IE890589L - Novel compounds - Google Patents

Abstract

Mutant Bacillus thuringiensis endotoxin proteins, exhibiting the characteristic insecticidal activity shown by the wild type delta -endotoxins. At each individual point of mutation it is indicated that the codons coding for any other natural amino acid can be substituted to produce active endotoxin protein. Also described are DNA sequences encoding such endotoxins and recombinant techniques for the production of insecticidally active mutant endotoxin [DE3905865A1]

Description

6 2 : ■ 8 Bacillus thuringiensis (B.t.) is a sporulating bacterium vhich produces a protein crystal delta-endotoxin (S-entiotoxin) at the end of vegetative stage of grovth. This endotoxin, upon ingestion by certain insects, produces toxic effects vhich include the cessation of: feeding, I® gastrointestinal dysfunction, dehydration and ultimately, death. The S-endotoxin is produced, generally from a plasmidal source, asi an inactive precursor or protoxin form having a molecular weight oil 130,000-140,000 daltons [Calabrese, Canad, J. Microbiol. 26 (1980) 1006]. Proteolytic cleavage to remove the C-terminal half, approximately, and 15 possibly several amino acids at the N-terminus, normally occurs in the insect gut as a result of the action of the gut proteases, and is required to produce the active toxin vith a molecular veight of 65,000 to 70,000d [Tyrell et al, J. Bacteriology 145 (1981) 1052]. 20 a large number of subvarieties of B.t. have been identified. Al though most of these shov a more specific or increased toxicity to insects of the order Lepidoptera, a limited number have also been demonstrated to be toxic tovards insects of other classifications. For example, B.t. israelensis is toxic tovards Dipteran larvae (mosquitos and 25 blackflies) and tvo other subvarieties have recently been identified vhich demonstrate toxicity tovards Coleopteran larvae [Hofte et al, Nuc. Acid. Res. 15(17) (1987) 7183].

Although much vork has been performed in the production of shortened 30 toxins and structural genes encoding these, there appears to be less knovn about the ability of the B.t. ^-endotoxins to vithstand point mutations vithin the active or toxic portion of the endotoxin sequence and the effect of such mutations on the activity of the toxin molecules. 35 An object of the present invention is to provide novel mutants of the active portionvof B.t. S-endotoxins. -1- 10 15 20 25 30 35 A further object o£ the present invention is to produce mutations vhich are effective to produce B.t. endotoxin-like activity in both truncated and full length S-endotoxin forms.

K pre. Ferret I object of the present invention is to provide mutations vhich enhance the insecticldal activity of B.t. ^-endotoxin structures.

In accordance vith the present invention, ve have, after randomly creating single and multiple point mutations in many hundreds of DNA strands coding for a large section of the active portion of a representative B.t. endotoxin insecticidally active against Lepidoptera, isolated and produced by recombinant techniques several mutant B.t. endotoxins vhich exhibit the characteristic insecticldal activity against Lepidoptera that is possessed by the vlld type B.t. S-endotoxin. Also, at these discovered points of mutation, it is indicated that the codons coding for any other natural amino acid can be substituted to produce active endotoxin protein. A number of the random mutations vere also found to produce a higher level ,of insecticldal activity. Such activity may be demonstrated in, for example, the Tobacco Budvorm (Heliothis virescens) assay or the Trichoplusia ni (cabbage looper) assay as hereinafter described and in many cases this increase vas quite remarkable by achieving an activity at least tvo or more times greater than the parent endotoxin structure. Multiple mutations (usually 2 or 3 amino acids per mutated DNA strand) vere also evaluated individually and in various combinations to identify certain more effective mutations and combinations thereof. The mutations in accordance vith the present invention, vith one exception, vere also found to exist vithin amino acid sequence sections vhich are highly conserved among a vide variety of vild type B.t. ^-endotoxins, hence indicating the general applicability of the mutations provided by the invention to a vide variety of endotoxin structures in vhich such conserved areas provide insecticidal B.t. endotoxins. -2- More particularly, vith reference to the amino acid sequence and the numbering thereof in Table A, infra, (beginning vith the methionine (MET) vhich is position number 1 and the normal N-terminus of the representative Lepidopteran active endotoxin shovn in Table A), it has been found that B.t. endotoxin protein othervise insectlcidally active against Lepidoptera insects in the manner of native B.t. endotoxins vhen containing vithin the active portion an amino acid residue sequence the same as or having substantial homology to that shovn in Table A for the 116 amino acid residue sequence shovn at positions from and including position 90 to and including position 205 (also amino acid positions m-1 through m-116), have one or more of the residues of the folloving amino acids at the indicated or equivalent homologous positions (the m-position numbers in parentheses being vith reference to said 116 amino acid residue sequence): a) at position 94 (position m-5 of said 116 amino acid sequence) any natural amino acid coded for by the genetic code except Asn; b) at position 95 (position m-6 of said 116 amino acid sequence) any such natural amino acid except Gin; c) at position 101 (position m-12 of said 116 amino acid sequence) any such natural amino acid except Glu; d) at position 105 (position m-16 of said 1.16 residue sequence) any such natural amino acid except Asn; e) at position 116 (position m-27 of said 116 residue sequence) any such natural amino acid except Glu; f) at position 119 (position m-30 of said 11.6 residue sequence) any such natural amino acid except Ala; g) at position 122 (position m-33 of said 116 residue sequence) any such natural amino add except Thr; h) at position 123 (position m-34 of said H6 residue sequence) any such natural amino acid except Asn; i) at position 125 (position m-36 of said 116 residue sequence) any such natural amino acid except Ala; j) at position 130 (position m-41 of said 116 residue sequence) any such natural amino acid except Met; k) at position 184 (position m-95 of said 116 residue sequence) any such natural amino acid except Phe; 1) at position 187 (position m-98 of said 116 residue sequence) any such natural amino acid except Ala; m) at position 188 (position m-99 of said 116 residue sequence) any such natural amino acid except Thr; n) at position 194 (position m-105 of said 116 residue sequence) any such natural amino acid except Asn; and o) at position 201 (position m-112 of said 116 residue sequence) any such natural amino acid except Gly. 10 15 20 25 30 In addition, and again vith reference to the numbered amino acid residue sequence shovn in Table A, the Invention includes the change in the amino acid Asn at amino acid position 4 to any other natural amino acid coded for by the genetic code.

Vith regard to the amino acid residues provided by the invention vithin said 116 residue sequence, it is preferred in accordance vith the invention that such sequence be characterised, again vith reference to the total mature sequence shovn in Table A (and also to such 116 residue sequence), by one or more of the folloving amino acids at the indicated a) Lys at position 94 (position 5 of the 116 residue b) Lys at position 95 (position 6 of said 116 residue c) Lys at position 101 (position 12 of said 116 residue d) Tyr at position 105 (position 16 of said e) Lys or Arg, more preferably Arg, at positions: sequence); sequence); sequence); sequence); (position (position (position (position (position (position (position (position (position 27 of said 116 residue sequence) 30 of said 116 residue sequence) 33 of said 116 residue sequence) 34 of said 116 residue sequence) 36 of said 116 residue sequence) 41 of said 116 residue sequence) 95 of said 116 residue sequence) 98 of said 116 residue sequence) 99 of said f) g) h) i) j) k) 1) m) n) Thr at lie at Tyr at Val at lie at lie at Thr at Ser at Lys at 116 residue position 116 position 119 position 122 position 123 position 125 position 130 position 184 position 187 position 188 position 194 116 residue sequence) (position 105 of said 116 residue sequence); and o) Asp at position 201 (position 112 of said 116 residue sequence).

Vhen the Asn at amino acid position 4 is changed, it is preferably -4- changed to Tyr.

Table A near the end of this specification sets forth a nucleotide sequence and resulting deduced amino acid sequence relevant to B.t. S-endotoxin production in nature. Vith one exception, the nucleotide sequence was obtained from a S-endotoxin-producingplasmid found in B.t. vuhanensis. In particular, the entire structural gene (actually coding for the endotoxin itself) is from B.t. vuhanensis and the one exception is that the sequence prior to methionine (Met) at the beginning of the structural gene is from an endotoxin-producing gene found in B.t. kur-staki HD-1 (the so-called 5.3Kb Hind III class plasmid of HD-1), such upstream sequence containing the native Rlbosomal Binding Site (RBS) from such B.t. kurstaki HD-1 endotoxin-producing plasmid. The upstream sequence containing the Rlbosomal Binding Site, as found in B.t. vuhanensis differs little from that shovn in Table A for Kurstaki and the differences are indicated later herein. Bovever, It should be kept In mind that both the nucleotide and amino acid sequences in the subject B.t. vuhanensis and B.t. Kurstaki HD-1 structural genes are identical from the beginning of the endotoxin sequence through the entire active portion thereof and up to at least the Kpn I site indicated in Table A, said Kpn I site being in the protoxin portion. Hence, the active toxin portion resulting from cleavage after ingestion by the insect vill be the same for both the subject B.t. vuhanensis and B.t. kurstaki HD-1 endotoxins. In Table A, amino acids for the endotoxin protein produced as a result of expression of the structural gene are positively numbered in parentheses 1 through 1181 belov the amino acid. Those In the untranslated area upstream of the 1-Met are negatively numbered in a back or upstream direction (vith stop signals counted as an amino acid posi- * tion). Nucleotides in the structural gene are numbered (noi: in parentheses) above the line in vhich they appear and the last dilgit in the number stands above the nucleotide to vhich the number applies. Nucleotides in the untranslated region vhich includes the rlbosomal binding site are negatively numbered backvard from the initiating ATG codon (for the 1-Met). Within the numbered sequences indicated above a portion thereof is separately or sub-numbered m-1 through m-116 for amino acids and n-1 through n-348 for the nucleotides for such amino acids, to indi-5 cate more particularly a highly conserved region in vhich most of the mutations provided by the invention vere found to be located. Certain restriction sites relevant to the nucleotide sequence in Table A are shovn by a line above the nucleotides involved in the restriction sites vith a footnote designation of the particular site. The toxic portion 10 of the endotoxin shovn in Table A as recognised in the art involves the amino acid sequence beginning at amino acid position 1 (Met) and extending through amino acid position 610 (Thr). In viev of the nature of the total DNA sequence shovn in Table A, and in order to understand the folloving description more easily, it vill be noted that the DNA and 15 amino acid sequences beginning vith the untranslated portion in line 1 of Table A and extending up to the Kpn I site at about amino acid positions 724-725, and portions thereof, can be and are also referred to herein as derived from B.t. kurstaki HD-1 (the 5.3Kb Hind III class plasmid). 20 Figure 1 shovs a map of the general vorking plasmids prAK and prAK-3 used at various stages in connection vith the invention and comprising DNA coding for a truncated B.t. endotoxin derived from B.t. Kurstaki HD-1 and having insecticldal activity against Lepidoptera. 25 Figure 2 shovs a map of the plasmid pB8rII vhich comprises DNA coding for a truncated B.t. endotoxin protein of somevhat greater length than that coded for by prAK and also derived from B.t. kurstaki HD-1 and also having insecticldal activity against Lepidoptera. 30 Figures 3a and 3b shov tvo representative double stranded DNA strands vhich may be synthesised for conducting so-called codon spin experiments and also useful for conveniently introducing desired mutations into a B.t. endotoxin DNA coding sequence. -6- Figure 4 shovs a map of the plasmid pBT210 vhich comprises DNA coding for a full length native endotoxin from B.t. vuhanensis, vhich endotoxin has the identical amino acid sequence in its active portion as the endotoxin from B.t. kurstaki HD-1 as coded for in prAK and pB8rII.

Figure S shovs an abbreviated map of the plasmid prAK-9 along vith a blov-up of take-out section thereof, said prAK-9 being otherwise similar in detail to plasmid prAK-3 and said section and subsections thereof in parent plasmids being conveniently useful for conducting codon spin experiments and otherwise introducing mutations as provided by the invention.

The plasmid prAK was deposited in E. coll JM103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18329.

The plasmid pB8rII was deposited in E. coll JM103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18331.

The plasmid pBT210 was deposited in E. coll JM103 with the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18330.

The. abo/e tJKrte. rrnc'tDOi'qCknier^S *xte,re. cLepo>>;fc«ci. under the. Budftpest Trecvts On tk"vs Op Oi?poo.i- Or for* tt\« Pdt«v*t r.'occilu/e As essentially indicated, the point mutations of the invention •.are-applied to endotoxin protein sequences produced by Bacillus thurlngl-ensis varieties and subtypes, which sequences are insecticidally active against Lepidopteran larvae when containing the 116 amino acid conserved sequence indicated above or a sequence which is highly homologous therewith, including protein endotoxin sequences which are of the natural full length type or substantially full length and those which are truncated by removal of all or a part of downstream protoxin or inactive portion thereof and even those vhich may 10 15 20 25 30 be truncated from the normal C-terminus upstream and back into the active portion of the endotoxin. As evident already, endotoxins from B.t. kurstaki and B.t. vuhanensis both have the identical 116 amino acid conserved region and others have or can be expected to have the same 116 amino acid sequence or a largely homologous equivalent thereof. For example, endotoxins from B.t. sotto, B.t. kurstaki HD-73 (strain), and B.t. Galleriae are already knovn to produce endotoxins with the identical 116 amino acid sequence even though some of these differ to at least some extent, and in cases significantly, in both the balance of the toxic portion of the endotoxin and in the protoxln section. Others, such as B.t. kurstaki HD-1 Dipel (a commercial substrain), have one amino acid change in the indicated 116 amino acid sequence (m-59 is Leu coded for by TTG) and other changes/deletions/additions in other sequence portions. This and others found to have a single or multiple changes but amino acid homology of at least about 70X to said 116 amino acid sequence may have one or more mutant changes of the invention made to the amino acids therein vhich correspond identically to the amino acid in said 116 amino acid non-mutated sequence, particularly vhen the amino acid to be changed has on each of its sides 2 and preferably 4 other amino acids vhich also correspond identically to those in the 116 amino acid sequence. It is also contemplated that the mutations of the invention may be made to corresponding amino acids in homologous series vhich essentially contain deletions or additions such that the sequence itself is shorter or longer than the indicated 116 amino acid sequence. In such cases, the numbering as employed in the reference 116 amino acid sequence vill be retained such that deletions existing in the sequence to be changed vill be counted as actually present and additions in the sequence to be changed vill simply not be counted. Hence, amino acid positioning assignment can be said to be made independent of deletions or additions in such a homologous sequence.

Preferably, the homologous amino acid sequences into vhich the mutant changes of the invention may be substituted are those vhich are -8- coded for by DNA to vhich DNA from either the sense or antisense strand (or double strand) of the DNA beginning vith position n-1 and extending through position n-348 in Table A vill hybridise under stringent hybridising conditions vhen the homologous sequence to be mutated has its amino acids, vhich correspond to those in the referenced 116 umino acid sequence, coded for by the same codon as the corresponding amino add in the reference sequence. Procedures for preparing such a tagged hybridisation probe are veil knovn in the art. Stringent hybridising conditions are those in vhich hybridisation is effected at 60°C in 2.5X saline citrate (SSC) buffer folloved merely by rinsing at 37°C at reduced buffer concentration vhich vill not affect the hybridisations which take place.

Preferably, the mutations are made in amino acid sequences vhich have no more than 1, 2 or 3 amino acid differences from those in the 116 amino acid reference sequence, most preferably a sequence which is identical to the reference sequence.

It is already clearly indicated in the art that the 116 amino acid reference sequence may form a portion of otherwise substantially modified or different endotoxin protein sequences vhich have insecticidal activity against Lepidopteran larvae, and other modifications outside of the reference sequence vill most certainly be uncovered as knowledge of the art unfolds. Hence, the sequences bordering the required mutated sequence portion which is analogous to the 116 amino acid reference portion may vary to a considerable extent and need only be sufficient to provide insectiddally active endotoxin protein, for example as demonstrated by insecticidal activity against the tobacco budworm. Thus the • • amino acid sequence upstream from the optionally mutated portion may be shortened or lengthened or itself mutated relative to the sequence shown in Table A, but will generally begin with methionine and is most preferably highly homologous (70%) or identical to that shown in Table A, although it is evident that such sequence may also optionally contain the preferred mutant at the 4-position as also provided by the invention. Similarly, the portion dovnstream from the required mutated sequence portion may vary videly and be shortened or lengthened relative to the balance thereof shovn in Table A up to its point of cleavage in the insect gut, 5 and of course may or may not be further extended to form a protoxin or inactive portion subject to cleavage in the insect gut to provide an insecticidally active protein toxin.

DNA comprising sequencer coding for mutant endotoxins as provided by 10 the invention vill be incorporated under the control of appropriate regulatory sequences into plasmids to form expression vectors vhich vill be transformed or transfected into cells to produce the endotoxin. The production of endotoxins by such recombinant blotechnological techniques, in contrast, for example, to the production of drugs by such tech-15 niques, involves little or no vork-up designed to purify the endotoxin. The cells in vhich it is produced may be lysed, but it has been characteristic in the commercial production of B.t. endotoxins in the past, simply to employ the entire contents of the culture or fermentation system used in production of the final product, usually after drying by 2Q conventional means such as lov temperature spray drying as is knovn in the art. Depending upon the product, various materials may be added to improve product stability as is also knovn, and proteinaceous materials if not present in adequate amounts in the fermentation system may be independently mixed vith the product to enhance stability, again as is knovn, eg soybean povder or defatted soybean povder. 25 30 Vhile the endotoxins may be produced biotechnically in a variety of transformed or transfected cell systems, it is generally preferred to transform or transfect bacterial cells of either the gram-negative or gram-positive type. One preferred type of gram-negative bacteria is E. coli vith vhich considerable experience in biotechnology has already been achieved and for vhich a vide variety of suitable and operatively functional plasmid and transfer expression vector systems are knovn and -10- available. Pseudomonas fluorescens represents another type of gram-negative bacteria into vhich plasmids carrying endotoxin sequences have been incorporated. As demonstrated herein, endotoxin-producing genes may include regulatory sequences such as particularly ribosomal binding site sequences vhich have their origin in B.t. vhen incorporated for expression into essentially heterologous bacterial cells, such as E. coli. Since Bacillus type bacteria provide an environment more closely native to the mutant endotoxins of the invention, it is particularly within the scope of this invention and contemplated thereby to transform or transfect Bacillus type bacteria vith expression vectors comprising the DNA coding for the mutant endotoxins of this invention. Illustrative of such Bacillus cells of particular interest are B.t. cells, B.-cereus cells and B.subtllls cells. A greatly improved procedure for transforming Bacillus cells, particularly B.t. cells, has recently been found and is described in UK patent application GB 2,199,044.

Cell types suitable for transformation by the process include cry minus types such as the knovn B.t. kurstaki cry B cells vhich have no plasmids and vild type Bacillus cells such as the native B.t. cells vhich carry endotoxin-producing plasmids. Plasmids suitable for incorporation into Bacillus cells such as B.t. cells are knovn, for example, the plasmid pBC16.1 (Kreft et al, Molec. Gen. Genet.

[1978] 162 59) and its parent plasmids vhich may be used or modified by employing conventional recombinant techniques to carry the mutant endotoxin coding sequences of the invention. As is veil knovn in the art, Bacillus cells characteristically produce endotoxin in desired amounts only at their sporulation stage and hence are grovn to such stage in order to best obtain the products useful as insecticides. Hence, plasmids or expression vectors provided by the invention and carrying DNA for the mutant endotoxins may be in- * corporated into Bacillus cells vhich either are devoid of endotoxin-producing plasmids or already contain one or more such plasmids. While the mutant endotoxins of the invention vill characteristically have activity against Lepidoptera, endotoxin activity against other insect classes may also be possessed by reason of existing in the parent endo- 10 15 20 25 30 toxin prior to mutation or as the result o£ other permitted sequence changes, and in any case it is vithin the scope of the invention to transform Bacillus cells vith the Lepidopteran-toxic endotoxin producing plasmids of the invention when such cells carry plasmids for endotoxins not substantially effective against Lepidoptera, in order to produce at sporulation, endotoxins combining to provide broader ranges of insecticidal activity. For example, plasmids carrying the mutated endotoxin DNA coding sequences may be used to transform B.t. israeliensis or B.t. tenebrlonis vhich individually are not substantially effective against Lepidoptera.

Vhile the present invention has been demonstrated both vith reference to truncated and full length native type endotoxin proteins, it is generally preferred, vhen using the mutant endotoxins directly as insecticides, as described above, to employ or produce fuller length sequences, vhich are the same as or mimic the native type at least in terms of the opportunity to achieve an endotoxin protein folding capability similar to that of its native capability, or an Improved full length folding effect.

Mutant DNA sequences according to the present invention can also be inserted into the genome of a plant. In such cases it is preferred that the mutated sequences of the truncated type are employed, although the fuller length sequences are also suitable. Any suitable method may be advantageously employed for such incorporation of the endotoxin sequences into a host plant genome, such as for example, via the Ti plasmid of Agrobacterium tumefaciens, electroporation, electrotransformation, micro-injfection, viral transfection or the use of chemicals that Induce or increase free DNA uptake, and the like. Such procedures and the use of such in the transformation of plants are veil knovn to the man skilled in the art. Preferably the DNA sequence encoding the mutant endotoxin vill be associated vith appropriate regulatory sequences, such as for example, operator and 3' regulatory sequences vhich are functio-12- nal in plants, and the vhole vill be incorporated into an expression-type vector. Such transformation of plant cells, followed by regeneration of development of cells into whole plants, enables the mutant endotoxin DNA sequence to become a stable and permanent part of the plant genome, such that it is passed on from one generation to the next via mitosis and meiosis and upon expression results in an insect toxic protein, endowing the plant vith inheritable insect resistance.

Two very similar vectors (prAK and prAK-3) vere used in our work as a source of B.t. S-endotoxin sequence for mutation and also 1:0 provide vehicles for production and evaluation of the B.t. endotoxin mutants. The plasmids prAK and prAK-3 are represented in Fig 1 by illustrating the relevant details of prAK and indicating the minor variation therefrom which exists in prAK-3. Basically, the plasmids prAK and prAK-3 are fully competent expression vectors for E.coli and each includes an ampicillin resistance gene, an origin of replication and operator sequences, including an E. coll promoter. As indicated in Fig 1 by the thick dark lines and boxes, the vector prAK includes in proper reading frame coordination vith the promoter a DNA sequence vhich is found in the vild type B.t. kurstaki strain HD-1. The thick dark line represents the mature sequence vhich has been shortened to code for a truncated native B.t. S-endotoxin extending from amino acid position 1 (Met) to position 610 (Thr) in Table A and further extending into the protoxin portion to end vith amino acid 723 (Leu). At the dovnstream «nd of said thick dark line, a small section shovn as an open thick box in Fig 1, represents a short DNA sequence of 54 base pairs vhich follows the base pair triplet coding for 723-Leu and vhich is itself immediately followed by a stop signal. This total extended sequence of 57 base pairs (including the stop signal) has its origin in the veil knovn plasmid pBR322 vhich vas used in the construction of prAK. Hence the expression vector prAK codes for and produces in E. coll essentially a truncated B.t. S-endotoxin fusion protein having a total of 741 amino acids and composed of the 610 amino acids of the native protoxin section and 18 amino acids having origin in pBR322. This truncated B.t. endotoxin fusion protein has a high level of insecticidal activity and vas used for the purpose of evaluating the mutants thereof produced in our vork. This activity is essentially indistinguishable from a fully truncated B.t. 5 S-endotoxin protein having only the 610 amino acids of the activated toxin (amino acids 1 to 610 in Table A).

The thick dark line representing most of the sequence coding for the truncated B.t. endotoxin fusion protein is connected at its upstream end 10 in Fig 1 to a thick dark box representing a sequence vhich includes a B.t. ribosomal binding site (RBS). This section (also shovn in Table A, lines 1 and 2) vhich contains the RBS has about 47 nucleotides before beginning at its upstream end vith a Bam HI site (inserted in prior plasmids to link the section vith the E. coli promoter section (indi-15 cated by an arrov in Fig 1). The promoter and RBS sections are arranged and joined to be in proper reading frame coordination vith the coding sequence for the endotoxin. Hence, the thick dark lines and boxes together represent DNA having origin in B.t. kurstaki HD-1. 20 Various other restriction sites indicated in Fig 1 vere relevant to the strategy for the conventional removal and reinsertion of sections of DNA for mutation experiments. These other restriction sites are the Nsi I site (beginning after about only 26 nucleotides from the start of the endotoxin coding sequence), the tvo Xba I sites (see belov, hovever, 25 concerning prAK-3), the Sst I site and the Hind III site.

As indicated above, prAK-3 differs from prAK only in a single minor respect. This difference is that the Xba I site (TCT AGA) at nucleotide positions 292 to 297 of Table A vere changed using standard techniques 30 to TCG CGA, thereby defining an Nru I site. No change in the coded amino acid sequence resulted from this change. The preparation of prAK-3 is described in Step a) of Example 1 hereinafter. prAK-3 is also the first intermediate in preparing other plasmids prAK-7 and prAK-9. -14- DNA sections, derived from different lengths of single stranded DNA sections from prAK and prAK-3 (both sense and anti-sense strands) mutated in a conventional manner, such as described by for example, Craick in Biotechniques Jan/Feb 1985, pages 12-19; "Use of Oligonucleotides for Site-Specific Mutagenesis", are indicated for convenience herein as M-l and M-2, M-l defining the 375 base pair section betveen the two Xba I sites in prAK and M-2 being the section betveen the Bam HI and Xba I sites in prAK-3 (as shovn in Fig 1).

The mutation found betveen the tvo Xba I sites In accordance vith the invention may be readily obtained using the plasmids prAK-7, prAK-8 or prAK-9 disclosed herein and synthetic double stranded oligonucleotides constructed and used analogously to the procedures described in Example 2 hereof.

Folloving mutation, the mutated single strand portions vere rendered double stranded by conventional means. In the case of the M-l mutants, using prAK as a mutation vehicle, the resulting double stranded, mutate plasmids vere transformed into E. coll JM103, plated on YT agar containing 50 yg/ml ampicillin and incubated overnight to obtain a plurality of colonies vith a variety of different mutations in plasmids the same as prAK except for the mutations.

In the case of the M-2 mutants, the mutated double stranded region betveen the Bam HI and Xba I sites in the mutation vehicles vere excised using Bam HI and Xba I restriction endonucleases, respectively, and ligated into prAK-3 vectors digested vith the same tvo enzymes. The resulting M-2 region mutant-containing prAK-3 plasmids vere transformed into E. coll JM103, plated on TT agar vith 50 ug/ml ampicillin and incubated overnight to obtain another plurality of colonies involving a variety of different mutations.

Testing to demonstrate activity of mutagenised endotoxin sequences, expressed from DNA contained in, for example E. coli JM103 or E. coli SG4044 (publicly available from the Agricultural Research Culture Collection (NRRL), Peoria, Illinois under Repository No. B-15969) vas performed in one or both of the Tobacco Budvorm assay (TBV) or T. ni assay as described in Example A hereinafter. DNA of mutants shoving increased activity over standard non-mutant endotoxin vas sequenced in the relevant areas of mutation to determine the mutation in the DNA and hence in the protein sequence. More than 6,000 different colonies vith plasmids containing either M-l or M-2 mutagenised sections vere thus evaluated and generally, from 1 to 3 amino acid changes vere found to have taken place in each mutation experiment.

Table B belov, identifies the up-mutants recovered directly as a result of the mutation experiments, the amino acid position vith reference. to the position numbers assigned in Table A at vhich each mutation occurred, each codon mutated in each mutant and the amino acid change resulting at the indicated position as a result of the codon change.

In Table B the minus or negative amino acid position numbers indi- 20 cate changes betveen the Bam HI site and the one position Met at the beginning of the endotoxin sequence, such changes therefore not affecting the sequence of the endotoxin coded for by the mutant sequence. 2^ The mutants identified in Table B, belov, vere evaluated in all three phases of the TBV Assay producing results as reported belov in Table B-l. Various 6f these mutants vere also evaluated in the T. ni assay, the results of vhich are illustrated belov in Table B-2. 30 -16- TABLE B MUTATION POSITION CHANGE IN ENDOTOXIN I AREA SECTION MUTANT AMINO ACID NUCLEIC ACID AMINO ACID M-l p26-3 119 GCA to ACA Ala to Thr 130 ATG to ATA Met to lie 201 GGC to GAC Gly to Asp M-l p48al4 101 GAA to AAA Glu to Lys 116 GAG to AAG Glu to Lys 217 CGT to CAT Arg to His M-1 p48c5 116 GAG to AAG Glu to Lys 187 GCG to ACG Ala to Thr M-l p36a65 122 ACT to ATT Thr to lie 125 GCA to GTA Ala to Val M-2 p95a76 123 AAT to TAT Asn to Tyr M-2 P95a86 188 ACT to TCT Thr to Ser M-2 p98cl 188 ACT to TCT Thr to Ser M-2 p99c62 204 ACA to ACT Thr to Thr 105 AAT to TAT Asn to Tyr 4 AAT to TAT Asm to Tyr M-2 pl07c22 194 AAT to AAA Asn to Lys 94 AAC to AAA Asn to Lys M-2 pl07c25 184 TTT to ATT Phe to lie -11 TTG to TAG .

M-2 pll4a30 95 CAA to AAA Gin to Lys -15 TAT to TAA In Table B-l, belov, the lover score in the toxicity column indicates the greater level of activity (see Example A for an explanation of toxicity scores) and the controls involved an equivalent amount of E. coli JM103 cells and E. coli SG4044 cells vhich had not been transformed vith any plasmid. It is noted that all mutants vere indicated to be substantially more active than the truncated native endotoxin produced 10 15 by an equivalent amount of such cells containing the plasmid prAK.

TABLE B-l MUTANT VITH REFERENCE TOXICITY SCORE TO TABLE B MEAN TOXICITY p26-3 2.75 p48al4 2.25 p48c5 2.63 p36a65 1.50 p95a76 2.50 p95a86 1.30 p98cl 1.33 p99c62 1.83 pl07c22 1.42 pll4a30 2.00 control (JM103 cells) 4.68 prAK 3.35 control (SG4044 cells) 4.12 TABLE B-2 MUTANT VITH REFERENCE RELATIVE TO TABLE B POTENCY p26-3 217 p36A65 887 p95a76 291 pl07c22 357 pll4a30 239 control (SAN415) 59 pBT301 100 In Table B-2 above, the standard, pBT301 is assigned a relative potency of 100, according to LD50 (for a fuller description see Example -18- A), and thus any relative potency value higher than this indicates an increased level of toxicity caused by the mutation.

In additional work in furtherance of the invention, certain of the mutant DNA shovn by Table B above to involve multiple mutations vere analysed to determine the effect of individual and-pairs of mutations in such multiple mutated sections. Such sub-cloning of individual mutations or pairs thereof vas carried out using a strategy involving the isolation of * targeted multiple mutated fragment and then cutting it at a restriction site internal to the fragment and located betveen tvo of the mutated codons. The tvo halves or fragment segments vere then gel isolated and each mixed vith non-mutant complementary halves or fragment segments obtained by similarly cutting the same fragments from prAK. The prAK vector vhich had been cut to isolate the larger complementary fragment vas then mixed vith the tvo mixed complementary halves and all three DNA segments ligated together to form a modified prAK plasmid containing the point mutation or mutations existing in the fragment half originating from the multiple mutant clone. More particularly, a site for the restriction endonuclease Xho II vas strategically located vithin certain multiple mutant segments so as to enable the isolation of fragments having less than the total number of mutations in the total mutant segment. As vill be evident, the use of the endonuclease Xho II vas applicable to a number of the multiple mutant segments in Table B for purposes of obtaining fragments vith a single point mutation and others vith tvo mutations. Hence, multiple mutant plasmids vere first treated vith the restriction endonucleases Nsi I and Sst I and the resulting 1430 base pair fragments separated by gel isolation. Each such 1430 bp fragment vas then treated vith the restriction endonuclease Xho II and the resulting 330-bp (Nsi I/Xho II) and 1100 bp (Xho II/Sst I) fragments gel isolated for each multiple mutant. Counterpart, non-mutant fragments of 330 and 1100 bp and the larger, approximately 4Kb Nsi I/Sst I fragment of prAK vere then similarly obtained. More particularly, small quantities of the larger segment vere mixed vith the mutated 330 bp 5 10 15 20 25 30 fragment and the non-mutated prAK 1100 bp fragment and the resulting mixture ligated to form a series of hybrid mutant plasmids of prAK. In a like manner, quantities of such larger prAK segments vere mixed vith the non-mutated 300 bp prAK fragments and the mutant 1100 bp fragments and these DNA ligated to form another series of hybrid mutant plasmids. The hybrid mutant plasmids or clones resulting from the above indicated strategy are summarised belov in Table C vhich shovs the three segments combined and the mutations in the resulting plasmid compared to the plasmid prAK.

TABLE C NEWLY FORMED prAK- DESIG- NATI0N VECTOR SEGMENT AND SOURCE SOURCE OF Nsil/ XhoII SEGMENT 330 bp SOURCE OF XhoII/ SstI SEGMENT 1100 bp MUTATION AMINO ACID POSITION A prAK Nsil/SstI p48al4 prAK Glu to Lys @ 101 4 Kb Glu to Lys @ 116 B n p26-3 prAK Ala to Thr e 119 C H p48c5 prAK Glu to Lys @ 116 D n prAK p48al4 Arg to His 217 E it prAK p26-3 Met to He @ 130 Gly to Asp @ 201 F n prAK p48c5 Ala to Thr @ 187 In a second round of hybrid mutant clone preparation using the same analogous procedure applied in preparing the clones of Table C, a series of mixed combination mutant plasmids vere prepared by the three segment combination of the large segment (roughly 4kb) from the digestion of prAK vith Nsi I and Sst I, a 330 bp Nsi I/Xho II fragment from one of the clones of Table B and a 1100 bp Xho Il/Sst I fragment from a differ-20- ent clone of Table B. The hybrid mutant clones resulting from this second round are shovn belov in Table D, it being noted that tvo plasmids arising from this second round protocol contained four amino acid changes compared to the parent prAK plasmid.

TABLE D NEWLY FORMED prAK- DESIG- NATION VECTOR SEGMENT AND SOURCE SOURCE OF Nsil/ XhoII SEGMENT 330 bp SOURCE OF XhoII/ SstI SEGMENT 1100 bp MUTATION AMINO ACID POSITION 10 15 20 25 30 prAK-J prAK Nsi/Sst p48al4 p26-3 Glu to Lys 101 4 Kb Glu to Lys e 116 Met to lie @ 130 Gly to Asp e 201 prAK-K tt p48al4 p48c5 Glu to Lys @ 101 Glu to Lys 116 Ala to Thr e 187 prAK-L n p48c5 p26-3 Glu to Lys 0 116 Met to lie @ 130 Gly to Asp @ 201 prAK-rM n p26-3 p48al4 Ala to Thr @ 119 Arg to Bis @ 217 prAK-N n p26-3 p48c5 Ala to Thr @ 119 Ala to Thr @ 187 prAK-0 w p48c5 p48al4 Glu to Lys 116 Arg to His 217 prAK-P if p26-3 P36a65 Ala to Thr prAK-3 (add Nru I) > prAK-4 (add Hind III) > prAK-5 (add Mst II) prAK-5 prAK-6 > prAK-6 (add BssH II) •> prAK-7 (delete original Hind III) The above indicated sites vere introduced about 40 base pairs apart such that an automated DNA synthesiser could be used effectively to make small double stranded DNA fragments vhich terminate at their tvo ends vith nucleotides representing the complementary residue of the restriction site residues to be created in prAK-7 vhen it is cut vith the tvo relevant restriction endonucleases. Such fragments therefore could be readily substituted into prAK-7 by standard cutting and ligation procedures (see Example P, infra) to provide a plasmid capable of expressing an endotoxin protein identical to that of prAK except for the amino acid changes coded for by the synthesised fragment substituted into prAK-7 for the corresponding fragment in prAK-7, as exemplified in Example 2 hereof.

Figs 3A and 3B represent tvo small double stranded DNA fragments prepared in accord vith the above codon spin strategy to be substituted into the Hind III/Mst II section in prAK-7. The double stranded fragment shovn in Fig 3A vas designed to produce any amino acid at amino acid position 116 in the truncated B.t. endotoxins expressed by the prAK plasmids by appropriate selection of the XXX codon in accord vith the genetic code. Similarly, the double stranded fragment shovn in Fig 3B vas designed to produce an amino acid at amino acid position 119 in the truncated B.t. endotoxins produced by the prAK plasmids by appropriate selection of the XXX codon in this fragment. As vill be apparent, the other double stranded fragments required for substitution into the Spe I/Nru I location (a fragment span of about 115 base pairs vhich is also preparable by automated DNA synthesisers), the Nru I/Hind III location and the Mst II/BssH II location in prAK-7 and designed to code for all amino acids at all points of mutation found in these sections may be prepared by analogous standard procedures. Hence, the remaining 18 of the 19 natural amino acid changes or mutations to be made at each point of mutation betveen the Nru I and BssH II sites in prAK-7 may be readily made using plasmid prAK-7.

To cover all of the points of mutation vithin the 116 amino acid concerned sequence for conveniently spinning of relevant codons, the plasmid prAK-7 may be used to prepare plasmid prAK-8 vhich in turn is used ultimately to prepare prAK-9, as described in Example 1. Xn Fig 5, all of the relevant restriction sites as ultimately accumulated in prAK-9 are shovn in an expanded cut-avay section of prAK-9. The Spe I site shovn in Fig 5 is also a unique site vhich vas already present in prAK, prAK-3 etc. As vill also be appreciated, the plasmids prAK-7, prAK-8 and prAK-9 may be used to introduce multiple mutation changes betveen any one pair of restriction sites and/or to produce DNA coding for at least one change vithin tvo or more such locations, such that a large variety of multiple mutant combinations involving original points of mutation found in accord vith the invention may be constructed to produce a large variety of nev lnsectlcldally active B.t. endotoxin proteins.

As vill also be appreciated, plasmids such as prAK-7, prAK-8 and prAK-9 are fully capable plasmids for changing any one or more codons vithin any of the restriction site pair locations provided in these plasmids. Where changes are desired vithin one or tvo but less than three such locations, plasmids such as prAK-4 or prAK-5 may be used if covering the desired location of changes, preferably after removal of the original Hind III site in prAK, and if such plasmids are not suitable, it vill be appreciated that a prAK type plasmid containing any one or more of such locations may be prepared conventionally by varying or limiting the selection for introduction of the restriction site pairs used to modify prAK in producing prAK-9. Hence, the invention provides also a variety of novel plasmids useful for production of mutants and mutant combinations in accord vith the invention and containing any one or more of the restriction site pairs ultimately produced in prAK-9. 10 15 20 25 30 As vill also be appreciated, DNA comprising any one or more such restriction site pairs may be excised, before or after modifying to contain one or more mutations in accord vith the invention, from the prAK type plasmids by cutting at restriction sites vhich are outside the desired mutation region(s) and vhich are correspondingly found in another plasmid for a B.t. endotoxin, and then inserting (ligation by standard means) the excised DNA segment into such other B.t. endotoxin plasmid vhich has been similarly cut, thereby enabling such other plasmids to be conveniently modified or for purposes of directly inserting the mutations of the invention therein.

For purposes of incorporating mutations provided by . the Invention into a full length endotoxin coding sequence, a plasmid incorporating the DNA structural gene for the ^-endotoxin of B.t vuhanensis vas used as a matter of convenience and ready availability at the time. This plasmid, pBT210, is shovn in Fig 4. The plasmid pBT210 incorporates the full length endotoxin structural gene from B.t. vuhanensis as indicated by the thick dark line in Fig 4, and by analogy to Fig 1, also incorporates a sequence containing a B.t. rlbosomal binding site vhich vas obtained from B.t. vuhanensis along vith the structural gene and vhich is indicated in Fig 4 by the dark box. The plasmid pBT210 is a fully competent E. coli expression vector Including the same E. coll promoter system as the prAK plasmids, an E. coli origin of replication (not shovn) and a gene for chloramphenicol resistance as Indicated in Fig 4. The arrovs in Fig 4 shov the reading direction of the B.t. vuhanensis gene under control of the E. coli promoter and of the gene for chloramphenicol resistance. 'Based upon sequence information in our possession, the entire operon (structural gene, B.t. derived rlbosomal binding sequence section and E. coll promoter/operator sequence) is very similar and only insignificantly different from the operon in the plasmid prAK. In particular, the DNA coding for the 610 amino acids of the active portion of the B.t. endotoxin (Table A) and extending into the protoxin region at least about up to the Kpn I site shovn in Fig 4 for pBT210 is - 28 - identical to the corresponding DNA sequence in the plasmid prAK.. In the DNA region downstream from the Kpn I site in the B.t. structural gene in pBT210 to the end of such structural gene there are unknown but minor differences compared to the corresponding section of the B.t. kurstaki HD-1 gene truncated in making prAK. These differences were indicated by restriction endonuclease mapping. The plasmid pBT210 codes i:or a full length endotoxin as shown in Table A and is completely homologous In the active portion (and through at least the amino acids produced up to its Kpn I site to the S-endotoxin from B.t. kurstaki HD-1 in clones prAK and pB8rII), and has substantial homology in the balance of the protoxin section. Finally, the rlbosomal binding site in pBT210 is identical to that in prAK and the entire DNA including the rlbosomal binding site (RBS) and extending upstream from just before the initiation Met back through the Bam HI site joining the promoter section are the same in pBT210 and in prAK except that in pBT210 there are tvo nucleotide changes immediately after the Bam HI site (CC instead of GT as in prAK) and three nucleotides (TTT) as found in prAK immediately after such two nucleotides are deleted in pBT210, these differences coming merely as a result of different ligation strategies in joining the RBS sections from B.t. to the E. coll promoter section through a Bam HI site. The plasmid pBT210 may be used to produce full length mutant B.t. ^-endotoxin protein having any one or more of the amino acid changes provided by the present invention. The Nsi I site, the two Xba I sites, the Sst I site and the first appearing downstream Hind III site shown in Fig 4 for pBT210 correspond to the same sites shown in Fig 1 for prAK (the DNA for both plasmids in this region being identical as above indicated).

EXAMPLE A 1. Trichoplusia ni (T. ni) assay Tests vere performed on second instar larvae. All insects vere kept in climatic chambers under standard conditions of temperature, humidity etc throughout the test period, and vere fed on a standard artificial diet. Test substances vere given to the Insects as part of the diet, vith each concentration of test substance being administered to one batch of tventy insects. Insects vere monitored for a period of 7 days after treatment, after vhich time the LDS0 of the insects vas taken. LDso may be defined as an estimate of the dose of substance required to induce mortality in 502 of the subjects. Final results are given as relative potency, vherein; relative potency - LD50 of standard x 100 LDso of experimental Using the above technique the absolute values of LDS0 can be provided vherein interpretation of the results is simple, such that all relative potency values higher than that of the standard indicate an activity higher than that of the standard. Furthermore a substance vith a relative potency of eg 400 vhen compared to a standard of 100, is 4 times more active than the standard.

The standard, having a relative potency of 100 in the above test, vas the plasmid pBT301, vhich plasmid contains a full-length vild-type S-endotoxin sequence, being identical to pBT210 except for containing tvo E. coli promoters, each of vhich individually is the same as that contained in pBT210.

Controls used in the above test vere; - 30 - a) CAG 629 - an E. coli strain containing no S-endotoxin producing plasmids and having no insecticidal (gift from C A Gross, Department of Bacteriology, University of Visconsin). activity per se; b) SAN 415 - a commercially available B.t. insecticide, obtainable under the registered trade name JAVELIN. 2. Tobacco Budvorm assay (TBV assay) The TBV assay employed vas that basically described by Dulmage et al, (1971) J. Invertebr. Path. 18 240-245, and vas performed vith samples done in triplicate in 1 ounce clear plastic souffle caps, vith one 2nd lnstar TBV larva (4 to 5 days old, average veight 1.6 gin) in each cup. The samples vere combined vith 15ml diet (comprising the Nutrient Povder, Vitamin Povder, agar and other ingredients) as described by Dulmage et al, USDA Technical Bulletin No. 1528:1-5 (1976). The diet vas divided evenly among three cups vhich vere alloved to cool for % hour. One TBV vas added (using a size 00 camel hair brush) to each cup and the lids vere securely snapped on. These samples vere then placed in a 27°C, 50X relative humidity incubator for 4 to 5 days. The size group numbers used in scoring the TBV toxicity assay correspond to the veight ranges given in the folloving table. - 31 - GROUP SIZE WEIGHT RANGE (mq) AVERAGE WEIGHT (mg) 1 .0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 6.0 1.3- 1.9 2.7- 3.1 5.5- 6.3 11.7- 12.3 17.3- 22.2 30.8- 34.2 50.1- 52.4 76.6- 94.3 1.6 2.8 5.8 12.0 19.6 32.8 51.1 84.8 113.5 119.9-114.7 119.8-134.3 >140.0 The "Group Size" indicated above equates directly to the toxicity scores reported herein. Hence, the weight of the larva after each test was determined/ and assigned the toxicity score equal to the group corresponding to the weight range into which its weight fell. Except as noted, infra, all dead larvae were assigned a group size and toxicity score of zero. The toxicity scores from all replications were averaged to obtain the results reported herein, and typically all results are based on at least 30 replications. - 32 - The cups were opened until ranges of different size TBWs were located. These TBWs were weighed out until one TBW was located that fell within every weight range. The sample cups containing the TBW of the given weight range were then marked with the corresponding group size number. These cups were then arranged in ascending order on the lab bench. The remaining samples were then scored by visual comparison of size with the weighed sample TBWs and assigned that group number on a score sheet. Dead larvae were recorded with a "+" and assigned a score of zero. Dead larvae which were bright pink or appeared to have liquified were suspscted to have died from causes unrelated to the 3-endotoxin. These larvae were scored with a and not counted in the results.

The standard sample size of 1 ml. of a prAK culture divided among three cups resulted in growth retardation in the middle of the range of toxicity scores. Therefore, the assay was useful in distinguishing the clones with increased toxicity from the ones with reduced or equal toxicity to the nonmutant parent. The assay produced a dose response depending on the amount of prAK culture put into the assay. Hence, the greater the amount of prAK-containing bacteria that was added to the samples, the greater the degree of toxicity to the TBW was observed. The dose response curve of prAK was useful in evaluating the degree by which clones were more toxic than the nonmutant parent. The following table illustrates the dose response of the prAK-containing bacteria: Amount of prAK Stationary Culture Added 5 ml 2 Toxicity Scores 1.5 1.5 2.0 2 2.5 2.5 3 3 3.5 3 3.5 4 3.5 4 4 0.5 0.25 - 33 - On the basis of the above evaluation, all cultures were assayed using 1 ml. of culture in order, in relation to the obtained group sizes, to allow em ample range to ascertain those with greater or less activity relative to prAK (and other nonmutant plasmids) as a standard.

The Nutrient Powder used in the TBW Assay was mixed in the following gram weight proportions: soybean flour, 1103.4 g.; wheat germ, 429.4 g.; Wesson Salt Mix, 292.4 g.; sucrose, 164.2 g.; methyl parabenzoate, 24.6 g.; ana sorbic acid, 14.8 g.

The Vitamin Powder used in the TBW Assay mixed in the following gram weight proportions: calcium peutothenate 12.0 g.; Nicotinamide, 6.0 g•; Riboflavin, 3.0 g.; folic acid, 3.0 g.; thiamine Hcl, 1.5 g.; pyridoxine Hcl, 1.5 g.; Biotin, 0.12 g.; and Vitamin B12, 6.0 g.

The following three screening applications of the TBW Assay (Primary, Secondary and Dilution-Series) were employed at various stages of evaluation, and are referred to in this specification.

Primary Assay: One ml aliquots from 18 hr cultures of two separate clones were combined in with TBW diet in a 50 ml conical centrifuge tube and divided evenly between three cups (with one TBW per cup). These samples were evaluated alongside controls of wild type prAK or pBT210 transformed cells and untransformed cells prepared in the same manner.

Secondary Assay: Samples which displayed increased toxicity toward the TBW's in the primary assay were screened in a second assay* Selected mutant colonies were innoculated from the library plates into YT/Amp broth (one colony per culture). Ten 1 ml samples were evaluated along with appropriate controls. Clones exhibiting increased toxicity to TBW's were designated as "probable up-mutants" and were evaluated a third time. Those that repeated their "up" phenotype a third time were identified as "up-mutants" and evaluated in a Dilution-Series Assay to more precisely - 34 - determine level of enhanced activity versus the parent wild type.

Dilution-Series Assay: Mutants confirmed to display an "up" phenotype over the non-mutant construction were 5 screened in the TBW assay in a dilution series based on dry weight of lyophilized bacterial cells that contained either the mutant or wild type toxin from prAK or pBT210 clones that were grown for 18 hours (and the cells pelleted prior to lyophilizing). Samples were set up in triplicate at each 10 of the following dilutions in a final volume of 15 ml: 167jjg/ml, 67jig/ml, and 33ug/ml. SDS-PAGE and Western (immunoblot) analysis was performed on the protein from these mutants, typically at 75 /ug dry weight cells per lane. The Dilution-Series results essentially confirmed the 15 results of the previous assays and are not otherwise reported herein or averaged in the Tables hereof which report biological results.

EXAMPLE P. - REGULAR PROCEDURES 20 In the following numbered examples or otherwise in this specification the following regular or standard laboratory procedures were used where referenced to the following or otherwise required, unless the text hereof indicate 25 otherwise.

Example P-1: Maintenance and Growth of Bacterial and Phage Stralni3 E. coli strains SG4044 and JM103 were host for all 30 plasmid constructions. E» coll strain JM103 and the phage M18 and MP19 were obtained from New England biolabs. These bacterial strains were grown in YT medium (5 g/1 yeast extract, 10 g/1 bactotryptone, 5 g/1 Na CI). Medium was supplemented with 50 mg/1 ampicillin for growth of cells containing prAK or derivatives of this plasmid and with 20 - 35 - mg/ml chloramphenical for cells containing pBT210 or derivatives of this plasmid.

Example P-2: Propagation and Isolation of Phage DNA Preparation of Ml3 derived recombinant phage stocks and isolation of phage DNA was done using previously described procedures (Messing, J. (1983) Methods Enzyr.cl. 101 :20-78).

Example P-3: Preparation of Synthetic Oligonucleotides Synthetic oligonucleotides were prepared using automated synthesis with an Applied Biosystems (Foster City, CA) 3 80A DNA synthesis machine.

Purification steps once the cycle was complete were as follows. The synthetic oligonucleotide was deblocked by adding an equal volume of ammonium hydroxide and incubating at 55*C overnight. After removing the ammonium hydroxide by successive rounds of speed-vacuum centrifugation and resuspensions in distilled H2O, the oligonucleotide was further purified by urea-polyacrylamide gel electrophoresis (Urea-PAGE). To visualize the band the gel was placed on a R " twin layer chromatography plate covered with Saran wrap (registered trademark) and the oligonucleotide was illuminated with short wave ultraviolet light. After cutting the oligonucleotide containing portion of the gel with a razor blade, the oligonucleotide was eluted from the gel in 0.5M ammonium acetate, 1mM EPTA, pH 8.0 at 37*C overnight with agitation. After eluting overnight, the gel fragments were pelleted at 6000 RPM in a JA20 rotor and the supernatant containing the eluted oligonucleotide was transferred to a fresh tube.

ETOH precipitation was used to concentrate the oligonucleotide and it was quantified by absorbance at O.D. 260. 200 pmol of the oligonucleotide was kinased in a 40 ^1 reaction with 2 units of T4 polynucleotide kinase and 0.05mM ATP. - 36 - Example P-4: DNA Transformation of E. coli cells A) E. coli JM103 or SG4044 competent for DNA transformation were prepared as described by a commonly used procedure (Cohen, S.N., Chang, A.C.P. and Hsu, L.

[1972] Proc. Natl. Acad. Sci. USSA 69:2110-2114). For site-directed oligonucleotide mutagenesis experiments, heteroduplex recombinant phage (M13) DNA (60ng) was added to 0.2 ml of competent cells and held at 0*C for 15 minutes. The cells were subsequently held at 42"C for 2 minutes and 30 ul of this mixture was added to 3 ml of YT broth containing 0.7% bacto agar held at 42*C. to prevent solidification and 0.2 ml of a fresh overnight culture of JM103 or SG4044. The mixture was immediately spread on a YT agar plate (YT broth plus 1.5% bacto agar) and the plates (inverted) were incubated overnight at 37*C.

B) Plasmid DNA (100ng) from mutagenesis experiments or any other ligations involving prAK or pBT210 vectors as described herein was added to 0.2 ml of competent cells (JM103 or SG4044) and held at 0*C for 30 minutes. The cells were subsequently held at 42*C for 2 minutes and returned to em ice bath. Amounts from 2 jjI to 200 jil were plated on YT agar containing 50 jiq/val ampicillin for clones based on prAK and 20 jig/wl of chloramphenicol for clones based on pBT210 and incubated overnight at 37*C.

Example P-5» Restriction Enzyme Digestion All restriction enzymes were purchased from either Bethesda Research Labs (Gaithersburg, MD) or New England Biolabs. Incubation conditions were those recommended by the manufacturer. - 37 - Example P-6: Ligation of DNA Fragments A) DNA ligation reactions (20 ul) contained 60 mM Tris-HCl, pH 7.5, 10mM MgC12, 1 mM dithiothreitol, 50 UM 5 ATP, 20 nM DNA termini and 20 units T4 DNA ligase (New England biolabs). Incubation was at 14*C for 4 hours.

B) Three fragment ligations were set up with fragments present in a 1:1:1 molar ratio at a concentration of 0.04 pmole each in a 20 ul reaction volume. Incubation was at 10 16*C for 4 hours when ligating only a sticky end (eg. XhoII internal site) or overnight for ligating any blunt end (eg. a FnuD2 site). New England biolabs (NEB) T4 Ligase was used at a concentration of 10 units (NEB definition) per jil reaction volume. 15 Example P-7: DNA Sequencing DNA sequencing of 3-endotoxin genes and their derivatives was done by the chain termination method of 20 Heidecker et al. (Heidecker, G., Messing, J., and Gronenborn, B.

[1980] Gene 10:68-73).

EXAMPLE 1 25 Preparation of Vectors prAK-3, prAK-4, prAK-5, prAK-6 and prAK-7 Step a) Preparation of prAK-3 1 ug of the plasmid pB8rII (shown in Fig. 2 and 30 described above) and the replicative form of DNA from the well-known M13 phage cloning vectors MP18 and MP19 were simultaneously digested with the restriction endonucleases Bam HI (8 units) and Kpn I (10 units) for 60 minutes at 37*c in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 7.9), 6 mM MgCl2# 100 jag/ml bovine serum - 38 - albumin. Desired fragments from these resulting DNA mixtures were purified by running the entire mixture on a 1% preparative agarose gel to. separate according to size.

Bands were visualized by staining with ethidium bromide and illuminating with long wave ultraviolet light. The gel fragment containing the desired DNA was cut and the DNA eluted by electrophoresis in dialysis tubing. The Bam HI/Kpn I fragment from pB8rII was ligated into the mp18 and mp19 Bam HI/Kpn I cut and gel purified vectors by incubating for 4 hours at 14*C. in a toted volume of 20 1 containing 60 mM Tris-Hcl, pH 7.5, 10 mM MgCl2, 1 mM dithiothreitol, 50 mM ATP, 20 nM DNA termini. The resulting DNA was transformed to competent E. coli JM 103 cells as in Example P-4 except that the YT plates contained isopropyl thiogalactoside (IPT6) and 5-bromo-4-chloro-3-indolyl--D-galactoside (X gal), both obtained from Sigma Chemical Company. Since recombinant phage (containing the DNA insert cut from pBSrll) will make clear plaques under these conditions, whereas M18 and M19 make blue plaques, the clear plaques were added to 2 ml of E. coli JM103 cells in YT broth, incubated overnight at 37*C and single stranded DNA was prepared from the phage following the procedure as described by J. Messing, J. Methods Enzymol. (1983), 101:20-78. These desired clones containing the large but single stranded DNA inserts from pBSrll were identified using agarose gel electrophoresis by virtue of their slower mobility as compared to mp18 or mp19. Sequencing of a portion of these clones that included the endotoxin DNA by the dideoxy chain termination method confirmed the presence of the endotoxin DNA and indicated that mp18 had acquired the antisense stand thereof and that mp-19 had acquired the sense strand thereof, both of which were recovered. A 26 base antisense oligonucleotide having the sequence 5 • GTC CTT CTA ATC GCG AAA TGG CTT GG3' was prepared by solid phase synthesis in the automated DNA - 39 - " synthesizer, and kinased with T4 polynucleotide kinase and ATP as described by Maniatis et al., Molecular Cloning (1982): A Laboratory Manual; Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. A mixture in total volume of 60 5 ul. containing 0.4 jjg. of the recombinant phage mp19 containing the endotoxin sense strand, 20 mM Tris-Hcl, pH 7.5, 7 mM MgCl2* 1mM dithiothreital, 50 mM sodium chloride and 10 ng of the 26 base antisense oligonucleotide was heated at 68°C. for 15 minutes, then at 37*C. for 10 minutes 10 and placed at 0*C. The resulting mixture containing the mp19 recombinant DNA with the mutagenic oligo annealled was then treated by addition of 0.2 mM of each of dATP, dCTP, dTTP and dGTP, 1 mM of ATP, 4 units of DNA Polymerase I Klenow fragment (from New England Biolabs), 0.5 ug of E. 15 coli single strand binding protein (from Pharmacia, Piscataway, N.J.) and 20 units T4 DNA ligase (New England Biolabs). The resulting mixture was incubated at 14*C. for 4 hours for polymerization and ligation to occur and the resulting circular double stranded heteroduplex DNA was 20 transformed into E. coli JM103 and plated as described in Example P-4. Twenty (20) individual plaques were then selected and single strand DNA isolated from the phage as described by Maniatis et al., supra. DNA from phage of the twenty (20) plaques each in a total volume of 20 1 and 25 containing 50 mM Tris-Hcl, pH 8.0, 50 mM KC1, 10 mM MgC^* 10 ng of the above?indicated antisense 26 base oligonucleotide and 0.2 ug of different circular single strand phage DNA molecules were each heated at 68*C. for 15 minutes and placed at 37*C. for 10 minutes. The restriction 30 endonuclease Nru I (8 units) was added to each resulting mixture and incubation at 37*C was continued for 1 hour. The mixture was electrophoresed through a 0.8% agarose gel. About 10% of the samples contained DNA migrating as linear DNA to enable the identification of the positive clones containing the desired Nru I site, and positive clones were - 40 - c transformed into E. coli JM103 to ensure purification. DNA between the Bam HI and Xba I site in the positive clones was excised therefrom (after annealling with ml 3 sequencing oligo and polymerizing to make double stranded as described 5 above for the Nru I oligo) by simultaneous cutting- with the endonucleases for these sites and ligated (Example P-6A) with the large fragment (about 5004 base pairs and missing the about 749 bp fragment between the Bam HI and the second Xba I site in prAK) which was obtained and gel purified 10 after complete digestion of prAK simultaneously with the same two restriction enzymes, all in a conventional manner to form the plasmid prAK-3.

Step b) Preparation of prAK-4 15 Following the essentially total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step a) was annealed to a 25 base synthesized antisense oligonucleotide having the sequence 5' CCACTCTCTAAAGCTTTCTGCGTAA3 , 20 designed to introduce the Hind III site between nucleotide position number 327 and 351 in the Table A nucleotide sequence. Positive clones now having both the desired Nru I and Hind III sites were identified in a frequency of about 6.6% by cleavage evaluation with the nuclease Hind III, and 25 were used to prepare prAK-4 by ligating the Bam Hl/Xba I fragment with the new sites to the 5004 bp large fragment f rom prAK in the manner of Step a).

Step c) Preparation of prAK-5 30 Following essentially the total procedure which is analogous to Step a), the single stranded phage DNA obtained in Step b), above, was annealed to a 26 base synthesized antisense olegonucleotide having the sequence 5' GCATCTCTTCCCTTAGGGCTGGATTA3 , designed to introduce the Mst II site between nucleotide - 41 - position number 366 and 391 in the Table A nucleotide sequence. Positive clones now having all three of the desired Nru 1/ Hind III and Mst II sites were identified in a frequency of about 9.1% by cleavage evaluation with the ^ restriction enzyme Mst II, and were used to prepare prAK-5.

Step d) Preparation of prAK-6 Following essentially the total procedure which is analogous to Step a), above, the positive double stranded phage clones from Step c), above, were converted into single stranded phase DMA and annealed to a 26 base synthesized antisense oligonucleotide having the sequence 5» GCGGTT6TAAGCGCGCTGTTCATGTC3 , designed to introduce the Bss HII site between nucleotide position number 406 and 431 in the Table A nucleotide sequence. Positive clones now having all four sites ultimately desired in prAK-7 were identified in a frequency of about 12.5% by cleavage evaluation with the enzyme Bss HII, and were used to prepare prAK-6. 20 Step e) Preparation of prAK-7 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step d), above, was annealed to a 26 base 25 synthesized antisense oligonucleotide having the sequence 5' TACAGTCCTAAATCTTCCGGACTGTA3 , designed to eliminate the Hind III site between nucleotide positions number 1682 and 1707 in the Table A nucleotide sequence. Positive clones representing the total sequence 30 desired for prAK-7 were identified in a frequency of about 2.8% by restriction endonuclease screening of the replicative form (double-stranded) of the recombinant phage DNA for the loss of the Hind III site between nucleotides 1682 and 1707. Double-stranded DNA isolated from the mutant was used to prepare prAK-7. - 42 - To complete the provision of a plasmid (prAK-9) having suitably unique and spaced restriction sites for conducting codon spin experiments at other points of mutation between the two Xba I sites the development of the prAK series plasmids may be continued analogously to the following steps to prepare a plasmid prAK-8 and therefrom prAK-9 as indicated below in Steps f) and g).

Step f) Preparation of prAK-8 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step e), above, was annealed to a 27 base synthesized antisense oligomer having the sequence: 5•TCCCCACCTTTGGCCAAACACTGAAAC 3• designed to introduce a Bal I restriction site at about nucleotide position number 534 in the Table A nucleotide sequence. Positive clones (prAK-8 now having all five of the desired Nru 1, Hind III, Mst II, BssHII and Bal I sites and missing the Hind III site removed in preparing prAK-7 are identified in the manner of Step a), above.

Step g) Preparation of prAK-9 Following essentially the procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step f), above, was annealed to a 30 base synthesized antisense oligomer having the sequence: 5* GTTGC CAATAAGACGCGTTAAATCATTATA 3' designed to introduce a Mlu I restriction site between nucleotide position number 588 and 595 in the Table A nucleotide sequence. Positive clones now having all six of the desired Nru I, Hind III, Mst II, BssHII, Bal I and Mlu I restriction sites and missing the Hind III site removed in forming prAK-7 are identified in the manner of Step a) and denominated as plasmid prAK-9.

As will be evident, cassette DNA suitable for substitution between the Bal I and Mlu I sites in prAK-9 may be appropriately coded to introduce all possible codon and - 43 - amino acid variations at the mutated amino acid positions 164, 187, 188 and 194.

In a like manner, cassette DNA suitable for substitution between the Mlu I and second Xba I site may be 5 appropriately coded to introduce all possible codon and amino acid variations at the mutated amino acid positions 201 and 204.

Fig. 5 is a schematic representation of the unique restriction sites introduceable between the two original 10 Xba I sites found in prAK (the first such Xba I site in prAK-9 now being the Nru I site).

Underlining in the antisense oligonucleotides shown above in the various steps of Example 2 indicates the change or changes to be introduced. 15 EXAMPLE 2 Codon Spin Experiments A) Single stranded oligonucleotides having the sequence of each of the two strands shown in Fig. 3A 6 3B were 2o prepared as described in Example P-3 with the DNA synthesizer programmed to randomly insert all of the nucleotides A, T, C and G at each of the X-positions in each strand shown in Fig. 3A. A total of approximately 200 ug (after purification) of DNA from each run on the machine 25 such single strands (representing a family of oligonucleotides identical except at the X-positions of each strand, were prepared by such procedure. 10 pmoles of each strand, sense and antisense for each codon spin were en masse combined and annealled by heating at 68*C for 10 30 minutes, then at 37*C. for 10 minutes, cooling to room temperature and placing on ice. The resulting mass of double stranded oligomers conforming to the DNA shown in Fig. 3A was judged to contain at the XXX positions (amino acid position 116) every combination permitted by the genetic code including stop signals and multiple but varying - 44 - numbers of "codons for each of the 20 natural amino acids plus stop signals. 1 pmole of these double strand oligomers or cassettes were then kinased with T4 polynucleotide kinase from New England biolabs and mixed en masse with th& larger fragment (present at a 10 fold less molar concentration) obtained by gel isolation after the simultaneous cleavage of the plasmid prAK-7 with the restriction endonucleases Hind III and Mst II in 100 mM NaCl 10 oM Tris-HCl pH 7.5, 10 mM MgCl2, 10mM 2-mercaptoethanol and 100 /ig/ml BSA, and the resulting mixture was subjected to ligation in accord with Example P-6(A). An aliquot (5 pi) of the resulting ligation mixture was then used to transform E. coli JM 103 under the conditions of Example P-4(B). A number (200) of the resulting transformed cells individually were subjected to the TBW and T.ni Assays (without prior knowledge of what codon at XXX was in any particular clone) and found to produce an activity level fairly indicating that all of the various different mutants had resulted in an insecticidal 1y active protein product having activity of at least about that of the control truncated endotoxin, with clear up-mutants (5X control) also indicated. Prior to this, random cells from the transformation were also selected, plated and colonies grown as in Example P-1 to isolate plasmid DNA for DNA sequence analysis by cloning the Baa HI/Xba I fragment into the sequencing vectors mp18 and mpl 9 cut with the aame enzymes. The DNA in the region of each of eleven (11) such position -116 mutations and the identified up-mutants was then sequence to determine the amino acid coded for at its 116- position. It was found that one of the two up-mutants was the original up-mutant (116-Lys, but coded for by AAA). The other up-mutant was found to 116- Arg coded for by CGT. One of the other clones was found the native 116-GXu (but coded by GAA). Seven of the other light mutants were 116-Ile (ATT), 116-Cys (TGC), 116-Leu (CTC), 116-Asp (GAT), 116-Asn (AAC), 116-Ile (ATT) and 116-Gly (GGA), all unique - 45 - except the new 116-Ile (ATT) was represented by two of the clones. The final clones coded for 116-STOP (TGA).

B) The procedure of part A) of this Example 2 was repeated for amino acid position-119 using the DNA shown in 5 Fig. 3B. Again, the random evaluation of a large number of resulting clones produced an activity level in the TBW and T.ni Assays fairly indicating that all mutant clones in the pool were active. (The % of inactive molecules was approximately equal to what frequency of STOP codons UAA, (JAG, and UGA 10 would be expected from the random input by the machine of the nucleotides at the XXX positions). Seven randomly selected individual clones were each indicated to have an activity level at least approximately that of the truncated native sequence endotoxin produced by prAK, but none was an 15 up-mutant by our arbitrary standard. Sequencing of the seven individual clones showed that they were all different and unique, as follows: 119-Leu (CTA), 119-Tyr (TAC), 119-Asp (GAT), 119-His (CAT), 119-Pro (CCA), 119-Ile (ATT) and 119-Ser (TCT). 20 EXAMPLE 3 Mutant Full Length B.t. Endotoxin 25 The plasmid pBT210 (1 yg) was simultaneously cut with restriction endonucleases Bam HI (8 units) and Sst I (8 units) for 60 minutes in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 7.9) 6mM MgCl2* and 100 jag/ml bovine serum albumin. The larger fragment of 30 about 7180 base pairs was gel purified for use as a vector. Then one /ig of plasmid prAK-26-3 involving the mutations Ala >Thr 9 119, Met >Ile @ 130 and Gly >Asp § 201 was also simultaneously cut with the restriction endonucleases Bam HI (8 units) and Sst I (8 units) in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH - 46 - 7.9)/ 6mM MgCl2, and 100 jug/ml bovine serum albumin. The smaller fragment of about 1,428 base pairs containing the mutations as well as the B.t. RBS section was gel purified and such fragment in an amount of about 0.06 p moles was combined for ligation with 0.02 p moles of the 7180 base pair vector fragment above obtained and joined together in 20 1 of ligation medium containing 60 mM Tris-Hcl. pH 7.5, 10 mM MgCl2, 1mM dithiothreitol, 50 MATP, and 20 units of T4 DNA ligase, and the resulting mixture incubated for 4 hours at 14*C. The resulting plasmid, designated pBt 26*3, was transformed into E. coli JM103 by adding 5 jjI of said ligation mixture to 0.2 ml. of competent E. coli JM103, holding initially at 0*C for 30 minutes and then pulsing at 42*C for 2 minutes and returning to ice. Various amounts (2 pi, 20 jul, and 180 jul of the resulting mixture was then immediately spread on YT agar plates with 20 pg/ml chloramphenicol (YT broth plus 1.5% bacto agar) and the plates incubated overnight at 37*C. inverted. Only a transformed cell with chloramphenicol resistance could grow on these plates. Chloramphenicol resistant colonies were grown in liquid culture overnight at 37*C and plasmid DNA was prepared for restriction digestion with EcoRl reagents and DNA sequencing to actually determine the presence of the point mutations. Successful transformants containing the plasmid pBT 26-3 were then evaluated in the TBW and T.ni Assays.

Proceding analogously to Example 3, above, the following additional full length mutant endotoxins were prepared and evaluated in the TBW and T.ni Assays. Table F below indicates the additional full length mutant endotoxin producing plasmid/cell systems that were so prepared, all with the approximate results of their evaluation in the TBW Assay and the approximate results obtained in such assay for the product of Example 3, above, the B.t. Wuhanensis native endotoxin produced in E. coli JM103 and a control involving untransformed JM103 cells. - 47 - TABLE P Example No.

New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation(s) Involved TBW Assay Toxicity Score 3 PBT26-3 prAK-26-3 119-Thr 130-Ile 201-Asp 1 3-A pBT36a65 prAK-36a6 122-Ile 125-Val 2 3-B pBT-C prAK-C 116-Lys 1 3-C pBT-E prAK-E 130-Ile 201-Asp 2 3-D pBT-0 prAK-0 116-Lys 217-His 2 3-E pBT-R prAK-R 101-Lys 116-Lys 122-Ile 125-Val 2 3-F pBT98cl prAK-98cl 188-Ser 2 3-G pBT-B prAK-B 119-Thr 2 3-H pBT-D prAK-D 217-His 3 3-1 pBT-F prAK-F 187-Thr 2.5 3-J pBT-J prAK-J 101-Lys 116-Lys 130-Ile 201-Asp 3 3-K pBT-M prAK-M 119-Thr 217-His 2.5 3-L pBT-N prAK-N 119-Thr 187-Thr 3 3-M pBT-S prAK-S 119-Thr 188-Ser 1 - 48 - f I TABLE F (cont.) 5 10 15 20 25 30 Example No.

New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation( s) Involved TBW Assay Toxicity Score 3-N pBT-T prAK-T 116-Lys 188-Ser 1.5 3-0 pBT-U prAK-U 101-Lys 116-Lys 188-Ser 2 3-P pBT107c22 p107c22 94-Lys 194-Lys 3 3-Q pBT99c62 p99c26 4-Thr 105-Tyr 204-Tyr 3 3-R pBT107c25 p107c25 184-Ile 3 3-S pBT-A prAK-A 101-Lys 116-Lys 3 3-T pBT-K prAK-K 101-Lys 116-Lys 187-Thr 3 3-0 pBT-P prAK-P 119-Thr 122-Ile 125-Val 2.5 3-V pBT-Q prAK-Q 116-Lys 122-Ile 125-Val 3 3-W pBT39 prAK-39 105-Tyr 188-Ser 3 3-X pBT70 prAK-70 119-Thr 184-Ile 1 3-Y pBT68 prAK-68 105-Tyr 130-Ile 201-Asp 1 - 49 - New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation( s) Involved TBW Assay Toxicity Score 3-Z pBT53 prAK-53 105-Tyr 184-IlE 3 Control B.T.

Wuhanensis - - 3 Control JM103 - - 4.7 15 20 25 30 EXAMPLE 4 More Full Length Mutant B.T. Endotoxins The plasmid pBT210 (1 p.g) was simultaneously digested with the restriction endonucleases Bam HI (8 units) and Sst I (8 units) and the resulting 7180 bp large fragment was gel isolated. In a series of separate experiments each (1 ^g) of the plasmids prAK, prAK-E, p26-3, p36a65 and p95a86 was also simultaneously digested with the restriction endonucleases Ban HI (8 units) and Sst I (8 units) and each resulting 1428 bp fragment comprising a portion of a truncated endotoxin coding sequence was gel isolated. Each quantity of these 1428 bp fragments was then separately digested with the restriction endonuclease Fnu 02 (4 units in 6mM NaCl, 6mM Tris HC1 (ph 7.4) 6mM MgCl2, 6mM 2-mercaptoethanol, 100 jig/ml bovine serum albumin). The restriction endonuclease Fnu 02 (also known as Acc 2) cuts each of the various 1 428 bp Bam Hl/Sst I fragments only once and into a 640 bp Bam HI/Fnu 02 fragment and a 788 bp Fnu D2/Sst I fragment, the different fragments from each experiment being purified by agarose gel electrophoresis. - 50 - There vas thus obtained a series of diffeent 640 bp Bam HI/Fnu 02 fragments and a series of different 788 bp Fnu D2/Sst I fragments. By selecting one fragment from each of these tvo series and ligating (Example P-6B) vith the 7180 bp larger fragment obtained from pBT210, there vas obtained a number of nev plasmids harbouring different full length mutant B.t. endotoxin genes. The thus obtained nev plasmids, identified belov in Table G, vere then used to transform E. coli JM103 according to the procedure of Example P-4(A) and the resulting cells vere evaluated for the production of B.t. endotoxin in the TBV assay of Example A, the approximate results obtained in said assay being also reported belov in Table G. Various of the transformed cells containing plasmids as described in Tables F and G vere also evaluated in the T. ni assay, the results of vhich are illustrated belov in Table H.

TABLE G EXAMPLE NO.

NEV FULL LENGTH MUTANT PLASMID IDENTIFICATION SOURCE OF BAM HI/ FNU D2 FRAGMENT SOURCE OF FNU 02/ SST I FRAGMENT ACTUAL MUTATION(S) INVOLVED TBV ASSAY SCORE 4-A 4-B 4-C 4-D 4-E 4-F 66 67 74 106 107 108 p36a65 p26-3 p36a65 p26-3 prAK prAK-E p26-3 p95a86 P95a86 prAK p26-3 prAK 122-Ile 125-Val 201-Asp 119-Thr 130-Ile 188-Ser 122-Ile 125-Val 188-Ser 119-Thr 130-Ile 201-Asp 130-Ile 2.5 3 - 51 - TABLE H PLASMID IDENTIFIC. pBTA pBTC pBT66 pBT107c25 pBTP pBTS pBT67 pBT106 standard pBT301 control SAN415 control CAG629 EXAMPLE 5 Cells transformed vith DNA encoding a mutant endotoxin sequence are grovn in a fermentor, under conditions knovn and standard for such. The vhole contents of the fermentor are, at the end of cell grovth and immediately prior to harvest, subjected to a raise in temperature to approximately 70-80°C. This temperature is maintained for 10 mins before cooling and is sufficient to inactivate the recombinant microorganisms vithout affecting the biological activity of the endotoxin proteins. The fermentor contents are then evaporated under pressure to concentrate to one-third of the previous volume and the resulting concentrate subjected to spray drying at an insertion pressure of about 2000 psi using a heated countercurrent air flov vith an inlet temperature of 140-160°C and an outlet temperature of 20-50°C. The resulting povder is mixed vith carrier such as defatted soybean to form a vettable concentrate. Suitable ratios of such vill depend i.a. on the desired TABLE RELATIVE SOURCE POTENCY F 391 F 299 F 169 F 254 F 340 F 255 G 304 G 367 100 59 0 -52- strength of the final product but may, for example, be 60t40 parts by veight povder to carrier. The resulting concentrate preferably contains from 0.4 to 10X and more preferably 0.8 to 82 active ingredient, in terms of spores or endotoxin protein. The vettable povder is suitably diluted vith vater as is knovn in the art, for spray application.

TABLE A (a) -46 GG ATC CGT TTT AAA TTG TAG TAA TGA AAA ACA GTA TTA lie Arg Phe Lys Leu *** *** *** Lys Thr Val Leu £ TAT CAT AAT GAA 5 Tyr His Asn Glu (-15) ATG GAT AAC AAT Met Asp Asn Asn (1) (4) 10 TTA AGT AAC CCT Leu Ser Asn Pro ACT GGT TAC ACC Thr Gly Tyr Thr 15 CTT TTG AGT GAA Leu Leu Ser Glu £TT GAT ATA ATA Val Asp lie lie 20 TTT CTT GTA CAA Phe Leu Val Gin TTC GCT AGG AAC 25 Phe Ala Arg Asn CTT TAT CAA ATT Leu Tyr Gin He CCT ACT AAT CCA Pro Thr Asn Pro 45 TGT Cys (15) (b) (60) ATT TTT GGT CCC TCT CAA TGG GAC GCA lie Phe Gly Pro Ser Gin Trp Asp Ala n-1 CAG TTA ATT AAC CAA AGA ATA GAA GAA Gin Leu lie Asn Gin Arg lie Glu Glu (m-1) (c) ■ 300 ATT TCT AGA TTA GAA GGA CTA AGC AAT lie Ser Arg Leu Glu Gly Leu Ser Asn (100) (105) 30 (1 35) Notes: (a) is Bam HI site (b) is Spe I site (c) is Xba I site - 54 - V GAC ATG AAC AGT GCC CTT ACA ACC GCT ATT CCT CTT TTT GCA GTT Asp Met Asn Ser Ala Leu Thr Thr Ala lie Pro Leu Phe Ala Val (140) 10 CAA AAT TAT Gin Asn Tyr AAT TTA CAT Asn Leu His 549 AGG TGG GGA Arg Trp Gly TTA ACT AGG Leu Thr Arg CAA GTT CCT CTT TTA TCA GTA TAT GTT CAA Gin Val Pro Leu Leu Ser Val Tyr Val Gin 523 TTA TCA GTT TTG AGA GAT GTT TCA GTG TTT Leu Ser Val Leu Arg Asp Val Ser Val Phe 577 TTT GAT GCC GCG ACT ATC AAT AGT CGT TAT Phe Asp Ala Ala Thr lie Asn Ser Arg Tyr 606 n-348 624 CTT ATT GGC AAC TAT ACA GAT CAT GCT GTA Leu lie Gly Asn Tyr Thr Asp His Ala Val (m-116) 495 GCT GCA Ala Ala (165) GGA CAA Gly Gin (180) AAT GAT Asn Asp (195) CGC TGG Arg Trp (210) (cl) 67 5 15 TAC AAT ACG GGA TTA GAG CGT GTA TGG GGA CCG GAT TCT AGA GAT Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg Asp (225) TGG ATA AGA TAT AAT CAA TTT AGA AGA GAA TTA ACA CTA ACT GTA Trp lie Arg Tyr Asn Gin Phe Arg Arg Glu Leu Thr Leu Thr Val ?n TTA GAT ATC GTT TCT CTA TTT CCG AAC TAT GAT AGT AGA ACG TAT Leu Asp lie Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr (255) CCA ATT CGA ACA GTT TCC CAA TTA Pro lie Arg Thr Val Ser Gin Leu CCA GTA TTA GAA AAT TTT GAT GGT 25 Pro Val Leu Glu Asn Phe Asp Gly GGC ATA GAA GGA AGT ATT AGG AGT Gly lie Glu Gly Ser lie Arg Ser AAC AGT ATA ACC ATC TAT ACG GAT Asn Ser lie Thr lie Tyr Thr Asp 30 TGG TCA GGG CAT CAA ATA ATG GCT Trp Ser Gly His Gin lie Met Ala ACA AGA GAA ATT TAT ACA AAC Thr Arg Glu lie Tyr Thr Asn AGT TTT CGA GGC TCG GCT CAG Ser Phe Arg Gly Ser Ala Gin CCA CAT TTG ATG GAT ATA CTT Pro His Leu Met Asp He Leu GCT CAT AGA GGA GAA TAT TAT Ala His Arg Gly Glu Tyr Tyr TCT CCT GTA GGG TTT TCG GGG Ser Pro Val Gly Phe Ser Gly Note: (d) is Xba I site - 55 - CCA Pro GAA Glu TTC Phe ACT Thr TTT Phe CCG Pro CTA Leu TAT Tyr GGA ACT Gly Thr ATG GGA AAT Met Gly Asn GCA Ala GCT Ala CCA Pro CAA Gin CAA Gin CGT Arg ATT lie GTT Val GCT Ala CAA Gin CTA Leu GGT Gly CAG GGC GTG Gin Gly Val TAT Tyr AGA Arg 5 ACA Thr TTA Leu TCG Ser TCC Ser ACT Thr TTA Leu TAT Tyr AGA Arg AGA Arg CCT Pro TTT Phe AAT Asn ATA lie GGG Gly ATA lie AAT Asn AAT Asn CAA Gin CAA Gin CTA Leu TCT Ser GTT Val CTT Leu GAC GGG Asp Gly ACA Thr GAA Glu TTT Phe GCT TAT Ala Tyr 10 GGA Gly ACC Thr TCC Ser TCA Ser AAT Asn TTG Leu CCA Pro TCC Ser GCT Ala GTA Val TAC Tyr AGA Arg AAA Lys AGC GGA Ser Gly ACG Thr GTA Val GAT Asp TCG Ser CTG Leu GAT Asp GAA Glu ATA lie CCG Pro CCA Pro CAG Gin AAT Asn AAC Asn AGC Asn GTG Val CCA Pro CCT Pro AGG Arg CAA Gin GGA Gly TTT Phe AGT Ser CAT His CGA Arg TTA Leu AGC Ser CAT His GTT Val TCA Ser ATG Met 15 TTG Phe CGT Arg TCA Ser GGC Gly TTT Phe AGT Ser AAT Asn AGT Ser AGT Ser GTA Val AGT Ser ATA lie ATA lie 1350 AGA GCT Arg Ala (4501 CCT Pro ATG Met TTC Phe TCT Ser TGG Trp ATA lie CAT His CGT Arg AGT Ser GCT Ala GAA Glu TTT Phe AAT Asn AAT Asn ATA lie 20 ATT He CCT Pro TCA Ser TCA Ser CAA Gin ATT lie ACA Thr CAA Gin ATA lie CCT Pro TTA Leu ACA Thr AAA Lys TCT Ser ACT Thr AAT Asn CTT Leu GGC Gly TCT Ser GGA Gly ACT Thr TCT Ser GTC Val GTT Val AAA Lys GGA CCA GGA Gly Pro Gly TTT Phe ACA Thr 25 GGA Gly GGA Gly GAT Asp ATT lie CTT Leu CGA Arg AGA Arg ACT Thr TCA Ser CCT Pro GGC CAG Gly Gin ATT lie TCA Ser ACC Thr TTA Leu AGA Arg GTA Val AAT Asn ATT lie ACT Thr GCA Ala CCA Pro TTA Leu TCA Ser CAA AGA TAT Gin Arg Tyr CGG Arg GTA Val AGA Arg ATT lie CGC Arg TAC Tyr GCT Ala TCT Ser ACC Thr ACA Thr AAT Asn TTA Leu CAA Gin TTC Phe CAT His ACA Thr TCA Ser 30 ATT lie GAC Asp GGA Gly AGA Arg CCT Pro ATT lie AAT Asn CAG Gin GGG AAT Gly Asn TTT Phe TCA Ser GCA Ala ACT Thr ATG Met AGT Ser AGT Ser GGG Gly AGT Ser AAT Asn TTA Leu CAG Gin TCC Ser GGA Gly AGC Ser TTT Phe AGG Arg ACT Thr GTA Val GGT Gly TTT Phe ACT Thr ACT Thr CCG Pro TTT Phe AAC Asn TTT Phe TCA Ser AAT GGA Asn Gly TCA Ser AGT Ser GTA Val TTT Phe ACG Thr - 56 - TTA AGT GCT CAT GTC TTC AAT TCA GGC AAT GAA GTT TAT ATA GAT Leu Ser Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr lie Asp CGA ATT GAA TTT GTT CCG GCA GAA GTA ACC TTT GAG GCA GAA TAT Arg lie Glu Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr (610) 5 GAT TTA GAA AGA GCA CAA AAG GCG GTG AAT GAG CTG TTT ACT TCT Asp Leu Glu Arg Ala Gin Lys Ala Val Asn Glu Leu Phe Thr Ser TCC AAT CAA ATC GGG TTA AAA ACA GAT GTG ACG GAT TAT CAT ATT Ser Asn Gin lie Gly Leu Lys Thr Asp Val Thr Asp Tyr His lie GAT CAA GTA TCC AAT TTA GTT GAG TGT TTA TCT GAT GAA TTT TGT 10 Asp Gin Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys CTG GAT GAA AAA AAA GAA TTG TCC GAG AAA GTC AAA CAT GCG AAG Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys CGA CTT AGT GAT GAG CGG AAT TTA CTT CAA GAT CCA AAC TTT AGA Arg Leu Ser Asp Glu Arg Asn Leu Leu Gin Asp Pro Asn Phe Arg 15 GGG ATC AAT AGA CAA CTA GAC CGT GGC TGG AGA GGA AGT ACG GAT Gly lie Asn Arg Gin Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp ATT ACC ATC CAA GGA GGC GAT GAC GTA TTC AAA GAG AAT TAC GTT lie Thr lie Gin Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val (e) 20 ACG CTA TTG GGT ACC TTT GAT GAG TGC TAT CCA ACG TAT TTA TAT Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr (723) CAA AAA ATA GAT GAG TCG AAA Gin Lys lie Asp Glu Ser Lys 25 TTA AGA GGG TAT ATC GAA GAT Leu Arg Gly Tyr lie Glu Asp 2250 TTA AAA GCC TAT ACC CGT TAC CAA Leu Lys Ala Tyr Thr Arg Tyr Gin (750) AGT CAA GAC TTA GAA ATC TAT TTA Ser Gin Asp Leu Glu lie Tyr Leu ATT CGC TAC AAT GCC AAA CAC GAA lie Arg Tyr Asn Ala Lys His Glu GGT TCC TTA TGG CCG CTT TCA GCC Gly Ser Leu Trp Pro Leu Ser Ala ACA GTA AAT GTG CCA GCT ACG Thr Val Asn Val Pro Gly Thr CCA AGT CCA ATC GGA AAA TGT Pro Ser Pro lie Gly Lys Cys Note: (e) is Kpn I site - 57 - GGA GAA CCG AAT CGA TGC GCA CCA CAA CTT GAA TGG AAT CCA GAT Gly Glu Pro Asn Arg Cys Ala Pro Gin Leu Glu Trp Asn Pro Asp CTA GAT TGT TCC TGC AGA GAC GGA GAA AAA TGT GCC CAT CAT TCC Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His His Ser CAT CAT TTC TCC TTG GAC ATT GAT GTT GGA TGT ACA GAC TTA AAT 13 His His Phe Ser Leu Asp lie Asp Val Gly Cys Thr Asp Leu Asn (840) GAG GAC TTA GGT GTA TGG GTG ATA TTC AAG ATT AAG ACG CAA GAT Glu Asp Leu Gly Val Trp Val lie Phe Lys lie Lys Thr Gin Asp GGC CAT GCA AGA CTA GGA AAT CTA GAA TTT CTC GAA GAG AAA CCA 10 Gly His Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro TTA GTA GGA GAA GCA CTA GCT CGT GTG AAA AGA GCG GAG AAA AAA Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys 2700 TGG AGA GAC AAA CGT GAA AAA TTG GAA TGG GAA ACA AAT ATT GTT Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr Asn lie Val 15 (900) TAT AAA GAG GCA AAA GAA TCT GTA GAT GCT TTA TTT GTA AAC TCT Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser CAA TAT GAT AGA TTA CAA GCG GAT ACC AAC ATC GCG ATG ATT CAT Gin Tyr Asp Arg Leu Gin Ala Asp Thr Asn lie Ala Met lie His 10 GCG GCA GAT AAA CGC GTT CAT AGC ATT CGA GAA GCT TAT CTG CCT Ala Ala Asp Lys Arg Val Bis Ser lie Arg Glu Ala Tyr Leu Pro *GAG CTG TCT GTG ATT CCG GGT GTC AAT GCG GCT ATT TTT GAA GAA Glu Leu Ser Val lie Pro Gly Val Asn Ala Ala lie Phe Glu Glu TTA GAA GGG CGT ATT TTC ACT GCA TTC TCC CTA TAT GAT GCG AGA -5 Leu Glu Gly Arg lie Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg AAT GTC ATT AAA AAT GGT GAT TTT AAT AAT GGC TTA TCC TGC TGG Asn Val lie Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp AAC GTG AAA GGG CAT GTA GAT GTA GAA GAA CAA AAC AAC CAC CGT Asn Val Lys Gly His Val Asp Val Glu Glu Gin Asn Asn His Arg 0 TCG GTC CTT GTT GTT CCG GAA TGG GAA GCA GAA GTG TCA CAA GAA Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gin Glu GTT CGT GTC TGT CCG GGT CGT GGC TAT ATC CTT CGT GTC ACA GCG Val Arg Val Cys Pro Gly Arg Gly Tyr lie Leu Arg Val Thr Ala - 58 - TAC Tyr AAG Lys GAG Glu GGA Gly TAT Tyr GGA GAA Gly Glu GGT Gly TGC Cys GTA Val ACC Thr ATT lie CAT His (SAG ATC Glu lie (1050) GAG Glu AAC Asn AAT Asn ACA Thr GAC Asp GAA CTG Glu Leu AAG Lys TTT Phe AGC Ser AAC Asn TGT Cys GTA Val GAA GAG Glu Glu 5 GAA Glu GTA Val TAT Tyr CCA Pro AAC Asn AAC ACG Asn Thr GTA Val ACG Thr TGT Cys AAT Asn GAT Asp TAT Tyr 3240 ACT GCG Thr Ala (1080) ACT Thr CAA Gin GAA Glu GAA Glu TAT Tyr GAG GGT Glu Gly ACG Thr TAC Tyr ACT Thr TCT Ser CGT Arg AAT Asn CGA GGA Arg Gly 10 TAT Tyr GAC Asp GGA Gly GCT Ala TAT Tyr GAA AGC Glu Ser AAT Asn TCT Ser TCT Ser GTA Val CCA Pro GCT Ala GAT TAT Asp Tyr GCA Ala TCA Ser GCC Ala TAT Tyr GAA Glu GAA AAA Glu Lys GCA Ala TAT Tyr ACA Thr GAT Asp GGA Gly CGA Arg AGA GAC Arg Asp 15 AAT Asn CCT Pro TGT Cys GAA Glu TCT Ser AAC AGA Asn Arg GGA Gly TAT Tyr GGG Gly GAT Asp TAC Tyr ACA Thr CCA CTA Pro Leu CCA Pro GCT Ala GGC Gly TAT Tyr GTG Val ACA AAA Thr Lys GAA Glu TTA Leu GAG Glu TAC Tyr TTC Phe CCA Pro GAA ACC Glu Thr 20 GAT Asp AAG Lys GTA Val TGG Trp ATT lie GAG ATC Glu lie GGA Gly GAA Glu ACG Thr GAA Glu GGA Gly ACA Thr TTC ATT Phe lie (1170) GTG Val GAT Asp AGC Ser GTG Val GAA Glu TTA CTC Leu Leu CTT Leu ATG Met GAG Glu GAA Glu TAG * ** (1181) The more preferred mutations of the invention include 25 those at positions 116 (Lys or Arg), 119 (Thr), 130 (lie) and 188 (Ser) and combinations including one or more of the same such as those found in pBT26-3, pBT-106, pBT-68, pBT-C, pBT-67 and pBT-70 (certain of these found in Table CD. Also of preferred interest are the individual and combined 30 mutations in p36a65, particularly for truncated endotoxins. - 59 - The mutations found and permitted in accord with the invention at amino acid position-4 are o£ interest since they fall within a section of 25 amino acids (positions 1 to 25, inclusive, in Table A) which has been postulated to also 5 form a pre-toxin or protoxin portion of the endotoxin and subject to protease cleavage in the gut to form the active endotoxin or more active endotoxin. Hence, the mutations permitted at position-4 are indicated to be relevant to endotoxin sequences comprising said 25 amino acids or having 10 substantial (at least 70%) homology therewith, and more particularly relevant to those endotoxins coded for in such region by DNA which would hybridize before the position-4 mutation and under stringent conditions to DNA having the sequence found in Table A for the nucleotide positions 15 extending from nucleotide position 1 to and including nucleotide position 75, independent of deletions and additions and with equivalent coding of corresponding amino acids as previously discussed in connection with the conserved 116 amino acid sequence area. 20 The mutation uncovered by our work at amino acid position 217 and reported in Table B, above, and evaluated as seen elsewhere herein is judged to indicate that all naturally coded amino acids may be present at this position in active endotoxins having the relevant sequence shown in 25 Table A which extends from the end of the 116 amino acid reference sequence to and including amino acid position 217. Accordingly, the situation in which the amino acid at position 217 in such a sequence or equivalent thereof is any naturally coded amino acid except Arg is included with the 30 scope of the invention. However, since the indicated mutation at position 217 produced less interesting results, it is only, of interest in combination with other mutations disclosed herein and indicating that position 217 can change in endotoxins in which Arg naturally occurs at this position. - 60 -

Claims (27)

1. A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA including a portion encoding an amino acid sequence demonstrating at least 70% homology to the 116 amino acid sequence beginning at position m-l and extending through position m-116 in Table A hereof, said position numbers applying to such homologous sequence independent of any deletions or additions therein, in vhich said DNA is modified such that any one or more of the folloving amino acids is coded for at the indicated amino acid reference position: a) at position m- ■5 any natural amino acid except Asn} b) at position m- >6 any natural amino acid except Gin; c) at position m- ■12 any natural amino acid except Glu; d) at position m- •16 any natural amino acid except Asn; e) at position m- -27 any natural amino acid except Glu; f) at position m- -30 any natural amino acid except Ala; g) at position m- -33 any natural amino acid except Thr; h) at position m- -34 any natural amino acid except Asn; i) at position m- -36 any natural amino acid except Ala; j> at position m- -41 any natural amino acid except Met; k) at position m- -95 any natural amino acid except Phe; 1) at position m- -98 any natural amino acidi except Ala; m) at position m- -99 any natural amino acid except Thr; n) at position m- -105 any natural amino acid except Asn o) at position m- -112 any natural amino acid except Gly - 61 -

2. A structural gene according to claim 1 in vhich the DNA has been modified such that any one or more of the folloving amino acids is coded for at the indicated amino acid reference position: a) at position m-5, Lys b) at position m-6, Lys O at position ra-12, Lys d) at position m-16, Tyr e) at position m-27, Lys or Arg f) at position m-30, Thr g) at position m-33, lie h) at position m-34, Tyr i) at position m-36, Val j) at position m-41, lie k) at position m-95, lie 1) at position m-98, Thr m) at position m-99, Ser n) at position m-105 , Lys; and o) at position m-112 . Asp

3. A structural gene according to claim 2 in vhich the DNA has been modified to incorporate the -change at one or both of the amino acid reference positions m-27 and m-30.

4. The structural gene of claims 1 to 3 in vhich the DNA portion prior to any of the modifications specified in claims 1 to 3 hybridises under stringent hybridising conditions in vhich hybridisation is effected at 60°C in 2.5x saline citrate (SSC) buffer to a 348 nucleotide oligomer having the nucleotide sequence depicted in Table A beginning at position n-1 and extending through nucleotide position n-348.

5. The structural gene of claim 4 in vhich the DNA portion prior to any modification specified in claims 1 to 3 codes for the 116 amino acid - 62 - sequence of Table A beginning at position m-l and extending through position m-116.

6. The structural gene of claim 5 in vhich the DNA coding for the endotoxin comprises DNA coding for the amino acid sequence of Table A beginning at amino acid position 1 and extending through amino acid position 205.

7. A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA having a portion encoding an amino acid sequence demonstrating at least 702 amino acid homology to the 205 amino acid sequence beginning at amino acid position 1 and extending through amino acid position 205 in Table A hereof, in vhich the amino acid at position 4 is any amino acid except A«n.

8. A structural gene according to claim 7 in vhich the amino acid at position 4 is Tyr.

9. An expression vector comprising the structural gene of any one of claims 1 to 8 under control of DNA operative' to cause expression of said structural gene in a bacterial host.

10. An expression vector according to claim 9 in vhich said gene is under control of DNA operative to cause expression of said gene in E. coli.

11. An expression vector according to claim 9 in vhich said gene is under control of DNA operative to cause expression of said gene in B.t.

12. A recombinant endotoxin protein having toxic activity against insects, said protein comprising an amino acid sequence portion having at least 70X homology vith the 116 amino acid sequence beginning at position m-l and extending through position m-116 in Table A hereof, said position numbers applying to such homologous sequence independent of any deletions or additions therein, in vhich any one or more of the folloving amino acids are present at the indicated amino acid reference positions: - 63 - a) at position m- ■5 any natural amino acid except Asn; b) at position m- ■6 any natural amino acid except Gin; c) at position m- -12 any natural amino acid except Glu; d) at position m- ■16 any natural amino acid except Asn; e) at position m- ■27 any natural amino acid except Glu; f) at position m- •30 any natural amino acid except Ala; g) at position m- -33 any natural amino acid except Thr; h) at position m- ■34 any natural amino acid except Asn; i) at position m- ■36 any natural amino acid except Ala; J) at position m- •41 any natural amino acid except Met; k) at position m- ■95 any natural amino acid except Phe; 1) at position m- 98 any natural amino acid except Ala; m) at position m- -99 any natural amino acid except Thr; n) at position m- ■105 any natural amino acid except Asn; and o) at position m- -112 any natural amino acid except Gly

13. An endotoxin protein according to claim 12 in vhich any one or more of the folloving amino acids is coded for at the indicated amino acid reference position: 20 a b c d 25 e f g h i 30 j k 1 m n o _ £/1 _ at position ■-5, Lys at position m-6, Lys at position m-12, Lys at position m-16, Tyr at position m-27, Lys or Arg at position m-30, 9 ' Thr at position m-33, He at position m-34, Tyr at position m-36, Val at position ra-41, lie at position m-95, lie at position m-98, Thr at position m-99, Ser at position m-105 , Lys; and at position m-112 » Asp

14. An endotoxin protein according to claim 13 in vhich one or both of the amino acids at reference positions m-27 and m-30 have been changed.

15. An endotoxin protein from a gene according to claim 7 or 8.

16. A process for the production of an endotoxin protein vhich comprises transforming or transfecting a cell vith an expression vector according to any one of the claims 9 to 11 and culturing the resulting cells to produce said endotoxin.

17. A process according to claim 16 in vhich the cell transforoed or transfected is a bacterial cell.

18. A plant comprising cells containing a structural gene according to any one of claim 1 to 8.

19. Bacterial cells comprising an expression vector according to any one of claims 9 to 11.

20. An insectidical composition comprising an insecticidally effective amount of a protein produced from a DNA according to any one o£ claims 1 to 8 in association vith an agriculturally acceptable carrier.

21. An insecticidal composition comprising an insecticidally effective amount of a protein according to any one of claims 12 to 12 in association vith an agriculturally acceptable carrier.

22. A structural gene according to Claim 1 substantially as hereinbefore described by way of Example.

23. An expression vector according to claim 9 comprising a gene according to claim 22.

24. A recombinant endotoxin protein according to Claim 12 substantially as hereinbefore described by way of Example.

25. An endotoxin protein produced from a gene according to claim 22. - 65 - A process according to claim 16 substantially as hereinbefore described by way of Example. An endotoxin protein whenever produced by a process as claimed in any of claims 16, 17 or

26. A host cell according to claim 19 comprising an expression vector according to claim 23. An insecticidal composition according to claim 20 or 21 comprising an insecticidally effective amount of an endotoxin protein as claimed in any of claims 24, 25 or

27. TOMKINS & CO.