that peptide analogs effectively prevent recurrence.   In practicing the present invention, it is preferable to select an effective therapeutic agent, and Is described in the part. Plus, one of the best peptide candidates Criteria are T cell responsive and stable complexes with class II MHC in vivo With higher MHC binding affinity compared to the natural peptide that forms the body The present invention has theorized that Specifically, the Applicant has II MBP peptide analogs that form stable complexes with MHC treat EAE In this respect, it was investigated that it was more effective when compared with the administration of Ac1-11. MB The P peptide analog Ac1-11 [4Y] has higher affinity for Aα^uAβ^uJoined to And Ac1-11 [4Y] and Aα^uAβ^uComplex formed in vitro between Coalescence is Ac1-11 and Aα^uAβ^uMore stable than those formed between The high potential has already been shown. Ac1-11 [4Y] also highly used before immunization It has been shown to prevent EAE when inhaled (Metzler , B. et al. , Above). The present invention provides a modified MBP peptide analog Ac1- 11 [4Y] is less effective as a therapeutic agent when compared to MBP Ac1-11. Require a dosing schedule that is at least 100 times higher and less frequent And are disclosed. This increased potency makes it more practical and more effective Thus, a therapeutic agent having both of the above is provided. The present applicant has obtained Ac1-11 [4Y]. (But not Ac1-11) intravenous administration of stable pepti in vivo The finding was that this resulted in the formation of the de-MHC complex. Ac1-11 [4Y ] Is considered to be involved in the formation of this stable peptide-MHC complex. Conceivable. These complexes contain MBP Ac1-1 for up to 10 hours after injection. Using 1-specific hybridoma Detected on spleen cells. Thus, the formation of a stable peptide-MHC complex is Thus, it may be one of the proofs of an effective therapeutic peptide. Surprised Strikingly, the in vivo therapeutic effect of Ac1-11 [4Y] is due to the peptide-MHC complex. The body persisted long after it was no longer detected on spleen cells (FIG. 6a and See FIG. 9). This indicates that this peptide-MHC complex is Antigen-specific therapeutic agent that exerts a long-lasting effect on cells Which persists after it is no longer detectable in vivo) It seems. Such a complex is effective at the periphery or in the central nervous system. It is unclear whether it will work. If they work in the central nervous system , The complex may be formed in situ, or the cell expressing the complex Vesicles may migrate across the blood-brain barrier.   The present invention further relates to a method of treating a cell comprising a therapeutically effective amount of IFN-β. Administering a therapeutically effective amount of at least one MBP peptide having A method for treating multiple sclerosis.   As a result of the studies described herein, myelin antigens (eg, MBP) Combination of at least one peptide having T cell activity and IFN-β Is found to have a synergistic effect when administered in certain therapies. However, this effect is surprisingly a symptom of EAE when administered alone (FIG. 12c). As for the relief of the condition, the EAE in the mice far exceeded each effect. Reversing the clinical symptoms of (FIGS. 12a-b), and this effect is similar to that of the peptide. Compared to what would be expected for a simple additive effect with the effect of IFN-β, growing.   EAE acts as a mouse model for human MS and has various myelin antigens (eg, For example, PLP, MBP, MOG) induce similar effects in humans. Is expected to exist. Therefore, the present invention may suffer from multiple sclerosis. Provides a method of treating an individual suspected of developing multiple sclerosis, the method comprising: , In certain treatments (this method further includes the administration of IFN-β), At least one having T cell activity derived from a myelin antigen in an immunogenic form Administering an effective amount of a composition of the invention comprising a peptide of the invention. Preferred composition Products include MBP peptides, as well as MBP peptides combined with MOG peptides. That is, the compositions of the present invention discussed in the first part are administered simultaneously or sequentially. Included in combination with IFN-β.   In the treatment method including the administration of IFN-β, the T cell activity of the myelin antigen is reduced. Administration of a composition of the invention comprising at least one peptide is involved in multiple sclerosis Known doses and duration to effectively reduce, eliminate, or prevent Can be carried out. When given simultaneously in a treatment The effective amount of either the peptide or IFN-β depends on the factors discussed above. Change. Active compounds (eg, MBP peptides or compositions thereof, and IFN-β) is administered by injection (subcutaneous injection, intravenous injection, etc.) as discussed above, orally May be administered in the usual manner, such as by inhalation, transdermal application, or rectal administration. No.   For example, preferably 1 μg to 3 mg, and more preferably about 20-500 μ g of myelin antigen-derived peptide per dose unit may be administered by injection . Preferably, 100 to 10,000 dose units of IFN-β are injected. May be given. Administration of these two compounds The method may be adjusted to provide the optimal therapeutic response. For example, IFN-β and And the composition of the invention may be administered simultaneously, or at least at intervals of 6 hours. , Preferably at least 12 hours apart, or even more preferably Or at least 24 hours apart. antigen Therapies that administer both peptide and IFN-β can last for days or weeks And may be needed due to the urgency of the treatment situation discussed earlier. If so, it may be reduced or extended.   The present invention further provides a myelin antigen in a pharmaceutically acceptable carrier or excipient. (Eg, MBP or MOG) and a peptide having T cell activity and I A novel composition comprising a physical mixture with FN-β is provided. This composition is applied to individuals Used as part of a therapy to treat or prevent multiple sclerosis May be.   Other autoimmune diseases such as, for example, type I diabetes and rheumatoid arthritis are Generally, the result of a response mediated by antigen-specific T cells to self-antigens. Have been accepted. For the treatment of autoimmune diseases mediated by T cells Various approaches have been proposed for the complete autoantigen or T cell epitopes derived therefrom. Of peptide-containing response of T-cell mediated response causing adverse symptoms of autoimmune disease Includes administration to patients for down regulation.   In MS, in addition to myelin autoantigens, which play a role, many antigens (such as That is, autoantigens are other autoimmune diseases (eg, diabetes, Grave). ) Diseases, myasthenia gravis, Good Pasture's symptoms Group, psoriasis, thyroiditis, and rheumatic (Symptoms) is found to produce disease symptoms (eg, insulin; rh factor; acetylcholine receptor; thyroid cell receptor; basement membrane protein; Thyroid protein; ICA-69 (PM-1); glutamate decarboxylase (6 4K or 65K); proteolipid; collagen (collagen) Ip II); heat shock protein (Heat Shock Protein) Carboxypeptidase H). Compositions similar to those described herein Articles and methods include, for example, rheumatoid arthritis, diabetes, myasthenia gravis, gray Grave's disease, Good Pasture's syndrome It may be used to treat autoimmune diseases such as herd, psoriasis, and thyroiditis. In this case, the antigen causing the disease is a protein autoantigen).   For many of the self-antigens listed above, identification with T cell activity Comprising at least one amino acid residue of the sequence, and preferably at least one Including a tope and / or inducing T cell unresponsiveness, or T cell response Peptides that reduce sex have been identified and isolated. For example, rheumatism Soluble type II strain, a protein antigen that is considered to be an autoantigen in arthritis Down-regulation of antigen-specific response to lagen Possible peptides have been identified in WO 94/07520. International public WO 94/07520 is believed to contain a T cell epitope and Useful in compositions and methods similar to those of the present invention for treating diseases. A method for identifying insulin peptides has been disclosed. In addition, An antigen or hypothesis that is assumed to be responsible for any of the diseases listed above Is the appropriate T cell epitope for the autoantigen T-cell epitopes of the peptide-containing peptide described above or of a protein autoantigen Any of the methods described in the Examples for identifying loop-containing peptides. May be more identified. Such T cell epitopes, including peptides, can be targeted Once identified, the peptide can be used in the treatment of multiple sclerosis. May be used in compositions and methods similar to those described herein.   The present invention is illustrated by the following non-limiting examples.Example 1 Human population of multiple sclerosis immune responses to myelin basic proteins and peptides Research and selection of MBP peptide suitable for therapeutic usePeptide synthesis   Peptides were synthesized using standard Fmoc / tBoc chemistry and applied to reverse phase HPLC. More purified. FIG. 3 shows the MBP peptides used in these studies. peptide The name or amino acid residue is constant throughout.Protocol: Analysis of human PBL for reactivity with MBP and MBP peptide   Using a Ficoll density gradient, a specific MS was obtained from 222 patients. PBL was purified from fresh peripheral blood samples (about 75 cc). 5% human AB blood RPMI supplemented with Qing, penicillin-streptomycin, and L-glutamine 2 x 10 per well in 1640 culture medium^FivePBL and 10 μg / ml Microtiter cultures were started on purified human spinal MBP. Start on day 6-7 In summary, cultures were treated with IL2 (20 units / ml) and IL4 (5 units / m Replenished in l). After 11-13 days, these microtiter cultures are washed, In a new medium And split into 12 new microtiter wells. Self-derived frozen 5x10 per well with PBL as antigen presenting cells^FourAdded by PBL.   Twelve replicate wells from each microtiter culture received the screening antigen positively. Added in two minor ways. Medium is always used as a negative control, 10 μg / ml Was used as a positive control. Up to 4MBP Each patient was also tested for reactivity with the peptide at a concentration of 10 μM each. 48 hours Later, these assays were run at 0.75 μCi.^ThreePulse-labeled with H-thymidine, Collected after a 16 hour pulse.   The following criteria: stimulation index greater than 3.0, greater than 500 or Change in equal cpm and standard error of the mean less than change in cpm Culture was scored positive for each peptide. In addition, the purpose of the analysis Only if the culture responded to both MBP and peptide, and If any of the products did not react with more than one non-overlapping peptide, Sex ". Using a minimum of 19 and a maximum of 43 patients, each of the peptides The reactivity with each was tested.result   For each of the patients, an average of 6% of the microtiter culture was involved in MBP responsiveness. Were scored as positive (MBP positive cultures ranging from 0-37 per patient). patient In 77% of the cultures, at least one microtiter culture becomes MBP-reactive. , And these individuals were considered to be "MBP responders." MBP responders' status was gender, MS Type (RR vs CP), HLA-DR type, age, or patient is Betasero There was no correlation with whether n was taken.   The MBP peptides tested overlapped the entire human MBP sequence (18 . A panel of 16 20 mers (FIG. 3) spanning the 5 kD isoform) was included. Two additional longer peptides were also tested (MBP sequence (MBP83-10 5 and MBP 141-165, FIG. 3)). Next, for one of the MBP peptides Based on the percentage of MBP-positive microtiter cultures that were also scored positive. P peptide reactivity was calculated. Four of the peptides each had total MBP reactivity Accounted for at least 10% (MBP11-30, MBP81-100, MBP83-105, and MBP141-165). In addition, the individual M tested In at least one-third of BP responder MS patients, each of these peptides Reactivity was detected. In addition, 77% of MBP responders had MBP83-1 05 or MBP 141-165, or both peptides Shows reactivity.   MBP 141-165 reacts best among the four peptides and all MBP anti- Occupying 21% of the total number of MBP responders tested there were. MBP 141-165 comprises MBP 141-160 and MBP 151-1 70 seem to contain T cell epitopes from both It showed dramatically higher reactivity than the two 20mer peptides. MBP81- 100 and MBP83-105 are very similar in sequence and are not identical. It appears to contain similar, if any, T cell epitopes. These are HL It corresponds to the region previously thought to bind to the A-DR2 haplotype. Our conclusion The results indicate that both DR2 and non-DR2 MS patients Has the reactivity of MBP11-30 is frequently recognized in MS patients. It is a region of peptide reactivity that was not previously thought to be perceived.   Each of the other peptides accounted for less than 5% of the total MBP reactivity, and the M Detected in 20% or less of BP responders (see FIGS. 4a and 4b) ). The highest reactivity among this group of peptides is found in MBP111-130. This accounts for 4.5% of the MBP responders and represents 19% of the MBP responders tested. %.Selection of preferred MBP peptides   Preferred MBP peptides are based on two criteria:     1. Number of MS patients responding to the candidate peptide (at least one of the peptides At least 75% of patients tested that respond to protein antigens recognized in Person)     2. The magnitude of the T cell response to the candidate peptide in MS patients ( Response to candidate peptide equal to 40% of total reactions Selected based on   MBP83-105 (MBP-2) and MBP141-165 (MBP-4) Meet the first criterion (77% of MBP responders have one or both of these One). See Table 1 below. These two peptides together form the MBP It accounts for 32% of the reactivity (see Table 2 below). Thus, the three peptides together account for 42% of the MBP reactivity, Adding MBP11-30 (MBP-1) satisfies the second criterion. MB P111-130 (MBP-3) are also, in particular, MBP-1, MBP-2 and M Suitable as a preferred peptide for therapeutic use in combination with BP-4 . MBP81-100 appears to be equivalent to MBP83-105, which is also Can be used with other peptides selected as preferred.                               Example 2 Administration of peptides to mammals for the treatment of EAE as a model for multiple sclerosis Peptide synthesis   Automated peptides using standard 9-fluorenylmethoxycarbonyl chemistry Tide synthesis (ABI430A, Applied Biosie nces, Foster City, CA). high speed The peptide was purified by liquid chromatography and the amino acid composition was confirmed. Selection The selected peptide sequence is MBP Ac1-11 ASQKRPSQRHG; MBP  Ac1-11 [4A] ASQARPSQRHG; MBP Ac1-11 [4Y] ASQYRPSQRHG; MBP 31-47 RHRDTGILDSIGRFFF SG; Ova 323-339 ISQAVHAAHAEINEAGR; and Ov a 323-337 ISQAVHAAHAEINEA.Purification of MBP   Smith, M .; E. FIG. ,J. Neurochem. , 1969, 16:83. Using a modification of the method, the guinea pig spinal cord (Keystone Biological) als, Cleveland, OH). In short, ku MBP was extracted from the isolated myelin membrane using roloform and methanol, Precipitated with potassium enoate, acid extracted and lyophilized. SDS of this substance -PAGE showed a major band at the expected molecular weight of 18.5 Kd.EAE induction, scoring, and peptide therapy   From Jackson Laboratory (Bar Harbor) ME EAE was induced in the obtained (PLJ x SJL) F1 mice. mouse When they reached the age of 8-14 weeks, an additional 400 μg per mouseM. tube rculosis   H37Ra (Difco Laboratories, De complete Freund's adjuvant (Gibco La) supplemented with troit, MI) borateries, Grand Island, NY) 100 μg MB EAE was induced by immunization with P. At immunization and 48 hours later, 200 ng of pertussis toxin (JRH Biosciences, Lenexa, KS) It was administered intravenously. The following measures: 1, tail palsy; 2, partial hind limb paralysis 3, complete hind limb paralysis; 4, forelimb paralysis; 5, dying or death based on clinical signs And given a score to the mouse. Stage 5 mice were euthanized. After death, the mouse It was excluded from later calculations of average clinical scores. It will be described in the individual examples below. As described above, the peptide was administered intravenously.   For lymph node proliferation and IL2 production assays, the groin and the aorta Mice immunized as described above for EAE induction (Pertussis toxin was not included in the growth experiments). MBP peptide And 0.5% of new normal mouse serum, penicillin-streptomycin, L-glutamine, and 5 × 10^-FiveR supplemented with M 2-mercaptoethanol 5x per well in round bottom microtiter plates with PMI1640 10^FiveAnd cultured the lymphocytes. After 72 hours incubation, proliferation assay Culture^ThreePulsed with H-thymidine for 16 hours. For IL-2 assays , Culture supernatants are harvested in 24 hours to aid in the growth of their IL-2-dependent cell line HT2. I checked the ability to put it. To distinguish IL2 production from IL4 production, HT2 cells 10. Monoclonal antibodies that inhibit IL-4 induced proliferation B. 11 10% Culture supernatant (O'Hara, J. et al.Nature1985, 315: 333). The HT2 bioassay was performed in the presence of   Ac1-11 [4Y] cancels EAE when administered after onset of paralysis FIG. 9 shows the result indicating that this is the case. In a group of 14 mice, EAE was converted to MBP Induced. After the mice showed clinical signs of EAE, they were individually cured in each mouse. Therapy was started. For each individual, present the data for the start of treatment (Day 1 = each Development of clinical signs for individual mice). On days 1, 4, 11, and 18 of the disease , Mice were injected intravenously with PBS (open circles), 250 nmol Ac1-11 [4Y] ( (Solid squares), or 250 nmol Ova323-337 (solid circles). Another control group did not receive any treatment (open squares). The 5th little cross 1 shows individual mice that died or were killed due to EAE. Untreated control The group had an MMS of 4.6 and a mortality of 64%. MM in the group treated with PBS S was 4.4 and mortality was 35%. Of the group treated with Ova323-337 The MMS was 4.2 and the mortality was 21%. Treated with Ac1-11 [4Y] The group had an MMS of 3.2 and a mortality of 7%.   FIG. 10 shows that when administered during the remission phase of the disease, Ac1-11 [4Y] Indicates to prevent recurrence. EAE was induced with MBP. Appearance of first symptoms of EAE On the second day of the later remission phase, treatment was started individually in each mouse. For each individual And represent data for the start of treatment (Day 1 = Day 2 of remission). 6-7 animals Groups of surviving mice were challenged on days 1, 4, 7, and 18 after the onset of remission. In the pulse, PBS (open circle) or 25 nmol Ac1-11 [4Y] (closed square) Treated with either. Small cross died or killed due to stage 5 EAE Shows individual mice. The first manifestation of the disease before remission, from 3 to 18 days Followed (average 9 days for both groups). MMS during the first disease outbreaks showed two groups of mice For the group treated with PBS (3. 0, 3.9 for the group treated with Ac1-11 [4Y]. Treated with PBS The group had a post-treatment MMS of 4.1 and a mortality of 33%. Treated with peptide The group had a post-treatment MMS of 0.3 and a mortality of 0%.   FIG. 11 shows that intravenous administration of Ac1-11 or Ac1-11 [4Y] was without T cells. It shows that it induces reactivity.   a. Groups of 3-4 mice were immunized with 150 μg MBP 10 and 5 days before Of PBS (solid circle) or 250 nmol Ac1-11 (solid square) intravenously Pre-treated with either. Lymph node proliferation assay with MBP Ac1-11 on day 9 Went to the eyes. Controls were as follows: PBS pre-treated PPD 1 08277 / medium 1855 and Ac1-11 pre-treated PPD 88499 / medium 1 335.   b. Groups of 4 mice were immunized with 150 μg of MBP 10 and 5 days before immunization. Pretreated intravenously with either PBS or 250 nmol Ac1-11 [4Y] I understood. Reload with 150 μM Ac1-11 or 17 μM Ac1-11 [4Y] The ampanode IL-2 production assay was performed on day 10.Example 3 Peptide administration during the exacerbation period   Recurrent EAE was observed in F1 mice after immunization with MBP (PLJ x SJL). Appearance (Fritz, RB, etc.,J. Immunol. , 1983, 130: 1. 024), making this EAE model ideal for investigating therapeutic intervention. M BPac1-11 induces immunodominant encephalitis in (PLJxSJL) F1 mice Although it is a substance, Pitotop MBP31-47 is also encephalogenic in this strain. This EAE induced by MBP with either one or both of these encephalitogenic peptides To determine if it is necessary for the treatment of Intravenous injection of MBP Ac1-11 and MBP31-47 together or Ac1-1 The procedure of Example 2 was followed, except that treatment was performed with only one. Control mouse Groups receive intravenous injection of PBS or control peptide Ova323-339. A, non-immune in F1 mice irrespective of MBP (PLJ x SJL) α^uBβ^uTreated with the binding peptide.   FIG. 5 shows either alone (FIG. 5a) or in combination with MBP31-47 (FIG. 5b). Repeated intravenous injections of any MBP Ac1-11 increase the incidence of EAE , Severe, and reduce mortality. Treatment with two peptides, MBP  It appears to be somewhat more effective than treatment with Ac1-11 alone, Agree with the results of others. 6 peptide veins throughout the acute and first relapse period Mice were treated with intra-injection. Next, during chronic remission, treatment with MBP peptide Mice were probed up to day 125 without any signs of end-stage disease (Data not shown). The control Ova323-339 peptide was iv When administered by the internal route, it had no effect on the disease (FIG. 5c). Another fruit In experiments, intravenous administration of MBP31-47 alone was effective in treating EAE. Not effective (data not shown). FIGS. 5 (a), (b) and (c) 4 shows the efficacy of intravenous treatment of mice with EAE induced by MBP. 11-16 animals In a group of mice, EAE was induced with MBP as attempted above. Mouse, 9, 12, 13, 21, 29, And on day 37, treated with an intravenous injection of 250 nmol of each peptide. The small cross used in all figures herein died due to stage 5 EAE Shown are individual mice that died or were killed. Control group treated with PBS (black Circle). These results indicate that the immunodominant encephalitis-inducing peptide of MBP was (PLJ), as indicated by a decrease in the severity and mortality of EAE in x SJL) required to treat MBP-induced EAE in F1 and Indicates that it is enough.Example 4 Multiple intravenous injections of Ac1-11   Following the preparation steps in Example 2, multiple injections of Ac1-11 were prepared. One injection of peptide on day 9 delays disease for two days and reduces mortality by 100% However, all of the treated mice eventually suffered from severe EAE. (Data not shown). Three injections of the peptide during the acute phase of EAE were initially The disease was effectively treated, however, during the relapse phase, the treated group of mice Suffered late-onset disease (data not shown). Together, these results are EA Multiple intravenous injections of MBP peptide during the acute and first relapse phase of E resulted in (PLJ x SJL) Required to treat MBP-induced disease in F1 mice Indicates that Thus, to prolong and reduce the severity of the disease, Ac1-1 One multiple injection is required. FIG. 6 shows that Ac1-11 [4Y] is different from Ac1-11. It shows that EAE is treated in lower doses and has a longer lasting effect on the disease. 8- In a group of 10 mice, EAE was induced with MBP. FIG. 6a shows 12 and On the 15th day, intravenous PBS (phosphate Buffered saline) (open circles), 250 nmol of Ac1-11 (solid squares), or 25 Shown are mice treated with 0 nmol of Ac1-11 [4Y] (open triangles). PBS The MMS of the mice treated with was 4.4 and the mortality was 60%. Ac1-11 The MMS of the mice treated with 3.9 was 3.9 and the mortality was 37.5%. Ac1- MMS of the mice treated with 11 [4Y] was 2.1 and the mortality was 0%. Figure 6b was intravenously injected with PBS (white) on days 12, 15, 18, 21, 24, and 27. Mice treated with either (circle) or 2.5 nmol of Ac1-11 (filled circle). Is shown. Mice treated with PBS had an MMS of 2.9 and a mortality of 20%. . The MMS of the mice treated with the peptide was 4.3 and the mortality was 50%.Example 5 With MBP peptide analogs that form stable complexes with class II MHC in vivo Treatment   Since the peptide-MHC complex is a functional therapeutic unit for treating EAE, Applicants have identified Ac1 in treating ongoing EAE induced by MBP. It was theoretically assumed that -11 [4Y] was more potent than Ac1-11. This hypothesis Example 2 except that the injection schedule and volume were changed to test The process was performed. FIG. 6 shows Ac1-11 [4Y] twice in the early stages of the course of the disease Injection alone produces a longer lasting effect than two injections of Ac1-11 Show. Further, FIG. 6b shows that repeated intravenous injections of Ac1-11 [4Y] It shows that it is very effective in treating EAE in an amount of 2.5 nmol (FIG. 6c). Thereafter, a histological examination was performed. Tissue dissection from brain and spinal cord of EAE Pieces were prepared and hematoxylin and eosin (CVD) Inc. , West Sa C.mento, CA). Inflammatory infiltration on a 1-4 scale by blinded subjects Sections were scored for items. Inflammatory centers in mice treated with peptides Treated with peptide and with PBS, showing significantly reduced number and severity of nervous system infiltrates Histological examination of brain and seminal spinal cord sections from treated mice revealed Ac1-11 [4Y]. Was confirmed (FIG. 7). FIG. 7 shows that the inflammatory infiltrate was Ac1-11 [4Y]. Shows that it is reduced in mice treated with. Improvement of Ac1-11 [4Y] The effect is clear.   The improved effect of Ac1-11 [4Y] was apparent in the above example. . Applicants have reported that stable peptide-MHC conjugates^uAβ^uAnd stillness Formed between Ac1-11 [4Y] injected intravenously, thereby observing It was theoretically assumed to cause an improved effect. These were formed in vivo The complex is a 1934 hybrid from an encephalitogenic MBP-specific T cell clone. Can be detected using a mask. The injection timing and amount were prepared as described below. Except for following the steps in Example 2 above. Wraith, D.W. C. etc,Ce ll   According to the method outlined in 1989, 59: 247, 1934 T cell high Bridoma is specific for MBPAc1-11. In short, hybrid Mammary cells are cultured in a flat bottom microtiter with MBP peptide or peptide analog. 5 x 10 per well in plate^FourIncubated. 3000rads 5 x 10 irradiated at^FivePresentation of (PLJ x SJL) F1 spleen cells Added as cells. Serum supplementation was 10% fetal bovine serum compared to normal mouse serum. Except that Same as for the nodal proliferation assay. The supernatant was collected in 24 hours and The ability to support T cell proliferation was examined. Then 250 nmoles of Ac At various times after injection of 1-11 [4Y], spleens were removed from injected mice. These spleen cells were tested against Ac1-11 specific hybridoma 1934. Used as original presentation cells. No additional peptide was added to these cultures . FIG. 8 shows that spleen cells “pulsed labeled” with Ac1-11 [4Y] in vivo. , 1934 are very effective in activating hybridomas. The ability to activate hybridomas is greatest 2 hours after injection, After 4 to 6 hours it starts to decrease. 10 hours after injection of Ac1-11 [4Y] Activation is minimal by 20 hours and is absent by 20 hours (data not shown). As can be seen from FIG. 8, the experiment with Ac1-11 was performed one hour after injection. Does not show any activation of hybridomas by spleen cells from injected mice. (Data not shown). Formed in vivo as shown in more detail in FIG. The peptide-MHC complex obtained was injected into mice injected with Ac1-11 [4Y]. Can be detected. Groups of two mice were given various times before removal of the spleen (1-10 hours During), 250 nmol Ac1-11 [4Y] was injected intravenously. These notes Spleen cells from the exposed mice were transformed with 1934 hybridisers to produce IL2. The ability to activate malignant cells was examined. Results are expressed in terms of HT2 proliferation. this These results indicate that the formation of a stable peptide-MHC complex in vivo is We support the hypothesis that it contributes to the effects of certain MBP peptide analogs.Example 6 Synthesis of mouse MBP peptide Ac1-11   Mouse MBP peptide Ac1-11 using standard Fmoc / tBoc synthesis Was synthesized and purified by HPLC. The amino acid sequence of peptide Ac1-11 is as follows: It is as follows.Induction of EAE   6-8 week old female (SJL x PL) F1 mice (Jackson   Labs, Bar Harbor, ME). Strain M. tubeculosis (DIFCO Lab., Detroit, M I) containing CFA (GIFCO Lab., Grand Island, Immunized subcutaneously at the base of the tail with 100 μg of purified guinea pig MBP in NY) To induce EAE. Even on the day of immunization and 48 hours later, 200 ng of 100 Anti-day cough toxin (JHL BIOSCIENCE, Lenexa, Kansas) Two doses were given intravenously (iv). Monitor mice daily for disease symptoms , The following scale: 0 = no disease symptoms of EAE, 1 = sloppy, response Soggy tail, 2 = partial hind limb paralysis, 3 = complete hind limb paralysis, 4 = partial to complete Severe forelimb paralysis, and 5 = moribundness, scored for disease severity. Data is group As average of disease severity scores for each day, including all animals in. mouse For 26 days. Once a mouse dies from EAE, all subsequent A score of 5 per day was included in the calculation.Effect of IFN-β on EAE   In a titration experiment to determine the effect of various amounts of IFN-β on EAE ( Figure 13), one group of mice 9, 13, and 1 after EAE induction On day 6, the mice were treated intraperitoneally with PBS (control) and one group of mice was On days 3 and 16, treatment was performed with 10,000 units of IFN-β (open circles). One group of mice was then treated on days 9, 13, and 16 with 2,000 units of I Treated with FN-β (filled circles). As shown in FIG. 13, the symptoms of EAE were IFN- is similar at each time point for both amounts of β, which results in lower amounts of IF Suitable for experiments with N-β, less potential for toxicity due to higher amounts of IFN-β Therefore, it is a preferable amount. This amount is the clinical score Having shown an improvement, 2000 units of IFN-β were then added to FIGS. Used in the remaining experiments shown in c.   As shown in FIG. 12a, on days 9, 12, 16, and 20, the control group Mice were treated with PBS and another group of mice was given 2,000 units intraperitoneally. IFN-β. As shown in FIG. 12a, the group treated with IFN-β During the time course, they had only slightly less symptoms than the control group.Effect of mouse MBP peptide Ac1-11 on EAE   The effect of mouse MBP peptide Ac1-11 was measured and these results are shown in FIG. Shown in One group of mice was administered on days 10, 13, 17, and 21 after EAE induction. Treated intraperitoneally with PBS (control) and one group of mice On days 13, 17, and 21 intravenous with 250 nmol of peptide Ac1-11 Treated. These mice were monitored as described above. As shown in FIG. 12b , Ac1-11 treated mice had milder symptoms than the control group.To EAE for treatment with a combination of peptides Ac1-11 and IFN-β Effect   FIG. 12c shows the results of treatment with the combination of peptides Ac1-11 and IFN-β. Shown in One group of mice was treated intraperitoneally with PBS after EAE induction (control ) And one group of mice on days 10, 13, 17, and 21 Were treated with 250 nmol of peptide Ac1-11 (open arrow), 9, 12, On days 16 and 20, they were treated intraperitoneally with 2000 units of IFN-β. Figure As shown in FIG. 12c, mice treated with a combination of peptide and IFN-β Groups were the control group and IFN-β as shown in FIGS. 12a and 12b. Or reduction in severity of symptoms compared to treatment with either or peptide alone And the synergistic effect of this combination. Thus, the peptide and I A treatment regimen that includes a combination of FN-β will reduce the severity of EAE symptoms Provides enhanced effects.Equivalent   Those skilled in the art will be able to use the It is possible to recognize or ascertain numerous equivalents to the particular method described. Wear. Such equivalents are considered to be within the scope of the present invention, and are set forth in the following claims. Is included in the range.Example 7 Spinal cord homogenate (SCH) -induced EAE as a model for multiple sclerosis Of peptides to mammals for the treatment of cancer Peptide synthesis   Automated peptides using standard 9-fluorenylmethoxycarbonyl chemistry Tide synthesis (ABI430A, Applied Biosie nces, Foster City, CA). High-speed liquid The peptide was purified by body chromatography and the amino acid composition was confirmed. Choice The peptide sequence obtained is MBP Ac1-11 ASQKRPSQRHG; MBP Ac1-11 [4A] ASQARPSQRHG; MBP Ac1-11 [4Y] ASQYRPSQRHG; MBP 31-47 RHRDTGILDSIGRFFF SG; Ova 323-339 ISQAVHAAHAEINEAGR; and Ov a 323-337 ISQAVHAAHAEINEA.Purification of MBP   Smith, M .; E. FIG. ,J. Neurochem. , 1969, 16:83. Using a modification of the method, SCH was transferred from guinea pig spinal cord (Keystone Biol). organics, Cleveland, OH). SCH protein The mixture was lyophilized and used according to dry weight.EAE induction, scoring, and peptide therapy   From Jackson Laboratory (Bar Harbor, ME) EAE was induced in the obtained (PLJ x SJL) F1 mice. mouse When they reached the age of 8-14 weeks, an additional 400 μg per mouseM. tube rculosis   H37Ra (Difco Laboratories, De complete Freund's adjuvant (Gibco La) supplemented with troit, MI) 500 emulsified in B. boratories, Grand Island, NY) EAE was induced by immunization with -1000 μg of SCH. At immunization and After 48 hours, 200 ng of pertussis toxin (JRH Biosciences, L. enexa, KS) was administered intravenously. The following measures: 1, tail paralysis; 2, partial hind limb paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or dead Mice were scored based on clinical signs by Stage 5 mice are euthanized I let you. After death, the mice were removed from later calculations of average clinical scores. The following individual examples The peptides were administered intravenously as described in   Ac1-11 [4Y] cancels EAE when administered after onset of paralysis The results shown are shown in FIG. In groups of 14 mice, EAE was induced by SCH Led. After the mice showed clinical signs of EAE, treatment was performed individually in each mouse. Started. For each individual, present the data for the start of treatment (Day 1 = each individual Development of clinical signs for mice). On days 1, 3, 6, and 9 of disease, mice With PBS (black square), 250 nmol Ac1-11 [4Y] (intravenous) (white three Horn) or 250 nmol Ac1-11 [4Y] (subcutaneous) (open circle) Was. Small stars indicate individual mice that died or were killed due to stage 5 EAE You.   FIG. 17 shows that when administered before symptoms of the disease appear, Ac1-11 [4Y] becomes EA Indicates that the occurrence of E is prevented. EAE was induced on SCH. Disease induction with gpSCH Eight days after induction, treatment was started individually in each mouse. Treatment for each individual Represents data for the start of. Groups of surviving mice were 8, 10, 13, On the 17th and 17th days, 25 nmol Ac1-11 [4Y] (intravenous) (open triangle) Or 25 nmol Ac1-11 [4Y] (subcutaneous) (filled circle). One The group did not receive any treatment (open squares).   The results shown in FIGS. 16 and 17 indicate that administration by either route prevented the onset of symptoms. It is effective in passing.Example 8   The same procedure was followed as in Example 2, but with lymph node proliferation and IL-2 production. No production assay was performed. On day 0, ESE was induced using gpMBP, Thereafter, on days 8, 10, 13, and 17, the three groups of mice were exposed to Ac1-11 [4Y]. Gave. Intravenous administration (open triangle), subcutaneous injection (closed circle), and control (open circle) FIG. 18 is a graph showing these results. Ac1-11 [4Y] Pretreatment (eg, treatment prior to the onset of symptoms) is a gpMBP-induced EAE disease Can be prevented.Example 9 CDNA encoding human MOG protein   First attempt to obtain human DNA encoding MOG protein Published rat MOG coding sequence of Gardinier et al. (Supra). Polymerase chain reaction using 3 'and 5' primers devised from The human cDNA library was subjected to PCR (PCR). Probably human and rat Due to insufficient homology at the 5 'and / or 3' end of the However, a human MOG sequence could not be obtained.   Therefore, four rat internal oligonucleotides were devised. These two are the remains Homologous to the upper chain of the gene (primers 94-111 and 166-183 (SEQ ID NO: 3) 4), bases 1) beginning with ATG, and two were homologous to the lower chain of the gene (pro Limer 538-555 (SEQ ID NO: 35) and 685-702). Primer 1 66-183 (SEQ ID NO: 34) and 538-555 (SEQ ID NO: 35) Is a human brain cDNA library. Results in amplification of a fragment of the expected size of about 400 bp from the library Succeeded. The sequences of these primers a) 166-183: CAGAATCCGGGAAGAATGCCCACGGGC (; SEQ ID NO: 34), and b) 538-555: CAGCGGCCGCACGGAGTTTTCCCTCTC AG (SEQ ID NO: 35).   An EcoRI site is present in the 166-183 primer (SEQ ID NO: 34), An otI site is present in the 538-555 primer (SEQ ID NO: 35).   pVL1393 (Pharmingen CA) with EcoRI and NotI Digest, digest the amplification products with the same enzymes, and combine these resulting fragments. By ligation, the 400 bp PCR product was added to the expression vector pVL1393. Cloned. Several clones from the ligated plasmid were And NotI, and the resulting 400 bp human MOG fragment was sequenced. The insert was verified by rinsing. 738 bp rat open tree Based on the reading frame, the resulting insert is likely to have a 5 'sequence. It lacks 184 bp and 201 bp of the 3 'sequence.   From the upper and lower chains at positions 346-363, from the 400 bp insert, To 5'-CAGAATTCTCAGGTTCTCAGATGAAGGA-3 '(array No. 36), and 5'-AAGCGGGCCGCTATCCTTTCATCTGAGAACCT-3 '( SEQ ID NO: 37) In the sequence, an EcoRI site is in the first strand and a NotI site is in the second. Exist, Two primers were devised. The underlined region corresponds to the MOG sequence.   From the same human brain cDNA library used previously, 5 'and 3' To amplify missing ends, human MOG346-363 upper and lower chain primers (SEQ ID NOs: 36 and 37) were substituted with the above 5 'and 3' rat primers, respectively. Used in combination with A PCR product corresponding to the 3 'end of the gene was obtained, No 5 'end occurred.   The resulting 3 'fragment has the expected size of 400 bp, Fragment was cloned into pVL1393 and sequenced.   To obtain the 5 'part of the gene, it was previously amplified and 8x10^Tenpfu / ml Human brain cord λgt10 library obtained from Clontech Were screened according to the protocol described by the manufacturer. Rye Cultures were grown at 30,000 plaques / plate on 12 large plates. These plaques were transferred onto nitrocellulose filters (two replica filters). Luther / plate). 12 filters transferred from 12 different plates, Next, an internal 400 bp fragment of the first cloned human MOG (position 184-534)³³Hybridized to P-labeled probe . 22 strong positives were obtained. For each positive, remove a portion from the original plate and Incubated overnight in lambda dilution buffer to elute phage from the sky. The tube was then centrifuged and the supernatant was transferred.   Λgt10 forward primer having an SstI site, 5'-CTTTTGAGCAAGTTCAGCCTGGTTAAG-3 '(SEQ ID NO: No. 38), or a λgt10 reverse primer having an XhoI site, 5'-ACCCTGAGGAGGTGGCTTATGAGATTTCTTCC AGGGTA-3 '(SEQ ID NO: 39), as well as a human MOG internal primer. The upper or lower chain of the mer, 5'-GGTGCGGGAAAGGTGACTCTCAGGATCCGGAAT- 3 '(SEQ ID NO: 40), or 5'-ATTCCGGATCCTGAGAGTCACCTTTCCCGCACC- 3 '(SEQ ID NO: 41) Was used to amplify DNA from each individual pool.   The last two primers (SEQ ID NOs: 40 and 41) are natively human MOG sequences BamHI site present in the sequence (underlined in the sequence).   These primers are combined in four different combinations: 1) forward On top / under internal MOG, 2) under reverse / under internal MOG, 3) over internal MOG / river 4) on the internal MOG / forward.   The first two combinations give the 5 'end of the gene (up to the BamHI site). The last two gave the 3 'end of the gene. Both 5 'and 3' parts untranslated Including the region. Which of the two members of each combination actually Whether a clone was generated depends on the orientation of the cDNA cloned into λgt10.   The size of the resulting fragments varied from pool to pool. Largest 5 of the 5 'or 3' fragments are replaced with the SK poly Subclones at the SstII and BamHI or BamHI and XhoI sites of It has become Three clones from each pool were then removed for the presence of PCR errors. And sequenced. This is the complete sequence of the coding region of the gene, As well as a 174 bp 5 'untranslated sequence.   The complete DNA sequence found (SEQ ID NO: 1) and the deduced amino acid sequence ( SEQ ID NO: 2) is shown in FIG.   The human MOG gene has 246 amino acids in the rat protein and 87% of the phase. Encodes a 248 amino acid preprotein with homosexuality. The mature protein It contains 218 amino acids (SEQ ID NO: 2) numbered 1-218 in FIG. The mature protein begins with the glycine shown at position 1 and starts at the MET start codon. From the previous sequence up to the alanine residue immediately before the glycine shown at position 1 Of 248 amino acids from the proprotein.Example 9A Expression of truncated human MOG in SF-9 insect cells and E. coli SF-9 expression   1 to 121 amino acids of human MOG (the first 121 amino acids of SEQ ID NO: 2) PVL1393 transfer vector containing a truncated human MOG cDNA The vector was transformed with Baculogold linear Bacillus DNA (Pharmin). gen, San Diego, CA). Recombination The culture supernatant containing the virus was collected 4 days later. This recombinant virus Plaque purified and subjected to three rounds of amplification to obtain a high titer virus stock. Was. AF-9 cells were then infected with the virus stock at an MOI of 2.0. Infected cells Supernatant was collected 48 hours after infection and loaded on a NiNTA agarose column. . Recombinant MOG protein was purified under non-denaturing conditions using 250 mM imidazole. And dialyzed against 5% propionic acid and water, then lyophilized. Tan The protein concentration was estimated by BCA. Purify MOG protein with Coomassie Visualized on a 12.5% polyacrylamide gel stained with blue.Example 10   A shortened human MOG (huMOG) was disclosed in Examples 9 and 9A. Prepared as follows. MBP (guinea pig) was prepared as disclosed. 75 μg g pMBP, and 100 μg huMOG (open triangles), and 75 μg MBP And the combination of 100 μg huMOG (solid squares) Example 2 above, except that EAE was induced in a separate group of mice Followed the law. The graph in FIG. 19 shows the course of the disease for each of this example. Diseases induced by both MOG and MBP are less than those induced by either alone. Rather heavy. These results indicate that both MOG and MBP contribute to disease. Is shown.Example 11   The disease was induced using huMOG + gpMBP as in Example 10 (day 0 Eye = disease induction). Mice were injected 6, 8, 10, 13, 17, 2, prior to the onset of symptoms. On days 2 and 27, 250 nmoles of Ac1-11 [4Y] and control Treatment (PBS) (arrows indicate treatment). As the graph in FIG. 20 shows , Treatment with Ac1-11 [4Y] (open square) compared to control (closed square) Significantly reduced average clinical score A little.

────────────────────────────────────────────────── ─── Continuation of front page    (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, M C, NL, PT, SE), OA (BF, BJ, CF, CG , CI, CM, GA, GN, ML, MR, NE, SN, TD, TG), AP (KE, LS, MW, SD, SZ, U G), AM, AT, AU, BB, BG, BR, BY, C A, CH, CN, CZ, DE, DK, EE, ES, FI , GB, GE, HU, IS, JP, KE, KG, KP, KR, KZ, LK, LR, LT, LU, LV, MD, M G, MN, MW, MX, NO, NZ, PL, PT, RO , RU, SD, SE, SG, SI, SK, TJ, TM, TT, UA, UG, US, UZ, VN (72) Inventor Gafter, Malcolm             Massachusetts, United States 01773             Nkhan Bay Curb Ridge Road 46 (72) Inventor Hus, Day-Fway             94304 Pa, California, United States             Roalto Benchyura Avenue 246 (72) Inventor Shi, Jia Dong             94041 Ma, California, United States             Untenbye Number 1 Church             Treat 98 (72) Inventor Pariart, Xavier             94115 California, United States             Francisco Apartment 1 Sata             Street 148 (72) Inventor Deboreau, Bridget             94061 Les, California, United States             Woodland Oliver Street             1113 (72) Inventor Ross Bird, Gijonasan             94027 A, California, United States             Sirton Watkins Avenue 54 (72) Inventor Franzen, Henry             United States Massachusetts State 02172 U             Watertown Charles River Road             372

Claims (1)

[Claims] 1. At least one peptide, wherein said peptide is a group of the following peptides: MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2 0.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (all of which are shown in FIG. 2); Alternatively, a composition for treating multiple sclerosis in a mammal, wherein the composition is selected from a variant or analog or peptidomimetic thereof. 2. 2. The method of claim 1, wherein said at least one peptide is selected from the group consisting of MBP-1.1, MBP-2.1, MBP-4, and MBP-5, all of which are shown in FIG. Composition. 3. 2. The composition of claim 1, wherein said at least one peptide is MBP-4. 4. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (all of which are shown in FIG. 2): at least one peptide derived from MBP selected from the group consisting of: A composition for treating multiple sclerosis in a mammal, comprising: at least 40% of the total T cell reactivity to MBP in a population of individuals having T cells that respond to MBP. A composition comprising: 5. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, At least two peptides of MBP selected from the group consisting of: MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (all of which are shown in FIG. 2). A composition for treating multiple sclerosis in a mammal, comprising: 6. 6. The method of claim 5, wherein said at least two peptides are selected from the group consisting of: MBP-1.1, MBP-2.1, MBP-4, and MBP-5, all of which are shown in FIG. Composition. 7. 6. The composition of claim 5, wherein one of said at least two peptides comprises MBP-4. 8. Amino acid sequence: 13-25, 31-50, 61-80, 82-92, 82-96, 82-97, 82-98, 82-100, 82-100 [100P> Y], 83-100, 83-101, 84-97, 84-100, 84-100, 85-100, 86-105, 87-99, 87-99 [91 K> A], 88-100, 88-99, 111-135 , 122-140, 139-170, 141-160, 142-166, 142-168, 146-160, and 153-170 (all of which are described in FIG. 14). 6. The composition of claim 5, further comprising a peptide. 9. Amino acid sequence: selected from the group consisting of 13-25, 87-99, 87-99 [91K> A], 82-100, 82-100 [100 P> Y] (all of which are shown in FIG. 14) 6. The composition of claim 5, further comprising at least one peptide. 10. Comprising at least two peptides derived from MBP, wherein at least one peptide is MBP-4 and at least one peptide is: MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-5, 13-25, 31-50, 61-80, 82-92, 82-96, 82-97, 82-98, 82-100, 82-100 [100 P> Y], 83-100, 83- 101, 84 to 97, 84 to 100, 84 to 100, 85 to 100, 86 to 105, 87 to 99, 87 to 99 [91 K> A], 88 to 100, 88 to 99, 111 to 135, 122-140, 139-170, 1 Treating multiple sclerosis in a mammal selected from the group consisting of 41-160, 142-166, 142-168, 146-160, and 153-170, all of which are shown in FIGS. Composition for 11. At least one peptide is MBP-4 and at least one peptide is: MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2. , MBP-2.3, MBP-2.4, MBP-2. 5, MBP-2.6, MBP-3, MBP-3.1, MBP-5, 13 to 25, 87 to 99, 87 to 99 [91 K> A], 82 to 100, 82 to 100 [100] P> Y] (all of which are shown in FIG. 14). 12. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (all of which are shown in FIG. 2) comprising at least two peptides of MBP selected from the group consisting of: A composition for treating multiple sclerosis in a mammal, said composition comprising at least 40% of the total T cell reactivity to MBP in a population of individuals having T cells responsive to MBP. Composition. 13. Claims wherein the composition comprises a sufficient percentage of the total T cell reactivity to MBP, such that administering the composition to an individual suffering from MS results in down-regulation of the MS autoimmune response. The composition of range 5. 14． A composition for treating multiple sclerosis in a mammal, comprising a peptide containing at least two T cell epitopes of MBP, wherein said composition comprises: MBP-1, MBP-2, MBP-3, MBP-. MBP-1.1, MBP-2.1, MBP-3, MBP-4, and MBP-5; MBP-1.1, MBP-2, MBP-4, and MBP-5 MBP-1, MBP-2.1, MBP-4, and MBP-5; MBP-1, MBP-2, MBP-4, and MBP-5; MBP-1.1, MBP-2.1, MBP -4, and MBP-5; MBP-1.1, MBP-2.1, and MBP-4; MBP-1, MBP-2.1, and MBP-4; MBP-1.1, MBP-2, And MBP-4; MBP-1.1, BP-2.1, and MBP-5; MBP-1.1, MBP-2.1, and MBP-3; MBP-1, and: MBP-2, MBP-2.1, MBP-2.2, One peptide selected from the group consisting of MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6; MBP-1.1, and: MBP-2, MBP-2 One peptide selected from the group consisting of: MBP-2, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6; MBP-4; : One selected from the group consisting of MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6 Peptides; MBP-4, and: MBP-1 or MBP-1.1 One peptide selected from the group consisting of MBP-1.1, MBP-4, and: 82-100, 82-100 [100 P> Y], and 87-99 [91 K> A] (all figures 14); MBP-1.1 and MBP-4, and: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2. 5, or one peptide selected from the group consisting of MBP-2.6 (all shown in FIG. 2); MBP-1.1, MBP-5, MBP-4, and: 82-100, 82-1 One peptide selected from the group consisting of 00 [100 P> Y], 87-99, and 87-99 [91 K> A] (all shown in FIG. 14); MBP-1.1, MBP-5 , MBP-4, and: MB One peptide selected from the group consisting of -2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6 (all shown in FIG. 2); 1.1, MBP-5, MBP-4, and: 82-100, 82-100 [100 P> Y], 87-99, and 87-99 [91 K> A] (all shown in FIG. 14 One peptide selected from the group consisting of: MBP-1.1, MBP-3, MBP-4, and: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2. 5. or a peptide selected from the group consisting of MBP-2.6 (all shown in FIG. 2), a composition selected from the group consisting of: 15. 6. The composition of claim 5, further comprising at least one peptide having T cell activity derived from human myelin oligodendrocyte protein (MOG) protein. 16. The peptides derived from MOG is: human MOG1-13 GQFRVIGPRHPIR person MOG103-115 HSYQEEAAMELKV human MOG1-121 GQFRVIGPRHPIRALVGDEV ELPCRTSPGKNATGMEVGWY RPPFSRVVHLYRNGKDQDGD QAPEYRGRTELLKDAIGEGK VTLRIRNVRFSDEGGFTCFF RDHSYQEEAAMELKVEDPFYW human MOG1-20 GQFRVIGPRHPIRALVGDEV person MOG11-30 PIRALVGDEVELPCRISPGK person MOG21-40 ELPCRISPGKNATGMEVGWY person MOG31-50 NATGMEVGWYRPPFSRVVHL human MOG141 -160 TVGLVFLCLQYRLRGKLRAE human MOG151-170 YRLRGKLRAEIENLHRTFDP human MOG161-180 IENLHRTFDPHFLRVPCWKI and human MOG199-218 YNWLHRRLAGQFLEELRNPF selected from the group consisting of: 17． 15. The composition of claim 14, further comprising at least one peptide having T cell activity derived from MOG. 18. Said peptides are: MBP-1.1, MBP-1.2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2. 6, MBP-3.1, MBP-4, and MBP-5 (all of which are shown in FIG. 2), or an isolated or derived from the MBP selected from the group consisting of modifications or analogs thereof. peptide. 19. 19. The isolated peptide of claim 18, wherein said peptide is MBP-4, or a variant or analog thereof. 20. 19. The peptide analog of claim 18, wherein at least one amino acid residue in said peptide is substituted with alanine, glutamic acid, or methyl amino acid. 21. MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6 (all of which are shown in FIG. 2) A peptide selected from the group consisting of: wherein lysine (K) is replaced with alanine (A). 22. A peptide analog of MBP-2.1 wherein lysine (K) at position 10 is replaced by alanine (A), wherein said peptide analog has the amino acid sequence D ENPVVHFF A Peptide analogs having NIVTPRTPPPSQGK. 23. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, At least one normal peptide bond of a peptide selected from the group consisting of MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5: a non-peptide bond, a peptide bond A peptidomimetic that is replaced with an analog or reduced binding analog. 24. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, A peptide selected from the group consisting of: MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (this peptide increases the solubility of said peptide in aqueous solution) Modified by the addition of at least one charged amino acid residue to the amino terminus, the carboxy terminus, or both of the peptides). 25. MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, A peptide selected from the group consisting of: MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 (this peptide is used to increase the T cell activity of the peptide. Modified by the addition of at least one charged amino acid residue to the amino terminus, the carboxy terminus, or both, of the peptide, wherein said at least one amino acid residue is derived from the native MBP protein sequence). 26. A method for treating multiple sclerosis in a mammal, comprising administering to the mammal an amount of the composition of claim 1 in an amount sufficient to down regulate the autoimmune response of multiple sclerosis. 27. The administration route is as follows: intravenous injection in non-immunogenic form, subcutaneous injection in non-immunogenic form, oral administration, inhalation administration, sublingual administration, transdermal administration, rectal administration, or any of these 27. The method of claim 26, wherein the combination is selected from the group consisting of: 28. 27. The method of claim 26, wherein said administration is subcutaneous administration in a non-immunogenic form. 29. Administering the composition of claim 1 to a mammal suspected of having multiple sclerosis, in an amount sufficient to prevent the development of the symptoms of multiple sclerosis. A method that includes: 30. A method for treating multiple sclerosis in a mammal, comprising administering to the mammal the composition of claim 5 in an amount sufficient to downregulate the symptoms of multiple sclerosis. 31. A method for treating multiple sclerosis in a mammal, comprising administering to the mammal the composition of claim 10 in an amount sufficient to down regulate the symptoms of multiple sclerosis. 32. 16. A method for treating multiple sclerosis in a mammal, comprising administering to the mammal the composition of claim 14 in an amount sufficient to effect down regulation of symptoms of multiple sclerosis. 33. 21. A method for treating multiple sclerosis in a mammal, comprising administering to the mammal the composition of claim 15 in an amount sufficient to down regulate the symptoms of multiple sclerosis. 34. Administering at least two different compositions of claim 1 for treating multiple sclerosis in a mammal, simultaneously or sequentially in an amount sufficient to down regulate the symptoms of multiple sclerosis. Method. 35. MBP-1, MBP-2, MBP-3, MBP-4, and MBP-5 for treating multiple sclerosis in a mammal; MBP-1.1, MBP-2.1, MBP-3, MBP -4, and MBP-5; MBP-1.1, MBP-2, MBP-4, and MBP-5; MBP-1, MBP-2.1, MBP-4, and MBP-5; MBP-2, MBP-4, and MBP-5; MBP-1.1, MBP-2.1, MBP-4, and MBP-5; MBP-1.1, MBP-2.1, and MBP-4 MBP-1, MBP-2.1, and MBP-4; MBP-1.1, MBP-2, and MBP-4; MBP-1.1, MBP-2.1, and MBP-5; 1.1, MBP-2.1, and MBP-3; MBP -1, and: selected from the group consisting of MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6. One peptide; MBP-1.1, and: MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or One peptide selected from the group consisting of MBP-2.6; MBP-4, and: MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, One peptide selected from the group consisting of MBP-2.5, or MBP-2.6; MBP-4, and one peptide selected from the group consisting of: MBP-1 or MBP-1.1; -1.1, MBP-4, and: 82-100 , 82-100, [100P> Y], 87-99, and 87-99 [91 K> A] (all shown in Figure 14); MBP-1. 1, MBP-4, and the group consisting of: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6 (all shown in FIG. 2). One peptide selected from: MBP-1.1, MBP-5, MBP-4, and: 82-100, 82-100 [100 P> Y], 87-99, and 87-99 [91 K > A] (all shown in FIG. 14); one peptide selected from the group consisting of: MBP-1.1, MBP-5, MBP-4, and: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2 6 (all shown in FIG. 2); one peptide selected from the group consisting of: MBP-1.1, MBP-5, MBP-4, and: 82-100, 82-100 [100 P> Y] , 87-99, and 87-99 [91 K> A] (all shown in FIG. 14); MBP-1.1, MBP-3, MBP-4, and: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, or MBP-2.6 (all shown in FIG. 2): selected from the group of peptide combinations consisting of: , A method of administration comprising simultaneously or sequentially administering a peptide combination derived from MBP as a single therapeutic infusion. 36. Comprising at least two peptides of MBP, each peptide being soluble and stable at a predetermined physiologically acceptable pH, wherein said peptides are: MBP-1, MBP-1.1, MBP-1 .2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3 A multipeptide formulation for pharmaceutical administration to a patient suffering from MS, selected from the group consisting of: 1, MBP-4, and MBP-5. 37. A therapeutic composition comprising at least one peptide having T cell activity derived from a myelin antigen or an analog of said peptide, for treating advanced multiple sclerosis in a mammal, comprising down-regulating the symptoms of multiple sclerosis. Administering to said mammal in an amount effective to perform. 38. 38. The method of claim 37, wherein said myelin antigen is selected from the group consisting of myelin basic protein (MBP), myelin oligodendrocyte protein (MOG), proteolipid protein (PLP), and myelin-associated glycoprotein (MAG). Method. 39. 38. The method of claim 37, wherein said administering occurs during the acute phase of multiple sclerosis. 40. 38. The method of claim 37, wherein said administering is performed during remission of multiple sclerosis disease symptoms. 41. 38. The method of claim 37, wherein the peptide comprises a peptide analog, wherein the peptide analog has a higher MHC binding affinity than the peptide from which the analog was derived. 42. A therapeutic composition for treating advanced multiple sclerosis in a mammal, comprising the mammal comprising at least one MBP peptide or an analog of the peptide in an amount effective to downregulate the symptoms of multiple sclerosis. Wherein the peptide comprises: MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP- 2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, MBP-5, 13-25, 31-50, 61-80, 82- 92, 82 to 96, 82 to 97, 82 to 98, 82 to 100, 82 to 100 [100 P> Y], 83 to 100, 83 to 101, 84 to 97, 84 to 100, 84 to 100, 85 to 85 100, 86-105, 87- 99, 87-99 [91 K> A], 88-100, 88-99, 111-135, 122-140, 139-170, 141-160, 142-166, 142-168, 146-160, and 153-170 (all of which are shown in FIGS. 2 and 14). 43. The at least one peptide comprises: MBP-1, MBP-1.1, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, NBP-2.4, MBP-2. 5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, MBP-5, 13 to 25, 87 to 99, 87 to 99 [91 K> A], 82 to 100, 82 43. The method of claim 42, wherein the method is selected from ~ 100 [100P> Y] or an analog thereof. 44. The derived from at least one peptide is human MOG, and: human MOG1-13 GQFRVIGPRHPIR person MOG103-115 HSYQEEAAMELKV human MOG1-121 GQFRVIGPRHPIRALVGDEV ELPCRTSPGKNATGMEVGWY RPPFSRVVHLYRNGKDQDGD QAPEYRGRTELLKDAIGEGK VTLRIRNVRFSDEGGFTCFF RDHSYQEEAAMELKVEDPFYW human MOG1-20 GQFRVIGPRHPIRALVGDEV person MOG11-30 PIRALVGDEVELPCRISPGK person MOG21-40 ELPCRISPGKNATGMEVGWY person MOG31-50 NATGMEVGWYRPPFSRVVHL Human MOG141-160 TVGLVFLCLQYRLRGKLRAE Human MOG151-170 YRLRGKLRAEIENLHRTFDP Human MOG161-180 IENLHRTFDPHFLRVPCWKI and Human MOG199-218 YNWLHRRLAGQFLEELRNPF 45. Human MOG1-13 GQFRVIGPRHPIR person MOG103-115 HSYQEEAAMELKV person MOG1-121 GQFRVIGPRHPIRALVGDEV ELPCRTSPGKNATGMEVGWY RPPFSRVVHLYRNGKDQDGD QAPEYRGRTELLKDAIGEGK VTLRIRNVRFSDEGGFTCFF RDHSYQEEAAMELKVEDPFYW person MOG1-20 GQFRVIGPRHPIRALVGDEV person MOG11-30 PIRALVGDEVELPCRISPGK person MOG21-40 ELPCRISPGKNATGMEVGWY person MOG31-50 NATGMEVGWYRPPFSRVVHL person MOG141-160 TVGLVFLCLQYRLRGKLRAE person MOG151-170 YRLRGKLRAEIENLHRTFDP 43. The method of claim 42, further comprising at least one peptide from a human MOG selected from the group consisting of human MOG161-180 IENLHRTFDPHFLRVPCWKI and human MOG199-218 YNWLHRRLAGQFLEELRNPF. 46. 38. The method of claim 37, wherein said administering comprises subcutaneous or intravenous injection of said peptide. 47. 38. The method of claim 37, wherein said administering comprises escalating the dose with each subsequent injection. 48. 38. The method of claim 37, wherein said administering comprises reducing the dose with each subsequent injection. 49. Administering at least one therapeutic composition comprising at least one isolated and purified peptide for treating a mammal in the advanced stage of multiple sclerosis, said peptide having a predetermined length; Having a predetermined amino acid residue sequence and comprising T cell activity, wherein the composition, when administered in a non-immunogenic form, manifests the symptoms of multiple sclerosis in a population of mammals suffering from advanced multiple sclerosis Wherein said composition is soluble in aqueous solution and is stable at a physiologically acceptable pH. 50. 50. The method of claim 49, wherein said administering comprises administering at least two of said therapeutic compositions simultaneously or sequentially. 51. A method for treating advanced multiple sclerosis in a mammal, comprising administering the therapeutic composition of claim 5 in an amount effective to down regulate the symptoms of multiple sclerosis. 52. A method for treating advanced multiple sclerosis in a mammal, comprising administering the therapeutic composition of claim 10 in an amount effective to down regulate the symptoms of multiple sclerosis. 53. 15. A method for treating advanced multiple sclerosis in a mammal, comprising administering the therapeutic composition of claim 14 in an amount effective to down regulate the symptoms of multiple sclerosis. 54. 16. A method for treating advanced multiple sclerosis in a mammal, comprising administering the therapeutic composition of claim 15 in an amount effective to down-regulate the symptoms of multiple sclerosis. 55. 38. The method of claim 37, wherein said advanced multiple sclerosis is relapsing-remitting MS, chronic progressive MS, primary progressive MS, or benign MS. 56. 38. The method of claim 37, further comprising administering [beta] -interferon in combination with said therapeutic composition. 57. A method of treating comprising administering a therapeutically effective amount of IFN-β, comprising administering a therapeutically effective amount of at least one peptide of a myelin autoantigen having T cell activity. A method for treating multiple sclerosis. 58. 58. The method of claim 57, wherein said peptide and said IFN-β are administered simultaneously. 59. 58. The method of claim 57, wherein said peptide and said IFN- [beta] are administered at least 24 hours apart. 60. A composition comprising a therapeutically effective amount of at least one peptide having T cell activity of human MBP and IFN-β in a pharmaceutically acceptable carrier or excipient. 61. The at least one peptide is: MBP-1, MBP-1.1, MBP-1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2. 4, MBP-2.5, MBP-2.6, MBP-3, MBP-3. 1, MBP-4, MBP-5, 13 to 25, 31 to 50, 61 to 80, 82 to 92, 82 to 96, 82 to 97, 82 to 98, 82 to 100, 82 to 100 [100 P > Y], 83-100, 83-101, 84-97, 84-100, 84-100, 85-100, 86-105, 87-99, 87-99 [91 K> A], 88-100, 88-99, 111-135, 122-140, 139-170, 141-160, 142-166, 142-168, 146-160, and 153-170 (all of which are shown in FIGS. 2 and 14). 61. The composition of claim 60 selected from the group. 62. A method of preventing the development of multiple sclerosis in an individual suspected of having multiple sclerosis, comprising administering a therapeutically effective amount of IFN-β to at least one peptide having T cell activity of a myelin antigen. A method comprising administering a therapeutically effective amount. 63. Claims: 1. A method of treating at least one composition according to claim 1 in a method of preventing the development of multiple sclerosis in an individual suspected of having multiple sclerosis, comprising administering a therapeutically effective amount of IFN- [beta]. A method comprising administering a therapeutically effective amount. 64. Administering a therapeutically effective amount of at least one composition according to claim 5 in a method of treating multiple sclerosis in a mammal, comprising administering a therapeutically effective amount of IFN-β. A method that includes 65. Administering a therapeutically effective amount of at least one composition within claim 10 in a method of treating multiple sclerosis in a mammal, comprising administering a therapeutically effective amount of IFN-β. A method that includes 66. Administering a therapeutically effective amount of at least one composition within claim 14 in a method of treating multiple sclerosis in a mammal, comprising administering a therapeutically effective amount of IFN-β. A method that includes 67. Administering a therapeutically effective amount of at least one composition within claim 15 in a method of treating multiple sclerosis in a mammal, comprising administering a therapeutically effective amount of IFN-β. A method that includes 68. A pharmaceutically acceptable excipient, and an MHC class II peptide complex capable of binding to a T cell receptor and inducing anergy in T cells displaying the receptor, wherein the complex comprises In essence: an MHC class II component comprising sufficient extracellular domain of an MHC class II molecule to form an antigen-binding pocket, said component being encoded by an allele associated with an autoimmune disease; The components are soluble under physiological conditions in the absence of detergents or lipids); and the autoantigenic peptide of claim 1, wherein the autoantigenic peptide is bound to its antigen binding pocket A pharmaceutical composition comprising: 69. A pharmaceutically acceptable excipient, and an MHC class II peptide complex capable of binding to a T cell receptor and inducing anergy in T cells displaying the receptor, wherein the complex comprises In essence: an MHC class II component comprising sufficient extracellular domain of an MHC class II molecule to form an antigen-binding pocket, said component being encoded by an allele associated with an autoimmune disease; The component is soluble under physiological conditions in the absence of detergents or lipids); and the autoantigenic peptide of claim 8, wherein the autoantigenic peptide is bound to its antigen binding pocket A pharmaceutical composition comprising: 70. A pharmaceutically acceptable excipient, and an MHC class II peptide complex capable of binding to a T cell receptor and inducing anergy in T cells displaying the receptor, wherein the complex comprises In essence: an MHC class II component comprising sufficient extracellular domain of an MHC class II molecule to form an antigen-binding pocket, said component being encoded by an allele associated with an autoimmune disease; The component is soluble under physiological conditions in the absence of detergents or lipids); and the autoantigenic peptide of claim 16 wherein the autoantigenic peptide is bound to its antigen binding pocket A pharmaceutical composition comprising: 71. 70. The composition of claim 68, wherein said autoimmune disease is multiple sclerosis. 72. 2. The composition of claim 1, wherein said composition comprises a tandem copy of said peptide. 73. 9. The composition of claim 8, wherein said composition comprises a tandem copy of said peptide. 74. 17. The composition of claim 16, wherein said composition comprises a tandem copy of said peptide.