GB2216127A

GB2216127A - Endotoxin muteins

Info

Publication number: GB2216127A
Application number: GB8904016A
Authority: GB
Inventors: Cindy Lou Jellis; James R Rusche; Daniel R Witt
Original assignee: Sandoz AG
Current assignee: Sandoz AG
Priority date: 1988-02-25
Filing date: 1989-02-22
Publication date: 1989-10-04
Anticipated expiration: 2009-02-22
Also published as: BR8900881A; ZA891463B; IL89391A0; IE62118B1; IL89391A; DE3905865A1; HU209148B; PT89812A; GB8904016D0; PL161726B1; AU616945B2; NL8900481A; IT1230483B; GR1000457B; AU3029789A; FR2627778B1; IE890589L; CN1037538A; PT89812B; NZ228108A

Description

221 6 1 27 136-7067 NOVEL COMPOUNDS Bacillus thuringiensis (B t) is a

sporulating bacterium which pro- duces a protein crystal delta-endotoxin ( 6-endotoxin) at the end of vegetative stage of growth This endotoxin, upon ingestion by certain insects, produces toxic effects which include the cessation of feeding, gastrointestinal dysfunction, dehydration and ultimately, death The 6-endotoxin is produced, generally from a plasmidal source, as an inac- tive precursor or protoxin form having a molecular weight of 130,000- 140,000 daltons lCalabrese, Canad, J Microbiol 26 ( 1980) 1006 l Pro- teolytic cleavage to remove the C-terminal half, approximately, and possibly several amino acids at the N-terminus, normally occurs in the insect gut as a result of the action of the gut proteases, and is re- quired to produce the active toxin with a molecular weight of 65,000 to 70,000 d lTyrell et al, J Bacteriology 145 ( 1981) 10521.

A large number of subvarieties of B t have been identified Al- though most of these show a more specific or increased toxicity to in- sects of the order Lepidoptera, a limited number have also been demon- strated to be toxic towards insects of other classifications For exam- ple, B t israelensis is toxic towards Dipteran larvae (mosquitos and blackflies) and two other subvarieties have recently been identified which demonstrate toxicity towards Coleopteran larvae lHofte et al, Nuc.

Acid Res 15 ( 17) ( 1987) 7183 l.

Although much work has been performed in the production of shortened toxins and structural genes encoding these, there appears to be less known about the ability of the B t 8-endotoxins to withstand point mutations within the active or toxic portion of the endotoxin sequence and the effect of such mutations on the activity of the toxin molecules.

An object of the present invention is to provide novel mutants of the active portion of B t 8-endotoxins.

136-7067 A further object of the present invention is to produce mutations which are effective to produce B t endotoxin-like activity in both truncated and full length S-endotoxin forms.

Another object of the present invention is to provide mutations which enhance the insecticidal activity of B t 6-endotoxin structures.

-In accordance with the present invention, we have, after randomly creating single and multiple point mutations in many hundreds of DNA strands coding for a large section of the active portion of a representative B t endotoxin insecticidally active against Lepidoptera, isola- ted and produced by recombinant techniques several mutant B t endo- toxins which exhibit the characteristic insecticidal activity against Lepidoptera that is possessed by the wild type B t S-endotoxin Also, at these discovered points of mutation, it is indicated that the codons coding for any other natural amino acid can be substituted to produce active endotoxin protein A number of the random mutations were also found to produce a higher level of insecticidal activity Such activity may be demonstrated in, for example, the Tobacco Budworm (Heliothis virescens) assay or the Trichoplusia ni (cabbage looper) assay as here- inafter described and in many cases this increase was quite remarkable by achieving an activity at least two or more times greater than the parent endotoxin structure Multiple mutations (usually 2 or 3 amino acids per mutated DNA strand) were also evaluated individually and in various combinations to identify certain more effective mutations and combinations thereof The mutations in accordance with the present invention, with one exception, were also found to exist within amino acid sequence sections which are highly conserved among a wide variety of wild type B t S-endotoxins, hence indicating the general applicabil- ity of the mutations provided by the invention to a wide variety of endotoxin structures in which such conserved areas provide insecticidal B.t endotoxins.

136-7067 More particularly, with reference to the amino acid sequence and the numbering thereof in Table A, infra, (beginning with the methionine (MET) which is position number 1 and the normal N-terminus of the representative Lepidopteran active endotoxin shown in Table A), it has been found -that B t endotoxin protein otherwise insecticidally active against Lepidoptera insects in the manner of native B t endotoxins when containing within the active portion an amino acid residue sequence the same as or having substantial homology to that shown in -Table A for the 116 amino acid residue sequence shown at positions from and including position 90 to and including position 205 (also amino acid positions m-i through m-116), may have one or more of the residues of the following amino acids at the indicated or equivalent homologous positions (the m- position numbers in parentheses being with reference to said 116 amino acid residue sequence): a) at position 94 (position m-5 of said 116 amino acid sequence) any natural amino acid coded for by the genetic code except Asn; b) at position 95 (position m-6 of said 116 amino acid sequence) any such natural amino acid except Gln; c) at position 101 (position m-12 of said 116 amino acid sequence) any such natural amino acid except Glu; d) at position 105 (position m-16 of said 116 residue any such natural amino acid except Asn; e) at position 116 (position m-27 of said 116 residue except Glu; f) at position 119 sequence) any such natural amino (position m-33 of said 116 residue except Thr; h) at position 123 sequence) any such natural amino (position m-36 of said 116 residue except Ala; j) at position 130 sequence) any such natural amino (position m-95 of said 116 residue except Phe; 1) at position 187 sequence) any such natural amino (position m-99 of said 116 residue sequence) any such natural amino acid (position m-30 of acid except Ala; g sequence) any such (position m-34 of acid except Asn; sequence) any such (position m-41 of acid except Met; k sequence) any such (position m-98 of E said 116 residue :) at position 122 i natural amino acid E said 116 residue i) at position 125 X natural amino acid I said 116 residue ) at position 184 X natural amino acid said 116 residue acid except Ala; m) at position 188 sequence) any such natural amino acid sequence) 136-7067 except Thr; n) at position 194 (position m-105 of said 116 residue sequence) any such natural amino acid except Asn; and o) at position 201 (position m-112 of said 116 residue sequence) any such natural amino acid except Gly.

In addition, and again with reference to the numbered amino acid residue sequence shown in Table A, the invention includes the change in the amino acid Asn at amino acid position 4 to any other natural amino acid coded for by the genetic code.

With regard to the amino acid residues provided by the invention within said 116 residue sequence, it is preferred in accordance with the invention that such sequence be characterised, again with reference to the total mature sequence shown in Table A (and also to such 116 residue sequence), by one or more of the following amino acids at the indicated positions:

sequence); sequence); sequence); sequence); (position (position (position (position (position (position (position (position (position (position:

(position:

a) Lys at position SC SC LC U- 94 (positior b) Lys at position 95 (position c) Lys at position 101 (position d) Tyr at position 105 (position e) Lys or Arg, more preferably 27 of said 116 residue sequence); of said 116 residue-sequence); f 13 of said 116 residue sequence); i 34 of said 116 residue sequence); 36 of said 116 residue sequence); i 4 of said 116 residue sequence); I of said 116 residue sequence); ' 98 of said 116 residue sequence); i 99 of said 116 residue sequence); i )5 of 2 of said 116 residue sequence); and said 116 residue sequence).

of the 116 residue 6 of said 116 residue 12 of said 116 residue 16 of said 116 residue Arg, at position 116 f) Thr at position 119 K) Ile at position 122 i) Tyr at position 123 i) Val at position 125 j) Ile at position 130 k) Ile at position 184 L) Thr at position 187 n) Ser at position 188 i) Lys at position 194 o) Asp at position 201 When the Asn at amino acid position 4 is changed, it is preferably 136-7067 changed to Tyr.

Table A near the end of this specification sets forth a nucleotide sequence and resulting deduced amino acid sequence relevant to B t.

8-endotoxin production in nature With one exception, the nucleotide sequence was obtained from a 6-endotoxin-producing plasmid found in B t.

wuhanensis In particular, the entire structural gene (actually coding for the endotoxin itself) is from B t wuhanensis and the one exception is that the sequence prior to methionine (Met) at the beginning of the structural gene is from an endotoxin-producing gene found in B t kur- staki HD-1 (the so-called 5 3 Kb Hind III class plasmid of HD-1), such upstream sequence containing the native Ribosomal Binding Site (RBS) from such B t kurstaki HD-1 endotoxin-producing plasmid The upstream sequence containing the Ribosomal Binding Site, as found in B t wuhan- ensis differs little from that shown in Table A for Kurstaki and the differences are indicated later herein However, it should be kept in mind that both the nucleotide and amino acid sequences in the subject B.t wuhanensis and B t Kurstaki HD-1 structural genes are identical from the beginning of the endotoxin sequence through the entire active portion thereof and up to at least the Kpn I site indicated in Table A, said Kpn I site being in the protoxin portion Hence, the active toxin portion resulting from cleavage after ingestion by the insect will be the same for both the subject B t wuhanensis and B t kurstaki HD-1 endotoxins In Table A, amino acids for the endotoxin protein produced as a result of expression of the structural gene are positively numbered in parentheses 1 through 1181 below the amino acid Those in the un- translated area upstream of the 1-Met are negatively numbered in a back or upstream direction (with stop signals counted as an amino acid posi- tion) Nucleotides in the structural gene are numbered (not in paren- theses) above the line in which they appear and the last digit in the number stands above the nucleotide to which the number applies Nucleo- tides in the untranslated region which includes the ribosomal binding site are negatively numbered backward from the initiating ATG codon (for 136-7067 the 1-Met) Within the numbered sequences indicated above a portion thereof is separately or sub-numbered m-i through m-116 for amino acids and n-1 through n-348 for the nucleotides for such amino acids, to indi- cate more particularly a highly conserved region in which most of the mutations provided by the invention were found to be located Certain restriction sites relevant to the nucleotide sequence in Table A are shown by a line above the nucleotides involved in the restriction sites with a footnote designation of the particular site The toxic portion of the endotoxin shown in Table A as recognised in the art involves the amino acid sequence beginning at amino acid position 1 (Met) and exten- ding through amino acid position 610 (Thr) In view of the nature of the total DNA sequence shown in Table A, and in order to understand the following description more easily, it will be noted that the DNA and amino acid sequences beginning with the untranslated portion in line 1 of Table A and extending up to the Kpn I site at about amino acid posi- tions 724-725, and portions thereof, can be and are also referred to herein as derived from B t kurstaki HD-1 (the 5 3 Kb Hind III class plasmid).

Figure 1 shows a map of the general working plasmids pr AK and pr AK-3 used at various stages in connection with the invention and comprising DNA coding for a truncated B t endotoxin derived from B t Kurstaki HD-1 and having insecticidal activity against Lepidoptera.

Figure 2 shows a map of the plasmid p B 8 r II which comprises DNA coding for a truncated B t endotoxin protein of somewhat greater length than that coded for by pr AK and also derived from B t kurstaki HD-1 and also having insecticidal activity against Lepidoptera.

Figures 3 a and 3 b show two representative double stranded DNA strands which may be synthesised for conducting so-called codon spin experiments and also useful for conveniently introducing desired muta- tions into a B t endotoxin DNA coding sequence.

136-7067 Figure 4 shows a map of the plasmid p BT 210 which comprises DNA co- ding for a full length native endotoxin from B t wuhanensis, which endotoxin has the identical amino acid sequence in its active portion as the endotoxin from B t kurstaki HD-1 as coded for in pr AK and p B 8 r II.

Figure 5 shows an abbreviated map of the plasmid pr AK-9 along with a blow-up of take-out section thereof, said pr AK-9 being otherwise similar in detail to plasmid pr AK-3 and said section and subsections thereof in parent plasmids being conveniently useful for conducting codon spin experiments and otherwise introducing mutations as provided by the invention.

The plasmid pr AK was deposited in E coli JM 103 with the Agricul- tural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No NRRL B-18329.

The plasmid p B 8 r II was deposited in E coli JM 103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No NRRL B-18331.

The plasmid p BT 210 was deposited in E coli JM 103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No NRRL B-18330.

As essentially indicated, the point mutations of the invention may be applied to endotoxin protein sequences produced by Bacillus thuringiensis varieties and subtypes, which sequences are insecticidally active against Lepidopteran larvae when containing the 116 amino acid conserved sequence indicated above or a sequence which is highly homologous therewith or essentially an equivalent thereof, including protein endotoxin sequences which are of the natural full length type or substantially full length and those which are truncated by removal of all or a part of downstream protoxin or inactive portion thereof and even those which may 136-7067 be truncated from the normal C-terminus upstream and back into the ac- tive portion of the endotoxin As evident already, endotoxins from B t.

kurstaki and B t wuhanensis both have the identical 116 amino acid conserved region and others have or can be expected to have the same 116 amino acid sequence or a largely homologous equivalent thereof For example, endotoxins from B t sotto, B t kurstaki HD-73 (strain), and B.t Galleriae are already known to produce endotoxins with the identi- cal 116 amino acid sequence even though some of these differ to at least some extent, and in cases significantly, in both the balance of the toxic portion of the endotoxin and in the protoxin section Others, such as B t kurstaki HD-1 Dipel (a commercial substrain), have one amino acid change in the indicated 116 amino acid sequence (m-59 is Leu coded for by TTG) and other changes/deletions/additions in other sequen- ce portions This and others found to have a single or multiple changes but amino acid homology of at least about 70 % to said 116 amino acid sequence may have one or more mutant changes of the invention made to the amino acids therein which correspond identically to the amino acid in said 116 amino acid non-mutated sequence, particularly when the amino acid to be changed has on each of its sides 2 and preferably 4 other amino acids which also correspond identically to those in the 116 amino acid sequence It is also contemplated that the mutations of the inven- tion may be made to corresponding amino acids in homologous series which essentially contain deletions or additions such that the sequence itself is shorter or longer than the indicated 116 amino acid sequence In such cases, the numbering as employed in the reference 116 amino acid sequence will be retained such that deletions existing in the sequence to be changed will be counted as actually present and additions in the sequence to be changed will simply not be counted Hence, amino acid positioning assignment can be said to be made independent of deletions or additions in such a homologous sequence.

Preferably, the homologous amino acid sequences into which the mu- tant changes of the invention may be substituted are those which are 136-7067 coded for by DNA to which DNA from either the sense or antisense strand (or double strand) of the DNA beginning with position n-i and extending through position n-348 in Table A will hybridise under stringent hybridising conditions when the homologous sequence to be mutated has its amino acids, which correspond to those in the referenced 116 amino acid sequence, coded for by the same codon as the corresponding amino acid in the reference sequence Procedures for preparing such a tagged hybridisation probe are well known in the art Stringent hybridising condit- ions are those in which hybridisation is effected at 601 C in 2 5 X saline citrate (SSC) buffer followed merely by rinsing at 371 C at reduced buffer concentration which will not affect the hybridisations which take place.

Preferably, the mutations are made in amino acid sequences which have no more than 1, 2 or 3 amino acid differences from those in the 116 amino acid reference sequence, most preferably a sequence which is iden- tical to the reference sequence.

It is already clearly indicated in the art that the 116 amino acid reference sequence may form a portion of otherwise substantially modified or different endotoxin protein sequences which have insecticidal activity against Lepidopteran larvae, and other modifications outside of the reference sequence will most certainly be uncovered as knowledge of the art unfolds Hence, the sequences bordering the required mutated sequence portion which is analogous to the 116 amino acid reference portion may vary to a considerable extent and need only be sufficient to provide insecticidally active endotoxin protein, for example as demonstrated by insecticidal activity against the tobacco budworm Thus the amino acid sequence upstream from the mutated portion may be shortened or lengthened or itself mutated relative to the sequence shown in Table A, but will generally begin with methionine and is most preferably high- ly homologous ( 70 X) or identical to that shown in Table A, although it is evident that such sequence may also optionally contain the preferred j i 136-7067 mutant at the 4-position as also provided by the invention Similarly, the portion downstream from the required mutated sequence portion may vary widely and be shortened or lengthened relative to the balance thereof shown in Table A up to its point of cleavage in the insect gut, and of course may or may not be further extended to form a protoxin or inactive portion subject to cleavage in the insect gut to provide an insecticidally active protein toxin.

DNA comprising sequences coding for mutant endotoxins as provided by the invention will be incorporated under the control of appropriate regulatory sequences into plasmids to form expression vectors which will be transformed or transfected into cells to produce the endotoxin The production of endotoxins by such recombinant biotechnological techniques, in contrast, for example, to the production of drugs by such techniques, involves little or no work-up designed to purify the endotoxin.

The cells in which it is produced may be lysed, but it has been characteristic in the commercial production of B t endotoxins in the past, simply to employ the entire contents of the culture or fermentation system used in production of the final product, usually after drying by conventional means such as low temperature spray drying as is known in the art Depending upon the product, various materials may be added to improve product stability as is also known, and proteinaceous materials if not present in adequate amounts in the fermentation system may be independently mixed with the product to enhance stability, again as is known, eg soybean powder or defatted soybean powder.

While the endotoxins may be produced biotechnically in a variety of transformed or transfected cell systems, it is generally preferred to transform or transfect bacterial cells of either the gram-negative or gram-positive type One preferred type of gram-negative bacteria is E.

coli with which considerable experience in biotechnology has already been achieved and for which a wide variety of suitable and operatively functional plasmid and transfer expression vector systems are known and 136-7067 available Pseudomonas fluorescens represents another type of gram- negative bacteria into which plasmids carrying endotoxin sequences have been incorporated As demonstrated herein, endotoxin-producing genes may include regulatory sequences such as particularly ribosomal binding site sequences which have their origin in B t when incorporated for expression into essentially heterologous bacterial cells, such as E.

coli Since Bacillus type bacteria provide an environment more closely native to the mutant endotoxins of the invention, it is particularly within the scope of this invention and contemplated thereby to transform or transfect Bacillus type bacteria with expression vectors comprising the DNA coding for the mutant endotoxins of this invention Illustra- tive of such Bacillus cells of particular interest are B t cells, B - cereus cells and B subtilis cells A greatly improved procedure for transforming Bacillus cells, particularly B t cells, has recently been found and is described in pending British patent application 8729726.

Cell types suitable for transformation by the process include cry minus types such as the known B t kurstaki cry B cells which have no plasmids and wild type Bacillus cells such as the native B t cells which carry endotoxin-producing plasmids Plasmids suitable for incorporation into Bacillus cells such as B t cells are known, for example, the plasmid p BC 16 1 (Kreft et al, Molec Gen Genet l 1978 l 162 59) and its parent plasmids which may be used or modified by employing conventional recombinant techniques to carry the mutant endotoxin coding sequences of the invention As is well known in the art, Bacillus cells characteristica- lly produce endotoxin in desired amounts only at their sporulation stage and hence are grown to such stage in order to best obtain the products useful as insecticides Hence, plasmids or expression vectors provided by the invention and carrying DNA for the mutant endotoxins may be in- corporated into Bacillus cells which either are devoid of endotoxin- producing plasmids or already contain one or more such plasmids While the mutant endotoxins of the invention will characteristically have activity against Lepidoptera, endotoxin activity against other insect classes may also be possessed by reason of existing in the parent endo- 136-7067 toxin prior to mutation or as the result of other permitted sequence changes, and in any case it is within the scope of the invention to transform Bacillus cells with the Lepidopteran-toxic endotoxin producing plasmids of the invention when such cells carry plasmids for endotoxins not substantially effective against Lepidoptera, in order to produce at sporulation, endotoxins combining to provide broader ranges of insecti- cidal activity For example, plasmids carrying the mutated endotoxin DNA coding sequences may be used to transform B t israeliensis or B t.

tenebrionis which individually are not substantially effective against Lepidoptera.

While the present invention has been demonstrated both with refer- ence to truncated and full length native type endotoxin proteins, it is generally preferred, when using the mutant endotoxins directly as insec- ticides, as described above, to employ or produce fuller length sequen- ces, which are the same as or mimic the native type at least in terms of the opportunity to achieve an endotoxin protein folding capability simi- lar to that of its native capability, or an improved full length folding effect.

Mutant DNA sequences according to the present invention can also be inserted into the genome of a plant In such cases it is preferred that the mutated sequences of the truncated type are employed, although the fuller length sequences are also suitable Any suitable method may be advantageously employed for such incorporation of the endotoxin sequences into a host plant genome, such as for example, via the Ti plasmid of Agrobacterium tumefaciens, electroporation, electrotransformation, micro-injection, viral transfection or the use of chemicals that induce or increase free DNA uptake, and the like Such procedures and the use of such in the transformation of plants are well known to the man skilled in the art Preferably the DNA sequence encoding the mutant endotoxin will be associated with appropriate regulatory sequences, such as for example, operator and 3 ' regulatory sequences which are functio- II 136-7067 nal in plants, and the whole will be incorporated into an expression- type vector Such transformation of plant cells, followed by regenera- tion of development of cells into whole plants, enables the mutant endo- toxin DNA sequence to become a stable and permanent part of the plant genome, such that it is passed on from one generation to the next via mitosis and meiosis and upon expression results in an insect toxic pro- tein, endowing the plant with inheritable insect resistance.

Two very similar vectors (pr AK and pr AK-3) were used in our work as a source of B t S-endotoxin sequence for mutation and also to provide vehicles for production and evaluation of the B t endotoxin mutants.

The plasmids pr AK and pr AK-3 are represented in Fig 1 by illustrating the relevant details of pr AK and indicating the minor variation therefrom which exists in pr AK-3 Basically, the plasmids pr AK and pr AK-3 are fully competent expression vectors for E coli and each includes an ampicillin resistance gene, an origin of replication and operator sequences, including an E coli promoter As indicated in Fig 1 by the thick dark lines and boxes, the vector pr AK includes in proper reading frame coordination with the promoter a DNA sequence which is found in the wild type B t kurstaki strain HD-1 The thick dark line represents the mature sequence which has been shortened to code for a truncated native B t 6-endotoxin extending from amino acid position 1 (Met) to position 610 (Thr) in Table A and further extending into the protoxin portion to end with amino acid 723 (Leu) At the downstream end of said thick dark line, a small section shown as an open thick box in Fig 1, represents a short DNA sequence of 54 base pairs which follows the base pair triplet coding for 723-Leu and which is itself immediately followed by a stop signal This total extended sequence of 57 base pairs (inclu- ding the stop signal) has its origin in the well known plasmid p BR 322 which was used in the construction of pr AK Hence the expression vector pr AK codes for and produces in E coli essentially a truncated B t.

S-endotoxin fusion protein having a total of 741 amino acids and composed of the 610 amino acids of the native protoxin section and 18 amino 136-7067 acids having origin in p BR 322 This truncated B t endotoxin fusion protein has a high level of insecticidal activity and was used for the purpose of evaluating the mutants thereof produced in our work This activity is essentially indistinguishable from a fully truncated B t.

6-endotoxin protein having only the 610 amino acids of the activated toxin (amino acids 1 to 610 in Table A).

The thick dark line representing most of the sequence coding for the truncated B t endotoxin fusion protein is connected at its upstream end in Fig 1 to a thick dark box representing a sequence which includes a B.t ribosomal binding site (RBS) This section (also shown in Table A, lines 1 and 2) which contains the RBS has about 47 nucleotides before beginning at its upstream end with a Bam HI site (inserted in prior plasmids to link the section with the E coli promoter section (indi- cated by an arrow inFig 1) The promoter and RBS sections are arranged and joined to be in proper reading frame coordination with the coding sequence for the endotoxin Hence, the thick dark lines and boxes to- gether represent DNA having origin in B t kurstaki HD-1.

Various other restriction sites indicated in Fig 1 were relevant to the strategy for the conventional removal and reinsertion of sections of DNA for mutation experiments These other restriction sites are the Nsi I site (beginning after about only 26 nucleotides from the start of the endotoxin coding sequence), the two Xba I sites (see below, however, concerning pr AK-3), the Sst I site and the Hind III site.

As indicated above, pr AK-3 differs from pr AK only in a single minor respect This difference is that the Xba I site (TCT AGA) at nucleotide positions 292 to 297 of Table A were changed using standard techniques to TCG CGA, thereby defining an Nru I site No change in the coded amino acid sequence resulted from this change The preparation of pr AK- 3 is described in Step a) of Example 1 hereinafter pr AK-3 is also the first intermediate in preparing other plasmids pr AK-7 and pr AK-9.

136-7067 DNA sections, derived from different lengths of single stranded DNA sections from pr AK and pr AK-3 (both sense and anti-sense strands) muta- ted in a conventional manner, such as described by for example, Craick in Biotechniques Jan/Feb 1985, pages 12-19; "Use of Oligonucleotides for Site-Specific Mutagenesis", are indicated for convenience herein as M-1 and M-2, M-1 defining the 375 base pair section between the two Xba I sites in pr AK and M-2 being the section between the Bam HI and Xba I sites in pr AK-3 (as shown in Fig 1).

The mutation found between the two Xba I sites in accordance with the invention may be readily obtained using the plasmids pr AK-7, pr AK-8 or pr AK-9 disclosed herein and synthetic double stranded oligonucleoti- des constructed and used analogously to the procedures described in Example 2 hereof.

Following mutation, the mutated single strand portions were rendered double stranded by conventional means In the case of the M-1 mutants, using pr AK as a mutation vehicle, the resulting double stranded, mutate plasmids were transformed into E coli JM 103, plated on YT agar containing 50 pg/ml ampicillin and incubated overnight to obtain a plurality of colonies with a variety of different mutations in plasmids the same as pr AK except for the mutations.

In the case of the M-2 mutants, the mutated double stranded region between the Bam HI and Xba I sites in the mutation vehicles were excised using Bam HI and Xba I restriction endonucleases, respectively, and ligated into pr AK-3 vectors digested with the same two enzymes The resulting M-2 region mutant-containing pr AK-3 plasmids were transformed into E coli JM 103, plated on YT agar with 50 pg/ml ampicillin and incu- bated overnight to obtain another plurality of colonies involving a variety of different mutations.

Testing to demonstrate activity of mutagenised endotoxin sequences, I 136-7067 expressed from DNA contained in, for example E coli JM 103 or E coli SG 4044 (publicly available from the Agricultural Research Culture Coll- ection (NRRL), Peoria, Illinois under Repository No B-15969) was per- formed in one or both of the Tobacco Budworm assay (TBW) or T ni assay as described in Example A hereinafter DNA of mutants showing increased activity over standard non-mutant endotoxin was sequenced in the rele- vant areas of mutation to determine the mutation in the DNA and hence in the protein sequence More than 6,000 different colonies with plasmids containing either M-1 or M-2 mutagenised sections were thus evaluated and generally, from 1 to 3 amino acid changes were found to have taken place in each mutation experiment.

Table B below, identifies the up-mutants recovered directly as a result of the mutation experiments, the amino acid position with refer- ence to the position numbers assigned in Table A at which each mutation occurred, each codon mutated in each mutant and the amino acid change resulting at the indicated position as a result of the codon change.

In Table B the minus or negative amino acid position numbers indi- cate changes between the Bam HI site and the one position Met at the beginning of the endotoxin sequence, such changes therefore not affec- ting the sequence of the endotoxin coded for by the mutant sequence.

The mutants identified in Table B, below, were evaluated in all three phases of the TBW Assay producing results as reported below in Table B-1 Various of these mutants were also evaluated in the T ni assay, the results of which are illustrated below in Table B-2.

136-7067 TABLE B

MUTATION POSITION CHANGE IN ENDOTOXIN AREA SECTION MUTANT AMINO ACID NUCLEIC ACID AMINO ACID M-1 p 26-3 119 GCA to ACA Ala to Thr ATG to ATA Met to Ile 201 GGC to GAC Gly to Asp M-1 p 48 a 14 101 GAA to AAA Glu to Lys 116 GAG to AAG Glu to Lys 217 CGT to CAT Arg to His M-1 p 48 c 5 116 GAG to AAG Glu to Lys 187 GCG to ACG Ala to Thr M-1 p 36 a 65 122 ACT to ATT Thr to Ile GCA to GTA Ala to Val M-2 p 95 a 76 123 AAT to TAT Asn to Tyr M-2 p 95 a 86 188 ACT to TCT Thr to Ser M-2 p 98 cl 188 ACT to TCT Thr to Ser M-2 p 99 c 62 204 ACA to ACT Thr to Thr AAT to TAT Asn to Tyr 4 MAAT to TAT Asn to Tyr M-2 p 107 c 22 194 AAT to AAA Asn to Lys 94 AAC to AAA Asn to Lys M-2 p 107 c 25 184 TTT to ATT Phe to Ile -11 TTG to TAG M-2 p 114 a 30 95 CAA to AAA Gln to Lys -15 TAT to TAA In Table B-1, below, the lower score in the toxicity column indi- cates the greater level of activity (see Example A for an explanation of toxicity scores) and the controls involved an equivalent amount of E.

coli JM 103 cells and E coli SG 4044 cells which had not been transformed with any plasmid It is noted that all mutants were indicated to be substantially more active than the truncated native endotoxin produced 136-7067 by an equivalent amount of such cells containing the plasmid pr AK.

TABLE B-1

MUTANT WITH REFERENCE TO TABLE B p 26-3 p 48 a 14 p 48 c 5 p 36 a 65 p 95 a 76 p 95 a 86 p 98 cl p 99 c 62 p 107 c 22 p 114 a 30 control (JM 103 cells) pr AK control (SG 4044 cells) TOXICITY SCORE MEAN TOXICITY 2.75 2.25 2.63 1.50 2.50 1.30 1.33 1.83 1.42 2.00 4.68 3.35 4.12 TABLE B-2

MUTANT WITH REFERENCE TO TABLE B p 26-3 p 36 A 65 p 95 a 76 pl O 7 c 22 p 114 a 30 control (SAN 415) p BT 301 RELATIVE POTENCY 217 887 291 357 239 59 In Table B-2 above, the standard, p BT 301 is assigned a relative potency of 100, according to LD 50 (for a fuller description see Example

136-7067 A), and thus any relative potency value higher than this indicates an increased level of toxicity caused by the mutation.

In additional work in furtherance of the invention, certain of the mutant DNA shown by Table B above to involve multiple mutations were analysed to determine the effect of individual and pairs of mutations in such multiple mutated sections Such sub-cloning of individual muta- tions or pairs thereof was carried out using a strategy involving the isolation of a targeted multiple mutated fragment and then cutting it at a restriction site internal to the fragment and located between two of the mutated codons The two halves or fragment segments were then gel isolated and each mixed with non-mutant complementary halves or fragment segments obtained by similarly cutting the same fragments from pr AK.

The pr AK vector which had been cut to isolate the larger complementary fragment was then mixed with the two mixed complementary halves and all three DNA segments ligated together to form a modified pr AK plasmid containing the poi-nt mutation or mutations existing in the fragment half originating from the multiple mutant clone More particularly, a site for the restriction endonuclease Xho II was strategically located within certain multiple mutant segments so as to enable the isolation of fragments having less than the total number of mutations in the total mutant segment As will be evident, the use of the endonuclease Xho II was applicable to a number of the multiple mutant segments in Table B for purposes of obtaining fragments with a single point mutation and others with two mutations Hence, multiple mutant plasmids were first treated with the restriction endonucleases Nsi I and Sst I and the resulting 1430 base pair fragments separated by gel isolation Each such 1430 bp fragment was then treated with the restriction endonuclease Xho II and the resulting 330 bp (Nsi I/Xho II) and 1100 bp (Xho II/Sst I) fragments gel isolated for each multiple mutant Counterpart, non-mutant frag- ments of 330 and 1100 bp and the larger, approximately 4 Kb Nsi I/Sst I fragment of pr AK were then similarly obtained More particularly, small quantities of the larger segment were mixed with the mutated 330 bp i 136-7067 fragment and the non-mutated pr AK 1100 bp fragment and the resulting mixture ligated to form a series of hybrid mutant plasmids of pr AK In a like manner, quantities of such larger pr AK segments were mixed with the non-mutated 300 bp pr AK fragments and the mutant 1100 bp fragments and these DNA ligated to form another series of hybrid mutant plasmids.

The hybrid mutant plasmids or clones resulting from the above indicated strategy are summarised below in Table C which shows the three segments combined and the mutations in the resulting plasmid compared to the plasmid pr AK.

TABLE C

SOURCE SOURCE NEWLY OF OF FORMED Nsi I/ Xho II/ pr AK Xho II Sst I DESIG VECTOR SEGMENT SEGMENT SEGMENT MUTATION AMINO NATION AND SOURCE 330 bp 1100 bp ACID POSITION A pr AK Nsi I/Sst I p 48 a 14 pr AK Glu to Lys @ 101 4 Kb Glu to Lys @ 116 B " p 26-3 pr AK Ala to Thr @ 119 C " p 48 c 5 pr AK Glu to Lys @ 116 D " pr AK p 48 a 14 Arg to His @ 217 E " pr AK p 26-3 Met to Ile @ 130 Gly to Asp @ 201 F " pr AK p 48 c 5 Ala to Thr @ 187 In a second round of hybrid mutant clone preparation using the same analogous procedure applied in preparing the clones of Table C, a series of mixed combination mutant plasmids were prepared by the three segment combination of the large segment (roughly 4 kb) from the digestion of pr AK with Nsi I and Sst I, a 330 bp Nsi I/Xho II fragment from one of the clones of Table B and a 1100 bp Xho II/Sst I fragment from a differ- i 136-7067 ent clone of Table B The hybrid mutant clones resulting from this second round are shown below in Table D, it being noted that two plas- mids arising from this second round protocol contained four amino acid changes compared to the parent pr AK plasmid.

136-7067 TABLE D

SOURCE SOURCE NEWLY OF OF FORMED Nsi I/ Xho II/ pr AK Xho II Sst I DESIG VECTOR SEGMENT SEGMENT SEGMENT MUTATION AMINO NATION AND SOURCE 330 bp 1100 bp ACID POSITION pr AK-J pr AK Nsi/Sst p 48 a 14 p 26-3 Glu to Lys @ 101 4 Kb Glu to Lys @ 116 Met to Ile @ 130 Gly to Asp @ 201 pr AK-K p 48 a 14 p 48 c 5 Glu to Lys @ 101 Glu to Lys @ 116 Ala to Thr @ 187 pr AK-L p 48 c 5 p 26-3 Glu to Lys @ 116 Met to Ile @ 130 Gly to Asp @ 201 pr AK-M p 26-3 p 48 a 14 Ala to Thr @ 119 Arg to His @ 217 pr AK-N p 26-3 p 48 c 5 Ala to Thr @ 119 Ala to Thr @ 187 pr AK-O p 48 c 5 p 48 a 14 Glu to Lys @ 116 Arg to His @ 217 pr AK-P p 26-3 p 36 a 65 Ala to Thr @ 119 Thr to Ile @ 122 Ala to Val @ 125 pr AK-Q p 48 c 5 p 36 a 65 Glu to Lys @ 116 Thr to Ile @ 122 Ala to Val @ 125 pr AK-R p 48 a 14 p 36 a 65 Glu to Lys @ 101 Glu to Lys @ 116 Thr to Ile @ 122 Ala to Val @ 125 pr AK-S p 26-3 p 95 a 86 Ala to Thr @ 119 Thr to Ser @ 188 pr AK-T p 48 c 5 p 95 a 86 Glu to Lys @ 116 Thr to Ser @ 188 136-7067 TABLE D (CONT) VECTOR SEGMENT AND SOURCE if i.

I i.

. SOURCE OF Nsi I/ Xho II SEGMENT 330 bp p 48 a 14 p 99 c 62 p 99 c 62 p 26-3 p 99 c 62 SOURCE OF Xho II/ Sst I SEGMENT 1100 bp p 95 a 86 p 107 c 25 p 26-3 p 107 c 25 p 98 cl MUTATION AMINO ACID POSITION Glu to Lys @ 101 Glu to Lys @ 116 Thr to Ser @ 188 Asn to Tyr @ 105 Phe to Ile @ 184 Asn to Tyr @ 105 Met to Ile @ 130 Gly to Asp @ 201 Ala to Thr @ 119 Phe to Ile @ 184 Asn to Tyr @ 105 Thr to Ser @ 188 The various hybrid mutants shown according included effect of in Tables C an( to the Tobacco Budworm Assay of Example A the mutant clones of Table B for comparison, essentially deleting or removing one or two d D were evaluated and the evaluation inter alia, of the mutations from the original mutants of Table B The results of these toxicity or insecti- cidal activity evaluations are reported below in Table E wherein it is noted: 1) the lower score in the toxicity column indicates the greater level of activity (see Example A for an explanation of scores); and 2) the controls involve an equivalent amount of JM 103 cells and SG 4044 cells which had not been transformed with any plasmid, it being noted that most if not all mutants evaluated in both such types of E coli cells and the mutant results in the tables herein which refer to both controls are to be taken as an average of the results for the mutants expressed from both type cells.

NEWLY FORMED pr AK- DESIG- NATION pr AK-U pr AK-53 pr AK-68 pr AK-70 pr AK-39 I 136-7067 L I TABLE E

Mutant with reference Toxicity Score to Tables B, C or D Average Toxicity Control 4 68 pr AK 3 35 A 2 05 B 2 90 C 2 68 D 3 40 E 2 50 F 3 00 E coli SG 4044 (Control) 4 12 J 2 25 K 2 06 L 2 08 M 3 10 N 2 73 0 2 70 p 1 00 Q 1 87 R 2 85 S 2 16 T 1 20 U 2 07 53 3 08 68 2 00 1 50 39 2 50 24 136-7067 The invention further includes a demonstration of the ability for general amino acid substitution at the amino acid positions at which the initial random DNA mutations produced amino acid changes, whereby a wide variety of novel insecticidally active B t endotoxin proteins are provided This ability was demonstrated with relative ease by so-called "codon-spin" experiments in which selected codons involved in the initial mutation changes were changed to the codons for the other natural amino acids These new mutants expressed an endotoxin protein having insecticidal activity against the Tobacco Budworm In order to conduct such an investigation more efficiently, a series of unique plasmids of the pr AK type were prepared starting essentially with pr AK and culmina- ting in the plasmid pr AK-7, and other intermediate plasmids being sequentially in order of preparation pr AK-3, pr AK-4, pr AK-5 and pr AK- 6, as described in Example 1 The plasmid p B 8 r II as shown in Fig 2 is in all respects identical to the plasmid pr AK except that it contains DNA coding for a truncated endotoxin somewhat longer than that coded for by pr AK and except for inconsequential modifications in the parent plasmid made in the area of its ligation to the downstream end of DNA truncated endotoxin structural gene, said structural gene as shown in Fig 2 showing the Kpn I site in the native gene whereas in pr AK the site is deleted and the pr AK structural gene ends at about the former position of said site The plasmid pr AK-7 is designed to express the same endo- toxin amino acid sequence as plasmid pr AK but has had its DNA sequence modified to include not only the Nru I site of pr AK-3, but also a Hind III, Mst II and Bss H II site and in addition the Hind III site origina- lly found in pr AK is preferably removed As more particularly indicated in Example 1, the sequential order of preparation of pr AK-7 from pr AK and the addition or deletion of a site in each step may be summarised as follows:- pr AK > pr AK-3 (add Nru I) pr AK-3 > pr AK-4 (add Hind III) pr AK-4 > pr AK-5 (add Mst II) - 136-7067 pr AK-5 > pr AK-6 (add Bss H II) pr AK-6 > pr AK-7 (delete original Hind III) The above indicated sites were introduced about 40 base pairs apart such that an automated DNA synthesiser could be used effectively to make small double stranded DNA fragments which terminate at their two ends with nucleotides representing the complementary residue of the restric- tion site residues to be created in pr AK-7 when it is cut with the two relevant restriction endonucleases Such fragments therefore could be readily substituted into pr AK-7 by standard cutting and ligation proce- dures (see Example P, infra) to provide a plasmid capable of expressing an endotoxin protein identical to that of pr AK except for the amino acid changes coded for by the synthesised fragment substituted into pr AK-7 for the corresponding fragment in pr AK-7, as exemplified in Example 2 hereof.

Figs 3 A and 3 B represent two small double stranded DNA fragments prepared in accord with the above codon spin strategy to be substituted into the Hind III/Mst II section in pr AK-7 The double stranded frag- ment shown in Fig 3 A was designed to produce any amino acid at amino acid position 116 in the truncated B t endotoxins expressed by the pr AK plasmids by appropriate selection of the XXX codon in accord with the genetic code Similarly, the double stranded fragment shown in Fig 3 B was designed to produce an amino acid at amino acid position 119 in the truncated B t endotoxins produced by the pr AK plasmids by appropriate selection of the XXX codon in this fragment As will be apparent, the other double stranded fragments required for substitution into the Spe I/Nru I location (a fragment span of about 115 base pairs which is also preparable by automated DNA synthesisers), the Nru I/Hind III location and the Mst II/Bss H II location in pr AK-7 and designed to code for all amino acids at all points of mutation found in these sections may be prepared by analogous standard procedures Hence, the remaining 18 of the 19 natural amino acid changes or mutations to be made at each point 26 - 136-7067 of mutation between the Nru I and Bss H II sites in pr AK-7 may be readily made using plasmid pr AK-7.

To cover all of the points of mutation within the 116 amino acid concerned sequence for conveniently spinning of relevant codons, the plasmid pr AK-7 may be used to prepare plasmid pr AK-8 which in turn is used ultimately to prepare pr AK-9, as described in Example 1 In Fig 5, all of the relevant restriction sites as ultimately accumulated in pr AK- 9 are shown in an expanded cut-away section of pr AK-9 The Spe I site shown in Fig 5 is also a unique site which was already present in pr AK, pr AK-3 etc As will also be appreciated, the plasmids pr AK-7, pr AK-8 and pr AK-9 may be used to introduce multiple mutation changes between any one pair of restriction sites and/or to produce DNA coding for at least one change within two or more such locations, such that a large variety of multiple mutant combinations involving original points of mutation found in accord with the invention may be constructed to pro- duce a large variety of new insecticidally active B t endotoxin pro- teins.

As will also be appreciated, plasmids such as pr AK-7, pr AK-8 and pr AK-9 are fully capable plasmids for changing any one or more codons within any of the restriction site pair locations provided in these plasmids Where changes are desired within one or two but less than three such locations, plasmids such as pr AK-4 or pr AK-5 may be used if covering the desired location of changes, preferably after removal of the original Hind III site in pr AK, and if such plasmids are not sui- table, it will be appreciated that a pr AK type plasmid containing any one or more of such locations may be prepared conventionally by varying or limiting the selection for introduction of the restriction site pairs used to modify pr AK in producing pr AK-9 Hence, the invention provides also a variety of novel plasmids useful for production of mutants and mutant combinations in accord with the invention and containing any one or more of the restriction site pairs ultimately produced in pr AK-9.

27 - 136-7067 As will also be appreciated, DNA comprising any one or more such restriction site pairs may be excised, before or after modifying to contain one or more mutations in accord with the invention, from the pr AK type plasmids by cutting at restriction sites which are outside the desired mutation region(s) and which are correspondingly found in another plasmid for a B t endotoxin, and then inserting (ligation by standard means) the excised DNA segment into such other B t endotoxin plasmid which has been similarly cut, thereby enabling such other plasmids to be conveniently modified or for purposes of directly inserting the mutations of the invention therein.

For purposes of incorporating mutations provided by the invention into a full length endotoxin coding sequence, a plasmid incorporating the DNA structural gene for the &-endotoxin of B t wuhanensis was used as a matter of convenience and ready availability at the time This plasmid, p BT 210, is shown in Fig 4 The plasmid p BT 210 incorporates the full length endotoxin structural gene from B t wuhanensis as indicated by the thick dark line in Fig 4, and by analogy to Fig 1, also incorpor- ates a sequence containing a B t ribosomal binding site which was ob- tained from B t wuhanensis along with the structural gene and which is indicated in Fig 4 by the dark box The plasmid p BT 210 is a fully com- petent E coli expression vector including the same E coli promoter system as the pr AK plasmids, an E coli origin of replication (not shown) and a gene for chloramphenicol resistance as indicated in Fig 4.

The arrows in Fig 4 show the reading direction of the B t wuhanensis gene under control of the E coli promoter and of the gene for chloram- phenicol resistance Based upon sequence information in our possession, the entire operon (structural gene, B t derived ribosomal binding sequence section and E coli promoter/operator sequence) is very similar and only insignificantly different from the operon in the plasmid pr AK.

In particular, the DNA coding for the 610 amino acids of the active portion of the B t endotoxin (Table A) and extending into the protoxin region at least about up to the Kpn I site shown in Fig 4 for p BT 210 is 28 - 136-7067 identical to the corresponding DNA sequence in the plasmid pr AK In the DNA region downstream from the Kpn I site in the B t structural gene in p BT 210 to the end of such structural gene there are unknown but minor differences compared to the corresponding section of the B t kurstaki HD-1 gene truncated in making pr AK These differences were indicated by restriction endonuclease mapping The plasmid p BT 210 codes for a full length endotoxin as shown in Table A and is completely homologous in the active portion (and through at least the amino acids produced up to its Kpn I site to the 6-endotoxin from B t kurstaki HD-1 in clones pr AK and p B 8 r II), and has substantial homology in the balance of the protoxin section Finally the ribosomal binding site in p BT 210 is identical to that in pr AK and the entire DNA including the ribosomal binding site (RBS) and extending upstream from just before the initiation Met back through the Bam HI site joining the promoter section are the same in p BT 210 and in pr AK except that in p BT 210 there are two nucleotide chan- ges immediately after the Bam HI site (CC instead of GT as in pr AK) and three nucleotides (TTT) as found in pr AK immediately after such two nucleotides are deleted in p BT 210, these differences coming merely as a result of different ligation strategies in joining the RBS sections from B.t to the E coli promoter section through a Bam HI site The plasmid p BT 210 may be used to produce full length mutant B t 6-endotoxin pro- tein having any one or more of the amino acid changes provided by the present invention The Nsi I site, the two Xba I sites, the Sst I site and the first appearing downstream Hind III site shown in Fig 4 for p BT 210 correspond to the same sites shown in Fig 1 for pr AK (the DNA for both plasmids in this region being identical as above indicated).

29 - 136-7067 EXAMPLE A

1 Trichoplusia ni (T ni) assay Tests were performed on second instar larvae All insects were kept in climatic chambers under standard conditions of temperature, humidity etc throughout the test period, and were fed on a standard artificial diet Test substances were given to the insects as part of the diet, with each concentration of test substance being administered to one batch of twenty insects Insects were monitored for a period of 7 days after treatment, after which time the LD 50 of the insects was taken.

LD 50 may be defined as an estimate of the dose of substance required to induce mortality in 50 % of the subjects Final results are given as relative potency, wherein; relative potency = LD 50 of standard x 100 LD 50 of experimental Using the above technique the absolute values of LD 50 can be pro- vided wherein interpretation of the results is simple, such that all relative potency values higher than that of the standard indicate an activity higher than that of the standard Furthermore a substance with a relative potency of eg 400 when compared to a standard of 100, is 4 times more active than the standard.

The standard, having a relative potency of 100 in the above test, was the plasmid p BT 301, which plasmid contains a full-length wild-type 8-endotoxin sequence, being identical to p BT 210 except for containing two E coli promoters, each of which individually is the same as that contained in p BT 210.

Controls used in the above test were; - 136-7067 a) CAG 629 an E coli strain containing no 6-endotoxin producing plasmids and having no insecticidal (gift from C A Gross, Department of Bacteriology, University of Wisconsin) activity per se; b) SAN, 415 a commercially available B t insecticide, obtainable under the registered trade name JAVELIN.

2 Tobacco Budworm assay (TBW assay) The TBW assay employed was that basically described by Dulmage et al, ( 1971) J Invertebr Path 18 240-245, and was performed with sam- ples done in triplicate in 1 ounce clear plastic souffle caps, with one 2nd instar TBW larva ( 4 to 5 days old, average weight 1 6 gi) in each cup The samples were combined with 15 ml diet (comprising the Nutrient Powder, Vitamin Powder, agar and other ingredients) as described by Dulmage et al, USDA Technical Bulletin No 1528:1-5 ( 1976) The diet was divided evenly among three cups which were allowed to cool for '/ hour One TBW was added (using a size 00 camel hair brush) to each cup and the lids were securely snapped on These samples were then placed in a 271 C, 50 % relative humidity incubator for 4 to 5 days The size group numbers used in scoring the TBW toxicity assay correspond to the weight ranges given in the following table.

31 - 136-7067 GROUP SIZE WEIGHT RANGE AVERAGE WEIGHT (mg) (mg) 1.0 1 3 1 9 1 6 1.5 2 7 3 1 2 8 2.0 5 5 6 3 5 8 2.5 11 7 12 3 12 0 3.0 17 3 22 2 19 6 3.5 30 8 34 2 32 8 4.0 50 1 52 4 51 1 4.5 76 6 94 3 84 8 5.0 119 9-114 7 113 5 6.0 119 8-134 3 > 140 O The "Group Size" indicated above equates directly to the toxicity scores reported herein Hence, the weight of the larva after each test was determined, and assigned the toxicity score equal to the group corresponding to the weight range into which its weight fell Except as noted, infra, all dead larvae were assigned a group size and toxicity score of zero The toxicity scores from all replications were averaged to obtain the results reported herein, and typically all results are based on at least 30 replications.

32 - i 136-7067 The cups were opened until ranges of different size TB Ws were located These TB Ws were weighed out until one TBW was located that fell within every weight range The sample cups containing the TBW of the given weight range were then marked with the corresponding group size number These cups were then arranged in ascending order on the lab bench The remaining samples were then scored by visual comparison of size with the weighed sample TB Ws and assigned that group number on a score sheet Dead larvae were recorded with a "+" and assigned a score of zero Dead larvae which were bright pink or appeared to have liquified were suspected to have died from causes unrelated to the a-endotoxin These larvae were scored with a "" and not counted in the results.

The standard sample size of 1 ml of a pr AK culture divided among three cups resulted in growth retardation in the middle of the range of toxicity scores Therefore, the assay was useful in distinguishing the clones with increased toxicity from the ones with reduced or equal toxicity to the nonmutant parent The assay produced a dose response depending on theamount of pr AK culture put into the assay.

Hence, the greater the amount of pr AK-containing bacteria that was added to the samples, the greater the degree of toxicity to the TBW was observed The dose response curve of pr AK was useful in evaluating the degree by which clones were more toxic than the nonmutant parent The following table illustrates the dose response of the pr AK-containing bacteria:

Amount of pr AK Stationary Culture Added Toxicity Scores ml 1 5 1 5 2 0 2 2 2 5 2 5 1 3 3 3 5 0.5 3 3 5 4 0.25 3 5 4 4 33 - 136-7067 On the basis of the above evaluation, all cultures were assayed using 1 ml of culture in order, in relation to the obtained group sizes, to allow an ample range to ascertain those with greater or less activity relative to pr AK (and other nonmutant plasmids) as a standard.

The Nutrient Powder used in the TBW Assay was mixed in the following gram weight proportions: soybean flour, 1103 4 g.; wheat germ, 429 4 g; Wesson Salt Mix, 292 4 g; sucrose, 164 2 g; methyl parabenzoate, 24 6 g; and sorbic acid, 14 8 g.

The Vitamin Powder used in the TBW Assay mixed in the following gram weight proportions: calcium peutothenate 12 0 g.; Nicotinamide, 6 0 g; Riboflavin, 3 0 g; folic acid, 3.0 g; thiamine Hcl, 1 5 g; pyridoxine Hcl, 1 5 g; Biotin, 0 12 g; and Vitamin B 12, 6 0 g.

The following three screening applications of the TBW Assay (Primary, Secondary and Dilution-Series) were employed at various stages of evaluation, and are referred to in this specification.

Primary Assay: One ml aliquots from 18 hr cultures of two separate clones were combined in with TBW diet in a 50 ml conical centrifuge tube and divided evenly between three cups (with one TBW per cup) These samples were evaluated alongside controls of wild type pr AK or p BT 210 transformed cells and untransformed cells prepared in the same manner.

Secondary Assay: Samples which displayed increased toxicity toward the TBW's in the primary assay were screened in a second assay Selected mutant colonies were innoculated from the library plates into YT/Amp broth (one colony per culture) Ten 1 ml samples were evaluated along with appropriate controls Clones exhibiting increased toxicity to TBW's were designated as "probable up-mutants" and were evaluated a third time Those that repeated their "up" phenotype a third time were identified as "up-mutants" and evaluated in a Dilution-Series Assay to more precisely 34 - f 136-7067 determine level of enhanced activity versus the parent wild type.

Dilution-Series Assay: Mutants confirmed to display an "up" phenotype over the non-mutant construction were screened in the TBW assay in a dilution series based on dry weight of lyophilized bacterial cells that contained either the mutant or wild type toxin from pr AK or p BT 210 clones that were grown for 18 hours (and the cells pelleted prior to lyophilizing) Samples were set up in triplicate at each of the following dilutions in a final volume of 15 ml:

167 pg/ml, 67 pg/iml, and 33 ug/ml SDS-PAGE and Western (immunoblot) analysis was performed on the protein from these mutants, typically at 75 pg dry weight cells per lane.

The Dilution-Series results essentially confirmed the results of the previous assays and are not otherwise reported herein or averaged in the Tables hereof which report biological results.

EXAMPLE P REGULAR PROCEDURES In the following numbered examples or otherwise in this specification the following regular or standard laboratory procedures were used where referenced to the following or otherwise required, unless the text hereof indicate otherwise.

Example P-1:

Maintenance and Growth of Bacterial and Phage Strains E coli strains SG 4044 and JM 103 were host for all plasmid constructions E coli strain JM 103 and the phage M 18 and MP 19 were obtained from New England biolabs These bacterial strains were grown in YT medium ( 5 g/l yeast extract, 10 g/l bactotryptone, 5 g/l Na Cl) Medium was supplemented with 50 mg/l ampicillin for growth of cells containing pr AK or derivatives of this plasmid and with 20 - 136-7067 mg/ml chloramphenical for cells containing p BT 210 or derivatives of this plasmid.

Example P-2:

Propagation and Isolation of Phage DNA Preparation of M 13 derived recombinant phage stocks and isolation of phage DNA was done using previously described procedures (Messing, J ( 1983) Methods Enzymol 101:20-78).

Example P-3:

Preparation of Synthetic Oligonucleotides Synthetic oligonucleotides were prepared using automated synthesis with an Applied Biosystems (Foster City, CA) 380 A DNA synthesis machine.

Purification steps once the cycle was complete were as follows The synthetic oligonucleotide was deblocked by adding an equal volume of ammonium hydroxide and incubating at 55 'C overnight After removing the ammonium hydroxide by successive rounds of speed-vacuum centrifugation and resuspensions in distilled H 20, the oligonucleotide was further purified by urea-polyacrylamide gel electrophoresis (Urea-PAGE) To visualize the band the gel was placed on a R twin layer chromatography plate covered with Saran wrap and the oligonucleotide was illuminated with short wave ultraviolet light After cutting the oligonucleotide containing portion of the gel with a razor blade, the oligonucleotide was eluted from the gel in O SM ammonium acetate, 1 m M EDTA, p H 8 0 at 37 C overnight with agitation.

After eluting overnight, the gel fragments were pelleted at 6000 RPM in a JA 20 rotor and the supernatant containing the eluted oligonucleotide was transferred to a fresh tube.

ETOH precipitation was used to concentrate the oligonucleotide and it was quantified by absorbance at O D.

260 200 pmol of the oligonucleotide was kinased in a 40 /l reaction with 2 units of T 4 polynucleotide kinase and 0 05 m M ATP.

36 - 136-7067 Example P-4:

DNA Transformation of E coli cells A) E coli JM 103 or SG 4044 competent for DNA transformation were prepared as described by a commonly used procedure (Cohen, S N, Chang, A C P and Hsu, L ( 1972 l Proc Natl Acad Sci USSA 69:2110-2114) For site-directed oligonucleotide mutagenesis experiments, heteroduplex recombinant phage (M 13) DNA ( 60 ng) was added to 0.2 ml of competent cells and held at O 'C for 15 minutes.

The cells were subsequently held at 42 C for 2 minutes and wl of this mixture was added to 3 ml of YT broth containing 0 7 % bacto agar held at 42 C to prevent solidification and 0 2 ml of a fresh overnight culture of JM 103 or SG 4044 The mixture was immediately spread on a YT agar plate (YT broth plus 1 5 % bacto agar) and the plates (inverted) were incubated overnight at 37 'C.

B) Plasmid DNA ( 100 lng) from mutagenesis experiments or any other ligations involving pr AK or p BT 210 vectors as described herein was added to 0 2 ml of competent cells (JM 103 or SG 4044) and held at O OC for 30 minutes The cells were subsequently held at 42 C for 2 minutes and returned to an ice bath Amounts from 2)l to 200 pl were plated on YT agar containing 50 pg/ml ampicillin for clones based on pr AK and 20,p g/ml of chloramphenicol for clones based on p BT 210 and incubated overnight at 37 'C.

Example P-5:

Restriction Enzyme Digestion All restriction enzymes were purchased from either Bethesda Research Labs (Gaithersburg, MD) or New England Biolabs Incubation conditions were those recommended by the manufacturer.

37 - 136-7067 Example P-6:

Ligation of DNA Fragments A) DNA ligation reactions ( 20 pl) contained 60 m M Tris-HC 1, p H 7 5, 10 m M Mg C 12, 1 m M dithiothreitol, 50 WM ATP,-20 n M DNA termini and 20 units T 4 DNA ligase (New England biolabs) Incubation was at 14 C for 4 hours.

B) Three fragment ligations were set up with fragments present in a 1:1:1 molar ratio at a concentration of 0 04 pmole each in a 20 ul reaction volume Incubation was at 16 'C for 4 hours when ligating only a sticky end (eg Xho II internal site) or overnight for ligating any blunt end (eg.

a Fnu D 2 site) New England biolabs (NEB) T 4 Ligase was used at a concentration of 10 units (NEB definition) per yl reaction volume.

Example P-7:

DNA Sequencing DNA sequencing of a-endotoxin genes and their derivatives was done by the chain termination method of Heidecker et al (Heidecker, G, Messing, J, and Gronenborn, B l 1980 l Gene 10:68-73).

EXAMPLE 1

Preparation of Vectors pr AK-3, pr AK-4, pr AK-5, pr AK-6 and pr AK-7 Step a) Preparation of pr AK-3 1 ug of the plasmid p B 8 r II (shown in Fig 2 and described above) and the replicative form of DNA from the well-known M 13 phage cloning vectors MP 18 and MP 19 were simultaneously digested with the restriction endonucleases Bam HI ( 8 units) and Kpn I ( 10 units) for 60 minutes at 37 C in 100 m M sodium chloride buffer solution also containing 6 m M Tris-H Cl (p H 7 9), 6 m M Mg C 12, 100 yg/ml bovine serum 38 - N 136-7067 albumin Desired fragments from these resulting DNA mixtures were purified by running the entire mixture on a 1 % preparative agarose gel to separate according to size.

Bands were visualized by staining with ethidium bromide and illuminating with long wave ultraviolet light The gel fragment containing the desired DNA was cut and the DNA eluted by electrophoresis in dialysis tubing The Barn HI/Kpn I fragment from p B 8 r II was ligated into the mp 18 and mp 19 Barn HI/Kpn I cut and gel purified vectors by incubating for 4 hours at 14 'C in a total volume of 20 1 containing m M Tris-Hcl, p H 7 5, 10 m M Mg C 12, 1 m M dithiothreitol, 50 m M ATP, 20 n M DNA termini The resulting DNA was transformed to competent E coli JM 103 cells as in Example P-4 except that the YT plates contained isopropyl thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl- -D-galactoside (X gal), both obtained from Sigma Chemical Company Since recombinant phage (containing the DNA insert cut from p B 8 r II) will make clear plaques under these conditions, whereas M 18 and M 19 make blue plaques, the clear plaques were added to 2 ml of E coli JM 103 cells in YT broth, incubated overnight at 37 'C and single stranded DNA was prepared from the phage following the procedure as described by J Messing, J Methods Enzymol ( 1983), 101:20-78 These desired clones containing the large but single stranded DNA inserts from p B 8 r II were identified using agarose gel electrophoresis by virtue of their slower mobility as compared to mp 18 or mp 19 Sequencing of a portion of these clones that included the endotoxin DNA by the dideoxy chain termination method confirmed the presence of the endotoxin DNA and indicated that mp 18 had acquired the antisense stand thereof and that mp-19 had acquired the sense strand thereof, both of which were recovered A 26 base antisense oligonucleotide having the sequence ' GTC CTT CTA ATC GCG AAA TGG CTT GG 3 ' was prepared by solid phase synthesis in the automated DNA 39 - 136-7067 synthesizer, and kinased with T 4 polynucleotide kinase and ATP as described by Maniatis et al, Molecular Cloning ( 1982): A Laboratory Manual; Cold Spring Harbor Laboratory, Cold Spring Harbor, N Y A mixture in total volume of 60 ul containing 0 4 jg of the recombinant phage mp 19 containing the endotoxin sense strand, 20 m M Tris-Hcl, p H 7.5, 7 m M Mg Cl 2, 1 m M dithiothreital, 50 m M sodium chloride and 10 ng of the 26 base antisense oligonucleotide was heated at 68 'C for 15 minutes, then at 37 'C for 10 minutes and placed at O OC The resulting mixture containing the mp 19 recombinant DNA with the mutagenic oligo annealled was then treated by addition of 0 2 m M of each of d ATP, d CTP, d TTP and d GTP, 1 m M of ATP, 4 units of DNA Polymerase I Klenow fragment (from New England Biolabs), 0 5 Wg of E.

coli single strand binding protein (from Pharmacia, Piscataway, N J) and 20 units T 4 DNA ligase (New England Biolabs) The resulting mixture was incubated at 14 'C for 4 hours for polymerization and ligation to occur and the resulting circular double stranded heteroduplex DNA was transformed into E coli JM 103 and plated as described in Example P-4 Twenty ( 20) individual plaques were then selected and single strand DNA isolated from the phage as described by Maniatis et al, supra DNA from phage of the twenty ( 20) plaques each in a total volume of 20 1 and containing 50 m M Tris-Hcl, p H 8 0, 50 m M K Cl, 10 m M Mg Cl 2, ng of the above-indicated antisense 26 base oligonucleotide and 0 2 ug of different circular single strand phage DNA molecules were each heated at 68 'C for 15 minutes and placed at 37 'C for 10 minutes The restriction endonuclease Nru I ( 8 units) was added to each resulting mixture and incubation at 37 'C was continued for 1 hour.

The mixture was electrophoresed through a 0 8 % agarose gel.

About 10 % of the samples contained DNA migrating as linear DNA to enable the identification of the positive clones containing the desired Nru I site, and positive clones were - -f 136-7067 transformed into E coli JM 103 to ensure purification DNA between the Bam HI and Xba I site in the positive clones was excised therefrom (after annealling with m 13 sequencing oligo and polymerizing to make double stranded as described above for the Nru I oligo) by simultaneous cutting with the endonucleases for these sites and ligated (Example P-6 A) with the large fragment (about 5004 base pairs and missing the about 749 bp fragment between the Barn HI and the second Xba I site in pr AK) which was obtained and gel purified after complete digestion of pr AK simultaneously with the same two restriction enzymes, all in a conventional manner to form the plasmid pr AK-3.

Step b) Preparation of pr AK-4 Following the essentially total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step a) was annealed to a 25 base synthesized antisense oligonucleotide having the sequence ' CCACTCTCTAAAGCTTTCTGCGTAA 3, designed to introduce the Hind III site between nucleotide position number 327 and 351 in the Table A nucleotide sequence Positive clones now having both the desired Nru I and Hind III sites were identified in a frequency of about 6.6 % by cleavage evaluation with the nuclease Hind III, and were used to prepare pr AK-4 by ligating the Barn HI/Xba I fragment with the new sites to the 5004 bp large fragment from pr AK in the manner of Step a).

Step c) Preparation of pr AK-5 Following essentially the total procedure which is analogous to Step a), the single stranded phage DNA obtained in Step b), above, was annealed to a 26 base synthesized antisense olegonucleotide having the sequence ' GCATCTCTTCCCTTAGGGCTGGATTA 3, designed to introduce the Mst II site between nucleotide 41 - I 136-7067 position number 366 and 391 in the Table A nucleotide sequence Positive clones now having all three of the desired Nru I, Hind III and Mst II sites were identified in a frequency of about 9 1 % by cleavage evaluation with the restriction enzyme Mst II, and were used to prepare pr AK-5.

Step d) Preparation of pr AK-6 Following essentially the total procedure which is analogous to Step a), above, the positive double stranded phage clones from Step c), above, were converted into single stranded phase DNA and annealed to a 26 base synthesized antisense oligonucleotide having the sequence ' GCGGTTGTAAGCGCGCTGTTCATGTC 3, designed to introduce the Bss HII site between nucleotide position number 406 and 431 in the Table A nucleotide sequence Positive clones now having all four sites ultimately desired in pr AK-7 were identified in a frequency of about 12 5 % by cleavage evaluation with the enzyme Bss HII, and were used to prepare pr AK-6.

Step e) Preparation of pr AK-7 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step d), above, was annealed to a 26 base synthesized antisense oligonucleotide having the sequence ' TACAGTCCTAAATCTTCCGGACTGTA 3, designed to eliminate the Hind III site between nucleotide positions number 1682 and 1707 in the Table A nucleotide sequence Positive clones representing the total sequence desired for pr AK-7 were identified in a frequency of about 2.8 % by restriction endonuclease screening of the replicative form (double-stranded) of the recombinant phage DNA for the loss of the Hind III site between nucleotides 1682 and 1707 Double-stranded DNA isolated from the mutant was used to prepare pr AK-7.

42 - 136-7067 To complete the provision of a plasmid (pr AK-9) having suitably unique and spaced restriction sites for conducting codon spin experiments at other points of mutation between the two Xba I sites the development of the pr AK series plasmids may be continued analogously to the following steps to prepare a plasmid pr AK-8 and therefrom pr AK-9 as indicated below in Steps f) and g).

Step f) Preparation of pr AK-8 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step e), above, was annealed to a 27 base synthesized antisense oligomer having the sequence:

'TCCCCACCTTTGGCCAAACACTGAAAC 3 ' designed to introduce a Bal I restriction site at about nucleotide position number 534 in the Table A nucleotide sequence Positive clones (pr AK-8 now having all five of the desired Nru I, Hind III, Mst II, Bss HII and Bal I sites and missing the Hind III site removed in preparing pr AK-7 are identified in the manner of Step a), above.

Step g) Preparation of pr AK-9 Following essentially the procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step f), above, was annealed to a 30 base synthesized antisense oligomer having the sequence:

' GTTGCCAATAAGACGCGTTAAATCATTATA 3 ' designed to introduce a Mlu I restriction site between nucleotide position number 588 and 595 in the Table A nucleotide sequence Positive clones now having all six of the desired Nru I, Hind III, Mst II, Bss HII, Bal I and Mlu restriction sites and missing the Hind III site removed in forming pr AK-7 are identified in the manner of Step a) and denominated as plasmid pr AK-9.

As will be evident, cassette DNA suitable for substitution between the Bal I and Mlu I sites in pr AK-9 may be appropriately coded to introduce all possible codon and 43 - 136-7067 amino acid variations at the mutated amino acid positions 184, 187, 188 and 194.

In a like manner, cassette DNA suitable for substitution between the Mlu I and second Xba I site may be appropriately coded to introduce all possible codon and amino acid variations at the mutated amino acid positions 201 and 204.

Fig 5 is a schematic representation of the unique restriction sites introduceable between the two original Xba I sites found in pr AK (the first such Xba I site in pr AK-9 now being the Nru I site).

Underlining in the antisense oligonucleotides shown above in the various steps of Example 2 indicates the change or changes to be introduced.

EXAMPLE 2

Codon Spin Experiments A) Single stranded oligonucleotides having the sequence of each of the two strands shown in Fig 3 A & 3 B were prepared as described in Example P-3 with the DNA synthesizer programmed to randomly insert all of the nucleotides A, T, C and G at each of the X-positions in each strand shown in Fig 3 A A total of approximately 200 ug (after purification) of DNA from each run on the machine such single strands (representing a family of oligonucleotides identical except at the X-positions of each strand, were prepared by such procedure 10 pmoles of each strand, sense and antisense for each codon spin were en masse combined and annealled by heating at 68 'C for 10 minutes, then at 37 'C for 10 minutes, cooling to room temperature and placing on ice The resulting mass of double stranded oligomers conforming to the DNA shown in Fig 3 A was judged to contain at the XXX positions (amino acid position 116) every combination permitted by the genetic code including stop signals and multiple but varying 44 - j 136-7067 numbers of codons for each of the 20 natural amino acids plus stop signals 1 pmole of these double strand oligomers or cassettes were then kinased with T 4 polynucleotide kinase from New England biolabs and mixed en masse with the larger fragment (present at a 10 fold less molar concentration) obtained by gel isolation after the simultaneous cleavage of the plasmid pr AK-7 with the restriction endonucleases Hind III and Mst II in 100 m M Na Cl 10 m M Tris-H Cl p H 7 5, 10 m M Mg C 12, 10 m M 2-mercaptoethanol and 100) g/ml BSA, and the resulting mixture was subjected to ligation in accord with Example P-6 (A) An aliquot ( 5 pl) of the resulting ligation mixture was then used to transform E coli JM 103 under the conditions of Example P-4 (B) A number ( 200) of the resulting transformed cells individually were subjected to the TBW and T ni Assays (without prior knowledge of what codon at XXX was in any particular clone) and found to produce an activity level fairly indicating that all of the various different mutants had resulted in an insecticidally active protein product having activity of at least about that of the control truncated endotoxin, with clear up-mutants ( 5 X control) also indicated Prior to this, random cells from the transformation were also selected, plated and colonies grown as in Example P-1 to isolate plasmid DNA for DNA sequence analysis by cloning the Bam HI/Xba I fragment into the sequencing vectors mp 18 and mp 19 cut with the same enzymes The DNA in the region of each of eleven ( 11) such position -116 mutations and the identified up-mutants was then sequence to determine the amino acid coded for at its 116 position It was found that one of the two up-mutants was the original up-mutant ( 116-Lys, but coded for by AAA).

The other up-mutant was found to 116 Arg coded for by CGT.

One of the other clones was found the native 116-Glu (but coded by GAA) Seven of the other light mutants were 116-Ile (ATT), 116-Cys (TGC), 116-Leu (CTC), 116-Asp (GAT), 116-Asn (AAC), 116-Ile (ATT) and 116-Gly (GGA), all unique - 136-7067 except the new 116-Ile (ATT) was represented by two of the clones The final clones coded for 116-STOP (TGA).

B) The procedure of part A) of this Example 2 was repeated for amino acid position-119 using the DNA shown in Fig 3 B Again, the random evaluation of a large number of resulting clones produced an activity level in the TBW and T ni Assays fairly indicating that all mutant clones in the pool were active (The % of inactive molecules was approximately equal to what frequency of STOP codons UAA, UAG, and UGA would be expected from the random input by the machine of the nucleotides at the XXX positions) Seven randomly selected individual clones were each indicated to have an activity level at least approximately that of the truncated native sequence endotoxin produced by pr AK, but none was an up-mutant by our arbitrary standard Sequencing of the seven individual clones showed that they were all different and unique, as follows: 119-Leu (CTA), 119-Tyr (TAC), 119-Asp (GAT), 119-His (CAT), 119-Pro (CCA), 119-Ile (ATT) and 119-Ser (TCT).

EXAMPLE 3

Mutant Full Length B t Endotoxin The plasmid p BT 210 ( 1 jig) was simultaneously cut with restriction endonucleases Bam HI ( 8 units) and Sst I ( 8 units) for 60 minutes in 100 m M sodium chloride buffer solution also containing 6 m M Tris-H Cl (p H 7 9) 6 m M Mg C 12, and 100)ug/ml bovine serum albumin The larger fragment of about 7180 base pairs was gel purified for use as a vector.

Then one ug of plasmid pr AK-26-3 involving the mutations Ala >Thr @ 119, Met >Ile @ 130 and Gly >Asp @ 201 was also simultaneously cut with the restriction endonucleases Bam HI ( 8 units) and Sst I ( 8 units) in 100 m M sodium chloride buffer solution also containing 6 m M Tris-H Cl (p H 46 - 136-7067 7.9), 6 m M Mg C 12, and 100 pg/ml bovine serum albumin.

The smaller fragment of about 1,428 base pairs containing the mutations as well as the B t RBS section was gel purified and such fragment in an amount of about 0 06 p moles was combined for ligation with 0 02 p moles of the 7180 base pair vector fragment above obtained and joined together in 20 1 of ligation medium containing 60 m M Tris-Hcl, p H 7 5, 10 m M Mg C 12, 1 m M dithiothreitol, 50 MATP, and 20 units of T 4 DNA ligase, and the resulting mixture incubated for 4 hours at 14 'C The resulting plasmid, designated p Bt 26-3, was transformed into E coli JM 103 by adding 5,l of said ligation mixture to 0 2 ml of competent E coli JM 103, holding initially at O 'C for 30 minutes and then pulsing at 42 'C for 2 minutes and returning to ice.

Various amounts ( 2 l, 20 Jul, and 180)ul of the resulting mixture was then immediately spread on YT agar plates with 20 pg/ml chloramphenicol (YT broth plus 1 5 % bacto agar) and the plates incubated overnight at 37 'C inverted Only a transformed cell with chloramphenicol resistance could grow on these plates Chloramphenicol resistant colonies were grown in liquid culture overnight at 37 'C and plasmid DNA was prepared for restriction digestion with Eco RI reagents and DNA sequencing to actually determine the presence of the point mutations Successful transformants containing the plasmid p BT 26-3 were then evaluated in the TBW and T ni Assays.

Proceding analogously to Example 3, above, the following additional full length mutant endotoxins were prepared and evaluated in the TBW and T ni Assays Table F below indicates the additional full length mutant endotoxin producing plasmid/cell systems that were so prepared, all with the approximate results of their evaluation in the TBW Assay and the approximate results obtained in such assay for the product of Example 3, above, the B t Wuhanensis native endotoxin produced in E coli JM 103 and a control involving untransformed JM 103 cells.

47 - 0.

136-7067 TABLE F

New Mutant Full Length Plasmid Identification p BT 26-3 p BT 36 a 65 Source oi Mutant Bam HI/ Sst I Sequence f pr AK-26-3 pr AK-36 a 6 Actual Mutation(s) Involved 1 19-Thr 130-Ile 201-Asp 122-Ile 125-Val TBW Assay Toxicity Score p BT-C pr AK-C p BT-E pr AK-E p BT-O pr AK-O p BT-R pr AK-R 116-Lys 1 130-Ile 2 Q 1 -Asp 1 16-Lys 217-His 101-Lys 116-Lys 122-Ile 125-Val 3-F p BT 98 cl pr AK-98 cl 188-Ser 3-G p BT-B pr AK-B 119-Thr 3-H p BT-D pr AK-D 217-His 3-I p BT-F pr AK-F 187-Thr p BT-J pr AK-J 101-Lys 116-Lys 130-Ile 201-Asp 2.5 3-K p BT-M pr AK-M 119-Thr 2 5 217-His 3-L p BT-N pr AK-N 119-Thr 3 187-Thr 3-M p BT-S pr AK-S 119-Thr 1 188-Ser 48 Example

No.

3-A 3-B 3-C 3-D 3-E 3-J S 136-7067 TABLE F (cont) Source of New Mutant Mutant Full Length Barn HI/ Actual TBW Assay Example Plasmid Sst I Mutation(s) Toxicity No Identification Sequence Involved Score 3-N p BT-T pr AK-T 116-Lys 1 5 188-Ser 3-0 p BT-U pr AK-U 101-Lys 2 116-Lys 188-Ser 3-P p BT 107 c 22 p 107 c 22 94-Lys 3 194-Lys 3-Q p BT 99 c 62 p 99 c 26 4-Thr 3 105-Tyr 204-Tyr 3-R p BT 107 c 25 p 107 c 25 184-Ile 3 3-S p BT-A pr AK-A 101-Lys 3 116-Lys 3-T p BT-K pr AK-K 101-Lys 3 116-Lys 187-Thr 3-U p BT-P pr AK-P 119-Thr 2 5 122-Ile 125-Val 3-V p BT-Q pr AK-Q 116-Lys 3 122-Ile 125-Val 3-W p BT 39 pr AK-39 105-Tyr 3 188-Ser 3-X p BT 70 pr AK-70 119-Thr 1 184-Ile 3-Y p BT 68 pr AK-68 105-Tyr 1 130-Ile 201-Asp 49 - I 136-7067 TABLE F (cont) Source of New Mutant Mutant Full Length Barn HI/ Actual TBW Assay Example Plasmid Sst I Mutation(s) Toxicity No Identification Sequence Involved Score 3-Z p BT 53 pr AK-53 105-Tyr 3 184-Il E Control B T 3 Wuhanensis Control JM 103 4 7 EXAMPLE 4

More Full Length Mutant B T Endotoxins The plasmid p BT 210 ( 1}ig) was simultaneously digested with the restriction endonucleases Bam HI ( 8 units) and Sst I ( 8 units) and the resulting 7180 bp large fragment was gel isolated In a series of separate experiments each ( 1,pg) of the plasmids pr AK, pr AK-E, p 26-3, p 36 a 65 and p 95 a 86 was also simultaneously digested with the restriction endonucleases Barn HI ( 8 units) and Sst I ( 8 'units) and each resulting 1428 bp fragment comprising a portion of a truncated endotoxin coding sequence was gel isolated Each quantity of these 1428 bp fragments was then separately digested with the restriction endonuclease Fnu D 2 ( 4 units in 6 m M Na Cl, 6 m M Tris HC 1 (ph 7 4) 6 m M Mg C 12, 6 m M 2-mercaptoethanol,100,pg/ml bovine serum albumin) The restriction endonuclease Fnu D 2 (also known as Acc 2) cuts each of the various 1428 bp Barn HI/Sst I fragments only once and into a 640 bp Barn HI/Fnu D 2 fragment and a 788 bp Fnu D 2/Sst I fragment, the different fragments from each experiment being purified by agarose gel electrophoresis.

- 136-7067 There was thus obtained a series of diffeent 640 bp Bam HI/Fnu D 2 fragments and a series of different 788 bp Fnu D 2/Sst I fragments By selecting one fragment from each of these two series and ligating (Example P-6 B) with the 7180 bp larger fragment obtained from p BT 210, there was obtained a number of new plasmids harbouring different full length mutant B t endotoxin genes The thus obtained new plasmids, identified below in Table G, were then used to transform E coli JM 103 according to the procedure of Example P-4 (A) and the resulting cells were evaluated for the production of B t endotoxin in the TBW assay of Example A, the approximate results obtained in said assay being also reported below in Table G Various of the transformed cells containing plasmids as described in Tables F and G were also evaluated in the T ni assay, the results of which are illustrated below in Table H.

TABLE G

NEW FULL LENGTH MUTANT SOURCE OF SOURCE OF PLASMID BAM HI/ FNU D 2/ ACTUAL TBW EXAMPLE IDENTI FNU D 2 SST I MUTATION(S) ASSAY NO FICATION FRAGMENT FRAGMENT INVOLVED SCORE 4-A 66 p 36 a 65 p 26-3 122-Ile 3 125-Val 201-Asp 4-B 67 p 26-3 p 95 a 86 119-Thr 1 130-Ile 188-Ser 4-C 74 p 36 a 65 p 95 a 86 122-Ile 3 125-Val 188-Ser 4-D 106 p 26-3 pr AK 119-Thr 1 130-Ile 4-E 107 pr AK p 26-3 201-Asp 2 5 4-F 108 pr AK-E pr AK 130-Ile 3 51 - 136-7067 TABLE H

PLASMID TABLE RELATIVE IDENTIFIC SOURCE POTENCY p BTA F 391 p BTC F 299 p BT 66 F 169 p BT 107 c 25 F 254 p BTP F 340 p BTS F 255 p BT 67 G 304 p BT 106 G 367 standard p BT 301 100 control SAN 415 59 control CAG 629 O EXAMPLE 5

Cells transformed with DNA encoding a mutant endotoxin sequence are grown in a fermentor, under conditions known and standard for such The whole contents of the fermentor are, at the end of cell growth and immediately prior to harvest, subjected to a raise in temperature to approximately 70-80 C This temperature is maintained for 10 mins be- fore cooling and is sufficient to inactivate the recombinant micro- organisms without affecting the biological activity of the endotoxin proteins The fermentor contents are then evaporated under pressure to concentrate to one-third of the previous volume and the resulting con- centrate subjected to spray drying at an insertion pressure of about 2000 psi using a heated countercurrent air flow with an inlet tempera- ture of 140-160 C and an outlet temperature of 20-50 C The resulting powder is mixed with carrier such as defatted soybean to form a wettable concentrate Suitable ratios of such will depend i a on the desired 136-7067 strength of the final product but may, for example, be 60:40 parts by weight powder to carrier The resulting concentrate preferably contains from 0 4 to l OX and more preferably 0 8 to 8 % active ingredient, in terms of spores or endotoxin protein The wettable powder is suitably diluted with water as is known in the art, for spray application.

136-7067 TABLE A (a) GG ATC CGT TTT AAA TTG TAG TAA Ile Arg Phe Lys Leu TAT CAT AAT Tyr His Asn (-15) -46 TGA AAA ACA GTA TTA Lys Thr Val Leu GAA TTG GTA TCT TAA TAA AAG AGA TGG AGG TAA CTT Glu Leu Val Ser Lys Arg Trp Arg Leu ATG GAT AAC Met Asp Asn ( 1) AAT Asn ( 4) CCG AAC ATC AAT GAA TGC Pro Asn Ile Asn Glu Cys ATT CCT TAT AAT TGT Ile Pro Tyr Asn Cys ( 15) TTA AGT AAC CCT GAA GTA GAA GTA TTA GGT GGA GAA AGA ATA GAA Leu Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu ACT GGT TAC ACC CCA ATC GAT ATT TCC TTG TCG CTA ACG CAA TTT Thr Gly Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe CTT TTG AGT GAA TTT GTT CCC GGT GCT GGA Leu Leu Ser Glu Phe Val Pro Gly Ala Gly ZTT GAT ATA Val Asp Ile (b) TTT GTG TTA GGA CTA Phe Val Leu Gly Leu ( 60) ATA TGG GGA ATT TTT GGT CCC TCT CAA TGG GAC GCA Ile Trp Gly Ile Phe Gly Pro Ser Gin Trp Asp Ala TTT CTT GTA CAA ATT GAA CAG TTA ATT AAC Phe Leu Val Gin Ile Glu Gln Leu Ile Asn n-1 CAA AGA ATA GAA GAA Gln Arg Ile Glu Glu (m-1) TTC GCT AGG AAC Phe Ala Arg Asn (c), 300 CAA GCC ATT TCT AGA TTA Gin Ala Ile Ser Arg Leu ( 100) GAA GGA CTA AGC AAT Glu Gly Leu Ser Asn )1 ( 105) CTT TAT CAA ATT TAC GCA GAA TCT TTT AGA GAG TGG GAA GCA GAT Leu Tyr Gln Ile Tyr Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp CCT ACT AAT CCA GCA TTA AGA GAA GAG ATG CGT ATT CAA TTC AAT Pro Thr Asn Pro Ala Leu Arg Glu Glu Met Arg Ile Gin Phe Asn ( 135) Notes: (a) is Bam HI site (b) is Spe I site (c) is Xba I site 54 - % 136-7067 GAC ATG AAC AGT GCC CTT ACA ACC GCT ATT CCT CTT TTT GCA GTT Asp Met Asn CAA AAT TAT Gln Asn Tyr AAT TTA CAT Asn Leu His 549 AGG TGG GGA Arg Trp Gly TTA ACT AGG Leu Thr Arg Ser Ala Leu Thr Thr Ala Ile Pro Leu Phe Ala Val ( 140) 495 CAA GTT CCT CTT TTA TCA GTA TAT GTT CAA GCT GCA Gln Val Pro Leu Leu Ser Val Tyr Val Gln Ala Ala ( 165) 523 TTA TCA GTT TTG AGA GAT GTT TCA GTG TTT GGA CAA Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gln ( 180) 577 TTT GAT GCC GCG ACT ATC AAT AGT CGT TAT AAT GAT Phe Asp Ala Ala Thr Ile Asn Ser Arg Tyr Asn Asp ( 195) 606 n-348 624 CTT ATT GGC AAC TAT ACA GAT CAT GCT GTA Leu Ile Gly Asn Tyr Thr Asp His Ala Val (m-116) CGC TGG Arg Trp ( 210) TAC AAT ACG Tyr Asn Thr TGG Trp (d) 675 GGA TTA GAG CGT GTA TGG GGA CCG GAT TCT AGA GAT Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg Asp ( 225) ATA AGA TAT AAT CAA TTT AGA AGA GAA TTA ACA CTA ACT GTA Ile Arg Tyr Asn Gin Phe Arg Arg Glu Leu Thr Leu Thr Val TTA GAT ATC Leu Asp Ile GTT TCT CTA TTT CCG AAC TAT GAT AGT AGA ACG TAT Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr ( 255) CCA ATT CGA ACA GTT TCC CAA TTA ACA AGA GAA ATT TAT ACA AAC Pro Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn CCA GTA TTA GAA AAT TTT GAT GGT AGT TTT CGA GGC TCG GCT CAG Pro Val Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln GGC ATA GAA Gly Ile Glu GGA AGT ATT AGG AGT CCA CAT TTG ATG GAT ATA CTT Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu AAC AGT ATA ACC ATC TAT ACG GAT GCT CAT AGA GGA GAA TAT TAT Asn Ser Ile Thr Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr TGG TCA GGG CAT CAA ATA ATG GCT TCT CCT GTA GGG TTT TCG GGG Trp Ser Gly His Gin Ile Met Ala Ser Pro Val Gly Phe Ser Gly Note: (d) is Xba I site {.

136-7067 CCA GAA TTC ACT TTT CCG CTA TAT GGA ACT ATG GGA AAT GCA GCT Pro Glu Phe Thr Phe Pro Tyr Gly Thr CAA CTA GGT Gin Leu Gly AGA AGA CCT Arg Arg Pro CTT GAC GGG Leu Asp Gly TCC GCT GTA Ser Ala Val ATA CCG CCA Ile Pro Pro CAT CGA TTA His Arg Leu TTG CGT TCA GGC TTT AGT AAT AGT AGT GTA Phe Arg Ser Gly Phe Ser Asn Ser Ser Val AGT GCT Ser Ala ATA CCT Ile Pro GTT AAA Val Lys TCA CCT Ser Pro TTA TCA Leu Ser AAT TTA Asn Leu GGG AAT Gly Asn GGA AGC Gly Ser AAT GGA Asn Gly Met Gly Asn CAG GGC GTG Gln Gly Val TTT AAT ATA Phe Asn Ile ACA GAA TTT Thr Glu Phe TAC AGA AAA Ala TAT Tyr GGG Gly GCT Ala AGC Ala AGA Arg ATA Ile TAT Tyr GGA Tyr Arg Lys Ser Gly CAG AAT AAC AGC GTG Gln Asn Asn Asn Val AGC CAT GTT TCA ATG Ser His Val Ser Met 1350 AGT ATA ATA AGA GCT Ser Ile Ile Arg Ala ( 450) GAA TTT AAT AAT ATA Glu Phe Asn Asn Ile TTA ACA AAA TCT ACT Leu Thr Lys Ser Thr GGA CCA GGA TTT ACA Gly Pro Gly Phe Thr GGC CAG ATT TCA ACC Gly Gin Ile Ser Thr CAA AGA TAT CGG GTA Gln Arg Tyr Arg Val CAA TTC CAT ACA TCA Gln Phe His Thr Ser TTT TCA GCA ACT ATG Phe Ser Ala Thr Met TTT AGG ACT GTA GGT Phe Arg Thr Val Gly TCA AGT GTA TTT ACG Ser Ser Val Phe Thr 56 - CCA Pro ACA Thr AAT Asn GGA Gly ACG Thr CCA Pro CAA Gin TTA Leu AAT Asn ACC Thr GTA Val CCT Pro CAA Gln TCG Ser CAA Gin TCC Ser GAT Asp AGG Arg CGT Arg TCC Ser CAA Gln TCA Ser TCG Ser CAA Gln ATT Ile ACT Thr CTA Leu AAT Asn CTG Leu GGA Gly Le u GCT Ala TAT Tyr GTT Val CCA Pro GAA Glu AGT Ser GTT Val TTA Leu TCT Ser TTG Leu GAT Asp TTT Phe CCT Pro ATT Ile AAT Asn GGA Gly TTA Leu AGA Arg ATT Ile AGT Ser TT Phe ATG Met CCT Pro CTT Leu GGA Gly AGA Arg ATT Ile GAC Asp AGT Ser ACT Thr TTC Phe TCA Ser GGC Gly GAT Asp GTA Val CGC Arg GGA Gly GGG Gly ACT Thr TCT Ser TCA Ser TCT Ser ATT Ile AAT Asn TAC Tyr AGA Arg AGT Ser CCG Pro TGG ATA Trp Ile CAA ATT Gln Ile GGA ACT Gly Thr CTT CGA Leu Arg ATT ACT Ile Thr GCT TCT Ala Ser CCT ATT Pro Ile AAT TTA Asn Leu TTT AAC Phe Asn CAT His ACA Thr TCT Ser AGA Arg GCA Ala ACC Thr AAT Asn CAG Gin TTT Phe CGT Arg CAA Gln GTC Val ACT Thr CCA Pro ACA Thr CAG Gln TCC Ser TCA Ser 136-7067 TTA AGT GCT CAT GTC TTC AAT TCA Leu Ser Ala His Val Phe Asn Ser CGA ATT Arg Ile GAA TTT GTT CCG GCA GAA Glu Phe Val Pro Ala Glu GGC AAT GAA GTT TAT ATA GAT Gly Asn Glu Val Tyr Ile Asp GTA ACC TTT GAG GCA GAA TAT Val Thr Phe Glu Ala Glu Tyr ( 610) GAT TTA GAA AGA GCA CAA AAG GCG GTG AAT GAG CTG TTT ACT TCT Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Glu Leu Phe Thr Ser TCC AAT CAA ATC GGG TTA AAA ACA GAT GTG ACG GAT TAT CAT ATT Ser Asn Gin Ile Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile GAT Asp CAA GTA TCC AAT TTA GTT GAG TGT TTA TCT GAT GAA TTT TGT Gln Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys CTG GAT GAA AAA AAA GAA TTG TCC GAG AAA GTC AAA CAT GCG AAG Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys CGA CTT AGT GAT GAG CGG AAT TTA CTT CAA GAT CCA AAC TTT AGA Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg GGG ATC AAT AGA CAA CTA GAC CGT GGC TGG AGA GGA AGT ACG GAT Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp ATT ACC ATC CAA GGA GGC GAT GAC GTA TTC AAA GAG AAT TAC GTT Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val (e) ACG CTA TTG GGT ACC Thr Leu Leu Gly Thr ( 723) TTT GAT GAG TGC TAT CCA ACG TAT TTA TAT Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr CAA AAA ATA GAT GAG TCG AAA TTA AAA GCC TAT ACC Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr 2250 CGT TAC CAA Arg Tyr Gln ( 750) ATT CGC TAC AAT GCC AAA CAC GAA Ile Arg Tyr Asn Ala Lys His Glu TTA AGA GGG TAT ATC GAA GAT AGT CAA GAC TTA GAA ATC TAT TTA Leu Arg Gly Tyr Ile Glu Asp Ser Gin Asp Leu Glu Ile Tyr Leu GGT TCC TTA TGG CCG CTT TCA GCC CCA AGT CCA ATC GGA AAA TGT Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Note: (e) is Kpn I site 57 - ACA GTA AAT GTG CCA GGT ACG Thr Val Asn Val Pro Gly Thr 136-7067 GGA GAA CCG AAT CGA TGC GCA CCA CAA CTT GAA TGG AAT CCA GAT Gly Glu Pro Asn Arg Cys Ala Pro Gin Leu Glu Trp Asn Pro Asp CTA GAT TGT TCC TGC AGA GAC GGA GAA AAA TGT GCC CAT CAT TCC Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His His Ser CAT CAT TTC TCC TTG GAC ATT GAT GTT GGA TGT ACA GAC TTA AAT His His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn ( 840) GAG GAC TTA GGT GTA TGG GTG ATA TTC AAG ATT AAG ACG CAA GAT Glu Asp Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp GGC CAT GCA AGA CTA GGA AAT CTA GAA TTT CTC GAA GAG AAA CCA Gly His Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro TTA GTA GGA GAA GCA CTA GCT CGT GTG AAA AGA GCG GAG AAA AAA Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys 2700 TGG AGA GAC AAA CGT GAA AAA TTG GAA TGG GAA ACA AAT ATT GTT Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr Asn Ile Val ( 900) TAT AAA GAG GCA AAA GAA TCT GTA GAT GCT TTA TTT GTA AAC TCT Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser CAA TAT GAT AGA TTA CAA GCG GAT ACC AAC ATC GCG ATG ATT CAT Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile Ala Met Ile His GCG GCA GAT AAA CGC GTT CAT AGC ATT CGA GAA GCT TAT CTG CCT Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu Pro GAG CTG TCT GTG ATT CCG GGT GTC AAT GCG GCT ATT TTT GAA GAA Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu TTA GAA GGG CGT ATT TTC ACT GCA TTC TCC CTA TAT GAT GCG AGA Leu Glu Gly Arg le Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg AAT GTC ATT AAA AAT GGT GAT TTT AAT AAT GGC TTA TCC TGC TGG Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp AAC GTG AAA GGG CAT GTA GAT GTA GAA GAA CAA AAC AAC CAC CGT Asn Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg TCG GTC CTT GTT GTT CCG GAA TGG GAA GCA GAA GTG TCA CAA GAA Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu GTT CGT GTC TGT CCG GGT CGT GGC TAT ATC CTT CGT GTC ACA GCG Val Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala 58 - 136-7067 TAC AAG GAG GGA TAT GGA GAA GGT TGC GTA ACC ATT CAT GAG ATC Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile ( 1050) GAG AAC AAT ACA GAC GAA CTG AAG TTT AGC AAC TGT GTA GAA GAG Glu Asn Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu 3240 GAA GTA TAT CCA AAC AAC ACG GTA ACG TGT AAT GAT TAT ACT GCG Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala ( 1080) ACT CAA GAA GAA TAT GAG GGT ACG TAC ACT TCT CGT AAT CGA GGA Thr Gln Glu Glu Tyr Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly TAT GAC GGA GCT TAT GAA AGC AAT TCT TCT GTA CCA GCT GAT TAT Tyr Asp Gly Ala Tyr Glu Ser Asn Ser Ser Val Pro Ala Asp Tyr GCA TCA GCC TAT GAA GAA AAA GCA TAT ACA GAT GGA CGA AGA GAC Ala Ser Ala Tyr Glu Glu Lys Ala Tyr Thr Asp Gly Arg Arg Asp AAT CCT TGT GAA TCT AAC AGA GGA TAT GGG GAT TAC ACA CCA CTA Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu CCA GCT GGC TAT GTG ACA AAA GAA TTA GAG TAC TTC CCA GAA ACC Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr GAT AAG GTA TGG ATT GAG ATC GGA GAA ACG GAA GGA ACA TTC ATT Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile ( 1170) GTG GAT AGC GTG GAA TTA CTC CTT ATG GAG GAA TAG Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu ( 1181) The more preferred mutations of the invention include those at positions 116 (Lys or Arg), 119 (Thr), 130 (Ile) and 188 (Ser) and combinations including one or more of the same such as those found in p BT 26-3, p BT-106, p BT-68, p BT-C, p BT-67 and p BT-70 (certain of these found in Table G) Also of preferred interest are the individual and combined mutations in p 36 a 65, particularly for truncated endotoxins.

59 - 136-7067 The mutations found and permitted in accord with the invention at amino acid position-4 are of interest since they fall within a section of 25 amino acids (positions 1 to 25, inclusive, in Table A) which has been postulated to also form a pre-toxin or protoxin portion of the endotoxin and subject to protease cleavage in the gut to form the active endotoxin or more active endotoxin Hence, the mutations permitted at position-4 are indicated to be relevant to endotoxin sequences comprising said 25 amino acids or having substantial (at least 70 %) homology therewith, and more particularly relevant to those endotoxins coded for in such region by DNA which would hybridize before the position-4 mutation and under stringent conditions to DNA having the sequence found in Table A for the nucleotide positions extending from nucleotide position 1 to and including nucleotide position 75, independent of deletions and additions and with equivalent coding of corresponding amino acids as previously discussed in connection with the conserved 116 amino acid sequence area.

The mutation uncovered by our work at amino acid position 217 and reported in Table B, above, and evaluated as seen elsewhere herein is judged to indicate that all naturally coded amino acids may be present at this position in active endotoxins having the relevant sequence shown in Table A which extends from the end of the 116 amino acid reference sequence to and including amino acid position 217 Accordingly, the situation in which the amino acid at position 217 in such a sequence or equivalent thereof is any naturally coded amino acid except Arg is included with the scope of the invention However, since the indicated mutation at position 217 produced less interesting results, it is mainly of interest in combination with other mutations disclosed herein and indicating that position 217 can change in endotoxins in which Arg naturally occurs at this position.

- 136-7067

Claims

1 A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA including a portion encoding an amino acid sequence demonstrating substantial homology to the 116 amino acid sequence beginning at position m-i and exten- ding through position m-116 in Table A hereof, said position numbers applying to such homologous sequence independent of any deletions or additions therein, in which said DNA is modified such that any one or more of the following amino acids is coded for at the indicated amino acid reference position:

a) at position b) at position c) at position d) at position e) at position f) at position g) at position h) at position i) at position j) at position k) at position 1) at position m) at position n) at position o) at position m-5 any natural amino acid except Asn; m-6 any natural amino acid except Gln; m-12 any natural amino acid except Glu; m-16 m-27 m-30 m-33 m-34 m-36 m-41 m-95 m-98 m-99 any any any any any any any any any natural natural natural natural natural natural natural natural natural amino amino amino amino amino amino amino amino amino any natural amino acid acid acid acid acid acid acid acid acid acid except Asn; except Glu; except Ala; except Thr; except Asn; except Ala; except Met; except Phe; except Ala; except Thr; m-105 any natural amino acid except Asn; and m-112 any natural amino acid except Gly;

2 A structural gene according to claim 1 in which the homology between the amino acid sequence encoded by a portion of the DNA of said structural gene and the 116 amino acid sequence beginning at positi- on m-1 and extending through position m-116 in Table A hereof, is at least 70 %.

136-7067 3 A structural gene according to claim 1 or 2 in which the DNA has been modified such that any one or more of the following amino acids is coded for at the indicated amino acid reference position:

position position position position position position position position position position position position position position position m-5, Lys m-6, Lys m-12, Lys m-16, Tyr m-27, Lys or Arg m-30, Thr m-33, Ile m-34, Tyr m-36, Val m-41, Ile m-95, Ile m-98, Thr m-99, Ser m-105, Lys; and m-112, Asp 4 A structural gene according to claim 3 in which modified to incorporate the change at one or both reference positions m-27 and m-30.

the DNA has been of the amino acid The structural gene of claims 1 to 4 in which the DNA portion with- out any of the modifications specified in claims 1 to 4 hybridises under stringent hybridising conditions to a 348 nucleotide oligomer having the nucleotide sequence depicted in Table A beginning at position n-1 and extending through nucleotide position n-348.

6 The structural gene of claim 5 in which the DNA portion prior to any modification specified in claims 1 to 4 codes for the 116 amino acid sequence of Table A beginning at position m-1 and extending through a) at b) at c) at d) at e) at f) at g) at h) at i) at j) at k) at 1) at m) at n) at o) at 136-7067 position m-116.

7 The structural gene of claim 6 in which the DNA coding for the endotoxin comprises DNA coding for the amino acid sequence of Table A beginning at amino acid position 1 and extending through amino acid position 205.

8 A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA having a portion encoding an amino acid sequence demonstrating substantial amino acid homology to the 205 amino acid sequence beginning at amino acid position 1 and extending through amino acid position 205 in Table A hereof, in which the amino acid at position 4 is any amino acid except Asn.

9 A structural gene according to claim 8 in which the amino acid at position 4 is Tyr.

An expression vector comprising the structural gene of any one of claims 1 to 9 under control of DNA operative to cause expression of said structural gene in a bacterial host.

11 An expression vector according to claim 10 in which said gene is under control of DNA operative to cause expression of said gene in E coli.

12 An expression vector according to claim 10 in which said gene is under control of DNA operative to cause expression of said gene in B.t 13 An endotoxin protein having toxic activity against insects, said protein comprising an amino acid sequence portion having substantial homology with the 116 amino acid sequence beginning at position m-1 136-7067 and extending through position m-116 in Table A hereof, said positi- on numbers applying to such homologous sequence independent of any deletions or additions therein, in which any one or more of the following amino ence positions:

acids are present at the indicated amino acid refer- m-5 any natural amino acid except Asn; m-6 any natural amino acid except Gln; m-12 m-16 m-27 m-30 m-33 m-34 m-36 m-41 m-95 m-98 m-99 any any any any any any any any any any natural natural natural natural natural natural natural natural natural natural amino amino amino amino amino amino amino amino amino amino any natural amino acid acid acid acid acid acid acid acid acid acid acid except except except except except except except except except except except Glu; Asn; Glu; Ala; Thr; Asn; Ala; Met; Phe; Ala; Thr; m-105 any natural amino acid except Asn; m-112 any natural amino acid except Gly; 14 An endotoxin protein according to claim 13 in which the homology between said amino acid sequence portion and the 116 amino acid sequence beginning at position m-1 and extending through position m-116 in Table A hereof, is at least 70 %.

An endotoxin protein according to claim 13 or 14 in which any one or more of the following amino acids is coded for at the indicated amino acid reference position:

a) at position m-5, Lys b) at position m-6, Lys a) at b) at c) at d) at e) at f) at g) at h) at i) at j) at k) at 1) at m) at n) at o) at position position position position position position position position position position position position position position position and c) at position d) at position e) at position f) at position g) at position h) at position i) at position j) at position k) at position 1) at position m) at position n) at position o) at position m-12, Lys m-16, Tyr m-27, Lys or Arg m-30, Thr m-33, Ile m-34, Tyr m-36, Val m-41, Ile m-95, Ile m-98, Thr m-99, Ser m-105, Lys; and m-112, Asp 16 An endotoxin protein according to claims 15 in which one or both of the amino acids at reference positions m-27 and m-30 have been changed.

17 An endotoxin protein produced from a gene according to claim 8 or 9.

18 A process for the production of an endotoxin protein which comprises transforming or transfecting a cell with an expression vector accor- ding to any one of claims 8 to 11 and culturing the resulting cells to produce said endotoxin.

19 A process according to claim 18 in which the cell transfected is a plant cell.

transformed or A process according to claim 18 in which the cell transformed or transfected is a bacterial cell.

21 A plant comprising cells containing a structural gene according to any one of claims 1 to 9.

136-7067 136-7067 22 Bacterial cells comprising an expression vector according to any one of claims 10 to 12.

23 A DNA sequence comprising DNA having the sequence from nucleotide position n-1 extending through nucleotide position n-348 in Table A or mutant variations thereof and having one or more spaced apart restriction sites selected from the group consisting of Hind III, Mst II, Bssh II, Bal I and Mlu I, which sites do not change the amino acid sequence for which the DNA codes.

24 An insecticidal composition comprising an insecticidally effective amount of a protein produced from a DNA according to any one of claims 1 to 9 in association with an agriculturally acceptable carrier.

An insecticidal composition comprising an insecticidally effective amount of a protein according to any one of claims 13 to 17 in association with an agriculturally acceptable carrier.

Published 1989 at The Patent Office, State House, 6671 Hiholborn London W Cl PR 4 TP Purther copies mnaybe obtainedfrom The Patent Ofce.

Sales Branch, St Mary Cray, Orpington, Kent BR 5 3 RP D Printed by Multiplex techniques ltd, St Mary Cray, Kent, Con 1/87