IE62118B1 - Modified dna sequences coding for mutant endotoxins of bacillus thuringiensis - Google Patents

Abstract

Mutant Bacillus thuringiensis endotoxin proteins, exhibiting the characteristic insecticidal activity shown by the wild type delta -endotoxins. At each individual point of mutation it is indicated that the codons coding for any other natural amino acid can be substituted to produce active endotoxin protein. Also described are DNA sequences encoding such endotoxins and recombinant techniques for the production of insecticidally active mutant endotoxin [DE3905865A1]

Description

Bacillus thuringiensls (B.t.) is a sporulating bacterium vhich produces a protein crystal delta-endotoxin (δ-endotoxin) at the end of vegetative stage of grovth. This endotoxin, upon ingestion by certain insects, produces toxic effects vhich include the cessation of feeding, gastrointestinal dysfunction, dehydration and ultimately, death. The δ-endotoxin is produced, generally from a plasmidal source, as an inactive precursor or protoxin form having a molecular veight of 130,000140,000 daltons [Calabrese, Canad, J. Microbiol. 26 (1980) 1006]. Proteolytic cleavage to remove the C-terminal half, approximately, and possibly several amino acids at the N-terminus, normally occurs in the insect gut as a result of the action of the gut proteases, and is required to produce the active toxin vith a molecular veight of 65,000 to 70,000d [Tyrell et al, J. Bacteriology 145 (1981) 1052].

A large number of subvarieties of B.t. have been identified. Although most of these $hov a more specific or increased toxicity to insects of the order Lepidoptera, a limited number have also been demonstrated to be toxic tovards insects of other classifications. For example, B.t. israelensls is toxic tovards Dipteran larvae (mosquitos and blackflies) and tvo other subvarieties have recently been identified vhich demonstrate toxicity tovards Coleopteran larvae [Hofte et al, Nuc. Acid. Res. 15(17) (1987) 7183].

Although much vork has been performed in the production of shortened toxins and structural genes encoding these, there appears to be less knovn about the ability of the B.t. δ-endotoxins to vithstand point mutations vithin the active or toxic portion of the endotoxin sequence and the effect of such mutations on the activity of the toxin molecules.

An object of the present invention is to provide novel mutants of the active portion^of B.t. δ-endotoxins. -1A further object of the present Invention is to produce mutations vhich are effective to produce B.t. endotoxin-like activity in both truncated and full length δ-endotoxin forms.

A pre.Pci-red object of the present invention is to provide mutations vhich enhance the insecticidal activity of B.t. δ-endotoxin structures.

In accordance vith the present invention, ve have, after randomly creating single and multiple point mutations in many hundreds of DNA strands coding for a large section of the active portion of a representative B.t. endotoxin insecticidally active against Lepidoptera, isolated and produced by recombinant techniques several mutant B.t. endotoxins vhich exhibit the characteristic insecticidal activity against Lepidoptera that is possessed by the vild type B.t. δ-endotoxin. Also, at these discovered points of mutation, it is indicated that the codons coding for any other natural amino add can be substituted to produce active endotoxin protein. A number of the random mutations vere also found to produce a higher level ,of insecticidal activity. Such activity may be demonstrated in, for example, the Tobacco Budvorm (Hellothls virescens) assay or the Trlchoplusia ni (cabbage looper) assay as hereinafter described and in many cases this increase vas quite remarkable by achieving an activity at least tvo or more times greater than the parent endotoxin structure. Multiple mutations (usually 2 or 3 amino acids per mutated DNA strand) vere also evaluated individually and ln various combinations to identify certain more effective mutations and combinations thereof. The mutations in accordance vith the present invention, vith one exception, vere also found to exist vithin amino acid sequence sections vhich are highly conserved among a vide variety of vild type B.t. δ-endotoxins, hence indicating the general applicability of the mutations provided by the invention to a vide variety of endotoxin structures in vhich such conserved areas provide insecticidal B.t. endotoxins. -2More particularly, vith reference to the amino acid sequence and the v numbering thereof in Table A, infra, (beginning vith the methionine (MET) vhich is position number 1 and the normal N-terminus of the representative Lepidopteran active endotoxin shovn in Table A), it has been found that B.t. endotoxin protein othervise insectlcidally active against Lepidoptera insects in the manner of native B.t. endotoxins vhen containing vithin the active portion an amino acid residue sequence the same as or having substantial homology to that shovn in Table A for the 116 amino acid residue sequence shovn at positions from and including position 90 to and including position 205 (also amino acid positions m-1 through m-116), have one or more of the residues of the folloving amino acids at the indicated or equivalent homologous positions (the mposition numbers in parentheses being vith reference to said 116 amino acid residue sequence): a) at position 94 (position m-5 of said 116 amino acid sequence) any natural amino acid coded for by the genetic code except Asn; b) at position 95 (position m-6 of said 116 amino acid sequence) any such natural amino acid except Gin; c) at position 101 (position m-12 of said 116 amino acid sequence) any such natural amino acid except Glu; d)- at position 105 (position m-16 of said 116 residue sequence) any such natural amino acid except Asn; e) at position 116 (position m-27 of said 116 residue sequence) any such natural amino acid except Glu; f) at position 119 (position m-30 of said 116 residue sequence) any such natural amino acid except Ala; g) at position 122 (position m-33 of said 116 residue sequence) any such natural amino add except Thr; h) at position 123 (position m-34 of said 116 residue sequence) any such natural amino acid except Asn; 1) at position 125 (position m-36 of said 116 residue sequence) any such natural amino acid except Ala; j) at position 130 (position m-41 of said 116 residue sequence) any such natural amino acid except Met; k) at position 184 (position m-95 of said 116 residue sequence) any such natural amino acid except Phe; 1) at position 187 (position m-98 of said 116 residue sequence) any such natural amino acid except Ala; m) at position 188 * (position m-99 of said 116 residue sequence) any such natural amino acid -3except Thr; n) at position 194 (position m-105 of said 116 residue sequence) any such natural amino acid except Asn; and o) at position 201 (position m-112 of said 116 residue sequence) any such natural amino acid except Gly.

In addition, and again vith reference to the numbered amino acid residue sequence shovn in Table A, the Invention includes the change in the amino acid Asn at amino acid position 4 to any other natural amino acid coded for by the genetic code.

Vith regard to the amino acid residues provided by the invention vithin said 116 residue sequence, it is preferred in accordance vith the invention that such sequence be characterised, again vith reference to the total mature sequence shovn in Table A (and also to such 116 residue sequence), by one or more of the folloving amino acids at the indicated positions: a) Lys at position 94 (position 5 of the 116 residue sequence); b) Lys at position 95 (position 6 of said 116 residue sequence); c) Lys at position 101 (position 12 of said 116 residue sequence); d) Tyr at position 105 (position 16 of said 116 residue sequence); e) Lys or Arg, more preferably Arg, at position 116 (position (position (position (position (position (position (position (position (position (position (position 27 of 30 of 33 of 34 of 36 of 41 of 95 of 98 of 99 of 105 of 112 of said 116 residue sequence); f) said 116 residue sequence); g) said 116 residue sequence); h) said 116 residue sequence); i) said 116 residue sequence); j) said 116 residue sequence); k) said 116 residue sequence); 1) said 116 residue sequence); m) said 116 residue sequence); n) said 116 residue sequence); and o) said 116 residue sequence).

Thr at position 119 lie at position 122 Tyr at position 123 Val at position 125 lie at position 130 lie at position 184 Thr at position 187 Ser at position 188 Lys at position 194 Asp at position 201 Vhen the Asn at amino acid position 4 is changed, it is preferably -4changed to Tyr.

Table A near the end of this specification sets forth a nucleotide sequence and resulting deduced amino acid sequence relevant to B.t. δ-endotoxin production in nature. With one exception, the nucleotide sequence vas obtained from a δ-endotoxin-productng plasmid found in B.t. vuhanensls. In particular, the entire structural gene (actually coding for the endotoxin itself) is from B.t. vuhanensls and the one exception is that the sequence prior to methionine (Met) at the beginning of the structural gene is from an endotoxin-producing gene found ln B.t. kurstaki HD-1 (the so-called 5.3Kb Hind III class plasmid of HD-1), such upstream sequence containing the native Ribosomal Binding Site (RBS) from such B.t. kurstaki HD-1 endotoxin-producing plasmid. The upstream sequence containing the Ribosomal Binding Site, as found in B.t. vuhanensis differs little from that shovn in Table A for Kurstaki and the differences are indicated later herein. Bovever, it should be kept ln mind that both the nucleotide and amino acid sequences in the subject B.t. vuhanensls and B.t. Kurstaki HD-1 structural genes are identical from the beginning of the endotoxin sequence through the entire active portion thereof and up to at least the Kpn I site indicated in Table A, said Kpn I site being in the protoxin portion. Hence, the active toxin portion resulting from cleavage after ingestion by the insect vill be the same for both the subject B.t. vuhanensls and B.t. kurstaki HD-1 endotoxins. In Table A, amino acids for the endotoxin protein produced as a result of expression of the structural gene are positively numbered in parentheses 1 through 1181 belov the amino acid. Those in the untranslated area upstream of the 1-Met are negatively numbered in a back or upstream direction (vith stop signals counted as an amino acid posi* tion). Nucleotides in the structural gene are numbered (not ln parentheses) above the line in vhich they appear and the last digit in the number stands above the nucleotide to vhich the number applies. Nucleotides in the untranslated region vhich includes the ribosomal binding site are negatively numbered backvard from the initiating ATG codon (for -5the 1-Met). Within the numbered sequences indicated above a portion thereof is separately or sub-numbered m-1 through m-116 for amino acids and n-l through n-348 for the nucleotides for such amino acids, to indicate more particularly a highly conserved region in vhich most of the mutations provided by the invention vere found to be located. Certain restriction sites relevant to the nucleotide sequence in Table A are shovn by a line above the nucleotides involved in the restriction sites vith a footnote designation of the particular site. The toxic portion of the endotoxin shovn in Table A as recognised in the art involves the amino acid sequence beginning at amino acid position 1 (Met) and extending through amino acid position 610 (Thr). In view of the nature of the total DNA sequence shovn in Table A, and in order to understand the folloving description more easily, it vill be noted that the DNA and amino acid sequences beginning vith the untranslated portion in line 1 of Table A and extending up to the Kpn I site at about amino acid positions 724-725, and portions thereof, can be and are also referred to herein as derived from B.t. kurstaki HD-1 (the 5.3Kb Hind III class plasmid).

Figure 1 shovs a map of the general vorking plasmids prAK and prAK-3 used at various stages in connection vith the invention and comprising DNA coding for a truncated B.t. endotoxin derived from B.t. Kurstaki HD-1 and having insecticidal activity against Lepidoptera.

Figure 2 shovs a map of the plasmid pB8rII vhich comprises DNA coding for a truncated B.t. endotoxin protein of somevhat greater length than that coded for by prAK and also derived from B.t. kurstaki HD-1 and also having Insecticidal activity against Lepidoptera.

Figures 3a and 3b shov tvo representative double stranded DNA strands vhich may be synthesised for conducting so-called codon spin experiments and also useful for conveniently introducing desired mutations into a B.t. endotoxin DNA coding sequence. -6Figure 4 shows a map o£ the plasmid pBT21O vhich comprises DNA coding for a full length native endotoxin from B.t. vuhanenais, vhich endotoxin has the identical amino acid sequence in its active portion as the endotoxin from B.t. kurstaki HD-1 as coded for in prAK and pB8rII.

Figure 5 shows an abbreviated map of the plasmid prAK-9 along vith a blov-up of take-out section thereof, said prAK-9 being otherwise similar in detail to plasmid prAK-3 and said section and subsections thereof in parent plasmids being conveniently useful for conducting codon spin experiments and otherwise introducing mutations as provided by the invention.

The plasmid prAK vas deposited in E. coll JM103 vith the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18329.

The plasmid pB8rII vas deposited in E. coli JM103 vith the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18331.

The plasmid pBT21O vas deposited in E. coll JM1O3 vith the Agricultural Research Culture Collection (NRRL), Peoria, Illinois, on February 19, 1988 and received Repository No. NRRL B-18330.

The. titoo/e rrufc'Oorqcw-Gerrxs cLepo^iteci. under tHe. ftudopasL Trec-i-M Or> ti-vs A.Ke Oespoo-t- Or H. <>r©o'fjG./v0.r»5 ro" As essentially indicated, the point mutations of the invention >are* applied to endotoxin protein sequences produced by Bacillus thurlnglensls varieties and subtypes, vhich sequences are insecticidally active against Lepidopteran larvae vhen containing the 116 amino acid conserved sequence Indicated above or a sequence vhich is highly homologous therewith, including protein endotoxin sequences vhich are of the natural full length type or substantially full length and those vhich are truncated by removal of all or a part of downstream protoxin or inactive portion thereof and even those vhich may -7be truncated from the normal C-terminus upstream and back into the active portion of the endotoxin. As evident already, endotoxins from B.t. kurstakl and B.t. vuhanensis both have the identical 116 amino acid conserved region and others have or can be expected to have the same 116 amino acid sequence or a largely homologous equivalent thereof. For example, endotoxins from B.t. sotto, B.t. kurstakl HD-73 (strain), and B.t. Galleriae are already knovn to produce endotoxins vith the identical 116 amino acid sequence even though some of these differ to at least some extent, and in cases significantly, in both the balance of the toxic portion of the endotoxin and in the protoxln section. Others, such as B.t. kurstakl HD-1 Dipel (a commercial substrain), have one amino acid change in the indicated 116 amino acid sequence (m-59 is Leu coded for by TTG) and other changes/deletions/additions in other sequence portions. This and others found to have a single or multiple changes but amino acid homology of at least about 70X to said 116 amino acid sequence may have one or more mutant changes of the invention made to the amino acids therein vhich correspond identically to the amino acid in said 116 amino acid non-mutated sequence, particularly vhen the amino acid to be changed has on each of its sides 2 and preferably 4 other amino acids vhich also correspond identically to those in the 116 amino acid sequence. It is also contemplated that the mutations of the invention may be made to corresponding amino acids in homologous series vhich essentially contain deletions or additions such that the sequence itself is shorter or longer than the indicated 116 amino acid sequence. In such cases, the numbering as employed in the reference 116 amino acid sequence vill be retained such that deletions existing in the sequence to be changed vill be counted as actually present and additions in the sequence to be changed vill simply not be counted. Hence, amino acid positioning assignment can be said to be made independent of deletions or additions in such a homologous sequence.

Preferably, the homologous amino acid sequences into vhich the mutant changes of the invention may be substituted are those vhich are -8coded for by DNA to vhich DNA from either the sense or antisense strand (or double strand) of the DNA beginning vith position n-1 and extending through position n-348 in Table A vill hybridise under stringent hybridising conditions vhen the homologous sequence to be mutated has its amino acids, vhich correspond to those in the referenced 116 umlno acid sequence, coded for by the same codon as the corresponding amino add in the reference sequence. Procedures for preparing such a tagged hybridisation probe are veil knovn in the art. Stringent hybridising conditions are those in vhich hybridisation is effected at 60"C in 2.5X saline citrate (SSC) buffer folloved merely by rinsing at 37°C at reduced buffer concentration vhich vill not affect the hybridisations vhich take place.

Preferably, the mutations are made in amino acid sequences vhich have no more than 1, 2 or 3 amino acid differences from those in the 116 amino acid reference sequence, most preferably a sequence vhich is identical to the reference sequence.

It is already clearly indicated in the art that the 116 amino acid reference sequence may form a portion of otherwise substantially modified or different endotoxin protein sequences vhich have insecticidal activity against Lepidopteran larvae, and other modifications outside of the reference sequence vill most certainly be uncovered as knowledge of the art unfolds. Hence, the sequences bordering the required mutated sequence portion vhich is analogous to the 116 amino acid reference portion may vary to a considerable extent and need only be sufficient to provide insecticidally active endotoxin protein, for example as demonstrated by insecticidal activity against the tobacco budvorm. Thus the • · · amino acid sequence upstream from the optionally mutated portion may be shortened or lengthened or itself mutated relative to the sequence shown in Table A, but will generally begin with methionine and is most preferably highly homologous (70%) or identical to that shown in Table A, although it is evident that such sequence may also optionally contain the preferred -9mutant at the 4-position as also provided by the invention. Similarly, the portion dovnstream from the required mutated sequence portion may vary videly and be shortened or lengthened relative to the balance thereof shovn in Table A up to its point of cleavage in the insect gut, and of course may or may not be further extended to form a protoxin or inactive portion subject to cleavage in the insect gut to provide an insectlcidally active protein toxin.

DNA comprising sequences coding for mutant endotoxins as provided by the invention vill be incorporated under the control of appropriate regulatory sequences into plasmids to form expression vectors vhich vill be transformed or transfected into cells to produce the endotoxin. The production of endotoxins by such recombinant biotechnological techniques, in contrast, for example, to the production of drugs by such techniques, involves little or no vork-up designed to purify the endotoxin. The cells in vhich it is produced may be lysed, but it has been characteristic in the commercial production of B.t. endotoxins in the past, simply to employ the entire contents of the culture or fermentation system used in production of the final product, usually after drying by conventional means such as lov temperature spray drying as is knovn in the art. Depending upon the product, various materials may be added to improve product stability as ls also knovn, and proteinaceous materials if not present in adequate amounts in the fermentation system may be independently mixed vith the product to enhance stability, again as is knovn, eg soybean povder or defatted soybean povder.

Vhile the endotoxins may be produced biotechnically in a variety of transformed or transfected cell systems, it is generally preferred to transform or transfect bacterial cells of either the gram-negative or gram-positive type. One preferred type of gram-negative bacteria is E. coli vith vhich considerable experience in biotechnology has already been achieved and for vhich a vide variety of suitable and operatively functional plasmid and transfer expression vector systems are knovn and -10available. Pseudomonas fluorescens represents another type of gramnegative bacteria into vhich plasmids carrying endotoxin sequences have been incorporated. As demonstrated herein, endotoxin-producing genes may include regulatory sequences such as particularly ribosomal binding site sequences vhich have their origin in B.t. vhen incorporated for expression into essentially heterologous bacterial cells, such as E. coll. Since Bacillus type bacteria provide an environment more closely native to the mutant endotoxins of the invention, it is particularly within the scope of this invention and contemplated thereby to transform or transfect Bacillus type bacteria vith expression vectors comprising the DNA coding for the mutant endotoxins of this invention. Illustrative of such Bacillus cells of particular interest are B.t. cells, B.cereus cells and B.subtilis cells. A greatly improved procedure for transforming Bacillus cells, particularly B.t. cells, has recently been found and is described in UK patent application GB 2,199,044.

Cell types suitable for transformation by the process include cry minus types such as the knovn B.t. kurstakl cry B cells vhich have no plasmids and vild type Bacillus cells such as the native B.t. cells vhich carry endotoxin-producing plasmids. Plasmids suitable for incorporation into Bacillus cells such as B.t. cells are knovn, for example, the plasmid pBC16.1 (Kreft et al, Molec. Gen. Genet. [1978] 162 59) and its parent plasmids vhich may be used or modified by employing conventional recombinant techniques to carry the mutant endotoxin coding sequences of the invention. As is veil knovn in the art, Bacillus cells characteristically produce endotoxin in desired amounts only at their sporulation stage and hence are grovn to such stage in order to best obtain the products useful as insecticides. Hence, plasmids or expression vectors provided by the invention and carrying DNA for the mutant endotoxins may be incorporated into Bacillus cells vhich either are devoid of endotoxinproducing plasmids or already contain one or more such plasmids. While the mutant endotoxins of the invention vill characteristically have activity against Lepidoptera, endotoxin activity against other insect classes may also be possessed by reason of existing in the parent endo-11toxin prior to mutation or as the result o£ other permitted sequence changes, and in any case it is vithin the scope of the invention to transform Bacillus cells vith the Lepidopteran-toxic endotoxin producing plasmids of the invention vhen such cells carry plasmids for endotoxins S not substantially effective against Lepidoptera, in order to produce at sporulation, endotoxins combining to provide broader ranges of insecticidal activity. For example, plasmids carrying the mutated endotoxin DNA coding sequences may be used to transform B.t. lsraellensls or B.t. tenebrlonis which individually are not substantially effective against Ιθ Lepidoptera.

Vhile the present invention has been demonstrated both vith reference to truncated and full length native type endotoxin proteins, it is generally preferred, vhen using the mutant endotoxins directly as insec15 ticides, as described above, to employ or produce fuller length sequences, vhich are the same as or mimic the native type at least in terms of the opportunity to achieve an endotoxin protein folding capability similar to that of its native capability, or an Improved full length folding effect.

Mutant DNA sequences according to the present invention can also be inserted into the genome of a plant. In such cases it is preferred that the mutated sequences of the truncated type are employed, although the fuller length sequences are also suitable. Any suitable method may be advantageously employed for such incorporation of the endotoxin sequences into a host plant genome, such as for example, via the Ti plasmid of Agrobacterium tumefaciens, electroporation, electrotransformation, micro-injfection, viral transfection or the use of chemicals that induce or increase free DNA uptake, and the like. Such procedures and the use 3Q of such in the transformation of plants are veil knovn to the man skilled in the art. Preferably the DNA sequence encoding the mutant endotoxin vill be associated vith appropriate regulatory sequences, such as for example, operator and 3' regulatory sequences vhich are functio-12nal in plants, and the vhole vill be incorporated into an expressiontype vector. Such transformation of plant cells, folloved by regeneration of development of cells into vhole plants, enables the mutant endotoxin DNA sequence to become a stable and permanent part of the plant genome, such that it is passed on from one generation to the next via mitosis and meiosis and upon expression results in an Insect toxic protein, endoving the plant vith Inheritable insect resistance.

Tvo very similar vectors (prAK and prAK-3) vere used in our vork as a source of B.t. δ-endotoxin sequence for mutation and also to provide vehicles for production and evaluation of the B.t. endotoxin mutants. The plasmids prAK and prAK-3 are represented ln Fig 1 by illustrating the relevant details of prAK and indicating the minor variation therefrom vhich exists in prAK-3. Basically, the plasmids prAK and prAK-3 are fully competent expression vectors for E.coli and each includes an ampicillin resistance gene, an origin of replication and operator sequences, including an E. coll promoter. As indicated ln Fig 1 by the thick dark lines and boxes, the vector prAK includes in proper reading frame coordination vith the promoter a DNA sequence vhich is found In the vild type B.t. kurstaki strain HD-1. The thick dark line represents the mature sequence vhich has been shortened to code for a truncated native B.t. δ-endotoxin extending from amino acid position 1 (Met) to position 610 (Thr) in Table A and further extending into the protoxin portion to end vith amino acid 723 (Leu). At the dovnstream end of said thick dark line, a small section shovn as an open thick box in Fig 1, represents a short DNA sequence of 54 base pairs vhich follovs the base pair triplet coding for 723-Leu and vhich is itself immediately folloved by a stop signal. This total extended sequence of 57 base pairs (including the stop signal) has its origin ln the veil knovn plasmid pBR322 vhich vas used in the construction of prAK. Hence the expression vector prAK codes for and produces in E. coll essentially a truncated B.t. δ-endotoxin fusion protein having a total of 741 amino acids and composed of the 610 amino acids of the native protoxin section and 18 amino -13acids having origin in pBR322. This truncated B.t. endotoxin fusion protein has a high level of insecticidal activity and vas used for the purpose of evaluating the mutants thereof produced in our vork. This activity is essentially indistinguishable from a fully truncated B.t. δ-endotoxin protein having only the 610 amino acids of the activated toxin (amino acids 1 to 610 in Table A).

The thick dark line representing most of the sequence coding for the truncated B.t. endotoxin fusion protein is connected at its upstream end in Fig 1 to a thick dark box representing a sequence vhich includes a B.t. ribosomal binding site (RBS). This section (also shovn in Table A, lines 1 and 2) vhich contains the RBS has about 47 nucleotides before beginning at its upstream end vith a Bam HI site (inserted in prior plasmids to link the section vith the E. coll promoter section (indicated by an arrov in Fig 1). The promoter and RBS sections are arranged and joined to be in proper reading frame coordination vith the coding sequence for the endotoxin. Hence, the thick dark lines and boxes together represent DNA having origin in B.t. kurstakl HD-1.

Various other restriction sites indicated in Fig 1 vere relevant to the strategy for the conventional removal and reinsertion of sections of DNA for mutation experiments. These other restriction sites are the Nsi I site (beginning after about only 26 nucleotides from the start of the endotoxin coding sequence), the tvo Xba I sites (see belov, hovever, concerning prAK-3), the Sst I site and the Hind III site.

As indicated above, prAK-3 differs from prAK only in a single minor respect. This difference is that the Xba I site (TCT AGA) at nucleotide positions 292 to 297 of Table A vere changed using standard techniques to TCG CGA, thereby defining an Nru I site. No change in the coded amino acid sequence resulted from this change. The preparation of prAK3 is described in Step a) of Example 1 hereinafter. prAK-3 is also the first intermediate in preparing other plasmids prAK-7 and prAK-9. -14DNA sections, derived from different lengths of single stranded DNA sections from prAK and prAK-3 (both sense and anti-sense strands) mutated in a conventional manner, such as described by for example, Craick in Biotechniques Jan/Feb 1985, pages 12-19; Use of Oligonucleotides for Site-Specific Mutagenesis, are indicated for convenience herein as M-1 and M-2, M-1 defining the 375 base pair section betveen the tvo Xba I sites in prAK and M-2 being the section betveen the Bam HI and Xba I sites in prAK-3 (as shovn in Fig 1).

The mutation found betveen the tvo Xba I sites in accordance vith the invention may be readily obtained using the plasmids prAK-7, prAK-8 or prAK-9 disclosed herein and synthetic double stranded oligonucleotides constructed and used analogously to the procedures described in Example 2 hereof.

Folloving mutation, the mutated single strand portions vere rendered double stranded by conventional means. In the case of the M-1 mutants, using prAK as a mutation vehicle, the resulting double stranded, mutate plasmids vere transformed into E. coli JM103, plated on YT agar containing 50 pg/ml ampicillin and incubated overnight to obtain a plurality of colonies vith a variety of different mutations in plasmids the same as prAK except for the mutations.

In the case of the M-2 mutants, the mutated double stranded region betveen the Bam HI and Xba I sites in the mutation vehicles vere excised using Bam HI and Xba I restriction endonucleases, respectively, and ligated into prAK-3 vectors digested vith the same tvo enzymes. The resulting M-2 region mutant-containing prAK-3 plasmids vere transformed into E. coll JM103, plated on YT agar vith 50 pg/ml ampicillin and incubated overnight to obtain another plurality of colonies involving a variety of different mutations.

Testing to demonstrate activity of mutagenised endotoxin sequences, -15expressed from DNA contained in, for example E. coli JM1O3 or E. coli SG4044 (publicly available from the Agricultural Research Culture Collection (NRRL), Peoria, Illinois under Repository No. B-15969) vas performed in one or both of the Tobacco Budvorm assay (TBV) or T. ni assay as described in Example A hereinafter. DNA of mutants shoving increased activity over standard non-mutant endotoxin vas sequenced ln the relevant areas of mutation to determine the mutation in the DNA and hence in the protein sequence. More than 6,000 different colonies vith plasmids containing either M-l or M-2 mutagenised sections vere thus evaluated and generally, from 1 to 3 amino acid changes vere found to have taken place in each mutation experiment.

Table B belov, identifies the up-mutants recovered directly as a result of the mutation experiments, the amino acid position vith reference. to the position numbers assigned ln Table A at vhich each mutation occurred, each codon mutated in each mutant and the amino acid change resulting at the indicated position as a result of the codon change.

In Table B the minus or negative amino acid position numbers indicate changes betveen the Bam HI site and the one position Met at the beginning of the endotoxin sequence, such changes therefore not affecting the sequence of the endotoxin coded for by the mutant sequence.

The mutants identified in Table B, belov, vere evaluated in all three phases of the TBV Assay producing results as reported belov in Table B-l. Various 6f these mutants vere also evaluated in the T. ni assay, the results of vhich are illustrated belov in Table B-2. -16TABLE Β MUTATION SECTION MUTANT POSITION AMINO ACID CHANGE IN ENDOTOXIN AREA NUCLEIC ACID AMINO ACID M-l p26-3 119 GCA to ACA Ala to Thr 130 ATG to ATA Met to lie 201 GGC to GAC Gly to Asp M-l p48al4 101 GAA to AAA Glu to Lys 116 GAG to AAG Glu to Lys 217 CGT to CAT Arg to His M-l p48c5 116 GAG to AAG Glu to Lys 187 GCG to ACG Ala to Thr M-l p36a65 122 ACT to ATT Thr to lie 125 GCA to GTA Ala to Val M-2 p95a76 123 AAT to TAT Asn to Tyr M-2 p95a86 188 ACT to TCT Thr to Ser M-2 p98cl 188 ACT to TCT Thr to Ser M-2 p99c62 204 ACA to ACT Thr to Thr 105 AAT to TAT Asn to Tyr 4 AAT to TAT Asn to Tyr M-2 plO7c22 194 AAT to AAA Asn to Lys 94 AAC to AAA Asn to Lys M-2 pl07c25 184 TTT to ATT Phe to lie -11 TTG to TAG ---------— M-2 pll4a30 95 CAA to AAA Gin to Lys -15 TAT to TAA In Table B-l , belov, the lover score in the toxicity column indi- cates the greater level of activity (see Example A for an explanation of toxicity scores) and the controls involved an equivalent amount of E. coli JM1O3 cells and E. coll SG4044 cells vhich had not been transformed vith any plasmid. It is noted that all mutants vere indicated to be substantially more active than the truncated native endotoxin produced -17by an equivalent amount of such cells containing the plasmid prAK.

TABLE B-l MUTANT VITH REFERENCE TO TABLE B p26-3 TOXICITY SCORE MEAN TOXICITY 2.75 p48al4 2.25 p48cS 2.63 p36a65 1.50 p95a76 2.50 p95a86 1.30 p98cl 1.33 p99c62 1.83 pl07c22 1.42 pll4a30 2.00 control (JM1O3 cells) 4.68 prAK 3.35 control (SG4044 cells) 4.12 TABLE B-2 MUTANT VITH REFERENCE RELATIVE TO TABLE B POTENCY p26-3 217 p36A65 887 p95a76 291 pl07c22 357 pll4a30 239 control (SAN415) 59 pBT301 100 In Table B-2 above, the standard, pBT301 is assigned a relative potency of 100, according to LD50 (for a fuller description see Example -18A), and thus any relative potency value higher than this indicates an increased level of toxicity caused by the mutation.

In additional vork in furtherance of the invention, certain of the mutant DNA shovn by Table B above to involve multiple mutations vere analysed to determine the effect of individual and-pairs of mutations in such multiple mutated sections. Such sub-cloning of individual mutations or pairs thereof vas carried out using a strategy involving the isolation of » targeted multiple mutated fragment and then cutting it at a restriction site internal to the fragment and located betveen tvo of the mutated codons. The tvo halves or fragment segments vere then gel isolated and each mixed vith non-mutant complementary halves or fragment segments obtained by similarly cutting the same fragments from prAK. The prAK vector vhich had been cut to isolate the larger complementary fragment vas then mixed vith the tvo mixed complementary halves and all three DNA segments ligated together to form a modified prAK plasmid containing the point mutation or mutations existing in the fragment half originating from the multiple mutant clone. More particularly, a site for the restriction endonuclease Xho II vas strategically located vithin certain multiple mutant segments so as to enable the isolation of fragments having less than the total number of mutations in the total mutant segment. As vill be evident, the use of the endonuclease Xho II vas applicable to a number of the multiple mutant segments in Table B for purposes of obtaining fragments vith a single point mutation and others vith tvo mutations. Hence, multiple mutant plasmids vere first treated vith the restriction endonucleases Nsi I and Sst I and the resulting 1430 base pair fragments separated by gel isolation. Each such 1430 bp fragment vas then treated vith the restriction endonuclease Xho II and the resulting 330-bp (Nsi Ι/Xho II) and 1100 bp (Xho II/Sst 1) fragments gel isolated for each multiple mutant. Counterpart, non-nautant fragments of 330 and 1100 bp and the larger, approximately 4Kb Nsi I/Sst I fragment of prAK vere then similarly obtained. More particularly, small quantities of the larger segment vere mixed vith the mutated 330 bp -19fragment and the non-mutated prAK 1100 bp fragment and the resulting mixture ligated to form a series of hybrid mutant plasmids of prAK. In a like manner, quantities of such larger prAK segments vere mixed vith the non-mutated 300 bp prAK fragments and the mutant 1100 bp fragments and these DNA ligated to form another series of hybrid mutant plasmids. The hybrid mutant plasmids or clones resulting from the above indicated strategy are summarised belov in Table C vhich shovs the three segments combined and the mutations in the resulting plasmid compared to the plasmid prAK.

TABLE C NEWLY FORMED prAK- DESIG- ΝΑΤΙ0Ν VECTOR SEGMENT AND SOURCE SOURCE OF Nsil/ XhoII SEGMENT 330 bp SOURCE OF XhoII/ Sstl SEGMENT 1100 bp MUTATION AMINO ACID POSITION A prAK Nsil/Sstl 4 Kb p48al4 prAK Glu to Lys @ 101 Glu to Lys @ 116 B n p26-3 prAK Ala to Thr @ 119 C n p48c5 prAK Glu to Lys @ 116 D w prAK p48al4 Arg to His @ 217 E n prAK p26-3 Met to He @ 130 Gly to Asp @ 201 F M prAK p48c5 Ala to Thr @ 187 In a second round of hybrid mutant clone preparation using the same analogous procedure applied in preparing the clones of Table C, a series of mixed combination mutant plasmids vere prepared by the three segment combination of the large segment (roughly 4kb) from the digestion of prAK vith Nsi I and Sst I, a 330 bp Nsi I/Xho II fragment from one of the clones of Table B and a 1100 bp Xho II/Sst I fragment from a differ-20ent clone of Table B. The hybrid mutant clones resulting from this second round are shovn belov in Table D, it being noted that tvo plasmids arising from this second round protocol contained four amino acid changes compared to the parent prAK plasmid. -21NEWLY FORMED prAKDESIGNATION prAK-J prAK-K prAK-L prAK-M prAK-N prAK-0 prAK-P prAK-Q prAK-R prAK-S prAK-T TABLE D VECTOR SEGMENT AND SOURCE SOURCE OF Nsil/ XhoII SEGMENT 330 bp prAK Nsi/Sst 4 Kb p48al4 tt p48al4 tt p48c5 tt p26-3 tt p26-3 it p48c5 tt p26-3 «9 p48c5 • tt p48al4 tt p26-3 tt p48c5 SOURCE OF XhoII/ Sstl SEGMENT MUTATION AMINO 1100 bp ACID POSITION p26-3 Glu to Lys 101 Glu to Lys 116 Met to He e 130 Gly to Asp 201 p48c5 Glu to Lys 8 101 Glu to Lys @ 116 Ala to Thr @ 187 p26-3 Glu to Lys @ 116 Met to lie 130 Gly to Asp 201 p48al4 Ala to Thr Θ 119 Arg to Bis @ 217 p48c5 Ala to Thr 119 Ala to Thr @ 187 p48al4 Glu to Lys 116 Arg to Bis € 217 p36a65 Ala to Thr 119 Thr to He 122 Ala to Val 125 p36a65 Glu to Lys @ 116 Thr to lie @ 122 Ala to Val @ 125 p36a65 Glu to Lys @ 101 Glu to Lys 0 116 Thr to lie @ 122 Ala to Val 0 125 p95a86 Ala to Thr 0 119 Thr to Ser 0 188 p95a86 Glu to Lys 0 116 Thr to Ser 0 188 -22TABLE D (CONT) NEWLY FORMED prAK- DESIG- NATION VECTOR SEGMENT AND SOURCE SOURCE OF Nsil/ XhoII SEGMENT 330 bp SOURCE OF XhoII/ Sstl SEGMENT 1100 bp MUTATION AMINO ACID POSITION prAK-U ft p48al4 p95a86 Glu to Lys 0 101 Glu to Lys ? 116 Thr to Ser 0 188 prAK-53 n p99c62 pl07c25 Asn to Tyr 0 105 Phe to lie Q 184 prAK-68 » p99c62 p26-3 Asn to Tyr 0 105 Met to lie @ 130 Gly to Asp 6 201 prAK-70 n p26-3 pl07c25 Ala to Thr 0 119 Phe to He 0 184 prAK-39 ft p99c62 p98cl Asn to Tyr 0 105 Thr to Ser 0 188 The various hybrid mutants shown in Tables C and D were evaluated according to the Tobacco Budvorm Assay of Example A and the evaluation included the mutant clones of Table B for comparison, inter alia, of the effect of essentially deleting or removing one or two mutations from the original mutants of Table B. The results of these toxicity or insecticidal activity evaluations are reported below in Table E wherein it is noted: 1) the lover score in the toxicity column indicates the greater level of activity (see Example A for an explanation of scores); and 2) the controls involve an equivalent amount of JM1O3 cells and SG4044 cells vhich had not*been transformed vith any plasmid, it being noted that most if not all mutants evaluated in both such types of E. coll cells and the mutant results in the tables herein vhich refer to both controls are to be taken as an average of the results for the mutants expressed from both type cells. -23TABLE Ε Mutant with reference Toxicity Score to Tables B, C or D Average Toxicity Control 4.68 prAK 3.35 A 2.05 B 2.90 C 2.68 D 3.40 E 2.50 F 3.00 E. coli SG 4044 (Control) 4.12 J 2.25 K 2.06 L 2.08 M 3.10 N 2.73 0 2.70 P 1 .00 Q 1 .87 R 2.85 S 2.16 T 1 .20 u 2.07 53 3.08 68 2.00 70 T.50 39 2.50 - 24 The invention further includes a demonstration of the ability for general amino acid substitution at the amino acid positions at vhich the initial random DNA mutations produced amino acid changes, vhereby a vide variety of novel insecticidally active B.t. endotoxin proteins are provided. This ability vas demonstrated vith relative ease by so-called codon-spin experiments in vhich selected codons involved in the initial mutation changes vere changed to the codons for the other natural amino acids. These nev mutants expressed an endotoxin protein having insecticidal activity against the Tobacco Budvorm. In order to conduct such an investigation more efficiently, a series of unique plasmids of the prAK type vere prepared starting essentially vith prAK and culminating in the plasmid prAK-7, and other intermediate plasmids being sequentially in order of preparation prAK-3, prAK-4, prAK-5 and prAK-6, as described in Example 1. The plasmid pB8rII as shovn in Fig 2 is in all respects identical to the plasmid prAK except that it contains DNA coding for a truncated endotoxin somevhat longer than that coded for by prAK and except for Inconsequential modifications in the parent plasmid made ln the area of its ligation to the downstream end of DNA truncated endotoxin structural gene, said structural gene as shovn in Fig 2 shoving the Kpn I site in the native gene vhereas ln prAK the site is deleted and the prAK structural gene ends at about the former position of said site. The plasmid prAK-7 is designed to express the same endotoxin amino acid sequence as plasmid prAK but has had its DNA sequence modified to include not only the Nru I site of prAK-3, but also a Bind III, Mst II and BssH II site and in addition the Hind III site originally found in prAK is preferably removed. As more particularly indicated in Example 1, the sequential order of preparation of prAK-7 from prAK and the addition or deletion of a site in each step may be summarised as follovs:prAK------------> prAK-3 (add Nru I) prAK-3----------> prAK-4 (add Hind III) prAK-4----------> prAK-5 (add Mst II) - 25 prAK-5----------> prAK-6 (add BssH II) prAK-6 ----------> prAK-7 (delete original Hind III) The above indicated sites vere introduced about 40 base pairs apart such that an automated DNA synthesiser could be used effectively to make small double stranded DNA fragments vhich terminate at their tvo ends vith nucleotides representing the complementary residue of the restriction site residues to be created in prAK-7 vhen it is cut vith the tvo relevant restriction endonucleases. Such fragments therefore could be readily substituted into prAK-7 by standard cutting and ligation procedures (see Example P, infra) to provide a plasmid capable of expressing an endotoxin protein identical to that of prAK except for the amino acid changes coded for by the synthesised fragment substituted into prAK-7 for the corresponding fragment in prAK-7, as exemplified in Example 2 hereof.

Figs 3A and 3B represent tvo small double stranded DNA fragments prepared in accord vith the above codon spin strategy to be substituted into the Hind III/Mst II section in prAK-7. The double stranded fragment shovn in Fig 3A vas designed to produce any amino acid at amino acid position 116 in the truncated B.t. endotoxins expressed by the prAK plasmids by appropriate selection of the XXX codon in accord vith the genetic code. Similarly, the double stranded fragment shovn in Fig 3B vas designed to produce an amino acid at amino acid position 119 in the truncated B.t. endotoxins produced by the prAK plasmids by appropriate selection of the XXX codon in this fragment. As vill be apparent, the other double stranded fragments required for substitution into the Spe I/Nru I location (a fragment span of about 115 base pairs vhich is also preparable by automated DNA synthesisers), the Nru I/Hind III location and the Mst ΙΙ/BssH II location in prAK-7 and designed to code for all amino acids at all points of mutation found in these sections may be prepared by analogous standard procedures. Hence, the remaining 18 of the 19 natural amino acid changes or mutations to be made at each point - 26 of mutation betveen the Nru I and BssH II sites in prAK-7 may be readily made using plasmid prAK-7.

To cover all of the points of mutation vithin the 116 amino acid concerned sequence for conveniently spinning of relevant codons, the plasmid prAK-7 may be used to prepare plasmid prAK-8 vhich in turn is used ultimately to prepare prAK-9, as described in Example 1. Xn Fig 5, all of the relevant restriction sites as ultimately accumulated in prAK9 are shovn in an expanded cut-avay section of prAK-9. The Spe I site shovn in Fig 5 is also a unique site vhich vas already present in prAK, prAK-3 etc. As vill also be appreciated, the plasmids prAK-7, prAK-8 and prAK-9 may be used to introduce multiple mutation changes betveen any one pair of restriction sites and/or to produce DNA coding for at least one change vithin tvo or more such locations, such that a large variety of multiple mutant combinations involving original points of mutation found in accord vith the invention may be constructed to produce a large variety of nev insecticidally active B.t. endotoxin proteins.

As vill also be appreciated, plasmids such as prAK-7, prAK-8 and prAK-9 are fully capable plasmids for changing any one or more codons vithin any of the restriction site pair locations provided in these plasmids. Where changes are desired vithin one or tvo but less than three such locations, plasmids such as prAK-4 or prAK-5 may be used if covering the desired location of changes, preferably after removal of the original Hind III site in prAK, and lf such plasmids are not suitable, it vill be appreciated that a prAK type plasmid containing any one or more of such locations may be prepared conventionally by varying or limiting the selection for introduction of the restriction site pairs used to modify prAK in producing prAK-9. Hence, the invention provides also a variety of novel plasmids useful for production of mutants and mutant combinations in accord vith the invention and containing any one or more of the restriction site pairs ultimately produced in prAK-9. - 27 As vill also be appreciated, DNA comprising any one or more such restriction site pairs may be excised, before or after modifying to contain one or more mutations in accord vith the invention, from the prAK type plasmids by cutting at restriction sites vhich are outside the desired mutation region(s) and vhich are correspondingly found in an5 other plasmid for a B.t. endotoxin, and then inserting (ligation by standard means) the excised DNA segment into such other B.t. endotoxin plasmid vhich has been similarly cut, thereby enabling such other plasmids to be conveniently modified or for purposes of directly inserting the mutations of the invention therein.

For purposes of incorporating mutations provided by . the invention into a full length endotoxin coding sequence, a plasmid incorporating the DNA structural gene for the &-endotoxln of B.t vuhanensis vas used as a matter of convenience and ready availability at the time. This plasmid, pBT210, is shovn in Fig 4. The plasmid pBT210 incorporates the full length endotoxin structural gene from B.t. vuhanensis as indicated by the thick dark line in Fig 4, and by analogy to Fig 1, also incorporates a sequence containing a B.t. ribosomal binding site vhich vas obtained from B.t. vuhanensis along vith the structural gene and vhich is indicated in Fig 4 by the dark box. The plasmid pBT210 is a fully competent E. coli expression vector including the same E. coll promoter system as the prAK plasmids, an E. coli origin of replication (not shovn) and a gene for chloramphenicol resistance as indicated in Fig 4. The arrovs in Fig 4 shov the reading direction of the B.t. vuhanensis OC 3 gene under control of the E. coli promoter and of the gene for chloramphenicol resistance. ‘Based upon sequence information in our possession, the entire operon (structural gene, B.t. derived ribosomal binding sequence section and E. coll promoter/operator sequence) is very similar and only insignificantly different from the operon in the plasmid prAK.

In particular, the DNA coding for the 610 amino acids of the active portion of the B.t. endotoxin (Table A) and extending into the protoxln region at least about up to the Kpn I site shovn in Fig 4 for pBT210 is - 28 identical to the corresponding DNA sequence in the plasmid prAK.. In the DNA region downstream from the Kpn I site in the B.t. structural gene in pBT21O to the end of such structural gene there are unknown but minor differences compared to the corresponding section of the B.t. kurstakl HD-1 gene truncated in making prAK. These differences vere indicated by restriction endonuclease mapping. The plasmid pBT21O codes for a full length endotoxin as shovn in Table A and is completely homologous in the active portion (and through at least the amino acids produced up to its Kpn I site to the δ-endotoxin from B.t. kurstakl HD-1 in clones prAK and pB8rII)t and has substantial homology in the balance of the protoxln section. Finally, the ribosomal binding site in pBT210 ls identical to that in prAK and the entire DNA including the ribosomal binding site (RBS) and extending upstream from just before the initiation Met back through the Bam HI site joining the promoter section are the same in pBT21O and in prAK except that in pBT210 there are tvo nucleotide changes immediately after the Bam HI site (CC instead of GT as in prAK) and three nucleotides (TTT) as found in prAK immediately after such tvo nucleotides are deleted in pBT210, these differences coming merely as a result of different ligation strategies in joining the RBS sections from B.t. to the E. coll promoter section through a Bam HI site. The plasmid pBT21O may be used to produce full length mutant B.t. δ-endotoxln protein having any one or more of the amino acid changes provided by the present invention. The Nsi I site, the tvo Xba I sites, the Sst I site and the first appearing dovnstream Hind III site shovn in Fig 4 for pBT21O correspond to the same sites shovn in Fig 1 for prAK (the DNA for both plasmids in this region being identical as above indicated). - 29 EXAMPLE A 1. Trichoplusia nl (T. nl) assay Tests vere performed on second lnstar larvae. All Insects vere kept in climatic chambers under standard conditions of temperature, humidity etc throughout the test period, and vere fed on a standard artificial diet. Test substances vere given to the Insects as part of the diet, vith each concentration of test substance being administered to one batch of tventy insects. Insects vere monitored for a period of 7 days after treatment, after vhich time the LDS0 of the insects vas taken. LD50 may be defined as an estimate of the dose of substance required to induce mortality in 50% of the subjects. Final results are given as relative potency, vherein; relative potency - LDso of standard x 100 LDso of experimental Using the above technique the absolute values of LD50 can be provided vherein interpretation of the results is simple, such that all relative potency values higher than that of the standard indicate an activity higher than that of the standard. Furthermore a substance vith a relative potency of eg 400 vhen compared to a standard of 100, is 4 times more active than the standard.

The standard, having a relative potency of 100 in the above test, vas the plasmid pBT301, vhich plasmid contains a full-length vild-type δ-endotoxin sequence, being identical to pBT21O except for containing tvo E. coli promoters, each of vhich individually is the same as that contained in pBT210.

Controls used in the above test vere; - 30 a) CAG 629 - an E. coli strain containing no δ-endotoxin producing plasmids and having no insecticidal (gift from C A Gross, Department of Bacteriology, University of Wisconsin), activity per se; b) SAN 415 - a commercially available B.t. insecticide, obtainable under the registered trade name JAVELIN.

IQ 2. Tobacco Budvorm assay (TBW assay) The TBW assay employed vas that basically described by Dulmage et al, (1971) J. Invertebr. Path. 18 240-245, and vas performed vith samples done in triplicate in 1 ounce clear plastic souffle caps, vith one 2nd instar TBW larva (4 to 5 days old, average veight 1.6 gm) in each cup. The samples vere combined vith 15ml diet (comprising the Nutrient Povder, Vitamin Povder, agar and other ingredients) as described by Dulmage et al, USDA Technical Bulletin No. 1528:1-5 (1976). The diet vas divided evenly among three cups vhich vere alloved to cool for % 2Q hour. One TBV vas added (using a size 00 camel hair brush) to each cup and the lids vere securely snapped on. These samples vere then placed in a 27°C, 50Z relative humidity incubator for 4 to 5 days. The size group numbers used in scoring the TBV toxicity assay correspond to the veight ranges given in the folloving table.

GROUP SIZE WEIGHT RANGE (mg) AVERAGE WEIGHT (mg) 1 .0 1.3- 1.9 1.6 1.5 2.7- 3.1 2.8 2.0 5.5- 6.3 5.8 2.5 11.7- 12.3 12.0 3.0 17.3- 22.2 19.6 3.5 30.8- 34.2 32.8 4.0 50.1- 52.4 51.1 4.5 76.6- 94.3 84.8 5.0 119.9-114.7 113.5 6.0 119.8-134.3 >140.0 The Group Size" indicated above equates directly to the toxicity scores reported herein. Hence, the weight of the larva after each test was determined, and assigned the toxicity score equal to the group corresponding to the weight range into which its weight fell. Except as noted, infra, all dead larvae were assigned a group size and toxicity score of zero. The toxicity scores from all replications were averaged to obtain the results reported herein, and typically all results are based on at least 30 replications. - 32 The cups were opened until ranges of different size TBWs were located. These TBWs were weighed out until one TBW was located that fell within every weight range. The sample cups containing the TBW of the given weight range were then marked with the corresponding group size number. These cups were then arranged in ascending order on the lab bench. The remaining samples were then scored by visual comparison of size with the weighed sample TBWs and assigned that group number on a score sheet. Dead larvae were recorded with a and assigned a score of zero. Dead larvae which were bright pink or appeared to have liquified were suspected to have died from causes unrelated to the 3-endotoxin. These larvae were scored with a and not counted in the results.

The standard sample size of 1 ml. of a prAK culture divided among three cups resulted in growth retardation in the middle of the range of toxicity scores. Therefore, the assay was useful in distinguishing the clones with increased toxicity from the ones with reduced or equal toxicity to the nonmutant parent. The assay produced a dose response depending on the amount of prAK culture put into the assay. Hence, the greater the amount of prAK-containing bacteria that was added to the samples, the greater the degree of toxicity to the TBW was observed. The dose response curve of prAK was useful in evaluating the degree by which clones were more toxic than the nonmutant parent. The following table illustrates the dose response of the prAK-containing bacteria: Amount of prAK Stationary Culture Added Toxicity Scores 5 ml 1.5 1.5 2.0 2 2 2.5 2.5 1 3 3 3.5 0.5 3 3.5 4 0.25 3.5 4 4 - 33 On the basis of the above evaluation, all cultures were assayed using 1 ml. of culture in order, in relation to the obtained group sizes, to allow em ample range to ascertain those with greater or less activity relative to prAK (and other nonmutant plasmids) as a standard.

The Nutrient Powder used in the TBW Assay was mixed in the following gram weight proportions: soybean flour, 1103.4 g.; wheat germ, 429.4 g.; Wesson Salt Mix, 292.4 g.; sucrose, 164.2 g.; methyl parabenzoate, 24.6 g.; and sorbic acid, 14.8 g.

The Vitamin Powder used in the TBW Assay mixed in the following gram weight proportions: calcium peutothenate 12.0 g.; Nicotinamide, 6.0 g.; Riboflavin, 3.0 g.j folic acid, 3.0 g.; thiamine Hcl, 1.5 g.; pyridoxine Hcl, 1.5 g.; Biotin, 0.12 g.j and Vitamin B12, 6.0 g.

The following three screening applications of the TBW Assay (Primary, Secondary and Dilution-Series) were employed at various stages of evaluation, and are referred to in this specification.

Primary Assay: One ml aliquots from 18 hr cultures of two separate clones were combined in with TBW diet in a 50 ml conical centrifuge tube and divided evenly between three cups (with one TBW per cup). These samples were evaluated alongside controls of wild type prAK or pBT210 transformed cells and untransfonned cells prepared in the same manner.

Secondary Assay: Samples which displayed increased toxicity toward the TBW's in the primary assay were screened in a second assay. Selected mutant colonies were innoculated from the library plates into YT/Amp broth (one colony per culture). Ten 1 ml samples were evaluated along with appropriate controls. Clones exhibiting increased toxicity to TBW’s were designated as probable up-mutants and were evaluated a third time. Those that repeated their up phenotype a third time were identified as up-mutants and evaluated in a Dilution-Series Assay to more precisely - 34 determine level of enhanced activity versus the parent wild type.

Dilution-Series Assay: Mutants confirmed to display an up phenotype over the non-mutant construction were screened in the TBW assay in a dilution series based on dry weight of lyophilized bacterial cells that contained either the mutant or wild type toxin from prAK or pBT210 clones that were grown for 18 hours (and the cells pelleted prior to lyophilizing). Samples were set up in triplicate at each of the following dilutions in a final volume of 15 ml: 167pg/ml, 67pg/ml, and 33ug/ml. SDS-PAGE and Western (immunoblot) analysis was performed on the protein from these mutants, typically at 75 pg dry weight cells per lane. The Dilution-Series results essentially confirmed the results of the previous assays and are not otherwise reported herein or averaged in the Tables hereof which report biological results.

EXAMPLE P. - REGULAR PROCEDURES In the following numbered examples or otherwise in this specification the following regular or standard laboratory procedures were used where referenced to the following or otherwise required, unless the text hereof indicate otherwise.

Example P-1: Maintenance and Growth of Bacterial and Phage Strains E. coll strains SG4044 and JM103 were host for all 30 plasmid constructions. E> coll strain JM103 and the phage M18 and MP19 were obtained from New England biolabs. These bacterial strains were grown in YT medium (5 g/1 yeast extract, 10 g/1 bactotryptone, 5 g/1 Na Cl). Medium was supplemented with 50 mg/1 ampicillin for growth of cells containing prAK or derivatives of this plasmid and with 20 - 35 mg/ml chloramphenical for cells containing pBT210 or derivatives of this plasmid.

Example P-2: Propagation and Isolation of Phage DNA Preparation of M13 derived recombinant phage stocks and isolation of phage DNA was done using previously described procedures (Messing, J. (1983) Methods Enzymcl. 101:20-78).

Example P-3: Preparation of Synthetic Oligonucleotides Synthetic oligonucleotides were prepared using automated synthesis with an Applied Biosystems (Foster City, CA) 380A DNA synthesis machine.

Purification steps once the cycle was complete were as follows. The synthetic oligonucleotide was deblocked by adding an equal volume of ammonium hydroxide and incubating at 55*C overnight. After removing the ammonium hydroxide by successive rounds of speed-vacuum centrifugation and resuspensions in distilled HjO, the oligonucleotide was further purified by urea-polyacrylamide gel electrophoresis (Urea-PAGE). To visualize the band the gel was placed on a R ** twin layer chromatography plate covered with Saran wrap (registered trademark) and the oligonucleotide was illuminated with short wave ultraviolet light. After cutting the oligonucleotide containing portion of the gel with a razor blade, the oligonucleotide was eluted from the gel in 0.5M ammonium acetate, 1mM EDTA, pH 8.0 at 37*C overnight with agitation. After eluting overnight, the gel fragments were pelleted at 6000 RPM in a JA20 rotor and the supernatant containing the eluted oligonucleotide was transferred to a fresh tube.

ETOH precipitation was used to concentrate the oligonucleotide and it was quantified by absorbance at O.D. 260. 200 pmol of the oligonucleotide was kinased in a 40 pi reaction with 2 units of T4 polynucleotide kinase and 0.05mM ATP. - 36 Example P-4: DNA Transformation of E. coli cells A) E. coli JM103 or SG4044 competent for DNA transformation were prepared as described by a commonly used procedure (Cohen, S.N., Chang, A.C.P. and Hsu, L. [1972] Proc. Natl. Acad. Sci. USSA 69:2110-2114). For site-directed oligonucleotide mutagenesis experiments, heteroduplex recombinant phage (M13) DNA (60ng) was added to 0.2 ml of competent cells and held at 0C for 15 minutes.

The cells were subsequently held at 42’C for 2 minutes and 30 ul of this mixture was added to 3 ml of YT broth containing 0.7% bacto agar held at 42*C. to prevent solidification and 0.2 ml of a fresh overnight culture of JM103 or SG4044. The mixture was immediately spread on a YT agar plate (YT broth plus 1.5% bacto agar) and the plates (inverted) were incubated overnight at 37C.

B) Plasmid DNA (100ng) from mutagenesis experiments or any other ligations involving prAK or pBT210 vectors as described herein was added to 0.2 ml of competent cells (JM103 or SG4044) and held at 0*C for 30 minutes. The cells were subsequently held at 42*C for 2 minutes and returned to an ice bath. Amounts from 2 pi to 200 pi were plated on YT agar containing 50 pg/ml ampicillin for clones based on prAK and 20 pg/ml of chloramphenicol for clones based on pBT210 and incubated overnight at 37*C.

Example P-5: Restriction Enzyme Digestion All restriction enzymes were purchased from either Bethesda Research Labs (Gaithersburg, MD) or New England Biolabs. Incubation conditions were those recommended by the manufacturer. - 37 Example P-6: Ligation of DNA Fragments A) DNA ligation reactions (20 ul) contained 60 mM Tris-HCl, pH 7.5, 10mM MgC12, 1 mM dithiothreitol, 50 UM ATP, 20 nM DNA termini and 20 units T4 DNA ligase (New England biolabs). Incubation was at 14*C for 4 hours.

B) Three fragment ligations were set up with fragments present in a 1:1:1 molar ratio at a concentration of 0.04 pmole each in a 20 ul reaction volume. Incubation was at 16*C for 4 hours when ligating only a sticky end (eg. XhoII internal site) or overnight for ligating any blunt end (eg. a FnuD2 site). New England biolabs (NEB) T4 Ligase was used at a concentration of 10 units (NEB definition) per pi reaction volume.

Example P-7: DNA Sequencing DNA sequencing of 3-endotoxin genes and their derivatives was done by the chain termination method of Heidecker et al. (Heidecker, G., Messing, J., and Gronenborn, B. [1980] Gene 10:68-73).

EXAMPLE 1 Preparation of Vectors prAK-3, prAK-4, prAK-5, prAK-6 and prAK-7 Step a) Preparation of prAK-3 ug of the plasmid pB8rII (shown in Fig. 2 and described above) and the replicative form of DNA from the well-known M13 phage cloning vectors MP18 and MP19 were simultaneously digested with the restriction endonucleases Bam HI (8 units) and Kpn I (10 units) for 60 minutes at 37’c in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 7.9), 6 mM MgCl2» 100 pg/ml bovine serum - 38 albumin. Desired fragments from these resulting DNA mixtures were purified by running the entire mixture on a 1% preparative agarose gel to. separate according to size.

Bands were visualized by staining with ethidium bromide and 5 illuminating with long wave ultraviolet light. The gel fragment containing the desired DNA was cut and the DNA eluted by electrophoresis in dialysis tubing. The Bam HI/Kpn I fragment from pB8rII was ligated into the mp18 and mp19 Bam HI/Kpn I cut and gel purified vectors by incubating for 4 hours at 14*C. in a total volume of 20 1 containing mM Tris-Hcl, pH 7.5, 10 mM MgCl2, 1 mM dithiothreitol, 50 mM ATP, 20 nM DNA termini. The resulting DNA was transformed to competent B. coll JM 103 cells as in Example P-4 except that the YT plates contained isopropyl thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-D-galactoside (X gal), both obtained from Sigma Chemical Company. Since recombinant phage (containing the DNA insert cut from pBSrll) will make clear plaques under these conditions, whereas M18 and M19 make blue plaques, the clear plaques were added to 2 ml of E. coli JM103 cells in YT broth, incubated overnight at 37’C and single stranded DNA was prepared from the phage following the procedure as described by J. Messing, J. Methods Enzymol. (1983), 101:20-78. These desired clones containing the large but single stranded DNA inserts from pB8rII were identified using agarose gel electrophoresis by virtue of their slower mobility as compared to mp18 or mp19. Sequencing of a portion of these clones that included the endotoxin DNA by the dideoxy chain termination method confirmed the presence of the endotoxin DNA and indicated that mp18 had acquired the antisense stand thereof and that mp-19 had acquired the sense strand thereof, both of which were recovered. A 26 base antisense oligonucleotide having the sequence ' GTC CTT CTA ATC GCG AAA TGG CTT GG3 ‘ was prepared by solid phase synthesis in the automated DNA - 39 ' synthesizer, and kinased with T4 polynucleotide kinase and ATP as described by Maniatis et al., Molecular Cloning (1982): A Laboratory Manual; Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. A mixture in total volume of 60 ul. containing 0.4 pg. of the recombinant phage mp19 containing the endotoxin sense strand, 20 mM Tris-Hcl, pH 7.5, 7 mM MgClj, 1mM dithiothreital, 50 mM sodium chloride and 10 ng of the 26 base antisense oligonucleotide was heated at 68*C. for 15 minutes, then at 37*C. for 10 minutes and placed at 0*C. The resulting mixture containing the mp19 recombinant DNA with the mutagenic oligo annealled was then treated by addition of 0.2 mM of each of dATP, dCTP, dTTP and dGTP, 1 mM of ATP, 4 units of DNA Polymerase I Klenow fragment (from New England Biolabs), 0.5 ug of E. coli single strand binding protein (from Pharmacia, Piscataway, N.J.) and 20 units T4 DNA ligase (New England Biolabs). The resulting mixture was incubated at 14*C. for 4 hours for polymerization and ligation to occur and the resulting circular double stranded heteroduplex DNA was 20 transformed into E. coli JM103 and plated as described in Example P-4. Twenty (20) individual plaques were then selected and single strand DNA isolated from the phage as described by Maniatis et al., supra. DNA from phage of the twenty (20) plaques each in a total volume of 20 1 and 25 containing 50 mM Tris-Hcl, pH 8.0, 50 mM KCl, 10 mM MgC^r 10 ng of the above?indicated antisense 26 base oligonucleotide and 0.2 ug of different circular single strand phage DNA molecules were each heated at 68*C. for 15 minutes and placed at 37C. for 10 minutes. The restriction endonuclease Nru I (8 units) was added to each resulting mixture and incubation at 37*C was continued for 1 hour.

The mixture was electrophoresed through a 0.8% agarose gel. About 10% of the samples contained DNA migrating as linear DNA to enable the identification of the positive clones containing the desired Nru I site, and positive clones were - 40 transformed into E. coli JM103 to ensure purification. DNA between the Bam HI and Xba I site in the positive clones was excised therefrom (after annealling with ml 3 sequencing oligo and polymerizing to make double stranded as described above for the Nru I oligo) by simultaneous cutting, with the endonucleases for these sites and ligated (Example P-6A) with the large fragment (about 5004 base pairs and missing the about 749 bp fragment between the Bam HI and the second Xba I site in prAK) which was obtained and gel purified after complete digestion of prAK simultaneously with the same two restriction enzymes, all in a conventional manner to form the plasmid prAK-3.

Step b) Preparation of prAK-4 Following the essentially total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step a) was annealed to a 25 base synthesized antisense oligonucleotide having the sequence 5’ CCACTCTCTAAAGCTTTCTGCGTAA3 , designed to introduce the Hind III site between nucleotide position number 327 and 351 in the Table A nucleotide sequence. Positive clones now having both the desired Nru I and Hind III sites were identified in a frequency of about 6.6% by cleavage evaluation with the nuclease Hind III, and were used to prepare prAK-4 by ligating the Bam ΗΙ/Xba I fragment with the new sites to the 5004 bp large fragment f rom prAK in the manner of Step a).

Step c) Preparation of prAK-5 Following essentially the total procedure which is analogous to Step a), the single stranded phage DNA obtained in Step b), above, was annealed to a 26 base synthesized antisense olegonucleotide having the sequence ' GCATCTCTTCCCTTAGGGCTGGATTA3 , designed to introduce the Mst II site between nucleotide - 41 position number 366 and 391 in the Table A nucleotide sequence. Positive clones now having all three of the desired Nru I, Hind III and Mst II sites were identified in a frequency of about 9.1% by cleavage evaluation with the restriction enzyme Mst II, and were used to prepare prAK-5.

Step d) Preparation of prAK-6 Following essentially the total procedure which is analogous to Step a), above, the positive double stranded phage clones from Step c), above, were converted into single stranded phase DNA and annealed to a 26 base synthesized antisense oligonucleotide having the sequence · GCGGTTGTAAGOSCGCTGTTCATGTC3 , designed to introduce the Bss HII site between nucleotide position number 406 and 431 in the Table A nucleotide sequence. Positive clones now having all four sites ultimately desired in prAK-7 were identified in a frequency of about 12.5% by cleavage evaluation with the enzyme Bss HII, and were used to prepare prAK-6.

Step e) Preparation of prAK-7 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step d), above, was annealed to a 26 base synthesized antisense oligonucleotide having the sequence * TACAGTCCTAAATCTTCCGGACTGTA3 , designed to eliminate the Hind III site between nucleotide positions number 1682 and 1707 in the Table A nucleotide sequence. Positive clones representing the total sequence desired for prAK-7 were identified in a frequency of about 2.8% by restriction endonuclease screening of the replicative form (double-stranded) of the recombinant phage DNA for the loss of the Hind III site between nucleotides 1682 and 1707. Double-stranded DNA isolated from the mutant was used to prepare prAK-7. - 42 To complete the provision of a plasmid (prAK-9) having suitably unique and spaced restriction sites for conducting codon spin experiments at other points of mutation between the two Xba I sites the development of the prAK series plasmids may be continued analogously to the following steps to prepare a plasmid prAK-8 and therefrom prAK-9 as indicated below in Steps f) and g).

Step f) Preparation of prAK-8 Following essentially the total procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step e), above, was annealed to a 27 base synthesized antisense oligomer having the sequence: 'TCCCCACCTTTGGCCAAACACTGAAAC 3' designed to introduce a Bal I restriction site at about nucleotide position number 534 in the Table A nucleotide sequence. Positive clones (prAK-8 now having all five of the desired Nru I, Hind III, Mst II, BssHII and Bal I sites and missing the Hind III site removed in preparing prAK-7 are identified in the manner of Step a), above.

Step g) Preparation of prAK-9 Following essentially the procedure which is analogous to Step a), above, the single stranded phage DNA obtained in Step f), above, was annealed to a 30 base synthesized antisense oligomer having the sequence: ' GTTGCCAATAAGACGCGTTAAATCATTATA 3* designed to introduce a Mlu I restriction site between nucleotide position number 588 and 595 in the Table A nucleotide sequence. Positive clones now having all six of the desired Nru I, Hind III, Mst II, BssHII, Bal I and Mlu I restriction sites and missing the Hind III site removed in forming prAK-7 are identified in the manner of Step a) and denominated as plasmid prAK-9.

As will be evident, cassette DNA suitable for substitution between the Bal I and Mlu I sites in prAK-9 may be appropriately coded to introduce all possible codon and - 43 amino acid variations at the mutated amino acid positions 184, 187, 188 and 194.

In a like manner, cassette DNA suitable for substitution between the Mlu I and second Xba I site may be appropriately coded to introduce all possible codon and amino acid variations at the mutated amino acid positions 201 and 204.

Fig. 5 is a schematic representation of the unique restriction sites introduceable between the two original Xba I sites found in prAK (the first such Xba X site in prAK-9 now being the Nru I site).

Underlining in the antisense oligonucleotides shown above in the various steps of Example 2 indicates the change or changes to be introduced.

EXAMPLE 2 Codon Spin Experiments A) Single stranded oligonucleotides having the sequence of each of the two strands shown in Fig. 3A 6 3B were prepared as described in Example P-3 with the DNA synthesizer programmed to randomly insert all of the nucleotides A, T, C and G at each of the X-positions in each strand shown in Fig. 3A. A total of approximately 200 ug (after purification) of DNA from each run on the machine such single strands (representing a family of oligonucleotides identical except at the X-positions of each strand, were prepared by such procedure. 10 pmoles of each strand, sense and antisense for each codon spin were en masse combined and annealled by heating at 68*C for 10 minutes, then at 37*C. for 10 minutes, cooling to room temperature and placing on ice. The resulting mass of double stranded oligomers conforming to the DNA shown in Fig. 3A was judged to contain at the XXX positions (amino acid position 116) every combination permitted by the genetic code including stop signals and multiple but varying - 44 numbers of 'codons for each of the 20 natural amino acids plus stop signals. 1 pmole of these double strand oligomers or cassettes were then kinased with T4 polynucleotide kinase from New England biolabs and mixed en masse with the larger fragment (present at a 10 fold less molar concentration) obtained by gel isolation after the simultaneous cleavage of the plasmid prAK-7 with the restriction endonucleases Hind III and Mst II in 100 mM NaCl 10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10mM 2-mercaptoethanol and 100 pg/ml BSA, and the resulting mixture was subjected to ligation in accord with Example P-6(A). An aliquot (5 pi) of the resulting ligation mixture was then used to transform E. coli JM 103 under the conditions of Example P-4(B). A number (200) of the resulting transformed cells individually were subjected to the TBW and T.ni Assays (without prior knowledge of what codon at XXX was in any particular clone) and found to produce an activity level fairly indicating that all of the various different mutants had resulted in an insecticidal ly active protein product having activity of at least about that of the control truncated endotoxin, with clear up-mutants (5X control) also indicated. Prior to this, random cells from the transformation were also selected, plated and colonies grown as in Example P-1 to isolate plasmid DNA for DNA sequence analysis by cloning the Bam ΗΙ/Xba I fragment into the sequencing vectors mp18 and mp19 cut with the same enzymes. The DNA in the region of each of eleven (11) such position -116 mutations and the identified up-mutants was then sequence to determine the amino acid coded for at its 116- position. It was found that one of the two up-mutants was the original up-mutant (116-Lys, but coded for by AAA). The other up-mutant was found to 116- Arg coded for by CGT. One of the other clones was found the native 116-Glu (but coded by GAA). Seven of the other light mutants were 116-Ile (ATT), 116-Cys (TGC), 116-Leu (CTC), 116-Asp (GAT), 116-Asn (AAC), 116-Ile (ATT) and 116-Gly (GGA), all unique - 45 except the new 116-Ile (ATT) was represented by two of the clones. The final clones coded for 116-STOP (TGA).

B) The procedure of part A) of this Example 2 was repeated for amino acid position-119 using the DNA shown in Fig. 3B. Again, the random evaluation of a large number of resulting clones produced an activity level in the TBW and T.ni Assays fairly indicating that all mutant clones in the pool were active. (The % of inactive molecules was approximately equal co what frequency of STOP codons UAA, (JAG, and UGA would be expected from the random input by the machine of the nucleotides at the XXX positions). Seven randomly selected individual clones were each indicated to have an activity level at least approximately that of the truncated native sequence endotoxin produced by prAK, but none was an up-mutant by our arbitrary standard. Sequencing of the seven individual clones showed that they were all different and unique, as follows: 119-Leu (CTA), 119-Tyr (TAC), 119-Asp (GAT), 119-His (CAT), 119-Pro (CCA), 119-Ile (ATT) and 119-Ser (TCT).

EXAMPLE 3 Mutant Full Length B.t. Endotoxin The plasmid pBT210 (1 pg) was simultaneously cut with restriction endonucleases Bam HI (8 units) and Sst I (8 units) for 60 minutes in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH 7.9) 6mM MgClj, and 100 jig/ml bovine serum albumin. The larger fragment of about 7180 base pairs was gel purified for use as a vector. Then one jug of plasmid prAK-26-3 involving the mutations Ala--->Thr @119, Met--->Ile 0 130 and Gly--->Asp 0 201 was also simultaneously cut with the restriction endonucleases Bam HI (8 units) and Sst I (8 units) in 100 mM sodium chloride buffer solution also containing 6mM Tris-HCl (pH - 46 7.9), 6mM MgCl2, and 100 pg/ml bovine serum albumin.

The smaller fragment of about 1,428 base pairs containing the mutations as well as the B.t. RBS section was gel purified and such fragment in an amount of about 0.06 p moles was combined for ligation with 0.02 p moles of the 7180 base pair vector fragment above obtained and joined together in 20 1 of ligation medium containing 60 mM Tris-Hcl. pH 7.5, 10 mM MgClj, 1mM dithiothreitol, 50 MATP, and 20 units of T4 DNA ligase, and the resulting mixture incubated for 4 hours at 14*C. The resulting plasmid, designated pBt 26-3, was transformed into E. coli JM103 by adding 5 pi of said ligation mixture to 0.2 ml. of competent E. coli JM103, holding initially at 0*C for 30 minutes and then pulsing at 42*C for 2 minutes and returning to ice. Various amounts (2 pi, 20 jul, and 180 jul of the resulting mixture was then immediately spread on YT agar plates with 20 pg/ml chloramphenicol (YT broth plus 1.5% bacto agar) and the plates incubated overnight at 37*C. inverted. Only a transformed cell with chloramphenicol resistance could grow on these plates. Chloramphenicol resistant colonies were grown in liquid culture overnight at 37*C and plasmid DNA was prepared for restriction digestion with EcoRI reagents and DNA sequencing to actually determine the presence of the point mutations. Successful transformants containing the plasmid pBT 26-3 were then evaluated in the TBW and T.ni Assays.

Proceding analogously to Example 3, above, the following additional full length mutant endotoxins were prepared and evaluated in the TBW and T.ni Assays. Table F below indicates the additional full length mutant endotoxin producing plasmid/cell systems that were so prepared, all with the approximate results of their evaluation in the TBW Assay and the approximate results obtained in such assay for the product of Example 3, above, the B.t. Wuhanensis native endotoxin produced in E. coli JM103 and a control involving untransformed JM103 cells. - 47 TABLE F Example No. New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation(s) Involved TBW Assay Toxicity Score 3 PBT26-3 prAK-26-3 119-Thr 130-Ile 201-Asp 1 3-A pBT36a65 prAK-36a6 122-Ile 125-Val 2 3-B PBT-C prAK-C 116-Lys 1 3-C pBT-E prAK-E 130-Ile 2Q1-Asp 2 3-D pBT-0 prAK-0 116-Lys 217-His 2 3-E pBT-R prAK-R 101-Lys 116-Lys 122-Ile 125-Val 2 3-F pBT98cl prAK-98cl 188-Ser 2 3-G pBT-B prAK-B 119-Thr 2 3-H pBT-D. prAK-D 217-His 3 3-1 pBT-P prAK-P 187-Thr 2.5 3-J pBT-J prAK-J 101-Lys 116-Lys 130-Ile 201-Asp 3 3-K pBT-M prAK-M 119-Thr 217-His 2.5 3-L pBT-N prAK-N 119-Thr 187-Thr 3 3-M pBT-S prAK-S 119-Thr 188-Ser 1 - 48 TABLE F icont.) Example No. New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation( s) Involved TBW Assay Toxicity Score 3-N pBT-T prAK-T 116-Lys 188-Ser 1.5 3-0 pBT-U prAK-U 101-Lys 116-Lys 188-Ser 2 3-P pBT107c22 p107c22 94-Lys 194-Lys 3 3-Q pBT99c62 p99c26 4-Thr 105-Tyr 204-Tyr 3 3-R pBT107c25 p107c25 184-Ile 3 3-S pBT-A prAK-A 101-Lys 116-Lys 3 3-T pBT-K prAK-K 101-Lys 116-Lys 187-Thr 3 3-U pBT-P prAK-P 119-Thr 122-Ile 125-Val 2.5 3-V pBT-Q prAK-Q 116-Lys 122-Ile 125-Val 3 3-W pBT39 prAK-39 105-Tyr 188-Ser 3 3-X pBT70 prAK-70 119-Thr 184-Ile 1 3-Y pBT68 prAK-68 105-Tyr 130-Ile 201-Asp 1 - 49 TABLE F (cont.) Example No. New Mutant Full Length Plasmid Identification Source of Mutant Bam HI/ Sst I Sequence Actual Mutation( s) Involved TBW Assay Toxicity Score 3 3-Z pBT53 prAK-53 105-Tyr 184-I1E Control B.T. Wuhanensis - - 3 Control JM103 - - 4.7 EXAMPLE 4 More Full Length Mutant B.T. Endotoxins The plasmid pBT210 (1 jag) was simultaneously digested with the restriction endonucleases Bam HI (B units) and Sst I (6 units) and the resulting 7180 bp large fragment was gel isolated. In a series of separate experiments each (1 jig) of the plasmids prAK, prAK-Ε, p26-3, p36a65 and p95a86 was also simultaneously digested with the restriction endonucleases Ban BI (8 units) and Sst I (8 units) and each resulting 1428 bp fragment comprising a portion of a truncated endotoxin coding sequence was gel isolated. Each quantity of these 1428 bp fragments was then separately digested with the restriction endonuclease Fnu D2 (4 units in 6mM NaCl, 6mM Tris HCl (ph 7.4) 6mM MgCl2r 6mM 2-mercaptoethanol, 100 jig/ml bovine serum albumin). The restriction endonuclease Fnu D2 (also known as Acc 2) cuts each of the various 1 428 bp Bam ΗΙ/Sst I fragments only once and into a 640 bp Bam HI/Fnu D2 fragment and a 788 bp Fnu D2/Sst I fragment, the different fragments from each experiment being purified by agarose gel electrophoresis. - 50 There vas thus obtained a series of diffeent 640 bp Bam HI/Fnu 02 fragments and a series of different 788 bp Fnu O2/Sst I fragments. By selecting one fragment from each of these tvo series and ligating (Example P-6B) vith the 7180 bp larger fragment obtained from pBT210, there vas obtained a number of nev plasmids harbouring different full length mutant B.t. endotoxin genes. The thus obtained nev plasmids, identified belov in Table G, vere then used to transform E. coll JM103 according to the procedure of Example P-4(A) and the resulting cells vere evaluated for the production of B.t. endotoxin in the TBV assay of Example A, the approximate results obtained in said assay being also reported belov in Table G. Various of the transformed cells containing plasmids as described in Tables F and G vere also evaluated in the T. ni assay, the results of vhich are illustrated belov ln Table H.

TABLB G EXAMPLE NO. NEV FULL LENGTH MUTANT PLASMID IDENTIFICATION SOURCE OF BAM HI/ FNU D2 FRAGMENT 4-A 66 p36a65 4-B 67 p26-3 4-C 74 p36a65 4-D 106 p26-3 4-E 107 prAK 4-F 108 prAK-E SOURCE OF FNU D2/ SST I FRAGMENT ACTUAL MUTATION(S) INVOLVED TBV ASSAY SCORE p26-3 122-Ile 125-Val 201-Asp 3 p95a86 119-Thr 130-Ile 188-Ser 1P95a86 122-Ile 125-Val 188-Ser 3 prAK 119-Thr 130-Ile 1 p26-3 201-Asp 2.5 prAK 130-Ile 3 TABLE Η PLASMID IDENTIPIC. TABLE SOURCE RELATIVE POTENCY pBTA F 391 pBTC F 299 pBT66 F 169 pBT107c25 F 254 pBTP F 340 pBTS F 255 pBT67 G 304 pBT106 G 367 standard pBT301 100 control SAN415 59 control CAG629 0 EXAMPLE 5 Cells transformed vith DNA encoding a mutant endotoxin sequence are grovn in a fermentor, under conditions knovn and standard for such. The vhole contents of the fermentor are, at the end of cell grovth and immediately prior to harvest, subjected to a raise in temperature to approximately 70-80°C. This temperature is maintained for 10 mins before cooling and is sufficient to inactivate the recombinant microorganisms vithout affecting the biological activity of the endotoxin proteins. The fermentor contents are then evaporated under pressure to concentrate to one-third of the previous volume and the resulting concentrate subjected to spray drying at an insertion pressure of about 2000 psi using a heated countercurrent air flov vith an inlet temperature of 140-160eC and an outlet temperature of 20-50°C. The resulting povder is mixed vith carrier such as defatted soybean to form a vettable concentrate. Suitable ratios of such vill depend i.a. on the desired -5210 strength of the final product but may, for example, be 60:40 parts by veight povder to carrier. The resulting concentrate preferably contains from 0.4 to 10Z and more preferably 0.8 to 8Z active ingredient, in terms of spores or endotoxin protein. The vettable povder is suitably diluted vith vater as is knovn in the art, for spray application. -53TABLE A (a) -46 GG ATC lie CGT Arg TTT AAA TTG TAG *** TAA TGA AAA ACA GTA TTA Thr Val Leu Phe Lys Leu *** *** Lys TAT CAT AAT GAA TTG GTA TCT TAA TAA AAG AGA TGG AGG TAA CTT Tyr His Asn Glu Leu Val Ser *** *** Lys Arg Trp Arg *** Leu (-15) ATG GAT AAC AAT CCG Met Asp Asn Asn Pro AAC Asn ATC AAT GAA TGC ATT CCT TAT Tyr 45 AAT TGT He Asn Glu Cys lie Pro Asn Cys (15) (1) (4) TTA AGT AAC CCT GAA GTA GAA GTA TTA GGT GGA GAA AGA ATA GAA Leu Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg He Glu ACT GGT TAC ACC CCA ATC GAT ATT TCC TTG TCG CTA ACG CAA TTT Thr Gly Tyr Thr Pro He Asp lie Ser Leu Ser Leu Thr Gin Phe (b) CTT TTG AGT GAA TTT GTT CCC GGT GCT GGA TTT GTG TTA GGA CTA Leu Leu Ser Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu (60) £tt GAT ATA ATA TGG GGA ATT TTT GGT CCC TCT CAA TGG GAC GCA Val Asp lie He Trp Gly He Phe Gly Pro Ser Gin Trp Asp Ala TTT CTT GTA CAA ATT GAA CAG TTA ATT AAC CAA AGA ATA n-1 GAA GAA Phe Leu Val Gin lie Glu Gin Leu He Asn Gin Arg lie Glu Glu (m-1) (c) 300 TTC GCT AGG AAC CAA GCC ATT TCT AGA TTA GAA GGA CTA AGC AAT Phe Ala Arg Asn Gin Ala He Ser Arg Leu Glu 1 Gly Leu Ser Asn (1001 (105) CTT TAT CAA ATT TAC GCA GAA TCT TTT AGA GAG TGG GAA GCA GAT Leu Tyr Gin lie Tyr Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp CCT ACT AAT CCA GCA TTA AGA GAA GAG ATG CGT ATT CAA TTC AAT Pro Thr Asn Pro Ala Leu Arg Glu Glu Met Arg He Gin Phe Asn (135) Notes: (a) is Bam HI site (b) is Spe I site (c) is Xba I site GAC ATG AAC AGT GCC CTT ACA ACC GCT Asp Met Asn Ser Ala Leu Thr Thr Ala (140) ATT CCT lie Pro CTT TTT GCA GTT Val Leu Phe Ala 495 CAA AAT TAT CAA GTT CCT CTT TTA TCA GTA TAT GTT CAA GCT GCA Gin Asn Tyr Gin Val Pro Leu Leu Ser Val Tyr Val Gin Ala Ala (165) 523 AAT TTA CAT TTA TCA GTT TTG AGA GAT GTT TCA GTG TTT GGA CAA Asn Leu His Leu Ser Val Leu Arg Asp Val Ser Val Phe Gly Gin (180) 549 GCG 577 AGG TGG GGA TTT GAT GCC ACT ATC AAT AGT CGT TAT AAT GAT Arg Trp Gly Phe Asp Ala Ala Thr He Asn Ser Arg Tyr Asn Asp (195) 606 n-348 624 TTA ACT AGG CTT ATT GGC AAC TAT ACA GAT CAT GCT GTA CGC TGG Leu Thr Arg Leu He Gly Asn Tyr Thr Asp His Ala Val Arg Trp (m-116) (210) (cl) . 675 TAC AAT ACG GGA TTA GAG CGT GTA TGG GGA CCG GAT TCT ASA GAT Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg Asp (225) TGG ΑΤΆ AGA TAT AAT CAA TTT AGA AGA GAA TTA ACA CTA ACT GTA Trp lie Arg Tyr Asn Gin Phe Arg Arg Glu Leu Thr Leu Thr Val TTA GAT ATC GTT TCT CTA TTT CCG AAC TAT GAT AGT AGA ACG TAT Leu Asp He Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr (255) CCA Pro ATT He CGA Arg ACA Thr GTT Val TCC Ser CAA Gin TTA Leu ACA Thr AGA Arg GAA Glu ATT He TAT Tyr ACA Thr AAC Asn CCA Pro GTA Val TTA Leu GAA Glu AAT Asn TTT Phe GAT GGT Asp Gly AST Ser TTT Phe CGA Arg GGC Gly TCG Ser GCT Ala CAS Gin GGC Gly ATA He GAA Glu GGA Gly AGT Ser ATT He AGG Arg AGT Ser CCA Pro CAT His TTG Leu ATG Met GAT Asp ATA He CTT Leu AAC Asn AGT Ser ATA lie ACC Thr ATC lie TAT Tyr ACG Thr GAT Asp GCT Ala CAT His ASA Arg GGA Gly GAA Glu TAT Tyr TAT Tyr TGG Trp TCA Ser GGG Gly CAT His CAA Gin ATA He ATG Met GCT Ala TCT Ser CCT Pro GTA Val GGG Gly TTT Phe TCG Ser GGG Gly Note: (d) is Xba I site - 55 10 CCA GAA TTC ACT TTT CCG CTA TAT GGA ACT ATG GGA AAT GCA GCT Pro Glu Phe Thr Phe Pro Leu Tyr Gly Thr Met Gly Asn Ala Ala CCA CAA CAA CCT ATT GTT GCT CAA CTA GCT CAG GGC GTG TAT AGA Pro Gin Gin Arg lie Val Ala Gin Leu Gly Gin Gly Val Tyr Arg ACA TTA TCG TCC ACT TTA TAT AGA AGA CCT TTT AAT ATA GGG ATA Thr Leu Ser Ser Thr Leu Tyr Arg Arg Pro Phe Asn lie Gly lie AAT AAT CAA CAA CTA TCT GTT CTT GAC GGG ACA GAA TTT GCT TAT Asn Asn Gin Gin Leu Ser Val Leu Asp Gly Thr Glu Phe Ala Tyr GGA ACC TCC TCA AAT TTG CCA TCC GCT GTA TAC AGA AAA AGC GGA Gly Thr Ser Ser Asn Leu Pro Ser Ala Val Tyr Arg Lys Ser Gly ACG GTA GAT TCG CTG GAT GAA ATA CCG CCA CAG AAT AAC AGC GTG Thr Val Asp Ser Leu Asp Glu He Pro Pro Gin Asn Asn Asn Val CCA CCT AGG CAA GGA TTT AGT CAT CGA TTA AGC CAT CTT TCA ATG Pro Pro Arg Gin Gly Phe Ser His Arg Leu Ser His Val Ser Met 1350 TTG CGT TCA GGC TTT AGT AAT AGT AGT CTA AGT ATA ATA AGA GCT Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser He lie Arg Ala (450) CCT ATG TTC TCT TGG ATA CAT CGT AGT GCT GAA TTT AAT AAT ATA Pro Met Phe Ser Trp He His Arg Ser Ala Glu Phe Asn Asn He ATT CCT TCA TCA CAA ATT ACA CAA ATA CCT TTA ACA AAA TCT ACT lie Pro Ser Ser Gin lie Thr Gin lie Pro Leu Thr Lys Ser Thr AAT CTT GGC TCT GGA ACT TCT CTC CTT AAA GGA CCA GGA TTT ACA Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr GGA GGA GAT ATT CTT CGA AGA ACT TCA CCT GGC CAG ATT TCA ACC Gly Gly Asp He Leu Arg Arg Thr Ser Pro Gly Gin lie Ser Thr TTA AGA GTA AAT ATT ACT GCA CCA TTA TCA CAA AGA TAT CGG CTA Leu Arg Val Asn He Thr Ala Pro Leu Ser Gin Arg Tyr Arg Val AGA ATT CGC TAC GCT TCT ACC ACA AAT TTA CAA TTC CAT ACA TCA Arg He Arg Tyr Ala Ser Thr Thr Asn Leu Gin Phe His Thr Ser ATT GAC GGA AGA CCT ATT AAT CAG GGG AAT TTT TCA GCA ACT ATG He Asp Gly Arg Pro lie Asn Gin Gly Asn Phe Ser Ala Thr Met AGT AGT GGG ACT AAT TTA CAG TCC GGA AGC TTT AGG ACT GTA GGT Ser Ser Gly Ser Asn Leu Gin Ser Gly Ser Phe Arg Thr Val Gly TTT ACT ACT CCG TTT AAC TTT TCA AAT GGA TCA AGT CTA TTT ACG Phe Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser Ser Val Phe Thr - 56 30 TTA AGT GCT CAT GTC TTC AAT TCA GGC AAT GAA GTT TAT ATA GAT Leu Ser Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr lie Asp CGA ATT GAA TTT GTT CCG GCA GAA GTA ACC TTT GAG GCA GAA TAT Arg He Glu Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr (610) GAT TTA GAA AGA GCA CAA AAG GCG GTG AAT GAG CTG TTT ACT TCT Asp Leu Glu Arg Ala Gin Lys Ala Val Asn Glu Leu Phe Thr Ser TCC AAT CAA ATC GGG TTA AAA ACA GAT GTG ACG GAT TAT CAT ATT Ser Asn Gin lie Gly Leu Lys Thr Asp Val Thr Asp Tyr His He GAT CAA GTA TCC AAT TTA GTT GAG TGT TTA TCT GAT GAA TTT TGT Asp Gin Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys CTG GAT GAA AAA AAA GAA TTG TCC GAG AAA GTC AAA CAT GCG AAG Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys CGA CTT AGT GAT GAG CGG AAT TTA CTT CAA GAT CCA AAC TTT AGA Arg Leu Ser Asp Glu Arg Asn Leu Leu Gin Asp Pro Asn Phe Arg GGG ATC AAT AGA CAA CTA GAC CGT GGC TGG AGA GGA AGT ACG GAT Gly lie Asn Arg Gin Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp ATT ACC ATC CAA GGA GGC GAT GAC GTA TTC AAA GAG AAT TAC GTT lie Thr He Gin Gly Gly (e) Asp Asp Val Phe Lys Glu Asn Tyr Val ACG CTA TTG GCT ACC TTT GAT GAG TGC TAT CCA ACG TAT TTA TAT Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr (723) 2250 CAA AAA ATA GAT GAG TCG AAA TTA AAA GCC TAT ACC CGT TAC CAA Gin Lys He Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gin (750) TTA AGA GGG TAT ATC GAA GAT AGT CAA GAC TTA GAA ATC TAT TTA Leu Arg Gly Tyr lie Glu Asp Ser Gin Asp Leu Glu lie Tyr Leu ATT CGC TAC AAT GCC AAA CAC GAA ACA GTA AAT GTG CCA GCT ACG He Arg Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr GGT TCC TTA TGG CCG CTT TCA GCC CCA AGT CCA ATC GGA AAA TGT Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro He Gly Lys Cys Note: (e) is Kpn I site GGA GAA CCG AAT CGA TGC GCA CCA CAA CTT GAA TGG AAT CCA GAT Gly Glu Pro Asn Arg Cys Ala Pro Gin Leu Glu Trp Asn Pro Asp CTA GAT TGT TCC TGC AGA GAC GGA GAA AAA TGT GCC CAT CAT TCC Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His His Ser CAT CAT TTC TCC TTG GAC ATT GAT GTT GGA TGT ACA GAC TTA AAT His His Phe Ser Leu Asp lie Asp Val Gly Cys Thr Asp Leu Asn (840) GAG GAC TTA GGT GTA TGG GTG ATA TTC AAG ATT AAG ACG CAA GAT Glu Asp Leu Gly Val Trp Val lie Phe Lys He Lys Thr Gin Asp GGC CAT GCA AGA CTA GGA AAT CTA GAA TTT CTC GAA GAG AAA CCA Gly His Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro TTA GTA GGA GAA GCA CTA GCT CGT GTG AAA AGA GCG GAG AAA AAA Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys 2700 TGG AGA GAC AAA CGT GAA AAA TTG GAA TGG GAA ACA AAT ATT GTT Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr Asn lie Val (900) TAT AAA GAG GCA AAA GAA TCT GTA GAT GCT TTA TTT GTA AAC TCT Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser CAA TAT GAT AGA TTA CAA GCG GAT ACC AAC ATC GCG ATG ATT CAT Gin Tyr Asp Arg Leu Gin Ala Asp Thr Asn He Ala Met He His GCG GCA GAT AAA CGC GTT CAT AGC ATT CGA GAA GCT TAT CTG CCT Ala Ala Asp Lys Arg Val Bis Ser He Arg Glu Ala Tyr Leu Pro GAG CTG TCT GTG ATT CCG GGT GTC AAT GCG GCT ATT TTT GAA GAA Glu Leu Ser Val lie Pro Gly Val Asn Ala Ala lie Phe Glu Glu TTA GAA GGG CGT ATT TTC ACT GCA TTC TCC CTA TAT GAT GCG AGA Leu Glu Gly Arg He Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg AAT GTC ATT AAA AAT GGT GAT TTT AAT AAT GGC TTA TCC TGC TGG Asn Val lie Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp AAC GTG AAA GGG CAT GTA GAT GTA GAA GAA CAA AAC AAC CAC CGT Asn Val Lys Gly His Val Asp Val Glu Glu Gin Asn Asn His Arg TCG GTC CTT GTT GTT CCG GAA TGG GAA GCA GAA GTG TCA CAA GAA Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gin Glu GTT CGT GTC TGT CCG GGT CGT GGC TAT ATC CTT CGT GTC ACA GCG Val Arg Val Cys Pro Gly Arg Gly Tyr He Leu Arg Val Thr Ala - 58 TAC AAG GAG GGA TAT GGA GAA GGT TGC GTA ACC ATT CAT <5AG ATC Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr lie His Glu lie (1050) GAG AAC AAT ACA GAC GAA CTG AAG TTT AGC AAC TGT GTA GAA GAG Glu Asn Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu 3240 GAA GTA TAT CCA AAC AAC ACG GTA ACG TGT AAT GAT TAT ACT GCG Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala (1080) ACT CAA GAA GAA TAT GAG GGT ACG TAC ACT TCT CGT AAT CGA GGA Thr Gin Glu Glu Tyr Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly TAT GAC GGA GCT TAT GAA AGC AAT TCT TCT GTA CCA GCT GAT TAT Tyr Asp Gly Ala Tyr Glu Ser Asn Ser Ser Val Pro Ala Asp Tyr GCA TCA GCC TAT GAA GAA AAA GCA TAT ACA GAT GGA CGA AGA GAC Ala Ser Ala Tyr Glu Glu Lys Ala Tyr Thr Asp Gly Arg Arg Asp AAT CCT TGT GAA TCT AAC AGA GGA TAT GGG GAT TAC ACA CCA CTA Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu CCA GCT GGC TAT GTG ACA AAA GAA TTA GAG TAC TTC CCA GAA ACC Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr GAT AAG GTA TGG ATT GAG ATC GGA GAA ACG GAA GGA ACA TTC ATT Asp Lys Val Trp lie Glu lie Gly Glu Thr Glu Gly Thr Phe He (1170) GTG GAT AGC GTG GAA TTA CTC CTT ATG GAG GAA TAG Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu *** (1181) The more preferred mutations of the invention include those at positions 116 (Lys or Arg), 119 (Thr), 130 (He) and 188 (Ser) and combinations including one or more of the same such as those found in pBT26-3, pBT-106, pBT-68, pBT-C, pBT-67 and pBT-78 (certain of these found in Table G). Also of preferred interest are the individual and combined mutations in p36a65, particularly for truncated endotoxins. - 59 The mutations found and permitted in accord with the invention at amino acid position-4 are of interest since they fall within a section of 25 amino acids (positions 1 to 25, inclusive, in Table A) which has been postulated to also form a pre-toxin or protoxin portion of the endotoxin and subject to protease cleavage in the gut to form the active endotoxin or more active endotoxin. Hence, the mutations permitted at position-4 are indicated to be relevant to endotoxin sequences comprising said 25 amino acids or having substantial (at least 70%) homology therewith, and more particularly relevant to those endotoxins coded for in such region by DNA which would hybridize before the position-4 mutation and under stringent conditions to DNA having the sequence found in Table A for the nucleotide positions extending from nucleotide position 1 to and including nucleotide position 75, independent of deletions and additions and with equivalent coding of corresponding amino acids as previously discussed in connection with the conserved; 116 amino acid sequence area.

The mutation uncovered by our work at amino acid position 217 and reported in Table B, above, and evaluated as seen elsewhere herein is judged to indicate that all naturally coded amino acids may be present at this position in active endotoxins having the relevant sequence shown in Table A which extends from the end of the 116 amino acid reference sequence to and including amino acid position 217. Accordingly, the situation in which the amino acid at position 217 in such a sequence or equivalent thereof is any naturally coded amino acid except Arg is included with the scope of the invention. However, since the indicated mutation at position 217 produced less interesting results, it is only, of interest in combination with other mutations disclosed herein and indicating that position 217 can change in endotoxins in which Arg naturally occurs at this position.

Claims (1)

1.CLAIMS 1.A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA including a portion 5 encoding an amino acid sequence demonstrating at least 70% homology to the 116 amino acid sequence beginning at position m-l and extending through position m-116 in Table A hereof, said position numbers applying to such homologous sequence independent of any deletions or additions therein, in vhich said DNA is modified such that any one 10 or more of the folloving amino acids is coded for at the indicated amino acid reference position: a) at position m-5 any natural amino acid except Asn; b) at position m-6 any natural amino acid except Gin; c) at position m-12 any natural amino acid except Glu; d) at position m-16 any natural amino acid except Asn; e) at position m-27 any natural amino acid except Glu; f) at position m-30 any natural amino acid except Ala; s) at position m-33 any natural amino acid except Thr; h) at position m-34 any natural amino acid except Asn; i) at position m-36 any natural amino acid except Ala; j) at position m-41 any natural amino acid except Met; k) at position m-95 any natural amino acid except Phe; 1) at position m-98 any natural amino acidi except Ala; m) at position m-99 any natural amino acid except Thr; n) at position m-105 any natural amino acid except Asn; and o) at position n-112 any natural amino acid except Gly · 2. A structural gene according to claim 1 in vhich the DNA has been modified such that any one or more of the folloving amino acids is coded for at the indicated amino acid reference position: a) at position m-5, Lys b) at position m-6, Lys c) at position m-12, Lys d) at position m-16, Tyr e) at position m-27, Lys or Arg f) at position m-30, Thr 8) at position m-33, Ile h) at position m-34, Tyr i) at position m-36, Val j) at position m-41, Ile k) at position m-95, Ile 1) at position m-98, Thr m) at position m-99, Ser n) at position m-105, Lys; and o) at position m-112, Asp 3. A structural gene according to claim 2 in vhich the DNA has been modified to incorporate the change at one or both of the amino acid reference positions m-27 and m-30. 4. The structural gene of claims 1 to 3 in vhich the DNA portion prior to any of the modifications specified in claims 1 to 3 hybridises under stringent hybridising conditions in vhich hybridisation is effected at 60°C in 2.5x saline citrate (SSC) buffer to a 348 nucleotide oligomer having the nucleotide sequence depicted in Table A beginning at position n-1 and extending through nucleotide position n-348. 5. The structural gene of claim 4 in vhich the DNA portion prior to any modification specified in claims 1 to 3 codes for the 116 amino acid sequence of Table A beginning at position n-l and extending through position m-116. 6. The structural gene of claim 5 in vhich the DNA coding for the endotoxin comprises DNA coding for the amino acid sequence of Table A beginning at amino acid position 1 and extending through amino acid position 205. 7. A structural gene comprising DNA coding for an endotoxin protein having toxic activity against insects, said DNA having a portion encoding an amino acid sequence demonstrating at least 70Z amino acid homology to the 205 amino acid sequence beginning at amino acid position 1 and extending through amino acid position 205 in Table A hereof, in vhich the amino acid at position 4 is any amino acid except Asn. 8. A structural gene according to claim 7 in vhich the amino acid at position 4 is Tyr. 9. An expression vector comprising the structural gene of any one of claims 1 to 8 under control of DNA operative' to cause expression of said structural gene in a bacterial host. 10. An expression vector according to claim 9 in vhich said gene is under control of DNA operative to cause expression of said gene in E. coll. 11. An expression vector according to claim 9 in vhich said gene is under control of DNA operative to cause expression of said gene in B.t. 12. A recombinant endotoxin protein having toxic activity against insects, said protein comprising an amino acid sequence portion having at least 70Z homology vith the 116 amino acid sequence beginning at position m-1 and extending through position m-116 in Table A hereof, said position numbers applying to such homologous sequence independent of any deletions or additions therein, in vhich any one or more of the folloving amino acids are present at the indicated amino acid reference positions: - 63 ii a) at position m-5 any natural amino acid except Asn; b) at position m-6 any natural amino acid except Gin; c) at position m-12 any natural amino acid except Glu; d) at position m-16 any natural amino acid except Asn; e) at position m-27 any natural amino acid except Glu; f) at position m-30 any natural amino acid except Ala; g) at position m-33 any natural amino acid except Thr; h) at position m-34 any natural amino acid except Asn; i) at position m-36 any natural amino acid except Ala; j) at position m-41 any natural amino acid except Met; k) at position m-95 any natural amino acid except Phe; l) at position m-98 any natural amino acid except Ala; m) at position m-99 any natural amino acid except Thr; n) at position m-105 any natural amino acid except Asn; and o) at position m-112 any natural amino acid except Gly 13. An endotoxin protein according to claim 12 in vhich any one or more of the folloving amino acids is coded for at the indicated amino acid reference position: a) at position m-5, Lys b) at position m-6, Lys c) at position m-12, Lys d) at position m-16, Tyr e) at position m-27, Lys or Arg f) at position m-30, Thr g) at position m-33, lie h) at position m-34, Tyr i) at position m-36, Val j) at position m-41, lie k) at position m-95, He l) at position m-98, Thr m) at position m-99, Ser n) at position m-105, Lys; and o) at position m-112, Asp - CA 16. 0 25. in Ο ui An endotoxin protein according to claim 13 in vhich one or both of the amino acids at reference positions m-27 and m-30 have been changed. An endotoxin protein from a gene according to claim 7 or 8. A process for the production of an endotoxin protein which comprises transforming or transfecting a cell vith an expression vector according to any one of the claims 9 to 11 and culturing the resulting cells to produce said endotoxin. A process according to claim 16 in vhich the cell transformed or transfected is a bacterial cell. A plant comprising cells containing a structural gene according to any one of claim 1 to 8. Bacterial cells comprising an expression vector according to any one of claims 9 to 11. An insectidical composition comprising an insecticidally effective amount of a protein produced from a DNA according to any one of claims 1 to 8 in association vith an agriculturally acceptable carrier. An insecticidal composition comprising an insecticidally effective amount of a protein according to any one of claims 12 to 15 in association vith an agriculturally acceptable carrier. A structural gene according to Claim 1 substantially as hereinbefore described by way of Example. An expression vector according to claim 9 comprising a gene according to claim 22. A recombinant endotoxin protein according to Claim 12 substantially as hereinbefore described by way of Example. An endotoxin protein produced from a gene according to claim 22. - 65 26. A process according to claim 16 substantially as hereinbefore described by way of Example. 27. An endotoxin protein whenever produced by a process as claimed in any of claims 16, 17 or 26. 28. A host cell according to claim 19 comprising an expression vector according to claim 23. 29. An insecticidal composition according to claim 20 or 21 comprising an insectici dally effective amount of an endotoxin protein as claimed in any of claims 24, 25 or 27.