AU616945B2

AU616945B2 - Modified dna sequences coding for mutant endotoxins of bacillus thuringiensis

Info

Publication number: AU616945B2
Application number: AU30297/89A
Authority: AU
Inventors: Cindy Lou Jellis; James R. Rusche; Daniel P. Witt
Original assignee: Sandoz AG
Current assignee: Sandoz AG
Priority date: 1988-02-25
Filing date: 1989-02-23
Publication date: 1991-11-14
Anticipated expiration: 2009-02-23
Also published as: IE62118B1; IT1230483B; NZ228108A; GR1000457B; GB2216127A; IL89391A; ZA891463B; CN1037538A; ES2012283A6; FR2627778A1; FR2627778B1; IE890589L; GB2216127B; DK84589A; AT396940B; PL277925A1; NL8900481A; ATA41389A; BE1001877A4; PL161726B1

Description

COMMONWEALTH OF AUSTRALIA PATENTS ACT 1952 COMPLETE SPECIFICATION V 4 NAME ADDRESS OF APPLICANT: Sandoz Ltd.

Lichtstrasse CH-4002 Basle Switzerland NAME(S) OF INVENTOR(S): Cindy Lou JELLIS James Robert RUSCHE Daniel Parker WrIT ADDRESS FOR SERVICE: DAVIES COLULSON Patent Attorneys 1 Little Collins Street, Melbourne, 3000.

COMPLETE SPECIFICATION FOR THE INVENTION ENTITLED: MODIFIED DNA SEQUENCES CODING FOR MUTANT ENDOTOXINS OF BACILLUS THURINGIENSIS SThe following statement is a full description of this invention, including the best method of performing it known to me/us:- 4 Bacillus thuringiensis is a sporulating bacterium which produces a protein crystal delta-endotoxin (6-endotoxin) at the end of vegetative stage of growth. This endotoxin, upon ingestion by certain insects, produces toxic effects which include the cessation of feeding, gastrointestinal dysfunction, dehydration and ultimately, death. The 6-endotoxin is produced, generally from a plasmidal source, as an inactive precursor or protoxin form having a molecular weight of 130,000- 140,000 daltons ECalabrese, Canad, J. Microbiol. 26 (1980) 1006]. Proteolytic cleavage to remove the C-terminal half, approximately, and possibly several amino acids at the N-terminus, normally occurs in the insect gut as a result of the action of the gut proteases, and is re- S' quired to produce the active toxin with a molecular weight of 65,000 to 70,000d [Tyrell et al, J. Bacteriology 145 (1981) 1052].

0 A large number of subvarieties of B.t. have been identified. Although most of these show a more specific or increased toxicity to insects of the order Lepidoptera, a limited number have also been demono '0 strated to be toxic towards insects of other classifications. For exam- S ple, B.t. israelensis is toxic towards Dipteran larvae (mosquitos and 9 4 4 S" blackflies) and two other subvarieties have recently been identified which demonstrate toxicity towards Coleopteran larvae [Hofte et al, Nuc.

Acid. Res. 15(17) (1987) 7183], 04 0 Although much work has been performed in he production of shortened toxins and structural genes encoding these, there appears to be less known about the ability of the B.t. 6-endotoxins to withstand point mutations within the active or toxic portion of the endotoxin sequence and the effect of such mutations on the activity of the toxin molecules.

An object of the present invention is to provide novel mutants of the active portion of B.t. 6-endotoxins.

la 136-7067 A further object of the present invention is to produce mutations which are effective to produce B.t. endotoxin-like activity in both truncated and full length 8-endotoxin forms.

Another object of the present invention is to provide mutations which enhance the insecticidal activity of B.t. 8-endotoxin structures.

In accordance with the present invention, we have, after randomly creating single and multiple point mutations in many hundreds of DNA strands coding for a large section of the active portion of a representative B.t. endotoxin insecticidally active against Lepidoptera, isola- .a ted and produced by recombinant techniques several mutant B.t. endotoxins which exhibit the characteristic insecticidal activity against 0 B SLepidoptera that is possessed by the wild type B.t. 5-endotoxin. Also, *e at these discovered points of mutation, it is indicated that the codons a: coding for any other natural amino acid can be substituted to produce active endotoxin protein. A number of the random mutations were also found to produce a higher level of insecticidal activity. Such activity may be demonstrated in, for example, the Tobacco Budworm (Heliothis 0 ao virescens) assay or the Trichoplusia ni (cabbage looper) assay as hereinafter described and in many cases this increase was quite remarkable by achieving an activity at least two or more times greater than the parent endotoxin structure. Multiple mutations (usually 2 or 3 amino acids per mutated DNA strand) were also evaluated individually and in various combinations to identify certain more effective mutations and S: combinations thereof. The mutations ir, accordance with the present invention, with one exception, were also found to exist within amino acid sequence sections which are highly conserved among a wide variety of wild type B.t. S-endotoxins, hence indicating the general applicability of the mutations provided by the invention to a wide variety of endotoxin structures in which such conserved areas provide insecticidal B.t. endotoxins.

i i- -"9pi 136-7067 More particularly, with reference to the amino acid sequence and the numbering thereof in Table A, infra, (beginning with the methionine (MET) which is position number 1 and the normal N-terminus of the representative Lepidopteran active endotoxin shown in Table it has been found that B.t. endotoxin protein otherwise insecticidally active against Ltpidoptera insects in the manner of native B.t. endotoxins when containing within the active portion an amino acid residue sequence the same as or having substantial homology to that shown in Table A for the 116 amino acid residue sequence shown at positions from and including position 90 to and including position 205 (also amino acid positions m-1 through m-116), may have one or more of the residues of the following amino acids at the indicated or equivalent homologous positions (the mposition numbers in parentheses being with reference to said 116 amino acid residue sequence): a) at position 94 (position m-5 of said 116 amino acid sequence) any naturia amino acid coded for by the genetic code except Asn; b) at position 95 (position m-6 of said 116 amino acid ,o *o 9 0C U. 0 U CM *9 *0 *d CU *o r r U 101 sequence) any such natural amino (position m-12 of said 116 amino acid except Glu; d) at position sequence) any such natural amino (position m-27 of said 116 residue except Glu; at position 119 sequence) any such natural amino (position m-33 of said 116 residue except Thr; h) at position 123 sequence) any such natural amino (position m-36 of said 116 residue except Ala; j) at position 130 sequence) any such natural amino (position m-95 of said 116 residue except Phe; 1) at position 137 sequence) any such natural tamino (position m-99 of said 116 residue acid except Gin; c acid sequence) an) 105 (position m-16 a) at position 101 Ssuch natural amino of said 116 residue acid except Asn; e) at position 116 sequence) any such natural amino acid (position m-30 of said 116 residue acid except Ala; g) at position 122 sequence) any such natural amino acid (position m-34 of said 116 residue acid except Asn; i) at position 125 sequence) any such natural amino acid (position m-41 of said 116 residue acid except Met; k) at position 184 sequence) any such natural amino acid (position m-98 of said 116 residue acid except Ala; m) at position 188 sequence) any such natural amino acid N 1 11 1 1 1 n 136-7067 except Thr; n) at position 194 (position m-105 of said 116 residue sequence) any such natural amino acid except Asn; and o) at position 201 (position m-112 of said 116 residue sequence) any such natural amino acid except Gly.

In addition, and again with reference to the numbered amino acid residue sequence shown in Table A, the invention includes the change in the amino acid Asn at amino acid position 4 to any other natural amino acid coded for by the genetic code.

With regard to the amino acid residues provided by the invention within said 116 residue sequence, it is preferred in accordance with the invention that such sequence be characterised, again with reference to the total mature sequence shown in Table A (and also to such 116 residue 44 o e *0 4 4 4 444* 4s 4 4 44 4 00 44 4 4r 4 44 4 4r 4 44 4 4 04 sequence), positions: sequence); sequence); sequence); sequence); (position (position (position (position (position (position (position (position (position (position (position by one or more of the following amino acids at the indicated Lys at position 94 (position Lys at position 95 (position Lys at position 101 (position Tyr at position 105 (position 5 of the 116 residue 6 of 12 of said said 16 of said e) 27 30 33 34 36 41 95 98 99 105 112 Lys or Arg, more preferably said said said said said said said said said residue residue residue residue residue residue residue residue residue sequence); sequence); sequence); sequence); sequence); sequence); sequence); sequence); sequence); Arg, at f) Thr at g) lie at h) Tyr at i) Val at j) Ile at k) Ile at 1) Thr at m) Ser at n) Lys at I o) Asp at 116 residue 116 residue 116 residue position 116 position 119 position 122 position 123 position 12; position 130 position 184 position 187 position 188 position 194 position 201 said 116 residue sequence); anc said 116 residue sequence), When the Asn at amino acid position 4 is changed, it is preferably r 136-7067 changed to Tyr.

Table A near the end of this specification sets forth a nucleotide sequence and resulting deduced amino acid sequence relevant to B.t.

8-endotoxin production in nature. With one exception, the nucleotide sequence was obtained from a 6-endotoxin-producing plasmid found in B.t.

wuhanensis. In particular, the entire structural gene (actually coding for the endotoxin itself) is from B.C wuhanensis and the one exception is that the sequence prior to methionine (Met) at the beginning of the structural gene is from an endotoxin-producing gene found in B.t. kurstaki HD-1 (the so-called 5.3Kb Hind III class plasmid of HD-1), such upstream sequence containing the native Ribosomal Binding Site (RBS) from such B.t. kurstaki HD-1 endotoxin-producing plasmid. The upstream sequence containing the Ribosomal Binding Site, as found in B.t. wuhanensis differs little from that shown in Table A for Kurstaki and the differences are indicated later herein. However, it should be kept in mind that both the nucleotide and amino acid sequences in the subject B.t. wuhanensis and B.t. Kurstaki HD-1 structural genes are identical from the beginning of the endotoxin sequence through the entire active portion thereof and up to at least the Kpn I site indicated in Table A, said Kpn I site being in the protoxin portion. Hence, the active toxin portion resulting from cleavage after ingestion by the insect will be the same for both the subject B.t. wuhanensis and B.t. kurstaki HD-1 endotoxins. In Table A, amino acids for the endotoxin protein produced as a result of expression of the structural gene are positively numbered in parentheses 1 through 1181 below the amino acid. Those in the untranslated area upstream of the 1-Met are negatively numbered in a back or upstream direction (with stop signals counted as an amino acid position). Nucleotides in the structural gene are numbered (not in parentheses) above the line in which they appear and the last digit in the number stands above the nucleotide to which the number applies. Nucleotides in the untranslated region which includes the ribosomal binding site are negatively numbered backward from the initiating ATG codon (for i jl S136-7067 the 1-Met). Within the numbered sequences indicated above a portion thereof is separately or sub-numbered m-1 through m-116 for amino acids and n-1 through n-348 for the nucleotides for such amino acids, to indicate more particularly a highly conserved region in which most of the mutations provided by the invention were found to be located. Certain restriction sites relevant to the nucleotide sequence in Table A are shown by a line above the nucleotides involved in the restriction sites with a footnote designation of the particular site. The toxic portion of the endotoxin shown in Table A as recognised in the art involves the amino acid sequence beginning at amino acid position 1 (Met) and extending through amino acid position 610 (Thr). In view of the nature of the total DNA sequence shown in Table A, and in order to understand the 8 following description more easily, it will be noted that the DNA and 4 0 e. amino acid sequences beginning with the untranslated portion in line 1 a' of Table A and extending up to the Kpn I site at about amino acid positions 724-725, and portions thereof, can be and are also referred to herein as derived from B.t. kurstaki HD-1 (the 5.3Kb Hind III class plasmid).

Figure 1 shows a map of the general working plasmids prAK and prAK-3 used at various stages in connection with the invention and comprising S• DNA coding for a truncated B.t. endotoxin derived from B.t. Kurst&',' HD-1 and having insecticidal activity against Lepidoptera.

Figure 2 shows a map of the plasmid pB8rII which comprises DNA coding for a truncated B.t. endotoxin protein of somewhat greater length than that coded for by prAK and also derived from B.t. kurstaki HD-1 and also having insecticidal activity against Lepidoptera.

Figures 3a and 3b show two representative double stranded DNA strands which may be synthesised for conducting so-called codon spin experiments and also useful for conveniently introducing desired mutations into a B.t. endotoxin DNA coding sequence.

136-7067 Figure 4 shows a map of the plasmid pBT210 which comprises DNA coding for a full length native endotoxin from B.t. wuhanensis, which endotoxin has the identical amino acid sequence in its active portion as the endotoxin from B.t. kurstaki HD-1 as coded for in prAK and pB8rII.

Figure 5 shows an abbreviated map of the plasmid prAK-9 along with a blow-up of take-out section thereof, said prAK-9 being otherwise similar in detail to plesmid prAK-3 and said section and subsections thereof in parent plasmids being conveniently useful for conducting codon spin experiments and otherwise introducing mutations as provided by the into. vention.

The plasmid prAX was deposited in E. coli JM103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18329.

4e The plasmid pB8rII was deposited in E. coli JM103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February t hAs essentially indicated, the point mutations of the invention may S be applied to endotoxin protein sequences produced by Bacillus thuringiensis varieties and subtypes, which sequences are insecticidally active against Lepidopteran larvae when containing the 116 amino acid conserved A sequence indicated above or a sequence which is highly homologous therewith or essentially an equivalent thereof, including protein endotoxin sequences which are of the natural full length type or substantially full length and those which are truncated by removal of all or a pat of downstream protoxin or inactive portion thereof and even those which may 1 :i I- 136-7067 be truncated from the normal C-terminus upstream and back into the active portion of the endotoxin. As evident already, endotoxins from B.t.

kurstaki and B.t. wuhanensis both have the identical 116 amino acid conserved region and others have or can be expected to have the same 116 amino acid sequence or a largely homologous equivalent thereof. For example, endotoxins from B.t. sotto, B.t. kurstaki HD-73 (strain), and B.t. Galleriae are already known to produce endotoxins with the identical 116 amino acid sequence even though some of these differ to at least some extent, and in cases significantly, in both the balance of the toxic portion of the endotoxin and in the protoxin section. Others, such as B.t. kurstaki HD-I Dipel (a commercial substrain), have one S amino acid change in the indicated 116 amino acid sequence (m-59 is Leu coded for by TTG) and other changes/deletions/additions in other sequence portions. This and others found to have a single or multiple changes S but amino acid homology of at least about 70% to said 116 amino acid sequence may have one or more mutant changes of the invention made to the amino acids therein which correspond identically to the amino acid in said 116 amino acid non-mutated sequence, particularly when the amino acid to be changed has on each of its sides 2 and preferably 4 other amino acids which also correspond identically to those in the 116 amino acid sequence. It is also contemplated that the mutations of the invention may be made to corresponding amino acids in homologous series which essentially contain deletions or additions such that the sequence itself is shorter, oz longer than the indicated 116 amino acid sequence. In such cases, the numbering as employed in the reference 116 amino acid sequence will be retained such that deletions existing in the sequence to be changed will be counted as actually present and additions in the sequence to be changed will simply not be counted. Hence, amino acid positioning assignment can be said to be made independent of deletions or additions in such a homologous sequence.

Preferably, the homologous amino acid sequences into which the mutant changes of the invention may be substituted are those which are 136-7067 coded for by DNA to which DNA from either the sense or antisense strand (or double strand) of the DNA beginning with position n-i and extending through position n-348 in Table A will hybridise under stringent hybridising conditions when the homologous sequence to be mutated has its amino acids, which correspond to those in the referenced 116 amino acid sequence, coded for by the same codon as the corresponding amino acid in the reference sequence. Procedures for preparing such a tagged hybridisation probe are well known in the art. Stringent hybridising conditions are those in which hybridisation is effected at 60°C in 2.5X saline citrate (SSC) buffer followed merely by rinsing at 37°C at reduced buffer concentration which will not affect the hybridisations which take Sto place.

o@ Preferably, the mutations are made in amino acid sequences which p6, V have no more than 1, 2 or 3 amino acid differences from those in the 116 S amino acid reference sequence, most preferably a sequence which is identical to the reference sequence.

It is already clearly indicated in the art that the 116 amino acid reference sequence may form a portion of otherwise substantially modifled or different endotoxin protein sequences which have insecticidal S activity against Lepidopteran larvae, and other modifications outside of the reference sequence will most certainly be uncovered as knowledge of the art unfolds. Hence, the sequences bordering the required mutated S* sequence portion which is analogous to the 116 amino acid reference S S portion may vary to a considerable extent and need only be sufficient to provide insecticidally active endotoxin protein, for example as demonstrated by insecticidal activity against the tobacco budworm. Thus the amino acid sequence upstream from the mutated portion may be shortened or lengthened or itself mutated relative to the sequence shown in Table A, but will generally begin with methionine and is most preferably highly homologous or identical to that shown in Table A, although it is evident that such sequence may also optionally contain the preferred -9- 136-7067 mutant at the 4-position as also provided by the invention. Similarly, the portion downstream from the required mutated sequence portion may vary widely and be shortened or lengthened relative to the balance thereof shown in Table A up to its point of cleavage in the insect gut, and of course may or may not be further extended to form a protoxin or inactive portion subject to cleavage in the insect gut to provide an insecticidally active protein toxin.

DNA comprising sequences codig for mutant endotoxins as provided by the invention will be incorporated under the control of appropriate regulatory sequences into plasmids to form expression vectors which will S* be transformed or transfected into cells to produce the endotoxin. The production of endotoxins by such recombinant biotechnological technim ques, in contrast, for example, to the production of drugs by such tech- *oo niques, involves little or no work-up designed to purify the endotoxin, 0o The cells in which it is produced may be lysed, but it has been characteristic in the commercial production of B.t. endotoxins in the past, simply to employ the entire contents of the culture or fermentation system used in production of the final product, usually after drying by conventional means such as low temperature spray drying as is known in a the art. Depending upon the product, various materials may be added to 1 improve product stability as is also known, and proteinaceous materials if not preseni in adequate amounts in the fermentation system may be independently mixed with the product to enhance stability, again as is S* known, eg soybean powder or defatted soybean powder.

While the endotoxins may be produced biotecnnically in a variety of transformed or transfected cell systems, it is generally preferred to 4 transform or transfect bacterial cells of either the gram-negative or gram-positive type. One preferred type of gram-negative bacteria is E.

coli with which considerable experience in biotechnology has already been achieved and for which a wide variety of suitable and operatively functional plasmid and transfer expression vector systems are known and 136-7067 available. Pseudomonas fluorescens represents another type of gramnegative bacteria into which plasmids carrying endotoxin sequences have been incorporated. As demonstrated herein, endotoxin-pr d ~g genes may include regulatory sequences such as particularly ribosomanl binding site sequences which have their origin in B.t. when incorporated for expression into essentially heterologous bacterial cells, such as E.

coli, Since Bacillus type bacteria provide an environment more closely native to the mutant end(toxins of the invention, it is particularly within the scope of this invention and contemplated thereby to transform or transfect Bacillus type bacteria with expression vectors comprising the DNA coding for the mutant endotoxins of this invention, Illustrative of such Bacillus cells of particular interest are B.t. cells, B.cereus cells and B.subtilis cells. A greatly improved procedure for a transforming Bacillus cells, particularly B.t. cells, has recently been found and is described in pending British patent application 8729726.

:1o9 Cell types suitable for transformation by the process include cry minus types such as the known B-t. kurstaki cry B cells which have no plasnids and wild type Bacillus cells such as the native Bt. cell o which carry Sendotoxin-producing plasmids. Plasmids suitable for incorporation into Bacillus cells such as B.t. cells are known, for example, the plasmid pBC16.1 (Kreft et al, Molec. Gen, Genet, [1978] 162 59) and its parent s sq plasmids which may be used or modified by employing conventional recombinant techniques to carry the mutant endotoxin coding sequences of the invention, As is well known in the art, Bacillus cells character;istica Slly produce endotoxin in desired amounts only at their sporulation stage and hence are grown to such stage in order to best obtain the products Suseful as insecticides. Hence, plasmids or expression vectors provided by the invention and carrying DNA for the mutant endotoxins may be incorporated into Bacillus cells which either are devoid of endotoxinproducing plasmids or already contain one or more such plasmids. While the mutant endotoxins of the invention will characteristically have activity against Lepidopteraf endotoxin activity against other insect classes may also be possessed by reason of existing in the parent endo- -11- 136-7067 toxin prior to mutation or as the result of other permitted sequence changes, and in any case it is within the scope of the invention to transform Bacillus cells with the Lepidopteran-toxic endotoxin producing plasmid, of the invention when such cells carry plasmids for endotoxins not substantially effective against Lepidoptera, in order to produce at sporulation, endotoxins combining to provide broader ranges of insecticidal activity. For example, plasmids carrying the mutated endotoxin DNA coding sequences may be used to transform B.t. israeliensis or B.t.

tenebrionis which individually are not substantially effective against Lepidoptera.

an While the present invention has been demonstrated both with reference to truncated and full length native type endotoxin proteins, it is generally preferred, when using the mutant endotoxins directly as insecticides, as described above, to employ or produce fuller length sequen- S ces, which are the same as or mimic the native type at least in terms of the opportunity to achieve an endotoxin protein folding capability similar to that of its native capability, or an improved full length folding o effect, Mutant DNA sequences according to the present invention can also be inserted Into the genome of a plant. In such cases it is preferred that the mutated seqi ences of the truncated type are employed, although the fuller length sequences are also suitable. Any suitable method may be advantageously employed for such incorporation of the endotoxin sequen- S es into a host plant genome, such as for example, via the Ti plasmid of Agrobacterium tumefaciens, electroporation, eectrotransformation, micro-injection, viral transfection or the use of chemicals that induce or increase free DNA uptake, and the like. Such procedures and the use of such in the transformation of plants are well known to the man skilled in the art. Preferably the DNA sequence encoding the mutant endotoxin will be associated with appropriate regulatory sequences, such as for example, operator and 3' regulatory sequences which are functiommw I #_VM6 136-7067 X, in plants, and the whole will be incorporated into an expressiontype vector. Such transformation of plant cells, followed by regeneration of development of cells into whole plants, enables the mutant endotoxin DNA sequence to become a stable and permanent part of the plant genome, such that it is passed on from one generation to the next via mitosis and meiosis and upon expression results in an insect toxic protein, endowing the plant with inheritable insect resistance.

Two very similar vectors (prAK and prAK-3) were used in our work as a source of B.t. 6-endotoxin sequence for mutation and also to provide vehicles for production and evaluation of the B.t. endotoxin mutants.

The plasmids prAK and prAK-3 are represented in Fig 1 by illustrating 0* the relevant details of prAK and indicating the minor variation there- On 02 from which exists in prAK-3. Basically, the plasmids prAK and prAK-3 are fully competent expression vectors for E.coli and each includes an ampicillin resistance gene, an origin of replication and operator sequences, including an E. coli promoter. As indicated in Fig 1 by the thick dark lines and boxes, the vector prAK includes in proper reading "frame coordination with the promoter a DNA sequence which is found in ,o the wild type B.t. kurstaki strain HD-1. The thick dark line represents the mature sequence which has been shortened to code for a truncated native B.t. 6-endotoxin extending from amino acid position 1 (Met) to position 610 (Thr) in Table A and further extending into the protoxin portion to end with amino acid 723 (Leu). At the downstream end of said 2 thick dark line, a small section shown as an open thick box in Fig 1, represents a short DNA sequence of 54 base pairs which follows the base pair triplet coding for 723-Leu and which is itself immediately followed by a stop signal. This total extended sequence of 57 base pairs (including the stop signal) has its origin in the well known plasmid pBR322 which was used in the construction of prAK. Hence the expression vector prAK codes for and produces in E. coli essentially a truncated B.t.

8-endotoxin fusion protein having a total of 741 amino acids and composed of the 610 amino acids of the native protoxin section and 18 amino -13r 136-7067 acids having origin in pBR322. This truncated B.t. endotoxin fusion protein has a high level of insecticidal activity and was used for the purpose of evaluating the mutants thereof produced in our work. This activity is essentially indistinguishable from a fully truncated B.t.

6-endotoxin protein having only the 610 amino acids of the activated toxin (amino acids 1 to 610 in Table A).

The thick dark line representing most of the sequence coding for the truncated B.t. endotoxin fusion protein is connected at its upstream end in Fig 1 to a thick dark box representing a sequence which includes a B.t. ribosomal binding site (RBS). This section (also shown in Table A, lines 1 and 2) which contains the RBS has about 47 nucleotides before beginning at its upstream end with a Bam HI site (inserted in prior plasmids to link the section with the E. coli promoter section (indicated by an arrow in Fig The promoter and RBS sections are arranged and joined to be in proper reading frame coordination with the coding sequence for the endotoxin. Hence, the thick dark lines and boxes together represent DNA having origin in B.t. kurstaki HD-1.

b Various other restriction sites indicated in Fig 1 were relevant to the strategy for the conventional removal and reinsertion of sections of *4 DNA for mutation experiments. These other restriction sites are the Nsi *0 I site (beginning after about only 26 nucleotides from the start of the endotoxin coding sequence), the two Xba I sites (see below, however, o0o concerning prAK-3), the Sst I site and the Hind III site.

a As indicated above, prAK-3 differs from prAK only in a single minor respect. This difference is that the Xba I site (TCT AGA) at nucleotide positions 292 to 297 of Table A were changed using standard techniques to TCG CGA, thereby defining an Nru I site. No change in the coded amino acid sequence resulted from this change. The preparation of prAK- 3 is described in Step a) of Example 1 hereinafter. prAK-3 is also the first intermediate in preparing other plasmids prAK-7 and prAK-9.

-14- I I 136-7067 DNA sections, derived from different lengths of single stranded DNA sections from prAK and prAK-3 (both sense and anti-sense strands) mutated in a conventional manner, such as described by for example, Craick in Biotechniques Jan/Feb 1985, pages 12-19; "Use of Oligonucleotides for Site-3pecitic Mutagenesis", are indicated for convenience herein as M-1 and M-2, M-l defining the 375 base pair section between the two Xba I sites in prAK and M-2 being the section between the Bam HI and Xba I sites in prAK-3 (as shown in Fig 1).

The mutation found between the two Xba I sites in accordance with the invention may be readily obtained using the plasmids prAK-7, prAK-8 or prAK-9 disclosed herein and synthetic double stranded oligonucleotides constructed and used analogously to the procedures described in Example 2 hereof.

.o 9* Following mutation, the mutated single strand portions were rendered double stranded by conventional means. In the case of the M-l mutants, using prAK as a mutation vehicle, the resulting double stranded, mutate a plasmids were transformed into E. coli JM103, plated on YT agar con- 0 0 taining 50 pg/ml ampicillin and incubated overnight to obtain a plural- Sa4 ity of colonies with a variety of different mutations in plasmids the same as prAK except for the mutations.

In the case of the M-2 mutants, the mutated double stranded region between the Bam HI and Xba I sites in the mutation vehicles were excised using Ban HI and Xba I restriction endonucleases, respectively, and ligated into prAK-3 vectors digested with the same two enzymes. The resulting M-2 region mutant-containing prAK-3 plasmids were transformed into E. coli JM103, plated on YT agar with 50 ug/ml ampicillln and incubated overnight to obtain another plurality of colonies involving a variety of different mutations.

Testing to demonstrate activity of mutagenised endotoxin sequences, I 136-7067 expressed from DNA contained in, for example E. coli JM103 or E. coli SG4044 (publicly available from the Agricultural Research Culture Coll- N ection (NRRL), Peoria, Illinois under Repository No. B-15969) was performed in one or both of the Tobacco Budworm assay (TBW) or T. ni assay as described in Example A hereinafter. DNA of mutants showing increased activity over standard non-mutant endotoxin was sequenced in the relevant areas of mutation to determine the mutation in the DNA and hence in the protein sequence. More than 6,000 different colonies with plasmids containing either M-1 or M-2 mutagenised sections were thus evaluated and generally, from 1 to 3 amio acid changes were found to have taken place in each mutation experiment.

iii Table B below, identifies the up-mutants recovered directly as a result of the mutation experimento, the amino acid position with reference to the position numbers assigned in Table A at which each mutation c, occurred, each codon mutated in each mutant and the amino acid change resulting at the indicated position as a result of the codon change.

In Table B the minus or negative amino acid position numbers indi- O4 a a« cate changes between the Bam HI site and the one position Met at the beginning of the endotoxin clequence, such changes therefore not affecting the sequence of the endotoxin coded for by the mutant sequence.

The mutants identified in Table B, below, were evaluated in all three phases of the TBW Assay producing results as reported below in Table B-1. Various of these mutants were also evaluated in the T. ni Sassay, the results of which are illustrated below in Table B-2.

4 -16- 136-7067 TABL& B

MUTATION

SECTION

M- 1 M- 1 M- 1 a.

ata *4

I

4* I a 14 .0*q 4 9 9 9,4 91 9~ 9 a 4 4 4. 40 44 4 4.04 ~a a 9 4 OlD

MUTANT

p26-3 p48a14 p 48 c 5 p36a65 p95a76 p95a86 p98cl p99c62 p107c22 p107c25 p114a30

POSITION

AMINO ACID 119 230 201 101 116 217 116 187 122 125 123 188 188 204 105 4 194 94 184 -11 95 -15

CHANGE

NUCLEIC

GCA to ATG to GGC to GAA to GAG to CGT to GAG to GCG to ACT to GCA to MAT to ACT to ACT to ACA to AAT to MAT to M.T to MAC to TTT to TTG t:o CMA to TAT to IN ENDOTOXIN AREA ACID AMINO ACID ACA Ala to Thr ATA Met to Ile GAC Gly to Asp AAA Glu to Lys MAG Glu to Lys CAT Arg to His MAG Glu to Lys ACG Ala to Thr ATT Thr to Ile GTA Ala to Va'L TAT Asn to Ty;: TCT Thr to Ser TCT Thr to Ser ACT Th'c to Thr TAT Asn to Tyr TAT Asn to Tyr AAA Asn to Lys AAA Asn to Lys ATT Phe to Ile TAG AMA Gin to Lys TMA 94. 94 V 4. 4.

9 4.

a a 4.0 4 44 In Table B-1p below, the lower score in the toxicity column indicates the greater level i~f activity (see Example A for an explanation of toxicity scores) and the controls involved an equivalent amount of E.

coli JM103 cells and E. coli SG4044 cells which had not been transformed with any plasmid. It is noted that all mutant>s were indicated to be substantially more active than the truncated native endotoxin produced -17r 136-7067 by an equivalent amount of such cells containing the plasmid prAK.

TABLE B-1 0I ~e.

a a qa a o* 04 6 0 a o 0 UI~, 4 a eQ 0 ow w~ 04 a a 4 4, 0v S 4 ~J 0 .4 MUTANT WITH REFERENCE TO TABLE B p26-3 p48a14 p48c5 p36a65 p95a76 p95a86 p98c1 p99c62 pl07c22 pl14a30 control (JMlO3 cells) prAK control (SG4044 cells) TOXICITY SCORE MEAN TOXICITY 2.75 2.25 2.63 1.50 2.50 1.30 1.33 1.83 1.42 2.00 4.68 3.35 4.12 TABLE B-2 MUTANT WITH REFERENCE TO TABLE B p26-3 p36A65 p95a76 p107c22 p114a30 control (SAN415) pBT301

RELATIVE

POTENCY

217 887 291 357 239 59 100

N

A

In Table B-2 above, the standard, pBT3O1 is assigned a relative potency of 100, according to LD 50 (for a fuller description see Example -18- I- 1 I- -I 136-7067 and thus any relative potency value higher than this indicates an increased level of toxicity caused by the mutation.

In additional work in furtherance of the invention, certain of the mutant DNA shown by Table B above to involve multiple mutations were analysed to determine the effect of individual and pairs of mutations in such multiple mutated sections, Such sub-cloning of individual mutations or pairs thereof was carried out using a strategy involving the isolation of a targeted multiple mutated fragment and then cutting it at a restriction site internal to the fragment and located between two of the mutated codons. The two halves or fragment segments were then gel isolated and each mixed with non-mutant complementary halves or fragment segments obtained by similarly cutting the same fragments from prAK.

The prAK vector which had been cut to isolate the larger complementary fragment was then mixed with the two mixed complementary halves and all o* three DNA segments ligated together to form a modified prAK plasmid containing the piir! mutation or mutations existing in the fragment half originating from the multiple mutant clone. More particularly, a site for the restriction endonuclease Xho II was strategically located within certain multiple mutant segments so as to enable the isolation of frag- S ments having less than the total number of mutations in the total mutant S segment. As will be evident, the use of the endonuclease Xho II was S applicable to a number of the multiple mutant segments in Table B for purposes of obtaining fragments with a single point mutation and others with two mutations. Hence, multiple mutant plasmids were first treated AC AC with the restriction endonucleases Nsi I and Sst I and the resulting I 1430 base pair fragments separated by gel isolation. Each such 1430 bp fragment was then treated with the restriction endonuclease Xho II and the resulting 330 bp (Nsi I/Xho II) and 1100 bp (Xho II/Sst I) fragments gel isolated for each multiple mutant. Counterpart, non-mutant fragments of 330 and 1100 bp and the larger, approximately 4Kb Nsi I/Sst I fragment of prAK were then similarly obtained. More particularly, small quantities of the larger segment were mixed with the mutated 330 bp i I 136-7067 fragment and the non-mutated prAK 1100 bp fragment and the resulting mixture ligated to form a series of hybrid mutant plasmids of prAK. In a like manner, quantities of such larger prAK segments were mixed with the non-mutated 300 bp prAK fragments and the mutant 1100 bp fragments and these DNA ligated to form another series of hybrid mutant plasmids.

The hybrid mutant plasmids or clones resulting from the above indicated strategy are summarised below in Table C which shows the three segments combined and the mutations in the resulting plasmid compared to the plasmid prAK.

TABLE C SOURCE SOURCE NEWLY OF OF FORMED NsiI/ XhoII/ i prAK- XhoII SstI DESIG- VECTOR SEGMENT SEGMENT SEGMENT MUTATION AMINO NATION AND SOURCE 330 bp 1100 bp ACID POSITION SA prAK NsiI/SstI p48a14 prAK Glu to Lys 101 4 Kb Glu to Lys 116 B p26-3 prAK Ala to Thr 119 C p48c5 prAK Glu to Lys 116 D prAK p48a14 Arg to His 217 E prAK p26-3 Met to lie 130 Gly to Asp 201 prAK p48c5 Ala to Thr 187 0 In a second round of hybrid mutant clone preparation using the same analogous procedure applied in preparing the clones of Table C, a series of mixed combination mutant plasmids were prepared by the three segment combination of the large segment (roughly 4kb) from the digestion of prAK with Nsi I and Sst I, a 330 bp Nsi I/Xho II fragment from one of the clones of Table B and a 1100 bp Xho II/Sst I fragment from a differ- 1 136-7067 ent clone of Table B. The hybrid mutant 4ones resulting from this second round are shown below in Table being noted that two plasmids arising from this second round protocol contained four amino acid changes curipared t~ the parent prAK plasmid.

9* 0 000 0000 0 0 0* 0 *0 0 0 k 0 Ot 0000 0 ~o00 *9 00 00 0 0 0 0000 0 00 0 0 *0 0 0 0 00 00 0 0 0 0 00 00 00 9 0~ 00 0 0 00 0 00 -21- 136-7067 TABLE D SOURCE SOURCE NEWLY OF OF FORMED NsiI/ XhoII/ prAK- XhoiI SstI DESIG- VECTOR SEGMENT SEGMENT SEGMENT MUTATION AMINO NATION AND SOURCE 330 bp 1100 bp ACID POSITION prAK-J prAK Nsi/Sst p48a14 p26-3 Glu to Lys 101 4 Kb Glu to Lys 116 Met to Ile 130 Gly to Asp 201 prAK-K p48a14 p48c5 Glu t o Lys 101 Glu to Lys Q 116 Ala to Thr 187 prAK-L p48c5 p26-3 Glu t o Lys @116 M ~et t o 'ie 130 Gly to Asp Q 201 0 09 prAK-M p26-3 p48a14 Ala to Thr 119 Arg to His 217 prAI4-N p26-3 p48c5 Ala to Thir 119 Ala to Thr 187 prAK-O p48c5 p48a14 Glu to Lys 116 Arg to His 217 o o9 prAK-P p26-3 p36a65 Ala to Thr 119 Thr to I1' 122 9Ala to Val 125 prAK-Q IIp48c5 p36a65 Glu to Lys 116 Thr to Ile Q 122 Ala to Val @125 prKRp48A14 p36a5 Glu to LYs @101 prAK-S itp26-3 p95a86 Ala t o Thr @119 Thtr to Serz 188 pirAK-T flp48c5 p95a86 Glu t o Lys Q 116 Thr to Ser Q 188 _22- 136-7067 TABLAX D (CONT) SOURCE SOURCE NEWLY OF OF FORMED NsiI/ XhoII/ prAK(- XhoII SstI DESIG- VECTOR SEGMENT SEGMENT SEGMENT MUTATION AMINO NATION AND SOURCE 330 bp 1100 bp ACID POSITION prAK-U "p48a14 p95a86 Glu to Lys 101 Glu to Lys 116 Thr to Ser 188 prAI4-53 "p99c62 p107c25 Asn to Tyr 105 Phe to Ile 184 o prAK-68 Hp99c62 p26-3 Asn to Tyr 105 .~Met to Ile 130 a ly to Asp 201 "p26-3 p107c25 Ala to Thr 119 41 prAYK-39 "p99c62 p98C1l Asn to Tyr 105 Thr to Ser 188 Th aroshybrid mlut.ants shown in Tables Cand D weeevaluated according to the Tobacco Budworn Assay of Example A and the evaluation included the mutant clones of Table B for comparison$ inter alia, of the effect of essentially deleting or removing one or two mutations from the original mutants of Tablc B. The results of thzse toxicity or insecticidal activity evp~uations are reported below in Table E Wherein it is 0 noted; 1) the lover score In the toxicity column indicates the greater level of activity (see Example A for an explanation of scores); and 2) the controls involve an equivalent amount of JM1O3 cells and S04044 cells which had not been transformed with any plasmidp it being noted that most if not all mutants evaluated in both such types of E. coi cells and the muta~ht results in the tables herein which refer to both controls are to be ta-ken as an average of the results for the mutants expressed from both type cells.

-23-

'I

136-7067 TABLE E *9 #0* 4*0* 9 0* 9, 4 4. 9 9* 9 49 .9 4 S 9 Mutant with reference to Tables B, C or D Control p -2rAK

A

B

C

D

E

F

coli SG 4044 (Control)

J

p Toxicity score Average Toxicity 4.68 3.35 2.05 2 2.68 3 .40 2 3.00 4.12 2.25 2.06 2.08 3.10 2.73 2.70 1 .00 V 944 9 49 f* 4 94 9 9 9* 4* 4 4 4 0S L Q 1 .87 R 2.85 S 2.16 T 1 U 2.07 53 3.08 68 2.00 1.50 39 2.50 24 136-7067 The invention further includes a demonstration of the ability for general amino acid substitution at the amino acid positions at which the initial random DNA mutations produced amino acid changes, whereby a wide variety of novel insecticidally active B.t. endotoxin proteins are provided. This ability was demonstrated with relative ease by so-called "codon-spin" experiments in which selected codons involved in the initial mutation changes were changed to the codons for the other natural amino acids. These new mutants expressed an endotoxin protein having insecticidal activity against the Tobacco Budworm. In order to conduct such an investigation more efficiently, a series of unique plasmids of the prAK type were prepared starting essentially with prAK and culminating in the plasmid prAK-7, and other intermediate plasmids being sequentially in order of preparation prAK-3, prAK-4, prAK-5 and prAK-6, S as described in Example 1. The plasmid pB8rII as shown in Fig 2 is in all respects identical to the plasmid prAK except that it contains DNA coding for a truncated endotoxin somewhat longer than that coded for by prAK and except for inconsequential modifications in the parent plasmid Smade in the area of its ligation to the downstream end of DNA truncated endotoxin structural gene, said structural gene as shown in Fig 2 showing the Kpn I site in the native gene whereas in prAK the site is deleted and the prAK structural gene ends at about the former position S of said site. The plasmid prAK-7 is designed to express the same endotoxin amino acid sequence as plasmid prAK but has had its DNA sequence modified to include not only the Nrt I site of prAK-3, but also a Hind III, Mst II and BssH II site and in addition the Hind III site oiginally found in prAK is preferably removed. As more particularly indicated in Example i, the sequential order of preparation of prAK-7 from prAK S" and the addition or deletion of a site in each step may be summarised as follows:prAK prAK-3 (add Nru I) prAK-3 prAK.4 (add Hind III) prAK-4 prAK-5 (add Mst II) 25 ~~1 k 136-7067 prAK-6 prAK-6 prA1K-7 (add Bssfl II) (delete original Hind III) The above indicated sites were introduced about 40 base pairs apart ouch that an automated DMA synthesise. could be used effectively to make small double stranded4 DNM fragments which termInate at their two ends with nuc-egotides representing the complementiry residue of the restriction -site residues to be created in prAK-7 who.n It is cut with the two releva ;nt restriction endpnucleases. Such f ragments thereiore could be readily substituted into prAK-7~ b),v standard cutting and ligation procedures (see Example Pp inira) to provide a plasmid capable of expressing F~q endotoxin protein Identical to that of prAK except for the amino acid chang,- -,oded for by the synthesised fragmint sub3tituted into prAK-7 for Ihe corresponding fragment in prAK-7, as exemplified in Example 2 hereof, 9 9 *9.

'.99 9 9' 9 99 S 9.

9.

9~'9 9 4. iigs 3A and 3B represent two small double stranded DNA fragments prepared in accord with the above codon spin strategy to be substituted into the Hind III/H1st 11 section In prAK-7. The double stranded frag, o rnment sMiown in Fig 3A. was designed to produce any amino acid at amin to 600, acid position 116 in the i'runcated B.t. endctoxins expressed by the prAK plasmids by appropriate selection of the XXX codon in Rccord with the 9: genetic code. Similarly, the double strandod fragment shown in Fig 3B waa designed to produce an amino acid at anrlno acid pogition 1129 in the truncated B.t. endotois produced by the peAK plasmids by appropriate selection of the XXX codon in this fragment. As will be apparent, the other double stranded. fragment,9 required for substitution into the Spe I/Nru 1 location (a fragment span of abouit 115 baF?, pairs 'Which also preparable by automated DNA synthesisers), the Nru I/Hind IIT location.

and the 'Ist II/BssH II location in prAK. and designed to ci, 1, for all amino acids at all points of mutation found in these s-e!ctions may be prepared bir analogous standard procodures, Hence, the remaining 18 of the 19 natural amino acid claanges or mutations to be made at e~jch point 26 s i i "*U3L "r~--rr-*iL 136-7067 of mutation between the Nru I and BssH II sites in prAK-7 may be readily made using plasmid prAK-7.

To cover all of the points of mutation within the 116 amino acid concerned sequence for conveniently spinning of relevant codons, the plasmid prAK-7 may be used to prepare plasmid prAK-8 which in turn is used ultimately to prepare prAK-9, as described in Example 1. In Fig all of the relevant restriction sites as ultimately accumulated in prAK- 9 are shown in an expanded cut-away section of prAK-9. The Spe I site shown in Fig 5 is also a unique site which was already present in prAK, prAK-3 etc. As will also be appreciated, the plasmids prAK-7, prAK-8 and prAK-9 may be used to introduce multiple mutation changes between any one pair of restriction sites and/or to produce DNA coding for at least one change within two or more such locations, such that a large variety of multiple mutant combinations involving original points of mutation found in accord with the invention may be constructed to pro- O duce a large variety of new insecticidally active B.t. endotoxin proteins.

As will also be appreciated, plasmids such as prAK-7, prAK-8 and prAK-9 are fully capable plasmids for Thanging any one or more codons within any of the restriction site pair locations provided in these plasmids. Where changes are desired within one or two but less than three such locations, plasmids such as prAK-4 or prAK-5 may be used if covering the desired location of changes, preferably after removal of the original Hind III site in prAK, and if such plasmids are not suitable, it will be appreciated that a prAK type plasmid containing any 4 6 e one or more of such locations may be prepared conventionally by varying or limiting the selection for introduction of the restriction site pairs used to modify prAK in producing prAK-9. Hence, the invention provides also a variety of novel plasmids useful for production of mutants and mutant combinations in accord with the invention and containing any one or more of the restriction site pairs ultimately produced in prAK-9.

27 136-7067 As will also be appreciated, DNA comprising any one or more such restriction site pairs may be excised, before or after modifying to contain one or more mutations in accord with the invention, from the prAK type plasmids by cutting at restriction sites which are outside the desired mutation region(s) and which are correspondingly found in another plasmld for a B.t. endotoxin, and then inserting (ligation by standard means) the excised DNA segment into such other B.t. endotoxin plasmid which has been similarly cut, thereby enabling such other plasmids to be conveniently modified or for purposes of directly inserting the mutations of the invention therein.

For purposes of incorporating mutations provided by the invention into a full length endotoxin coding sequence, a plasmid incorporating the DNA structural gene for the 6-endotoxin of B.t wuhanensis was used as a matter of convenience and ready availability at the time. This plasmid, pBT210, is shown in Fig 4. The plasmid pBT210 incorporates the p. full length endotoxin structural gene from B.t. wuhanensis as indicated by the thick dark line in Fig 4, and by analogy to Fig 1, also incorporates a sequence containing a B.t. ribosomal binding site which was obtained from Bt. wuhanensis along with the structural gene and which is o indicated in Fig 4 by the dark box. The plasmid pBT210 is a fully competent E. coli expression vector including the same E. coli promoter system as the prAK plasmids, an E. coli origin of replication (not rhown) and a gene for chloramphenicol resistance as indicated in Fig 4.

The arrows in Fig 4 show the reading direction of the B.t. wuhanensis o. gene under control of the E. coli promoter and of the gene for chloram- S phenicol resistance. Based upon sequence information in our possession, the entire operon (structural gene, B.t. derived ribosomal binding sequence section and E. coli promoter/operator sequence) is very similar and only insignificantly different from the operon in the plasmid prAK.

In particular, the DNA coding for the 610 amino acids of :he active portion of the B.t. endotoxin (Table A) and extending into thb protoxin region at least about up to the Kpn I site shown in Fig 4 for pBT210 is 28 136-7067 identical to the corresponding DNA sequence in the plasmid prAK. In the DNA region downstream from the Kpn I site in the B.t. structural gene in pBT210 to the end of such structural gene there are unknown but minor differences compared to the corresponding section of the B.t. kurstaki HD-1 gene truncated in making prAK. These differences were indicated by restriction endonuclease mapping. The plasmid pBT210 codes for a full length endotoxin as shown in Table A and is completely homologous in the active portion (and through at least the amino acids produced up to its Kpn I site to the 6-endotoxin from B.t. kurstaki HD-1 in clones prAK and pB8rII), and has substantial homology in the balance of the protoxin section. Finally, the ribosomal binding site in pBT210 is identical to that in prAK and the entire DNA including the ribosomal binding site (RBS) and extending upstream from just before the initiation Met back through the Bam HI site joining the promoter section are the same in pBT210 and in prAK except that in pBT210 there are two nucleotide changes immediately after the Bam HI site (CC instead of GT as in prAK) and «o three nucleotides (TTT) as found in prAK immediately after such two nucleotides are deleted in pBT210, these differences coming merely as a result of different ligation strategies in joining the RBS sections from B.t. to the E. coli promoter section through a Bam HI site. The plasmid *o pBT210 may be used to produce full length mutant B.t. 6-endotoxin protein having any one or more of the amino acid changes provided by the present invention. The Nsi I site, the two Xba I sites, the Sst I site and the first appearing downstream Hind III site shown in Fig 4 for pBT210 correspond to the same sites shown in Fig 1 for prAK (the DNA for j both plasmids in this region being identical as above indicated).

4 2' -29 S136-7067 EXAMPLE A 1. Trichoplusia ni ni) assay Tests were performed on second instar larvae. All insects were kept in climatic chambers under standard conditions of temperature, humidity etc throughout the test period, and were fed on a standard artificial diet. Test substances were given to the insects as part of the diet, with each concentration of test substance being administered to one batch of twenty insects. Insects were monitored for a period of 7 days after treatment, after which time the LDso of the insects was taken.

LD

50 may be defined as an estimate of the dose of substance required to induce mortality in 50% of the subjects. Final results are given as relative potency, wherein; •.99 relative potency LD 5 0 of standard x 100

LD

5 of experimental 9• Using the above technique the absolute values of LD 50 can be provided wherein interpretation of the results is simple, such that all a relative potency values higher than that of the standard indicate an 0 0 a 9 activity higher than that of the standard. Furthermore a substance with a relative potency of eg 400 when compared to a standard of 100, is 4 times more active than the standard.

The standard, having a relative potency of 100 in the above test, S was the plasmid pBT301, which plasmid contains a full-length wild-type -endotoxin sequence, being identical to pBT210 except for containing ~two E. coli promoters, each of which individually is ta same as that contained in pBT210.

Controls used in the above test were; 30 136-7067 a) CAG 629 an E. coli strain containing no 6-endotoxin producing plasmids and having no insecticidal (gift from C A Gross, Department of Bacteriology, University of Wisconsin). activity per se; b) SAN 415 a commercially available B.t. insecticide, obtainable under the registered trade name JAVELIN.

2. Tobacco Budworm assay (TBW assay) The TBW assay employed was that basically described by Dulmage et al, (1971) J. Invertebr. Path. 18 240-245, and was performed with samples done in triplicate in 1 ounce clear plastic souffle caps, with one S 2nd instar TBW larva (4 to 5 days old, average weight 1.6 gm) in each cup. The samples were combined with 15ml diet (comprising the Nutrient Powder, Vitamin Powder, agar and other ingredients) as described by SDulmage et al, USDA Technical Bulletin No. 1528:1-5 (1976). The diet was divided evenly among three cups which were allowed to cool for Y2 hour. One TBW was added (using a size 00 camel hair brush) to each cup and the lids were securely snapped on. These samples were then placed in a 27°C, 50% relative humidity incubator for 4 to 5 days. The size group numbers used in scoring the TBW toxicity assay correspond to the weight ranges given in the following table.

*o 0^ 04 31 136-7067 GROUP SIZE WEIGHT RANGE AVERAGE WEIGHT (mg) (mg) 1.3- 1.9 1.6 2.7- 3.1 2.8 5.5- 6.3 5.8 11.7- 12.3 12.0 17.3- 22.2 19.6 30.8- 34.2 32.8 50.1- 52.4 51.1 76.6- 94.3 84.8 119,9-114.7 113.5 119.8-134.3 >140.0 The "Group Size" indicated above equates directly to the toxicity scores reported herein. Hence, the weight of the larva after each test was determined, and assigned the toxicity score equal to the group corresponding to the Sweight range into which its weight fell. Except as noted, infra, all dead larvae were assigned a group size and toxicity score of zero. The toxicity scores from all replications were averaged to obtain the results reported 9" herein, and typically all results are based on at least replications.

0 6 0 a 32

*I

i i -3~ 136-7067 a.

4 *4 4* a eqo *r a i 4 a a .44 ar a Q 44o a 4 P a 4 4, 44; 4 bi The cups were opened until ranges of different size TBWs were located. These TBWs were weighed out until one TBW was located that fell within every weight range. The sample cups containing the TBW of the given weight range were then marked with the corresponding group size number. These cups were then arranged in ascending order on the lab bench. The remaining samples were then scored by visual comparison of size with the weighed sample TBWs and assigned that group number on a score sheet. Dead larvae were recorded with a and assigned a score of zero. Dead larvae which were bright pink or appeared to have liquified were suspected to have died from causes unrelated to the a-endotoxin. These larvae were scored with a and not counted in the results.

The standard sample size of 1 ml. of a prAK culture divided among three cups resulted in growth retardation in the middle of the range of toxicity scores. Therefore, the assay was useful in distinguishing the clones with increased toxicity from the ones with reduced or equal toxicity to the nonmutant parent. The assay produced a dose response depending on the amount of prAK culture put into the assay.

Hence, the greater the amount of prAK-containing bacteria that was added to the samples, the greater the degree of toxicity to the TBW was observed. The dose response curve of prAK waa useful in evaluating the degree by which clones were more toxic than the nonmutant parent. The following table illustrates the dose response of the prAR-containing bacteria: Amount of prAK Stationary Culture Added ml 2 1 0.25 Toxicity Scores 1 .5 1.5 2 2.5 3 3 3 3.5 4 3.5 4 4 33 136-7067 SOn the basis of the above evaluation, all cultures were assayed using 1 ml. of culture in order, in relation to the obtained group sizes, to allow an ample range to ascertain those with greater or less activity relative to prAK (and other nonmutant plasmids) as a standard.

The Nutrient Powder used in the TBW Assay was mixed in the following gram weight proportions: soybean flour, 1103.4 wheat germ, 429.4 Wesson Salt Mix, 292.4 g.; sucrose, 164.2 methyl parabenzoate, 24.6 and sorbic acid, 14.8 g.

The Vitamin Powder used in the TBW Assay mixed in the following gram weight proportions: calcium peutothenate 12.O Nicotinamide, 6.0 Riboflavin, 3.0 folic acid, 3.0 thiamine Hcl, 1.5 pyridoxine Hcl, 1.5 g.; Biotin, 0.12 and Vitamin B12, 6.0 g.

The following three screening applications of the TBW s Assay (Primary, Secondary and Dilution-Series) were employed 6 at various stages of evaluation, and are referred to in this specification.

Primary Assay: One ml aliquots from 18 hr cultures of two separate clones were combined in with TBW diet in a ml conical centrifuge tube and divided evenly between three cups (with one TBW per cup). These samples were evaluated alongside controls of wild type prAK or pBT210 transformed cells and untransformed cells prepared in the same manner.

0. 64 Secondary Assay: Samples which displayed increased S toxicity toward the TBW's in the primary assay were screened in a second assay. Selected mutant colonies were innoculated from the library plates into YT/Amp broth (one colony per culture). Ten 1 ml samples were evaluated along with appropriate controls. Clones exhibiting increased toxicity to TBW's were designated as "probable up-mutants" and were evaluated a third time. Those that repeated their "up" phenotype a third time were ident. .ied as "up-mutants" and evaluated in a Dilutioi-Series Assay to more precisely 34 r I 136-7067 determine level of enhanced activity versus the parent wild type.

Dilution-Series Assay: Mutants confirmed to display an "up" phenotype over the non-mutant construction were screened in the TBW assay in a dilution series based on dry weight of lyophilized bacterial cells that contained either the mutant or wild type toxin from prAK or pBT210 clones that were grown for 18 hours (and the cells pelleted prior to lyophilizing). Samples were set up in triplicate at each of the following dilutions in a final volume of 15 ml: 167pg/ml, 67pg/ml, and 33ug/ml. SDS-PAGE and Western (immunoblot) analysis was performed on the protein from these mutants, typically at 75 pg dry weight cells per lane.

Theo Dilution-Series results essentially confirmed the results of the previous assays and are not otherwise reported herein or averaged in the Tables hereof which report biological results.

4 4 e I 04 04 *4 on 14 4' 0 EXAMPLE P REGULAR PROCEDURES In the following numbered examples or otherwise in this specification the following regular or standard laboratory procedures were used where referenced to the following or a 0: otherwise required, unless the text hereof indicate otherwise.

0.

00 4 4 04'r 4 0 p O Example P-1: Maintenance and Growth of Bacterial and Phage Strains E. coli strains SG4044 and JM103 were host for all plasmid constructions. E. coli strain JM103 and the phage M18 and MP19 were obtained from New England biolabs. These bacterial strains were grown in YT medium (5 g/l yeast extract, 10 g/1 bactotryptone, 5 g/1 Na Cl). Medium was supplemented with 50 mg/1 ampicillin for growth of cells containing prAK or derivatives of this plasmid and with 35 136-7067 mg/ml chloramphenical for cells containing pBT210 or derivatives of this plasmid.

Example P-2: Propagation and Isolation of Phage DNA Preparation of M13 derived recombinant phage stocks and isolation of phage DNA was done using previously described procedures (Messing, J. (1983) Methods Enzymol. 101:20-78).

Example P-3: Preparation of Synthetic Oligonucleotides Synthetic oligonucleotides were prepared using automated synthesis with an Applied Biosystems (Foster City, CA) 380A DNA synthesis machine.

Purification steps once the cycle was complete were as follows. The synthetic oligonucleotide was deblocked by adding an equal volume of ammonium hydroxide and incubating at 55°C overnight, After removing the ammonium hydroxide by successive rounds of speed-vacuum centrifugation and 0° resuspensions in distilled H 2 0, the oligonucleotide was further purified by urea-polyacrylamide gel electrophoresis t 0 (Urea-PAGE). To visualize the band the gel was placed on a o twin layer chromatography plate covered with Saran wrap and the oligonucleotide was illuminated with short wave ultraviolet light. After cutting the cligonucleotide 0 d cont-ining portion of the gel with a razor blade, the oligonucleotide was eluted from the gel in 0.5M ammonium acetate, ImM EDTA, pH 8.0 at 373C overnight with agitation.

After eluting overnight, the gel fragments were pelleted at 6000 RPM in a JA20 rotor and the supernatant containing the eluted oligonucleotide was transferred to a fresh tube.

ETOH precipitation was used to concentrate the oligonucleotide and it was quantified by absorbance at O.D.

260. 200 pmol of the oligonucleotide was kinased in a 40 l reaction with 2 units of T4 polynucleotide kinase and 0.05mM

ATP,

36 136-7067 Example P-4: DNA Transformation of E. coli cells A) E. coli JM103 or SG4044 competent for DNA transformation were prepared as described by a commonly used procedure (Cohen, Chang, A.C.P. and Hsu, L. [1972] Proc. Natl. Acad. Sci. USSA 69:2110-2114). For site-directed oligonucleotide mutagenesis experiments, heteroduplex recombinant phage (M13) DNA (60ng) was added to 0.2 ml of competent cells and held at O'C for 15 minutes.

The cells were subsequently held at 42"C for 2 minutes and 30 pl of this mixture was added to 3 ml of YT broth containing 0.7% bacto agar held at 420C. to prevent o" solidification and 0.2 ml of a fresh overnight culture of JM'03 or SG4044. The mixture was immediately spread on a YT agar plate (YT broth plus 1.5% bacto agar) and the plates 0 (inverted) were incubated overnight at 37'C.

B) Plasmid DNA (100ng) from mutagenesis experiments or any other ligations involving prAK or pBT210 vectors as described herein was added to 0.2 ml of competent cells a 0 o 0" (JM103 or SG4044) and held at O'C for 30 minutes. The cells 0, 0 were subsequently held at 42'C for 2 minutes and returned to 0 an ice bath. Amounts from 2 Pl to 200 pl were plated on YT agar containing 50 pg/ml ampicillin for clones based on prAK and 20 ug/ml of chloramphenicol for clones based on pBT210 0. and incubated overnight at 37*C.

Example Restriction Enzyme Digestion All restriction enzymes were purchased from either Bethesda Research Labs (Gaithersburg, MD) or New England Biolabs. Incubation conditions were those recommended by the manufacturer.

37 l. l m 136- 7067 Example P-6: Ligation of DNA Fragments A) DNA ligation reactions (20 pl.) contained 60 mM Tris-liCi, pH 7.5f 10mM MgCl2, 1 mM dithiothreitol, 50 PM ATP, 20 nM DNA~ termini and 20 units T4 DNA ligase (New England biolabs) Incubation was at 14*C for 4 hours.

B) Three fragment ligations were set up with fragments present in a 1:1:1 molar ratio at a concentration of 0.04 pmole each in a 20 ul reaction volume. Incubation was at 160C for 4 hours whe;i ligating only a sticky end (eg. XhoII :0.

*00 internal site) or overnight for ligating any blunt end (eg.

a FnuD2 site). New England blolabs (NEB) T4 Ligase was used 0 0 at a concentration of 10 units (NEB definition) per ?l reaction volume.

ExampleP-7: DNA Seauencing ONA sequencing of D-endotoxin genes and their derivatives was done by the chain termination method of 0004de Heidecker et al.. (Heidecker, Messing, and 04 0 Gronenborn, B. t19801 Gene 10:68-73).

EXAMPLE 1 Preparation of Vectors prAK-3# prAK-4, prAK-5', prAK-6 and p step a) Preparation of prAK-3 1 ug of the plasmid pB8rII (shown in Fig. 2 and described above) and the replicative form of DNA from the well-known M13 phage cloning vectors MP18 and MP19 were simultaneously digested with the restriction endonucleases Bam H! (8 tvnits) and Kpn I (10 Units) for 60 minutes at 370C in 100 mM so'lum chloride buffer solution also containing 6mM Tris-HC. (pH 7.9)t 6 MM MgC12, 100pyg/ml bovine serum -38 136-7067 albumin. Desired fragments from these resulting DNA mixtures were purified by running the entire mixture on a 1% preparative agarose gel to. separate according to size.

Bands were visualized by staining with ethidiumn bromde and illuminating with long wave ultraviolat light The gel fragment containing the desired DNA was cut and the DNA eluted by electrophoresis in dialysis tubing. The Bam HI/Kpn I fragment from pB8rII was ligated into the mp18 and mp19 Bam HI/Kpn I cut and gel purified vectors by incubating for 4 hours at 14*C. in a total volume of 20 1 containing 60 mM Tris-Hcl, pH 7.5, 10 mM MgC12, 1 mM dithiothreitol, mM ATP, 20 nM DNA termini. The resulting DNA was transformed to competent E. coli JM 103 cells as in Example P-4 except that the YT plates contained isopropyl thiogalactqside (IPTG) and 5-bromo-4-chloro-3-indolyl- Se -D-galactoside (X gal), both obtained from Sigma Chemical Company. Since recombinant phage (containing the DNA insert cut from pB8rII) will make clear plaques under these Sconditions, whereas M18 and M19 make blue plaques, the clear plaques were added to 2 ml of E. coli JM103 cells in YT broth, incubated overnight at 37*0 and single stranded DNA was prepared from the phage following the procedure as described by J. Messing, J. Methods Enzymol. (1983), a 101:20-78. These desired clones containing the large but S single stranded DNA inserts from pB8rII were identified S using agarose gel electrophoresis by virtue of their slower mobility as compared to mp18 or mp19 9 Sequencing of a portion of these clones that included the endotoxin DNA by the dideoxy chain termination method confirmed the presence of the endotoxin DNA and indicated that mpl8 had acquired the antisense stand thereof and that mp-19 had acquired the sense strand thereof, both of which were recovered. A 26 base antisense oligonucleotide having the sequence GTC CTT CTA ATC GCG AAA TGG CTT GG 3 was prepared by solid phase synthesis in the automated DNA 39 136-7067 synthesizer, an~J kinased w7ith T4 polynucleotide kinase and ATP as desc'ribed by Maniatis et al., Molecular Cloning (1982): Laboratory Mtanual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. A mixture in total volume of GO wil. containing 0.4 pg. of the recombinant phage mnpl9 con.~taining the endot*)xin sense strand, 20 mM Tris-Hcl, pH 7 mM MgC1 2 lmt i dithiothreital, 50 mM sodium chloride and 11 of the 26 base antIsense oligonucleotide was 'heated at 680C. for 15 minutes, then at 370C. for 10 minutes and plac;24 at 0'C. ri,,e resulling mixtuire con- aining the mP19 rec(,b-Lnant DNA with the mutagenic oligo annealled was ::then tre."ed by additiin of 0. Mo each of dATP, dCTP, dlTP and dT,1mofATP, 4uisof DNA Polymerase I Kienow fragment (from New Englan~d Biolabs), 0.5 lWg of E.

coli single, strand binding protein (from Pharmacia, 9 9 Piscatawayf and 20 units T4 DNA ligase (New 4ngland Biolabs). The resulting mixture was incubated at 140C, for 04 hours for polymeri'zaticn anid li.gation to occur and the 0 resulting circular doule stranded heteroduplex DNA was 0 '004 transformed into E. zoli JM103 and plated as described in Example P-4. Twenty (20) individual plaques were then selected and single strand DNA isolated from the phage as described by Maniatis et al., supra. DNA from phage of the twenty (20) plaques each in a total volume of 20 1 and containing 50 mM Triz.Hcl, pH 8.0, 50 mM KClf 10 MM MgCl 2 1 0 10 ng of the above-indicated antisense 26 base oligonucleotide rn~i 0.2 pig of different circular single strand phage DNA~ molecules were each heated at 680C. fo minutes and p'aced at 37*C. for 10 minutes. The restriction endonuclease Nru 1 (8 units) was added to each resulting mixture and incubation at 37*C was continued for 1 hour.

The mixture was electrophoresed through a 0.8% agarose gel.

About 10% of the samples con~tained DNA migrating as linear DNA to enable the identification of the positive clones containing the desired Nru I site, and positive clones were 40 136-7067 transformed into E. coli JM103 to ensure purification. DNA between the Barn HI and Xba I site in the positive clones was excised therefrom (after annealling with m13 sequencing oligo and polymerizing to make double stranded as described above for the Nru I oligo) by simultaneous cutting with the endonucleases for these sites and ligated (Example P-6A) with the large fragment (about 5004 base pairs and missing the about 749 bp fragment between the Bam HI and the second Xba I site in prAK) which was obtained and gel purified after complete digestion of prAK simultaneously with the 0, o same two restriction enzymes, all in a conventional manner to form the plasmid prAK-3.

A 0 P Step b) Preparation of prAK-4 Following the essentially total procedure which is analogous to Step above, the single stranded phage DNA obtained in Step a) was annealed to a 25 base synthesized antisense oligonucleotide having the sequence o 1 5, CCACTCTCTAAAGCTTTCTGCGTAA 3 designed to introduce the Hind III site between nucleotide position number 327 and 351 in the Table A nucleotide o sequence. Positive clones now having both the desired Nru I and Hind III sites were identified in a frequency of about 6.6% by cleavage evaluation with the nuclease Hind III, and were used to prepare prAK-4 by ligating the Bam HI/Xba I fragment with the new sites to the 5004 bp large fragment from prAK in the manner of Step a).

Step c) Preparation of Following essentially the total procedure which is analogous to Step the single stranded phage DNA obtained in Step above, was annealed to a 26 base synthesized antisense olegonucleotide having the sequence GCATCTCTTCCCTTAGGGCTGGATTA3 designed to introduce the Mst II site between nucleotide 41 136-7067 position number 366 and 391 in the Table A nucleotide sequence. Positive clones now having all three of the desired Nru I, Hind III and Mst II sites were identified in a frequency of about 9.1% by cleavage evaluation with the restriction enzyme Mst II, and were used to prepare Step d) Preparation of prAK-6 Following essentially the total procedure which is analogous to Step above, the positive double stranded phage clones from Step above, were converted into single stranded phase DNA and annealed to a 26 base synthesized antisense oligonucleotide having the sequence *q S. 5 1 GCGGTTGAAGCGCGCTGTTCATGTC3 *o a. designed to introduce the Bss HII site between nucleotide :.Oo position number 406 and 431 in the Table A nucleotide sequence. Positive clones now having all four sites ultimately desired in prAK-7 were identified in a freqency of about 12.5% by cleavage evaluation with the enzyme Bss HII, and were used to prepare prAK-6.

Step e) Preparation of prAK-7 Following essentially the total procedure which is analogous to Step above, the single stranded phage DNA obtained in Step above, was annealed to a 26 base synthesized antisense oligonucleotide having the sequence TACAGTCCTAAATCTTCCGGACTGTA3 designed to eliminate the Hind III site between nucleotide positions number 1682 and 1707 in the Table A nucleotide sequence. Positive clones representing the total sequence desired ,or prAK-7 were identified in a frequency of about 2.8% by restriction endonuclease screening of the replicative form (double-stranded) of the recombinant phage DNA for the loss of the Hind III site between nucleotides 1682 and 1707. Double-stranded DNA isolated from the mutant was used to prepare prAK-7.

42 i I 136-7067 To complete the provision of a plasmid (prAK-9) having suitably unique and spaced restriction sites for conducting codon spin experiments at other points of mutation between the two Xba I sites the development of the prAK series plasmids may be continued analogously to the following steps to prepare a plasmid prAK-8 and therefrom prAK-9 as indicated below in Steps f) and g).

Step f) Preparation of prAK-8 Following essentially the total procedure which is analogous to Step above, the single stranded phage DNA obtained in Step above, was annealed to a 27 base synthesized antisense oligomer having the sequence: 5'TCCCCACCTTTGGCCAAACACTGAAAC 3' o* designed to introduce a Bal I restriction site at about nucleotide position number 534 in the Table A nucleotide sequence. Positive clones (prAK-8 now having all. five of the desired Nru I, Hind III, Mst II, BssHII and Bal I sites and missing the Hind III site removed in preparing prAK-7 o are identified in the manner of Step above.

Step 9) Preparation of paAK-9 Following essentially the procedure which is analogous to Step above, the single stranded phage DNA obtained in Step above, was annealed to a 30 base synthesized antisense oligomer having the sequence: "t 5' GTTGCCAATAAGACGCGTTAAATCATTATA 3' designed to introduce a Mlu I restriction site between nucleotide position number 588 and 595 in the Table A nucleotide sequence. Positive clones now having all six of the desired Nru I, Hind III, Mst II, BssHII, Bal I and Mlu I restriction sites and missing the Hind III site removed in forming prAK-7 are identified in the manner of Step a) a d denominated as plasmid prAK-9.

As will be evident, cassette DNA suitable for substitution between the Bal I and Mlu I sites in prAK-9 may be appropriately coded to introduce all possible codon and 43 -ii 136-7067 amino acid variations at the mutated amino acid positions 184, 187, 188 and 194.

In a like manner, cassette DNA suitable for substitution between the Mlu I and second Xba I site may be appropriately coded to introduce all possible codon and amino acid variations at the mutated amino acid positions 201 and 204.

Fig. 5 is a schematic representation of the unique restriction sites introduceable between the two original Xba I sites found in prAK (the first such Xba I site in prAK-9 now being the Nru I site).

S a Underlining in the antisense oligonucleotides shown above in the various steps of Example 2 indicates the change or changes to be introduced.

4 EXAMPLE 2 Codon Spin Experiments A) Single stranded oligonucleotides having the sequence SO*o of each of the two strands shown in Fig. 3A 3B were prepared as described in Example P-3 with the DNA synthesizer programmed to randomly insert all of the 6 o0 nucleotides A, T, C and G at each of the X-positions in each strand shown in Fig. 3A. A total of approximately 200 ug (after purification) of DNA from each run on the machine S, such single strands (representing a family of oligonucleotides identical except at the X-positions of each strand, were prepared by such procedure. 10 pmoles of each strand, sense and antisense for each codon spin were en masse combined and annealled by heating at 68'C for minutes, then at 37'C. for 10 minutes, cooling to room temperature and placing on ice. The resulting mass of double stranded oligomers conforming to the DNA shown in Fig. 3A was judged to contain at the XXX positions (amino acid position 116) every combination permitted by the genetic code including stop signals and multiple but varying 44 136-7067 numbers of codons for each of the 20 natural amino acids plus stop signals. 1 pmole of these double strand oligomers or cassettes were then kinased with T4 polynucleotide kinase from New England biolabs and mixed en masse with the larger fragment (present at a 10 fold less molar concentration) obtained by gel isolation after the simultaneous cleavage of the plasmid prAK-7 with the restriction endonucleases Hind III and Mst II in 100 mM NaC1 10 mM Tris-HC1 pH 7.5, 10 mM MgC1 2 10mM 2-nercaptoethanol and 100 pg/ml BSA, and the resulting mixture was subjected to ligation in accord with Example An aliquot (5 ul) of the resulting ligation mixture was then used to transform E. coli JM 103 under the conditions of Example A number (200) of the 04 resulting transformed cells individually were subjected to 0" the TBW and T.ni Assays (withoit prior knowledge of what codon at XXX was in any particular clone) arid found to produce an activity level fairly indicating that all of the various different mutants had resulted in an insecticidally active ~protein product having activity of at least about that of a: the control truncated endotoxin, with clear up-mutants control) also indicated. Prior to this, random cells from the transformation were also selected, plated and colonies grown as in Example P-1 to isolate plasmid DNA for DNA sequence analysis by cloning the Barn HI/Xba I fragment into the sequencing vectors mpl8 and mp19 cut with the same a enzymes. The DNA in the region of each of eleven (11) such position -116 mutations and the identified up-mutants was then sequence to determine the amino acid coded for at its 4 116- position. It was found that one of the two up-mutants was the original up-mutant (116-Lys, but coded for by AAA).

The other up-mutant was found to 116- Arg coded for by CGT.

One of the other clones was found the native 116-Glu (but coded by GAA). Seven of the other light mutants were 116-11e (ATT), 116-Cys (TGC), 116-Leu (CTC), 116-Asp (GAT), 116-Asn (AAC), 116-Ile (ATT) and 116-Gly (GGA), all unique 45 i I: 7T--^YI i 136-7067 except the new 116-Ile (ATT) was represented by two of the clones. The final clones coded for 116-STOP (TGA).

B) The procedure of part A) of this Example 2 was repeated for amino acid position-119 using the DNA shown in Fig. 3B. Again, the random evaluation of a large number of resulting clones produced an activity level in the TBW and T.ni Assays fairly indicating that all mutant clones in the pool were active. (The of inactive molecules was approximately equal to what frequency of STOP codons UAA, UAG, and UGA would be expected from the random input by the machin. of the nucleotides at the XXX positions). Seven randomly selected individual clones were each indicated to have an activity level at least approximately that of the truncated no native sequence endotoxin produced by prAK, but none was an up-mutant by our arbitrary standard. Sequencing of the Sseven individual clones showed that they were all different and unique, as follows: 119-Leu (CTA), 119-Tyr (TAC), 119-Asp (GAT), 119-His (CAT), 119-Pro (CCA), 119-Ile (ATT) and 119-Ser (TCT).

4 a 0 EXAMPLE 3 9 0 Mutant Full Length B.t. Endotoxin a 0 The plasmid pBT210 (1 ug) was simultaneously cut with Srestriction endonucleases Bam HI (8 units) and Sst I (8 units) for 60 minutes in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 7.9) 6mM MgCl 2 and 100 pg/ml bovine serum albumin. The larger fragment of about 7180 base pairs was gel purified for use as a vector.

Then one pg of plasmid prAK-26-3 involving the mutations Ala--->Thr 119, Met--->Ile 130 and Gly--->Asp 2C'1 was also simultaneously cut with the restriction endonucleases Bam HI (8 units) and Sst I (8 units) in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 46 136-7067 6mM MgC1 2 and 100 pg/ml bovine serum albumin.

The smaller fragment of about 1,428 base pairs containing the mutations as well as the B.t. RBS section was gel purified and such fragment in an amount of about 0.06 p moles was combined for ligation with 0.02 p mole of the 7180 base pair vector fragment above obtained and joined together in 20 1 of ligation medium containing 60 mM Tris-Hcl, pH 7.5, 10 mM MgC12, imM dithiothreitol, 50 MATP, and 20 units of T4 DNA ligase, and the resulting mixture r: incubated for 4 hours at 14'C. The resulting plasmid, ,ao designated pBt 26-3, was transformed into E. coli JM103 by adding 5 ul of said ligation mixture to 0.2 ml. of competent 4 9O SE. coli JM103, holding initially at O'C for 30 minutes and 0 then pulsing at 42'C for 2 minutes and returning to ice.

ro. Various amounts (2 ul, 20 jul, and 180 jl of ,he resulting mixture was then immediately spread on YT agar plates with pg/ml chloramphenicol (YT broth plus 1.5% bacto agar) and the plates incubated overnight at 37'C. inverted. Only a 9 0, 9* transformed cell with chloramphenicol resistance could grow on these plates. Chloramphenicol resistant colonies were 00 9 S0. grown in liquid culture overnight at 37°C and plasmid DNA was prepared for restriction digestion with EcoRI reagents and DNA sequencing to actually determine the presence of the Sa" point mutations. Successful transformants containing the plasmid pBT 26-3 were then evaluated in the TBW and T.ni Assays.

Proceding analogously to Example 3, above, the following additional full length mutant endotoxins were prepared and evaluated in the TBW and T.ni Assays. Table F below indicates the additional full length mutant endotoxin producing plasmid/cell systems that were so prepared, all with the approximate results of their evaluation in the TBW Assay and the approximate results obtained in such assay for the product of Example 3, above, the B.t. Wuhanensis native endotoxin produced in E. coli JM103 and a control involving untransformed JM103 cells.

47 ;i I 136-7067 TABLE F 4.

44 44* 4444 o 44 44 4 *4 4 44 44 $444 4 44*4 44 .4 44 4 0 4 944* 44 44 4 44 44 4 4 44 44 4 4 44 4 44 44 44 44 4 4 4 44 4 4 4 4 44 Example No.

3 3-A 3-B 3-C 3-D 3-E New Mutant Full Length Plasmid Identification p BT 26-3 p BT36 a65 pBT-C pBT-E p BT -Q pBT-R source of Mutant Barn HI/ Sst I sequence prAK-26-3 prAK-3 6a6 _prAK-C prAK-E prAK-O prAK-R Actual Mutation(s) Involved 1 19 -Th r 1 201 -Asp 1 22-Ile 1 11 6-Lys 1 30-le 2Q 1 -Asp 1 16-Lys 21 7-His 1 01 -Lys 1 16-Lys 122-le 1 25-Val TEW Assay Toxicity Score 2 2 2 2 I 4~ I 3-F 3 -G 3-H 3-I 3-J 3-K 3-M PBT9801 PBT -B pBT-D.

pBT-F pBT-J pBT-M p8T-N p BT -S prAIK-98cl prAK-B prAK-D prAK-F prAK-J prAK-4 prAK-N prAK-S 1 88-Ser 11 9-Thr 217-His 1 87-Thr 101 -Lys 1 16 -Lys 130-le 201 -Asp 1 19-Thr 217-His 1 19 -Th r 1 87-Thr 1 19-Thr 1 88-Se r 2 2 3 3 48 r 136-7067 TABLE F (cont. 1* V a, a a *.a .ae a a a *4 *a a a a a a.

*~aa a a aa*a at at a a a a a a a a. a 44 a a 4 a 4~ a. a a .4 a. a a a a a a.

a a a a *a* Example No.

3-N 3-o 3-p 3-0 3 -R 3-S 3-T 3-u 3-v 3-W 3'-x 3-Y New Mutant Full Length Plasinid Identification pBT-T pBT-U pBT107c22 pBT99c62 pBT107c25_ pBT-A pBT-K pBT-P pBT-Q PBT39 pBT70 pBT68 Source of Mutant Barn H I/ Sst I Sequence prAK-T prAIK-U p1 07c22 p99c26 _2107c25 prAIK-A prAK-K prA1K-P prAi(-Q prAK-39 prAIK-70 prAK-6 8 Actual Mutation(s) involved 1 16-Lys 1 88-Ser 1 Ol-Lys 1 16-Lys 1 88-Ser- 94-Lys 1 94-Lys 4-Thr 1 204-Tyr 1 84-Ile I 01-Lys 11 6-Lys 1l01-Lys 1 16-Lys 1 87-Thr 1 19 -Thr 1 22-Ile 1 1 16-Lys 1 22-Ile 1 105-Tyr 1 88-Ser 1 19-Thr 1 84-Ile 1 1 201-Asp TBW Assay Toxicity Score 2 3 3 3 3 3 3 3 49

I

136-7067 TABLE F (coit Sou rce of New Mutant Mutant Full Length Barn HI/ Actual TBW Assay Example Plasmid Sat I Mutation(s) Toxicity No. Identification Sequence Involved Score 3-z pBT53 prAK-53 105-Tyr 3 Contr2. BT184-Il3 *1 4 0 #4 Os 0 9 #9 o 09 #0*9 9 e0 0# OP S

S

p9*0 P 05 ~0 4 o os 0

OS

P 0~ 0 54 So *4 '9; t Wuhanensis Control JM1O3 4.7 EXAMPLE 4 More Full Length Mutant B.T. Endotoxins The plasmid pBT2JO (1 )ag) was simultaneously digested with the restriction endonucleases Barn HI (8 units) and Sst 1 (8 units) and the resulting 7180 bp large fragment was gel isolated. in a series of separate experiments each (1 ,pg) of the plasmids prAKf prAK-Ef p26-3, p36a65 and p95a86 was also simultaneously digested with the restriction endonucleases; Barn HI (8 units) and Sat I (8 units) and each resulting 1428 bp fragment comprisihg a portion of a truncated endotoxin coding sequence was gel isolated. Each quantity of these 1428 bp fragmnents was then separately digested with the restriction endonuclease Fnu D2 (4 units in 6mM Wadj 6mM Tris HCl (ph 7.4) 6mM MgCl 2 f 6mM 2-mercaptoethanol, 100 ).g/ml bovine serum albumin). The restriction endonuc3.ease Fnu D2 (also known as Acc 2) cuts each of the various 1428 bp Barn HI/Sat I fragments only once and into a 640 bp Barn HI/Fnu D2 fragment and a 788 bp Fnu D2/Sst I fragmento the different fragments from each experiment being purified by agarose gel electrophoresis.

136-7067 There was thus obtained a series of diffeent 640 bp Barn HI/Fnu D2 fragments and a series of different 788 bp Fnu D2/Sst I fragments. By selecting one fragment from each of these two series and ligating (Example P-6B) w. th the 7180 bp larger fragment obtained from pBT2lO, there was obtained a number of new plasmids harbouring different full length mutant B.t. endotoxin genes. The thus obtained new plasmids, id tified below in Table G, were then used to transform E. coli JM103 according to the procedure of Example P"4(A) and the resulting cells were evaluated for the production of, B.t. endotoxin in the TBW assay of Example A, the approximate results obtained in said assay being also reported below in Table G. Various of the transformed cells containing plasmids as described in Tables F and G were also evaluated in the T. ni assay, the results of which are illustrated below in Table H 4 TABLE G NEW FULL

LENGTH

MUTANT SOURCE OF SOURCE OF PLASMID BAM HI1/ FNU D2/ ACTUAL TBW EXAMPLE IDENTI- FNU D2 SST I MUTATION(S) ASSAY NO. FICATION FRAGMENT FRAGMENT INVOL-VED SCORE 4-A 66 p36a65 p26-3 122-Ile 3 old 125-4Val 201-Asp 4-B 67 p26-3 p95a86 119-Thr 1 130-Ile 44 4 188-Ser 4-C 74 p36a65 p95a86 122-Ile3 125-Val 188-Ser 4-D 106 p26-3 prAK 119-Thr 1 130-Ile 4-E 107 prAK p26-3 201-Asp 4-F 108 prAK-E prAK 130-Ile 3 51 -4 136-7067 TABLE H PLASMID TABLE RELATIVE IDENTIFIC. SOURCE POTENCY pBTA F 391 pBTC F 299 pBT66 F 169 pBT107c25 F 254 pBTP F 340 pBTS F 255 pBT67 G 304 pBT106 G 367 standard pBT301 100 9 control SAN415 59 control CAG629 0 o EXAMPLE Cells transformed with DNA encoding a mutant endotoxin sequence are 040 2 grown in a fermentor, under conditions known and standard for such. The whole contents of the fermentor are, at the end of cell growth and immediately prior to harvest, subjected to a raise in temperature to approximately 70-80 0 C. This temperature is maintained for 10 mins be- Sfore cooling and is sufficient to inactivate the recombinant microorganisms without affecting the biological activity of the endotoxin 1 proteins. The fermentor L~ntents are then evaporated under pressure to Sconcentrate to one-third of the previous volume and the resulting concentrate subjected to spray drying at an insertion pressure of about 2000 psi using a heated countercurrent air flow with an inlet temperature of 140-1600C and an outlet temperature of 20-50°0. The resulting powder is mixed with carrier such as defatted soybean to form a wettable concentrate. Suitable ratios of such will depend i.a, on the desired

A

136-7067 strength of the final product but may, for example, be 60:40 parts by weight powder to carrier. The resulting concentrate preferably contains from 0.4 to 10% and more preferably 0.8 to active ingredient, in terms of spores or endotoxin protein. The wettable powder is suitably diluted with water as is known in the art, for spray application.

440 4 4 4' 4 4 t' "DO 4 136-7067 TABLE A -46 GG ATO CdGT TT~T AAA TTG TAG TAA TGA AAA ACA GTA TTA I11 Arg Pile Lys Lau Lys Th r Val. Leu TAT CAT Aki? GAA TTG GTA TCT TAA TAA MAG AGA TGG AGG TAA CTT Tyr His As Giu Leu Val Ser Lys Arg Trp Arg Leu ATG GAT AAC AAT CCG MAC ATC AAT GAA TGC ATT CCT TAT AAT TGT Met Asp Asn Asn Pro Asn Ile Asn Giu Cys Ile Pro Tyr Asn Cys TTA AGT AAC CCT GAA G'VA GAA GTA TTA GGT GGA GMA AGA ATA GAA Lau Ser Asn Pro Giu Vali Glu Val Lau Giy Gly Giu Arg Ile Gtu ACT GGT TAC ACC CCA ATC GAT ATT TCC TTG TOG CTA ACG CAA TTT The G3.y Tyr The Pro Ile Asp Ile Ser Leq Ser Leu Thr Gin Phe 49 04 V~4 ft 9 99 ft D'i t 9 09 004 p 0044 49 *o 0 4 0 0 44 p 40 04 0 0 04 00 p 04 0 I~ 90 0 oo .a 49 A~ 0 ft 9 44 4

U

ft OTT TTG AGT GMA TTT OTT CCC GGT GCT GGA TTT GTG TTA Laeu Leu, Ser Glu Phe Vat Pro Gly Ala Gly P'e Vat Le-j (b) GGA CTA Giy Lau UTT GAT ATA ATA TGG GGA ATT TTT GGT CCC TOT CAA TGG GAC GCA, V&J" Asp Ile Ile Trp Gly Ile Phe Gly Pro Ser GJ' Trp Asp Ala TTT O'TT GTA CAA PTT GAA CAG TTA ATT AAC CAA AGA ATA Phe Leu Vat Gin Ile Giu Gin Lau Ile Asn Gin Arg Ile 1 300 TTC GOT AGG MAC CAA GCC AT'r TCT AGA TTA GMA GGA CTA Phe Ala Arg %sn Gin Ala Ile Ser Arg Lau Gtu 61Yx 'feu (100) n-1 GAA GAA Giu Giu (nM-1 AGC AAT See Asn (105) C'TT TAT CAA ATT TAC GCA GMA TCT TTT AGA GAG TGG GAA GCA GAT Leu Tyr Gin Ile Tyr Aia Glu Ser Phe Arcj Giu Trp Glt3 Ala Asp O CT ACT MAT CCA GCA TTA AGA GMA GAG ATG CGT AITT CMA Pro The Asn Pro Ala Le-u Arg Gtu Giu Met Arg Ile Gin TTC AAT Phe Asn (135Y Notes; is Barn HI site is Spe I site is )Cba I site 54 136-7067 GAC ATG AAC AGT GCC OTT ACA ACC GCT ATT oCC OTT TTT GCA GTT Asr Met Asn Ser Ala Leu Thr Thr Ala Ile Pro Le.u Phe Ala Val (140) 495 CAA AAT TAT CAA GTT COT OTT TTA TCA GTA TAT GTT CAA GOT GCA Gin Asn Tyr Gin Val Pro leu Leu Ser Val Tyr Val Gin Ala Ala (165) 523 AAT TTA CAT TTA TCA GTT TTG AGA GAT GTT TCA GTG TTT GGA CAA Asn ieu His Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gin (180) 549 577 AGG TGG GGA TTT GAT GCC GCG ACT ATO AAT AGT CGT TAT AAT GAT Arg Trp Gly Phe As? Al~a Ala Thr Ile Asn Ser Arg Tyr Asn Asp (195) TT AT GGOT AT GC606 n-348 624 too TA CT AG CT AT GG AO TAT ACA GAT OAT GOT GTA OGC TGG Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val Arg Trp (m-116) (210) o 675, TAO AAT AOG GGA TTA GAG CGT GTA TGG GGA COG GAT TOT AGA GAT Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg Asp 0 (225) TGG ATA AGA TAT MAT CAA TTT AGA AGA GAA TTA ACA CTA ACT GTA Trp, Ile Arg Tyr Asn Gin Phe Arg Arg Giu, Leu Thr Leu Thr Val STTA GAT ATO GTT TCT CTA TTT COG MAC TAT GAT AGT AGA AOG TAT 0444 Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr (255) 0 0 OCA ATT OGA ACA GTT TOC CAA TTA ACA AGA GMA ATT TAT ACA MoC Pro Ile Arg Thr Val Ser Gin Leu Thr Arg Giu Ile Tyr Thr Asn COCA rTA TTA GAA MAT IZTT GAT GG13 AGT

T

TT CGA GGC TOG GOT CAG *Pro Val Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gin 4 GGC ATA (GAA GGA AGT ATTI AGG AGT OCA CAT TTG ATG GAT ATA CTT Gly Ile GlU Giy Ser Ile Arg Ser Pro His Leu Met Asp Ile li,.u AAC AGT ATA ACC ATC TAT ACG GAT GC CAT AGA GO;, 41,\A. TAT TAT Asn Ser Ile Thr Ile Tyr Thr Asp Ala His Arg G1,y, 51 Tyr Tyr TGG TOA GGG CAT CMA ATA ATG GOT TOT COCT GTA GGG TOG GGG Trp Ser Giy His Gin Ile Met Ala Ser Pro Val Gly Phe Ser Gly Note: is Xba I site 55 136-7C67 CCA GAA TTC Pro Giu Phe OCA CAA CAA Pro Gin Gin ACA TTA TCG Thr Leu Ser AAT AAT CAA Asn Asn Gin GGA ACC TC Giy Thr Ser

ACT

Th r C GT Arg TO C Ser C AA Gin TO A Ser

TTT

Phe ATT1 Ile

ACT

Th r

CTA

Leu

MAT

Asn

CCG

Pro

GTTI

Val.

TTA

Le u T CT Ser

TTG

Le u

CTA

Le u G CT Ala

TAT

Ty r

GTT

Val.

CCA

Pro Thr Vai Asp Ser Leu Asp Glu CCA CCT AGG CAA GGA TTT ACT Pro Pro Arg Gin Gly Phe Ser CGT TCA GGC TTT AGT AAT GO 0 Phe Arg Ser Gly Phe Ser Asn OCT ATG TTC TCT G Pro Met Phe Ser G0 q ATT CCT TCA TCA Ile Pro Ser Ser 0o AAT CTT GGO TCT Asn Leu Giy Ser GGA GGA GAT ATT Gly~ Gly Asp Ile A TTA AGA G',A MAT 000 Leu Arg Val Asn AGA ATT CGO TAO Arg Ile Arg Tyr ATT GAO GGA AGA Ile Asp Gly Arg WG9 AGT GOG AGT Ser Ser Giy Ser TTT ACT ACT COG Phe Thr Thr Pro TG G ATA Trp Ile CAA ATT Gin Ile GGA ACT Giy Thr OTT OGA Leu Arg ATT ACT Ile Thr GOT TOT Aia Ser OCT ATT Pro Ile AAT TTA Asri Leu TTT AAC Phe Asn

OAT

H is 7.OA Th r

TOT

Ser

AGA

Arg GO A Al a

ACC

Th r

AAT

Asn

CAG

Gin

TTT

Ph e TAT GGA ACOT ATG GGA MAT GCA GOT Tyr Gly Thr Met Gly Asn Ala Ala CM A..TA GGT CAG GGO GTG TAT AGA Gin Leu G2.5y Gin Gly Val Tyr Arg AGA AGA OCT TTT MAT ATA GGG ATA Arg Arg Pro Phe Asn Ile Gly Ile OTT GA\C GGG ACA GMA TTT GCT TAT Leu Asp Gly Thr Glu Phe Ala Tyr T1CO GOT GTA TAO AGA AAA AGO GGA Ser Ala Val Tyr Arg Lys Ser Gly ATA COG OCA CAG AAT AAC AGO GTG Ile Pro Pro Gin Asn Asn Asn Val CAT OGA TTA AGO CAT GT T TCA ATG His Arg Leu Ser His Val Ser Met 1350 AGT AGT GTA AGT ATA ATA AG3A GOT Ser Set Val Ser Ile Ile Arg Ala (450) OGT A \'vT GC%' GAA TTT AAT AAT ATA Arg U~r Ala Giu Phe Asn Asn Ile CAA ATA OCT TTA ACA AAA TCT ACT Gin Ile Pro Lea Thr Lys Ser Thr GTO GTT AMA GGA OCA GGA TTT ACA Val Val Lys Gly Pro Gly Phe Thr ACT TOA OCT GGO CAG ATT TCA ACC Thr Ser Pro Gly Gin Ile Ser Thr OCA TTA TCA CAA AGA TAT CGG GTA Pro Leti Ser Gin Arg Tyr Arg Val ACA AAT TTA CAA TTO CAT ACA TCA Thr Asn Leu Gin Phe His Thr Ser CAG GGG AAT TTT TCA GCA ACT ATG Gin Gly Asn Phe Ser Ala Thr Met TOO GGA AGO TTT AGG ACT GTA GGT Ser Giy Ser Phe Arg Thr Vai Giy TCA AAT GGA TCA AGT GTA TTT ACG Ser Asn Gly Ser Ser Vai Phe Thr 56 136-7067 TTA AGT GCT CAT GTC TTC AAT TCA GGC AAT GAA GTT TAT ATA GAT Leu Ser Ala His Vai Phe Asn Ser Giy Asri Giu Val Tyr Ile Asp OGA ATT GMA TTT GTT COG GCA GMA GTA ACC TTT GAG GCA GMA TAT Arg Ile Giu Phe Vai Fr o Al a Giu Val Thr Phe Giu Al a Giu Tyr (610) GAT TTA GMA AGA GOA CM-IA MG GOG GTG AAT GAG OTO TTT ACT TOT Asp Leu Giu Arg Ala Gin Lys Al a Val Asn Giu Leu Phe Thr Ser TOO AAT CMA ATO GGG TTA AAA ACA GAT GTG AOG GAT TAT OAT ATT Ser Asn Gin Ile Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile GAT CMA GTA TOO AAT TTA GTT GAG TGT TTA TOT GAT GMA TTT TGT Asp Gin Val Ser Asn Leu Val Giu Cys Leu Ser Asp Glu Ph~e Cys C TG GAT GAA MAA MAA GAA TTG TOO GAG MAA GTO AMA OAT GOG MAG Leu Asp Giu Lys Lys Giu Leu Ser Giu Lys Val Lys His Ala Lys OGA OTT AGT GAT GAG COGr AAT TTA OTT CMA G~ MOCA AAO TTT AGA 4 s Arg Leu Ser Asp Giu Arg Asn Leu Leu Gin, Asp Pro Asn Phe Ar9 GGG ATOC AAT AG A" CMA OTA GAO OGT GGO TGG AGA GGA AGT AOG GAT Gly Ile Asn Arg Gin Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp ATT ACC ATO CMA GGA GGO GAT GAC GTA TTO AAA GAG AAT TAO GTT Ile Thr Ile Gin Gly Gly Asp Asp Val Phe Lys Giu Asn Tyr Vai 60(e) 0 ACG OTA TTG GGT AC TTT~ GAT GAG TGO TAT OCA ACG TAT TTA TAT Thr Leu Leu Gly Thr Phe Asp Giu Cys Tyr Pro Thr Tyr Leu Tyr s* s.(723) 2250 CAA AMA ATA GAT GAG TOG MAA TTA MAA GOC TAT ACC OGT TAO CAA Gin Lys Ile Asp Giu Ser Lys Leu Lys Ala T y L Thr Arg Tyr Gin (750) S. TTA AGA GGG TAT ATO GAA GAT AGT CMA GAO TTA GAA ATO TAT TTA Leu Arg Giy Tyr Ile Glu Asp Ser Gin Asp Leu Giu Ile Tyr Leu ATT OGO TAC AAT GOC AAA CAC GMA ACA GTA AAT GTG OCA GGT AOG S Ile Arg Tyr Asn Ala Lys His Giu Thr Val. Asn Val. Pro Giy Th r GGT TOOC TTA TGG COG OTT TCA GCO OCA AGT OCA ATO GGA MAA TGT Giy Ser Leu Trp, Pro Leu Ser Ala Pro Ser' Pro Ile Gly Lys Cys Note: is Kpn I site 57 136-7067 GGA GAA CCG AAT CGA TGC GCA CCA CAA CTT GAA TGG AAT CCA GAT Gly Giu Pro Asn Arg CTA GAT TGT Leu Asp Cys CAT CAT TTC His His Phe TCC TGC Ser Cys TC C TTG Ser Leu Cys Ala AGA GAC Arg Asp GAC ATT Asp Ile TG G GTG Trp Vai GGA AAT Giy Asn OTA GCT Leu Ala Pro Gin Leu Glu Trp Asn Pro Asp GGA GMA AAA TGT GCC CAT CAT TCC Gly Giu Lys Cys Ala His His Ser GAT GTT GGA TGT ACA GAC TTA AAT Asp Val Gly Cys Thr Asp Leu Asr,

GAG

C I

GGC

Gly T TA Le u GAO TTA Asp Leu CAT GCA Hiz Ala GTA GGA Val Gly

GGT

Gl1y

AGA

Arg

GAA

Giu

GTA

Val.

C TA Leu

GCA

Al a ATA TTC AAG ATT AAG Ile Phe Lys Ile Lys CTA GMA TTT CTC GMA Leu Glu Phe Leu Giu CGT GTG AMA AGA GCG' Arg Val Lays Arg Ala

ACG

Th r

GAG

Giu

GAG

Glu 9.

4 o #99 9,99 9 99 99 9 99 9 @9 9 99 9999 9 9 49 @4 4 9 9 TGG AGA GAC MAA CGT GAA AAA TTG GAA TGG GAA ACA MAT Trp Arg Asp Lays Arg Giu Lays Laeu Giu Trp Giu Thr Asri

TAT

Ty r

*ROO

GAG

Glu S TTA Laeu

AAT

Asn

AAC

Asn

TCG

Ser

GTT

Val.

AAA GAG Lays Giu TAT GAT Tyr Asp GCA GAT Ala Asp CTG TOT ILeu Ser GAA GGG Giu Giy GTC ATT Va). Ile GTG AAA Val Lays GTC CTT Val. Leu CGT GTC Arg Val

GCA

Al a

AGA

Arg

AAA

Lays

GTG

Val

CGT

Arg

AMA

Lays

GGG

Gly Val.

TGT

Cys

A

Lys

TTA

Leu

CGC

Arg

ATT

Ile

MTT

CAT

H is G2'r Val.

CCG

Pro GAA TCT Glu Ser CMA GCG Gin Ala GTT CAT Val His CCG GGT Pro Gly TTC ACT Phe Thr GGT GAT Gly Asp GTA GAT Va). Asp COG GMA Pro Glu GGT CGT Gly Arg GTA GAT GOT TTA TTT Va). Asp Ala Leu Phe GAT ACC AAC ATC GCG Asp Thr Asn Ile Ala AGC ATT CGA GAA GCT Ser Ile Arg Glu Ala GTC AAT GOG GOT ATT Val Asn Ala Ala Ile GCA TTC TCC CTA TAT Ala Phe Ser Leu Tyr TTT AAT AAT GGC TTA Phe Asn Asn Gly Leu GTA GAA GAA CAA MO Val Glu Giu Gin Asn TGG GMA GOA GMA GTG Trp GJlu Ala Glu Val GGO TAT ATO OTT CGT Gly Tyr Ile Leu Arg

GTA

Val

ATG

Met

TAT

Tyr

TTT

Phe

GAT

Asp

TCC

Se r

AAC

Asn

TCA

S er cG 1 r C Val (840) CMA GAT Gin Asp AMA CCA Lays Pro MAA AMA Lays Lays 2700 ATT GTT Ile Val (900) MAC TOT Asn Ser ATT CAT Ile His CTG COT Leu Pro GMA GAA Giu Giu GOG AGA Ala Arg TGC TGG Cys Trp CAC CGT His Arg CMA GAA G).n Giu ACA GCG Thr Ala 58 fl I- i

I

136-7067 TAC AAG GAG GGA TAT GGA GAA GGT Tyr Lys Glu Gly Tyr Gly Glu Gly GAG AAC AAT ACA GAC GAA CTG AAG Glu Asn Asn Thr Asp Glu Leu Lys TGC GTA Cys Val TTT AGC Phe Ser GAA GTA TAT CCA AAC AAC ACG GTA ACG TGT Glu Val Tyr Pro Asn Asn Thr Val Thr Cys 4.* *400 *a 4 44 4. 0 44r a4 4i 0*40 04 44 04 4 4 0040 4 4 44 4 4; 4* I 4 4 00l

ACT

Thr

TAT

Tyr

GCA

Ala

AAT

Asn

CCA

Pro

GAT

Asp CAA GAA GAA TAT GAG GGT ACG Gin Glu Glu Tyr Glu Gly Thr GAC GGA GCT TAT GAA AGC AAT Asp Gly Ala Tyr Glu Ser Asn TCA GCC TAT GAA GAA AAA GCA Ser Ala Tyr Glu Glu Lys Ala CCT TGT GAA TCT AAC AGA GGA Pro Cys Glu Ser Asn Arg Gly GCT GGC TAT GTG ACA AAA GAA Ala Gly Tyr Val Thr Lys Glu AAG GTA TGG ATT GAG ATC GGA Lys Val Trp Ile Glu Ile Gly TAC ACT Tyr Thr TCT TCT Ser Ser TAT ACA Tyr Thr TAT GGG Tyr Gly TTA GAG Leu Glu GAA ACG Glu Thr ACC ATT CAT GAG ATC Thr Ile His Glu Ile (1050) AAC TGT GTA GAA GAG Asn Cys Val Glu Glu 3240 AAT GAT TAT ACT GCG Asn Asp Tyr Thr Ala (1080) TCT CGT AAT CGA GGA Ser Arg Asn Arg Gly GTA CCA GCT GAT TAT Val Pro Ala Asp Tyr GAT GGA CGA AGA GAC Asp Gly Arg Arg Asp GAT TAC ACA CCA CTA Asp Tyr Thr Pro Leu TAC TTC CCA GAA ACC Tyr Phe Pro Glu Thr GAA GGA ACA TTC ATT Glu Gly Thr Phe Ile (1170) S, GTG GAT AGC GTG GAA TTA CTC CTT Val Asp Ser Val Glu Leu Leu Leu ATG GAG GAA TAG Met GlU Glu (1181) rr o a 4 0 4 4 4 Q 4 0 Ct O2 The more preferred mutations of the invention include those at positions 116 (Lys or Arg), 119 (Thr), 130 (Ile) and 188 (Ser) and combinations including one or more of the same such as those found in pBT26-3, pBT-106, pBT-68, pBT-C, pBT-67 and pBT-70 (certain of these found in Table Also of preferred interest are the individual and combined mutations in p36a65, particularly for truncated endotoxins.

59 i i 136-7067 The mutations found and permitted in accord with the invention at amino acid position-4 are of interest since they fall within a section of 25 amino acids (positions 1 to inclusive, in Table A) which has been postulated to also form a pre-toxin or protoxin portion of the endotoxin and subject to protease cleavage in the gut to form the active endotoxin or more active endotoxin. Hence, the mutations permitted at position-4 are indicated to be relevant to endotoxin sequences comprising said 25 amino acids or having substantial (at least 70%) homology therewith, and more particularly relevant to those endotoxins coded for in such region by DNA which would hybridize before the position-4 mutation and under stringent conditions to DNA having the S' sequence found in Table A for the nucleotide positions extending from nucleotide position 1 to and including p. nucleotide position 75, independent of deletions and additions and with equivalent coding of corresponding amino acids as previously discussed in connection with the conserved; 116 amino acid sequence area.

The mutation uncovered by our work at amino acid position 217 and reported in Table B, above, and evaluated as seen elsewhere herein is judged to indicate that all naturally coded amino acids may be present at this position in active endotoxins having the relevant sequence shown in Table A which extends from the end of the 116 amino acid reference sequence to and including amino acid position 217. Accordingly, the situation in which the amino acid at position 217 in such a sequence or equivalent thereof is any naturally coded amino acid except Arg is included with the scope of the invention. However, since the indicated mutation at position 217 produced less interesting results, it is mainly of interest in combination with other mutations disclosed herein and indicating that position 217 can change in endotoxins in which Arg naturally occurs at this position.

60

Claims

136-7067 3 A structural gene according to claim 1 or 2 in which the DNA has been modified such that any one or more of the following amino acids is coded for at the indicated amino acid reference position: a) at position m-5, Lys b) at position m-6, Lys c) at position m-12, Lys d) at position m-16, Tyr e) at position m-27, Lys or Arg f) at position m-30, Thr g) at position m-33, lie h) at position m-34, Tyr i) at position m-36, Val j) at position m-41, Ile Sk) at position m-95, lie 1) at position m-98, Thr m) at position m-99, Ser n) at position m-105, Lys; and o o) at position m-112, Asp 4 A structural gene according to claim 3 in which the DNA has been *9 modified to incorporate the change at one or both of the amino acid reference positions m-Z7 and 5 The structural gene of claims 1 to 4 in which the DNA portion with- out any of the modifications specified in claims 1 to 4 hybridises under stringent hybridising conditions to a 348 nucleotide oligomer having the nucleotide sequence depicted in Table A beginning at position n-i and extending through nucleotide position n-348. 6 The structural gene of claim 5 in which the DNA portion prior to any modification specified in claims 1 to 4 codes for the 116 amino acid sequence of Table A beginning at position m-l and extending through -62- 136-7067 position m-116. 7 The structural gene of claim 6 in which the DNA coding for the endo- toxin comprises DNA coding for the amino acid sequence of Table A beginning at amino acid position 1 and extending through amino acid position 205. 8 A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA having a portion encoding an amine acid sequence demonstrating substantial aminu acid homology to the 205 /amino acid sequence beginning at amino acid .bl position 1 and extending through amino acid position 205 in Table A hereof, in which the amino acid at position 4 is any amino acid Sa except Asn. 04*« 9 A structural gene according to claim 8 in which the amino acid at 0* position 4 is Tyr, 0, 0 10 An expression vector comprising the structural gene of any one of claims 1 to 9 under control of DNA operative to cause expression of said structural gene in a bacterial host. a 4 11 An expression vector according to claim 10 in which said gene is under control of DNA operative to cause expression of said gene in a E. coli. 12 An expression vector according to claim 10 in which said gene is under control of DNA operative to cause expression of said gene in 4 B.t.. 13 An endotoxin protein having toxic activity against insects, said protein comprising an amino acid sequence portion having substantial homology with the 116 amino acid sequence beginning at position m-I -63- 136-7067 and extending through position m-116 in Table A hereof, said positi- on numbers applying to such homologous sequence independent of any deletions or additions therein, in which any one or more of the following amino ence positions: acids are present at the indicated amino acid refer- 0 04 0 94 *b 9 9 position position position position position position position position position position position position position position position m-12 m-16 m-27 m-30 m-33 m-34 m-36 m-41 m-95 m-98 M-99 any any any any any any any any any any any natural amino acid natural natural natural natural natural natural natural natural natural natural amino amino amino amino amino amino amino amino amino amino acid acid acid acid acid acid acid acid acid acid except except except except except except except except except except except Glu; Asn; Glu; Ala; Thr; Asn; Ala; Met; Phe; Ala; Thr; m-5 any natural amino acid except Asn; m-6 any natural amino acid except Gin; m-105 any natural amino acid except Asn; m-112 any natural 4mino acid except Gly; 14 An endotoxin protein according to claim 13 in whicn the homology between said amino acid sequence portion and the 116 amino acid sequence beginning at position m-l and extending through position m-416 in Table A hereof, is at least An endotoxin protein according to claim 13 or 14 in which any one or more of the following amino acids is coded for at the indicated amino acid teference position: a) at position m-5, Lys b) at position m-6, Lys -64- 136-7067 c)a oiio -2 y d at position m-16, Tyr e) at position m-27, Lys or Arg f) at position m-30, Thr g) at position m-33, Ile ht) at position m-34, Tyr I) at position m-36, Val J) at position m-41, Ile k) lat position m-95, Ile 1) at position m-98, Thr mn) at position m-99, Ser a) t position m-105, Lys; dnid 0 at position m-112, Asp 16 An endotoxin protcein according to claims 153 in which one or both of 4 ~.the amino acids at reference positions m-27 and m-30 have been changed. 17 An endotoxin protein produced from a gene according to claim 8 or 9, 18 A process for the production of an endotO~in protein which comprises transforming or transfecting a cell with an expression vector accor- dAng to any one of claims 8 to 11 and culturing the resulting cells to pro~duce said endotoxin. Po4 4, a 19 A process according to claim 18 in which the cell transformed. or transfectod, is a plant, call.. 420 A process according to claim 18 in which the cell transformed or transfected is a bacterial cell. 21 A plant comprising cells containing a structural gene according to any QtIe of claims 1 to 9. wl 136-7067 i A 22 Bacterial cells comprising an expression vector according to any one of claims 10 to 12. 23 A DNA sequence comprising DNA having the sequence from nucleotide position n-1 extending through nucleotide position n-348 in Table A or mutant variations thereof and having one or more spaced apart restriction sites selected from the group consisting of Hind III, Mst II, Bssh II, Bal I and Mlu I, which sites do not change the amino acid sequence for which the DNA codes. S\ 24 Ar insecticidal composition comprising an insecticidally effective oce amount of a protein produced from a DNA according to any one of claims 1 to 9 in association with an agriculturally acceptable e a carrier. I 25 An insecticidal composition comprising an insecticidally effective amount of a protein according to any one of claims 13 to 17 in association with an agriculturally acceptable carrier. .4 *J i -66- -67- 26. A method for combating insects, the method comprising the application of an effective amount of an insecticidal composition according to claim 24 or 25 to a locus infested or likely to be infested with insects. 27. A gene according to claim 1 or 23, an expression vector containing said gene or a process for the production of an endotoxin encoded by said gene substantially as hereinbefore described with reference to the Examples and/or drawings. 28. An endotoxin protein according to claim 13, an insecticidal composition or a method for the use thereof substantially as hereinbefore described with reference to the Examples and/or drawings. DATED this ist day of August, 1991. 4*9S*S SANDOZ LTD. By Its Patent Attorneys DAVIES COLLISON S 4 91O8O1,lmIat08O:\3 97sanre,67