IE62833B1 - Bacillus thuringiensis and bacillus cereus recombinant transformation - Google Patents

Abstract

The present invention describes a process which makes it possible to carry out direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus using recombinant DNA technology. The present invention also relates to the construction of plasmids and shuttle vectors and to the B. thuringiensis strains transformed therewith. Likewise described is a process for the direct cloning, expression and identification of genes in B. thuringiensis and the closely related B. cereus.

Description

Bacillus thuringiensis and Bacillus cereus recombinant transformation The present invention describes a process that for the first time renders possible a direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus using recombinant DMA technology, based on an efficient transformation process for the said Bacillus species» Xn particular, tha present invention relates to a process for inserting and cloning and, if desired, also expressing genes or other useful DMA sequences in Bacillus thuringiensis and/or Bacillus cereus, but especially to a process for inserting and expressing protoxin genes.

The present invention also includes a process for the direct cloning and, if desired, expression and identification of novel genes or other useful DMA sequences in Bacillus thuringiensis and/or Bacillus cereus, as a result of which it is possible for the first time to establish gene banks directly in Bacillus thuringiensis and/or Bacillus cereus and to express them therein.

The present invention furthermore relates to the use of plasmids and ’’shuttle" vectors in the process according to the invention and to th® 3- thuringiensis and/or B. cereus strains chat have been transformed therewith.

Bacillus thuringiensis belongs to the large group of gram-positive, aerobic, endospore-forming bacteria. Unlike the very closely related species of Bacillus, B. cereus and Β» anthracis, the majority of the hitherto known B. thuringiensis species produce in the course of their speculation a parasporal inclusion body which, on account of its crystalline structure, is generally referred to also ®s a crystalline body. This crystalline body is composed of Insecticidally active crystalline protoxin proteins, the so-called δ-endotoxin.

S'ι ’ * These protein crystals are responsible for the toxicity to insects of B. thuringiensis. The ό-endotoxin does not exhibit its insecticidal activity until after oral intake of the crystalline body, «hen tha latter is dissolved in th® alkaline intestinal juice of th© target Insects and the actual toxic component is released from th® protoxin as a result ot limited proteolysis caused by the action of proteases from the digestive tract of the insects.

The 6-endotoxins of the various 3. thuringiensis strains are distinguished by high specificity with respect to certain target insects, especially with respect to various Lepidoptera, Coleopters and Diptera larvae, and by their high degree of activity. Further advantages in using o-endotoxins of B. thuringiensis reside in the obvious difficulty that che target insects have in developing resistance to the crystalline protein and in the fact that the toxins are harmless to humans, other mammals, birds. fish and insects, with the exception of the above-mentioned target insects.

The insecticidal potential of 3. thuringiensis protoxins was recognised very early on. Since the end of the twenties 3. thuringiensis preparations have been used as bioinsecticides for controlling various diseases caused by insects in cultivated plants. With the discovery of 1) B. thuringiensis var. israelensis by Goldberg aad Margalit (1977) and 9) B. thuringiensis var. tenebrionis by " Krieg et al. (1983) it was possible for the range of use of 3. thuringiensis to be extended even fo mosquito and beetle larvae.

With the introduction of genetic engineering and the new possibilities resulting from it, the field of 3. thuringiensis toxins has received a fresh impetus.

For example, the cloning of β-endotoxin genes in foreign host organisms, such as, for example, in E. coli, is already routine. The result of this, meanwhile, has been that the DNA sequences of a whole series of 3) A-endotoxin genes ar® now known (for exampl® Schnepf H.E. end A) St Whiteley H.XL , 1981; 'Klier A. ee al.» 1982; /Geiser M. et al., 1986; ^Haider M.Z. et al., 1987).

Most ox the 3. thuringiensis species contain several genes that cod® for an insecticidally active protein. These genes, which are expressed only daring the sporulation phase, are in the majority of cases located on large transferable plasmids (30 - 150 Hd) and can therefore very easily be interchanged between th® various 3. thuringiensis strains ©nd between 3. thuringiensis and 3. cereus, provided these ar® compatible (^Gonzales J.H. et al., 1982).

Th® protoxin genes of 8. thuringiensis vsr. kurstaki belong to a family of related genes, various of which have already been cloned and sequenced. This work has been carried out especially in an E. coli cloning system.

The cloning of 3. thuringiensis genes has thus so tar essentially been limited to some few and exclusively heterologous host systems, of which the E. coli system is the best researched and understood.

Xn the meantime, however, reports have also been published on the successful cloning and expression of protoxin genes in other host A) systems, such as, for example, in 3. subtilis ( Kliar es al-» 1982), 8) Pseudomonas flborescens ( ‘'Obukowics M.G. et ©1.» 1986), and Saccharomyces cerevisiae (EP 0 238 AAi)„ The insertion ©nd expression of the S—endotoxin gene in plant host cells hes also been successful (2? 0292 A35).

In cloning in E. coli, advantage is taken of th® fact that some protoxin genes happen to contain, in addition to gram-positive promoters, also an E. eoli-like promoter. These promoter-like DM sequences make it possible for the 3. thuringiensis protoxin genes to be expressed also in heterologous host systems, provided these are capable of recognising th® . » above-mentioned control sequences.

After breaking open the host cells, the expressed protoxxn proteins can then be isolated and identified using known methods.

It has since been demonstrated, however, that £. coli-like promoters are 9) not present in all protoxin genes ( ^Donovan et al., 1988), and consequently so far only very specific protoxin genes that meet the above-mentioned prerequisites can be expressed and thus identified in heterologous host systems.

The cloning of genes outside the natural host organism and the use of these strains as bioinsecticides in practice is thus associated with a number of disadvantages, some of which are serious: ©) Expression of B. thuringiensis protoxin genes from the native expression sequences is possible only in certain cases. b) Generally there is no, or only a slight, secretion of expressed foreign proteins. c) Correct folding of the δ-endotoxins is not always guaranteed in the reducing medium of heterologous host cells, and this could result in an undesirable change in the specific activity or in the host range of the toxins. d) If expression occurs at all, the expression rates of the cloned foreign genes among the native expression sequences are mostly only low. 3),"Q^schnepf and Whitley (1981; 1985) estimate that the 3. thuringiensis toxin cloned in E. coli constitutes only 0.5 % to 1 % of the total cell protein of E. coli, whereas the crystalline protein in 3. thuringiensis amounts to between 30 % and &0 % of the dry weight of sporulating cultures. These considerable discrepancies between the expression rates may possibly be attributed to the lack of sporulation-specific control signals in tha heterologous host systems and to difficulties in the recognition of the 3. thuringiensis promoters and/or to problems in the post-translational modification of the toxin molecule by the foreign host. •s) Many of che hose strains generally used for expression are toxicologically noc as harmless as 3. thuringiensis and 3. cereus. £) 3. thuringiensis and 3. cereus form a natural major component of *> microbial soil flora, which is not true of most of the host strains generally used for expression.

The problems and difficulties mentioned above could be overcome if the said 3. thuringiensis genes could be cloned directly in the homologous host system where it is possible co us® the natural gram-positive promoters of th® protoxin genes for the expression.

As y®t„ however, there is no process that would make B. thuringiensis, this very important bacterium from the commercial point of view, amenable to direct genetic modification, and that would consequently render possible, for example, efficient reinsertion of a cloned protoxin gene into s B. thuringiensis strain.

The reason for this can be regarded, in particular, as being che fact that the development of an efficient transformation system for 3. thuringiensis and th® closely related B. cereus that would ensure adequately high transformation rates and consequently render possible the application also to 3. thuringiensis of established SKA techniques has not as yet been’ successful.

The processes used so far to produc® new 3. thuringiensis strains having novel insecticidal properties are based chiefly on transfer by conjugation of plasmid-encoded protoxin genes.

Successful reinsertion of a cloned 3. thuringiensis crystalline protein gene into 3. thuringiensis has to date been described only in one case (^"^Klier A. et al., 1983), but in that case too. owing to the lack of a suitable transformation system for 3. thuringiensis, it was necessary co ' * resort to transfer by conjugation between 3. subtilis .and 3. thuringiensis. Furthermore, in this process described by Klier et al.

E. coli is used as intermediate host.

The processes of transfer by conjugation, however, have a whole series of serious disadvantages that makes them appear unsuitable for routine use for the genetic modification of 3. thuringiensis and/or 3. cereus. s) The transfer of plasmid-encoded protoxin genes hy conjugation is 5 possible only between B. thuringiensis strains and between 3. cereus and 3. thuringiensis strains that are compatible with one another. b) Wish transfer of plasmids by conjugation between more distant strains, often only a low transfer frequency is achieved. c) There is no possible way of regulating or modifying the expression of 10 the protoxin genes. d) There is no possible way of modifying the gene itself.

®) If several protoxin genes are present in one strain the expression of individual genes may be greatly reduced as a result of the so-called gene-dosage effect. f) Instabilities may arise as a result of a possible homologous recombination of related protoxin genes.

Alternative transformation processes, which have since been used routinely for many gram-positive organisms, have proved unsuitable both for 3. thuringiensis and for 3. cereus.

One of the above-mentioned processes is, for example, the direct transformation of bacterial protoplasts by means of polyethylene glycol treatment, which has been used successfully in the case of many 12) Streptomyces strains (* Bibb J.J. et al., 1978) and in the case of 13) 3. subtilis ( Chang S. and Cohen S.M. , 1979), 3. megaterium j ( Brown 3.J. and Carlton B.C. . 1980), Streptococcus lactis ("^Kondo J.K. and McKay L.L., 198&), S. faecalis (^Virth R. et al.). 17) Corynebactarium glutamicum ( Yoshihama M. ec al.. other gram-positive bacteria. 1985) and numerous To use this process s the bacterial cells must first of all be converted to protoplasts, that is to say che cell walls are digested using lytic * enzymes. fr Another prerequisite for the success of this direct transformation process is the expression of the newly introduced genetic information and she regeneration of the transformed protoplasts on complex solid media before successful transformation can be detected, for exampl© using a selectable marker.

This transformation process has proved unsuitable for B. thuringiensis and the closely related 3. cereus. As a result of the high resistance of B. thuringiensis cells to lysozyme and the very poor regenerability of the protoplasts to intact cell «all-containing cells, the rates of transformation achievable remain low and difficult to reproduce (^®\likhanian S.J. et al., 1981; '^Martin P.A. et al., 1981; "^Fischer H-K et al., 1984).

With this process it is possible therefore, at the most, for very simple plasmids, which are unsuitable for work with recombinant DNA, to be inserted as ® low frequency into 3. thuringiensis or 3. cereus cells.

Individual reports on satisfactory ratss o.f transformation that it has been possible to achieve using the afore-described process rely on the formulation of very complex optimising programmes, but these programmes are always applicable specifically to one particular 3. thuringiensis strain only and involve high expenditure in terms of time and money 21) ( Schall D., 1986). Such processes «re therefor© unsuitable for routine application on an industrial scale.

As the intensive research work in the field of B. thuringiensis genetics demonstrates, there is substantial interest in developing new processes • 0. that would make B. thuringiensis or the closely related 3. cereus amenable to direct genetic modification and would thus, for example. render possible the cloning of protoxin genes in the natural host system. Despite this research there are still no satisfactory solutions to the existing difficulties and problems.

Suitable transformation processes that render possible an efficient and reproducible transformation of 3. thuringiensis and/or B. cereus at a transformation frequency sufficient to overcome the restriction present in the bacterial cells are not available currently, and neither ar® suitable cloning vectors that permit the application also to B. thuringiensis of the recombinant DNA techniques already established for θ other bacterial host systems. The same is true for 3. cereus.

This object has now surprisingly been achieved within the scope of the present invention by the use of simple process steps, some of which are known.

The novel process according to the present invention is based on recombinant DNA technology, chat for the first time renders possible a direct and reproducible genetic manipulation of B. thuringiensis and of B. cereus by transforming Bacillus thuringiensis and/or Bacillus cereus with high efficiency by means of a simple transformation process using a recombinant DNA that is suitable for the said genetic manipulation of Bacillus thuringiensis and/or Bacillus cereus.

The present invention thus relates to a process for the transformation of B. thuringiensis and/or B. cereus by inserting, cloning and, optionally expressing recombinant DNA. especially plasmid and/or vector DNA, into B. thuringiensis and/or B. cereus cells by means of electroporation.

In particular, the present invention relates to a process for inserting and cloning DNA sequences in gram positive bacteria selected from the group consisting of B- thuringiensis and B. cereus. which comprises: a) isolating the DNA to be introduced; b) cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of 3- thuringiensis and B. cereus cells in a heterologous cloning system; c) directly introducing th© thus cloned vector DMA into the said bacterial cell via electroporation, at a transformation rat® sufficient to overcome the restriction present in the said bacterial cells; and d) cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA.

The present invention also provides a process for inserting, cloning and expressing DMA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacillus cereus,, comprising: a,) isolating the DMA to be introduced and optionally ligating the thus isolated DMA with expression sequences that are capable of functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells; b) cloning the thus isolated DMA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; c) directly introducing the thus cloned vector DMA into the said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction present in the said bacterial cells; and d) cultivating the thus transformed bacterial cells and isolating the thus cloned vector DMA and ths expressed gen® product.

The DMA to be introduced into the bacterial host cell aay be a recombinant DNA, which is of homologous or heterologous origin or is a combination of homologous or heterologous DMA.

The recombinant DMA preferably may contain one or more structural genes and 3’ and 5’ flanking regulatory sequences that are capable of functioning in the said bacterial host cells such as, for example, a sparulation-dependenc promoter of B. thuringiensis which sequences ar® operably linked to the structural gene(s) and thus ensure the expression · of the said structural gene(s) in said bacterial host cells.

Preferred as a structural gene to be used In a process accoring to the Invention are DNA sequences coding tor a δ-endotoxin polypeptide occurring naturally In 3. thuringiensis, or for a polypeptide that has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline fi-endotoxin polypeptide.

Also preferred are δ-endotoxin-encoding DNA sequences which are substantially homologous with at least the part ©r parts et the natural e-endotoxin-encoding sequence that is (are) responsible tor the insecticidal activity.

Apart from structural genes it is obviously also possible for any ©ther useful DNA sequences to be used in the process according to the invention, such as, for example, non-coding DNA sequences that have a regulatory function, such as, for example, ’’anti-sense DNA".

The present invention involves the use of bifunctional vectors, so-called ’’shuttle" vectors, for B. thuringiensis and/or B. cereus in the transformation of 3. thuringiensis and/or 3- cereus cells.

Preferred are bifunctional vectors that in addition to replicating in B. thuringiensis and/or B. cereus also replicate in one or more other heterologous host systems, but especially in E- coli cells.

The present invention thus specifically relates to a process for inserting, cloning and, optionally expressing DNA sequences ©herein the vector used is a bifunctional vector that apart from being capable of replicating In bacterial cells selected from the group consisting of 3. thuringiensis and 3. cereus is capable of replicating at least in one ocher heterologous host organism, and that is identifiable in both the homologous and the heterologous host system.

The said bifunctional vectors can also be used for the transformation of B, thuringiensis and/or 3. cereus cells and the expression of the DMA sequences present on the said shuttle" vectors, especially those DHA sequences that code for a δ-endotoxin of 3- thuringiensis or at least for a protein that has substantially the insect-toxic properties of the 3- thuringiensis toxins.

The present invention ebus especially relates to a process for inserting,, cloning and expressing DKA sequences using a bifunctional vector «herein the said bifunctional vector comprises under the control of expression sequences that are capable of functioning in bacterial sells selected from the group consisting of Bseillus thuringiensis and Bacillus cereus ceils ά structural gens encoding a S-endotoxin polypeptide that occurs naturally in 3. thuringiensis, or a polypeptide chat has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline δ-endotoxin polypeptide.

Especially preferred in this regard are the bifunctional (shuttle) vectors pXX61 ("pK61) and pX!93 (»pK93) which, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB and int© 3. cereus 569S, have been deposited at the Deutsch® Sammlung von Hikroorganistaen (Braunschweig. Federal Republic of Germany), recognised as an International Depository, in accordance with the Budapest Treaty under the number DSH 4572 (pXI61, introduced by transformation into B. thuringiensis v^r. kurstaki HDlcryB) and DSM A571 (pX193, introduced by transformation into 3. thuringiensis var. kurstaki HDlcryB) ©nd DSH 4573 CpXI93„ introduced by transformation into 3. cereus SS9K).

Th® present invention also relates to the use of B. thuringiensis and/or B. cereus as general host organisms for cloning and expressing homologous ©nd especially also heterologous DMA, or a combination of homologous and heterologous DNA and to 8. thuringiensis and B. cereus cells that have been transformed according to the invention with one of the vector molecules as hereinbefore defined. xhe present invention relates especially to novel B- thuringiensis and B. cereus varieties that have been transformed according to the invention with a DNA sequence that codes for a 6-endotoxin of B. thuringiensis and that can he expressed, or transformed with a DMA sequence coding for at least one protein chat has substantially the toxic properties of she B. thuringiensis toxins.

Th® transformed B. thuringiensis and B. cereus cells and the toxins produced by chea can he used for the preparation of insecticidal compositions, to which the present invention also relates.

The invention also relates to methods of, and to compositions for, controlling insects using the above more closely characterised transformed B. thuringiensis and/or B. cereus cells or a cell-free crystalline body-( δ-endotoxin) preparation containing protoxins produced by the said transformed Bacillus cells.

In particular, the present invention relates co a method of controlling insects, or their habitat, a) with a bacterial host cell selected from B. thuringiensis and B. cereus cells, prepared by a process: 1) for inserting and cloning DNA sequences in gram positive bacteria selected from B. thuringiensis and B. cereus, comprising: isolating the DNA to he introduced; cloning the thus isolated DNA in a dotting vector that is capable of implicating in a bacterial host cell selected from B. thutingicasis and B. cereus cells in a heterologous cloning Systran; directiy introducing the thus cloned vector DNA into tire said bacterial cell, via electroporation, as a transformation rate sufficient to overcome the restriction present in the said bacterial cells; and cultivating she thus transformed bacterial cells and isolating the thus cloned vector DNA; or' 2) for inserting, cloning and expressing DNA sequences in gram positive bacteria selected from B. thuringiensis and B. cereus, comprising: isolating the DNA ro be introduced and optionally ligating the thus isolated DNA with expression sequences that are capable of functioning in bacterial cells selected from B. thuringiensis and B. cereus ceils; cloning the thus isolated DNA in a dotting vector that is capable of replicating in a bacterial host cell selected from B. thuringiensis and B. census cells in a heterologous donfag system; directly introdudng the thus cloned, vector DNA into the said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction present in the said bacterial cells; and cultivating the thus transformed bacterial cells and isolating the thus dotted vector DNA and die expressed gene produce or with a mixture of these host cells; or b) with a cell-free crystal body preparation containing a protoxin which is produced by a bacterial host cell a).

The present invention also provides a composition for controlling insects comprising a host cell a), defined above; and carriers and/or dispersing agents.

The bacterial host cell used in the method or composition of the invention comprises a recombinant DNA molecule selected from a recombinant DMA, which is of homologous or heterologous origin, or is a combination of homologous and heterologous DNA, preferably a recombinant DNA containing one or more structural genes and 3’ and 5' flanking regulatory sequences, preferably sequences comprising a sporutation-dependent promoter of B. thuringiensis, that are capable of functioning in the bacterial host cells, which sequences are operably linked to the structural gene(s) and thus ensure the expression of the structural ge»)e(s) in the bacterial host cells.

The structural gene preferably codes for a δ-endotoxin polypeptide occurring naturally in B. thuringiensis, or for a polypeptide that has substantial structural homologies therewith, and still has substantially the toxicity properties of the crystalline δ-endotoxin polypeptide, especially a polypeptide which is substantially homologous with a δ-endotoxin polypeptide of a suitable sub-species of B. thuringiensis selected from kurstaki, bcrlimer, alesti, sotto, tolworthi, dendrolimus, tenebrionis and israelensis.

Preferably, the δ-endotoxin-encoding DMA sequence is substantially homologous vzicb at least the part or parts of the natural δ-endotoxin-encoding scquence(s) that is (or are) responsible for the insecticidal activity, especially a DMA fragment of B. thuringiensis var. kurstaki HDl located between nucleotides 156 and 3623 in formula I (as hereinafter defined.), or is any shorter DMA fragment that still codes for a polypeptide having insect-toxic properties.

Alternatively, the bacterial host cell used in the method or composition of the invention comprises a bifunctional vector which, apart from being capable of replicating in bacterial cells selected from B. thuringiensis and '3. cereus cells, is capable of replicating at least in one other heterologous host organism, and that is identifiable in both the homologous and the heterologous host system.

Preferably, the heterologous host organism is a) prokaryotic organisms selected from the genera Bacillus, Staphylococcus, Streptococus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella and Erwinia, especially E. coli; or b) eukaryotic organisms selected from yeast, animal and plant cells.

Preferably, the bifunctional vector comprises, under the control of expression sequences that are capable of functioning in bacterial cells selected from B. thuringiensis and B. cereus cells, a structural gene encoding a δ-endotoxin polypeptide that occurs naturally in 3. thuringiensis, or for a polypeptide that has substantial structural homologies therewith and still has substantially the toxicity properties of the crystalline δ-endotoxin polypeptide. Preferably, the expression sequences comprise a spoliation - dependent promoter of B. thuringiensis.

The subject of the present invention is accordingly © process, based on a pronounced increase in the efficiency of 3. thuringiensis/3. cereus transformation compared with known processes, that for the first time renders possible a direct genetic modification of the 3. thuringiensis and/or 3. cereus genome.

The process of the invention thus opens up a large number of see possibilities that are of extraordinary interest from both scientific and commercial points of view.

For example, it is now possible for th® first time to obtain information 10 «η a genetic level about the regulation of 6-endotoxin synthesis, especially in respect of sporulation.

Also, it should now be possible to clarify ac which position of the toxin molecule the region(s) responsible for the toxicity to insects is (are) located, and to what extent this (these) is (©re) also associated wish the host specificity.

Knowledge of the molecular organisation of the various toxin molecules and of the toxin genes coding for these molecules from the various species of 3. thuringiensis is of extraordinary practical interest for a controlled genetic manipulation of those genes, which is now possible for the first time using the process of the invention. is In addition to a controlled raodification of she δ-endotoxin genes themselves, she novel process of the invention permits also the manipulation of the regulatory DNA sequences controlling the expression of those genes, as a result of which the specific properties of the δ-endotoxins, such as, for example, their host specificity, their resorption behaviour inter alia, can be modified and the production rates of the δ-endotoxins can be increased, for exampl® by the insertion of stronger and more efficient promoter sequences.

By mutation of selected genes or subgenas in vitro it is thus possible to obtain new B. thuringiensis and/or B. cereus variants.

Another possible way of constructing novel 3. thuringiensis and/or B. cereus variants comprises splicing together genes or portions of genes that originate from different B. thuringiensis sources, resulting in B. thuringiensis and/or B. cereus strains with a broader spectrum of use. Ic is also possible for synthetically or semi-synthecically produced toxin genes to be used in this manner for constructing new B. thuringiensis and/or B. cereus varieties.

In addition, the process according to the invention renders possible for ths first time, as a result of tha pronounced increase in the transformation frequency ana the simplicity of the process, the establishment of gene banks and tha rapid screening of modified and new genes in 3. thuringiensis and/or 3. cereus.

In particular, the process of the invencion now for the first time renders possible direct expression of gene Banks in B. thuringiensis and/or 3. cereus and the identification of new protoxin genes in B. thuringiensis using known, preferably immunological or biological processes.

Preferred within the scope of the invention is a process for the identification of new δ-endotoxin encoding genes in Bacillus thuringiensis, which process comprises 1? (a) digesting th® total DNA of Bacillus thuringiensis using suitable restriction onsymes (b) isolating from the resulting restriction fragments those of suitable sise; (c) inserting said fragments into © suitable vector. preferably ® bifunctional vector; (d) constructing a genomic DNA library by transforming Bacillus thuringiensis host cells with the said vector using a process according to the invention; and (e) screening the thus obtainable DNA library for new δ-endotoxin encoding genes, preferably by use of an immunological screening process.

The following is a brief description of the Figures: Figure 1: Transformation of E. coli HB 101 with pBS.322 (o) and *3. thuringiensis HDlcryB with pBC16(-) (^number of surviving *HDlcryB cells).

Figure 2*. Influence of the age of a *B. thuringiensis HDlcryB culture on the transformation frequency.

Figure 3: Influence of the pH value of the PBS buffer solution on the transformation frequency.

Figure 4: Influence of the saccharose concentration of the PBS buffer solution on the transformation frequency.

Figure 5: Interdependence of the number of transformants and the amount of DNA used per transformation.

Figure a: Simplified restriction map of the ’shuttle" vector *pXl61. The shaded region characterises the sequences originating from the gram-positive pBGla, the remainder originating from the gram-negative plasmid pUCS. figure 7: Simplified restriction map of *ρΧϊ93. The shaded region characterises the protoxin structural gene (arrow, Kurhdl) and the 5’ and 3’ non-coding sequences. The remaining unshaded part originates from the ’shuttle vector *pXl6l.

Figure 8: SDS (sodium dodecyl sulfate)/polyacrylamide gel electrophoresis of extracts of speculating cultures of *3» thuringiensis HDlcryB, B. cereus 569K and their derivatives. [1: *HDlcryB (pXI93), 2: *HDlcryB (pXI61), 3: *HDlcryB, 4; HDl, LBG 3-4449, 5: *3. cereus 569K (pX!93), 6: 569K] a) Comassie-dysd, M: molecular weight standard, MW: molecular weight (Dalton), arrow: position of the 130,000 Dalton protoxin. b) Western blot of the same gel. to which there have bean added polyclonal antibodies to the K-l crystalline protein of B. thuringiensis HDl.

Positive bands were found with the aid of labelled anti-goat antibodies. Arrow: position of the 130,000 Dalton protoxin. Other bands: degradation products of the protoxin.

Figure 9: Transformation of 3. subtilis LBG 3-4468 with p3Cl6 plasmid DNA using the electroporation process optimised for B. thuringiensis. (©: transformants/pg plasmid DNA: -: number of living bacteria/ml) * The internal reference pK selected for the nomenclature of the plasmids in the priority document has been replaced for the Auslandsfassung (foreign filing text) by the officially recognised designation ρΧϊ.

Also, the names for the asporogenic 3. thuringiensis HDl mutants used in the Embodiment Examples have been changed from cryS to cryB.

An essential aspect of the present invention concerns a novel transformation process for 3. thuringiensis and B. cereus based on the insertion of plasmid DNA into B. thuringiensis and/or B. cereus cells using electroporation technology, which is known per se.

All attempts up to the time of the present invention to apply the transformation processes already established for other bacterial host systems to B- thuringiensis and the closely related B. cereus having been frustrated, it is now possible within th© scope of this invention to achieve surprising success using electroporation technology and accompanying steps.

This success must also be considered surprising ©nd unexpected, especially since electroporation tests with B- thuringiensis protoplasts wes« 22) carried out at an earlier date by a Soviet group ( Shivarova H. et al., 1983), but the transformation frequencies achieved were so low that this process was subsequently regarded ss unusable for 3. thuringiensis transformation and consequently received no further attention.

Building upon investigations into the process parameters critical for an electroporation 'of 3. thuringiensis and/or 3. cereus cells, it has now surprisingly been possible to develop a transformation process that is ideally adapted to the requirements of B. thuringiensis and 3. cereus and results in transformation rates ranging from 10£ to 10* cells/pg of plasmid DMA, but especially from 10® to 10' cells/pg of plasmid DMA.

Roughly equally high transformation rates with values from 10® to a maximum of 10s transformancs/pg of plasmid DBA could hitherto be achieved only with the PEG (polyethylene glycol) transformation process described 21) by " Schell ¢1986)- High transformation rates remained restricted, however, to those 3. thuringiensis strains for which the PEG process wg§ specifically adapted in very time-consuming optimisation studies, which makes this process appear unsuitable for practical use.

Furthermore, the reproducibility of that process in practice is in many cases non-existent or poor.

In contrast, the process of the present invention is a transformation process that in principle is applicable to all B. thuringiensis and 3. cereus strains, and that is less time-consuming, more rational and consequently mot® efficient than the traditional PEG transformation process.

For example, in the process of the invention it is possible to use, for example, whole intact cells, thus dispensing with the time-consuming production of protoplasts critical for 3. thuringiensis and 3. cereus and with the subsequent regeneration on complex nutrient media.

Furthermore, when using the PEG process, carrying out the necessary process steps can take up to a week, whereas with th© transformation process of the invention the transformed cells can be obtained within a feu hours (as a rule overnight).

Another advantage of the process of the invention concerns che number of 3. thuringiensis and/or B. cereus cells that can be transformed per unit of time.

Whereas in the traditional PEG process only small aliquots can be plated out simultaneously in order to avoid inhibition of the regeneration as a result of the growth of the cells being too dense, when using the electroporation technique large amounts of 3. thuringiensis and/or 3- cereus cells can be placed out simultaneously.

This renders possible the detection of transformants even at very low transformation frequencies, which with th® afore-described processes is not possible or is possible only with considerable expenditure.

Furthermore, amounts of DNA in the nanogram range are sufficient to obtain at least some transformants.

This is especially important if a very efficient transformation system is necessary, such as, for example, when using DNA material from E. coli, which on account of a strongly pronounced restriction system in 3. thuringiensis cells can lead to a reduction of the transformation frequencies by a factor of 103 compared with 3. thuringiensis DNA.

The transformation process of the invention, which is based essentially on electroporation technology known per se, is characterised by the following specific process steps: a) Preparation of a suspension of host cells in an aerated medium sufficient to allow for the growth of the cells; b) separation of the grown cells from the cell suspension and resuspension of the grown cells in ®n inoculation buffer; ; c) addition of a DNA sample, comprising the cloned DNA, in a concentration suitable for the electroporation, to the buffer; d) introduction of the batch of step c) into an electroporation apparatus; «) subjecting the thus introduced batch to at least one capacitor 0 discharge of a capacitor to produce a high electric field strength that is sufficient to render'the bacterial cell wall permeable to the DNA to be introduced, for a period of time sufficient to transform the bacterial host cells with the recombinant DNA; f) selection of the thus transformed bacterial host cells.

In a specific embodiment of the process of the invention that is preferred within the scope of the invention, the 3. thuringiensis cells are first of all incubated in a suitable nutrient medium with adequate aeration and at a suitable temperature, preferably of from 20°C to 35°C. until an optical density (ODsso) of from 0.1 to 1.0 is achieved. The age of th® Bacillus cultures provided for the electroporation has a distinct effect on the transformation frequency. An optical density of the Bacillus cultures of from 0.1 to 0.3, but especially of 0.2, is therefore especially preferred. Attention is, however, drawn to the fact that it is also possible to achieve good transformation frequencies with Bacillus cultures from other growth phases, especially with overnight cultures (see Figure 2).

Generally, fresh cells or spores are used as starting material, but it is also equally possible to use deep-frozen cell material. The cell material is preferably cell suspensions of 3. thuringiensis and/or 3. cereus cells in suitable liquid media to which, advantageously, a certain amount of an antifreeze solution’5 has been added.

Suitable antifreeze solutions are especially mixtures of osmotically active components and DMSO in water or a suitable buffer solution. Other suitable components that can be used in antifreeze solutions include sugars, polyhydric alcohols, such as. for example, glycerol, sugar alcohols, amino acids and polymers, such as, for example, polyethylene glycol.

If B. thuringiensis spores are used as starting material, they are first of all inoculated in a suitable medium and incubated overnight at a suitable temperature, preferably of from 25°C to 28°C, and with adequate aeration. This batch is then diluted and further treated in the manner described above.

To induce sporulation in B. thuringiensis it is possible to use any medium that causes such a sporulation. Within the scope of this invention 23) a GTS medium according to " Yousten A.A. and Rogoff M.H., (1969) is preferred.

Oxygen is usually introduced into the culture medium by moving the culture, for example using a shaker, speeds of rotation of frora 50 revs/min to 300 revs/min being preferred.

B. thuringiensis spores and vegetative microorganism cells are cultured within the scope of the present invention according to known generally customary processes, liquid nutrient media preferably being used for reasons of practicability.

The composition of th® nutrient media may vary slightly depending on th© strain of B. thuringiensis or B. cereus used. Generally, complex media with loosely defined, readily assimilable carbon (C~) and nitrogen (M-) sources are preferred, like chose customarily used for culturing aerobic Bacillus species. la addition, vitamins and essential metal ions are necessary, but these are usually contained in ®n adequate concentration as constituents ©r ,.. ί'. ’ii impurities in the complex nutrient media used.

If desired, the said constituents, such as, for example, essential . . η , ,, + «.+ 2+ _ 2ΐ· ,,24’ 34· © 3= __ 2— Titaaus and also Me , X , Cu , Ca , Hg , re , «da , ROa * bOt « Gl , CO3 ions ©nd the trace elements cobalt and manganese, sine, etc., cam be added in the form of their salts. la addition to yeast extracts, yeast hydrolysates, yeast autolysates and yeast cells, especially suitable nitrogen sources are in particular soya seal, maize meal, oatmeal, edamine (enzymatically digested lactalbumin), peptone, casein hydrolysate, corn steep liquors and meat extracts,* without the subject of the invention being in any way limited by this list of examples.

The preferred concentration of th® mentioned Μ-sources is from 1-0 g/1 to 20 g/1.

Suitable C-sources are especially glucose, lactose, sucrose, dextrose, maltose, starch, cerelose, cellulose and malt extract- The preferred concentration range is from 1.0 g/1 to 20 g/1.

Apart from complex nutrient media it is obviously also possible to use semi- or fully-synthetic media that contain the above-described nutrients in a suitable concentration.

Apart from the L3 medium preferably used within the scope of the present invention it is also possible to use any other culture medium suitable £er culturing B- thuringiensis and/or B. cereus. such as, for example. 24.

Antibiotic Medium 3, SCGY medium, etc.. Sporulated 3. thuringiensis cultures are preferably stored on GTS media (inclined agar) at a temperature of 4°C.

After the cell culture has reached tha desired cell density, the cells ar© harvested by means of centrifugation and suspended in a suitable buffer solution that has preferably been cooled beforehand with ice.

Xn the course of the investigations, the temperature proved not to be critical and is therefore freely selectable within a broad range. A temperature range of from 0°C to 35°C, preferably from 2°C to 15eC and more especially a temperature of 4°C, is preferred. The incubation period of the Bacillus cells before and after electroporation has only a slight effect on che transformation frequency attainable (see Table 1). Only an excessively long incubation results in a decrease in the transformation frequency. An incubation period of from 0.1 to 30 minutes, especially of 10 minutes, is preferred. Xn the course of the investigations, the temperature proved not to be critical and is therefore freely selectable within a broad, range. A temperature range of from 0°G to 35°C, preferably from 2°C to 15°C and more especially a temperature of 4°CS is preferred. This operation can be repeated one or more times. Buffer solutions that are especially suitable within the scope of this invention are osmotically stabilised phosphate buffers that contain as stabilising agent sugars such as, for example, glucose or saccharose, or sugar alcohols, such as, for example, mannitol, and have pH values set to from 5.0 to 8.0. More especially preferred are phosphate buffers of the PBS type having a pK value of from 5.0 to 8.0, preferably of from 5-5 Co 6.5, that contain saccharose as stabilising agent in a concentration of from 0.1M to 1.0M, but preferably of from 0.3M to 0.5M (see Figures 3 and 4).

Aliquots of the suspended Bacillus cells are then transferred into cuvettes or any other suitable vessels and incubated together with a DNA sample for a suitable period, preferably for ® period of from 0.1 to 30 minutes, but especially of from 5 to 15 minutes, and at a suitable temperature, preferably at a temperature of from 0°C to 35°C, but especially at a temperature of from 2°C to 15°C and more especially at a temperature of 4°c.

Uhon operating at low temperatures it is advantageous to use cuvettes that have already been precooled, or any other suitable precooled vessels. ftOver a wide range there is a linear relationship between th® number of transformed cells and the DMA concentration used for the electroporation, the number o£ transformed cells Increasing as th® DMA concentration increases (see Figure 5). The DMA concentration preferred within the scope of this invention is ia © range of from 1 -ng to 20 pg. A DNA concentration of from 10 ng to 2 pg is especially preferred.

Subsequently the entire batch containing 3. thuringiensis and/or 3. cereus cells and plasmid DNA or another suitable DNa sample is introduced into ar. electroporation apparatus ©nd subjected to electroporation, that is to say is briefly exposed co an electric pulse.

Electroporation apparatus suitable for ess® in the process of the invention is already available from a variety of manufacturers, such as, for example, from Bio Rad (Richmond. CA, USA; Gene Pulser Apparatus), Biotechnologies and Experimental Research Inc. (San Diego. CA, USA; BTX Transfector 100), Promega (RIM) (Madison, WI USA; X-Cell 2000 Electroporaciea System), etc..

It is obviously also possible co use ©ny other suitable apparatus in the process of the invention.

Various puls® forms can be used, for example rectangular pulses or alternatively exponentially decaying pulses.

The latter are preferred within the scope of this invention. They are produced by the discharging of a capacitor and are characterised by an initially very rapid increase in voltage and by a subsequent exponential decaying phase as a function of resistance and capacitance. The time constant RC provides a measure of the length of the exponential decay tiag. It corresponds So the time necessary for the voltage to decay to * of th® initial volrage (V ). o Ona parameter decisive in influencing the bacterial cell concerns the strength of the electric field acting on the cells, which is calculated from the ratio of the voltage applied to the distance between the electrode plates.

Also of great importance in this connection is the exponential decay time, which depends on the configuration of the apparatus used (for example the capacitance of the capacitor) and on other parameters, such as, for example, the composition of the buffer solution or the volume of cell suspension provided for the electroporation.

In the course of the investigations it has been demonstrated, for example, that reducing by half the volume of the cell suspension provided for the electroporation results in an increase in the transformation frequency by a factor of 10.

A prolongation of the exponential decay time by way of an optimisation of the buffer solution used also results in a distinct increase in the transformation frequency.

All measures that result in a prolongation of the exponential decay time and consequently in an increase in the transformation frequency are therefore preferred within the scope of this invention.

The decay time preferred within che scope of the process of the invention is from approximately 2 ms to approximately 50 ms, but especially frora approximately 8 ms to approximately 20 ms. Most especially preferred is an exponential decay time of from approximately 10 ms to approximately 12 ms.

Vithin the scope of the present invention, the bacterial cells are acted upon for short periods by very high electric field strengths by means of brief discharge(s) of a capacitor across the DNA-containing cell suspension; ss a result of this, th® permeability of th® B. thuringiensis cells is briefly and reversibly increased. The electroporation parameters &,£·'£ so coordinated with each other in the course of the process of the inveation that optimum absorption into the Bacillus cells of th® DMA located in the electroporation buffer Is ensured.

The capacitance setting of the capacisor within the scope of this issvesition is' advantageously from 1 pF to 250 pF, but especially from 1 pF to 50 pF and more especially is 25 p?. The choice ox the initial voltage is. not critical, and is therefore freely selectable, within wide ranges. Asi initial voltage V of fro® 0.2 kV to 50 kV, but especially of from 0.2 kV t© 2.5 kv and more especially of frost 1.2 fcV eo 1,8 kV9 is preferred. The distance between the electrode plates depends, inter alia, on the size of th® electroporation apparatus. Xt is advantageously from 0.1 cm to 1.0 cm. preferably from 0.2 cm co 1.0 cm, and store especially is 0.4 ca. Th® field strength values that ®cc on the cell suspension result from the distance between the electrode plates and th® initial voltage set in the capacitor. These values are advantageously in a range of from 100 V/cm to 50,000 V/ca. Field strengths of frost 100 v/cm to 10,000 V/ca, but particularly of froa 3,000 V/ess co 4,500 V/cm, ©re especially preferred.

The fine coordination of the freely selectable parameters, such as, for example, capacitance, initial voltage, distance between plates etc., depends to a certain extent on the architecture of the apparatus used and can therefore vary frost case to case within certain limits. Xn certain cases, therefore, it is possible to exceed or fall below the limiting values indicated, should this be necessary in order to achieve optimum field strengths.

The actual electroporation operation can be repeated one or more times until the optimum transformation frequency for the system in question has been achieved.

Following the electroporation, the treated Bacillus cells can advantageously be reincubated, preferably for a period of from 0.1 to 30 ainutes, at a temperature of from 0°C to 35°C, preferably from 2°C to 15°C. The electroporated cells are then diluted with a suitable medium and in28 cubaced again for a suitable period, preferably from 2 to 3 hours, with adequate aeration and at a suitable temperature, preferably of fro® 2Q°C co 35eC.

The 3. thuringiensis cells are then plated out onto solid media that contain as an additive an agent suitable for selecting the new DNA sequences introduced into the bacterial cell. Depending on th® nature of the DNA used, tha said agent may be, for example, an antibiotically active compound or a dye, inter alia. Antibiotics selected from the group consisting of tetracycline, kanamyein, chloramphenicol and erythromycin are especially preferred within che scope of this invention for the selection of Bacillus thuringiensis and/or 3. cereus cells.

Also preferred are ebromogenie substrates, such as, for example, X-gal (5-bromo-4~ehloro-3~indoIyl-S-D-galactoside), which can be detected by way of a specific colour reaction.

Other phenotypic markers are known to the skilled person and can also be used within the scope of this invention.

It is possible to use any nutrient medium suitable for culturing 3. thuringiensis cells, to which one of the conventionally employed solidifying media, such as, for example, agar, agarose, gelatin, etc., is added.

The process parameters described hereinbefore in detail for 3. thuringiensis are applicable in the same manner to 3. cereus cells.

Unlike the processes hitherto available in che prior art, the process of the invention for the transformation of B. thuringiensis and 3. cereus described hereinbefore is not limited to the use of specific natural plasmids occurring in 3. thuringiensis and/or 3. cereus but is applicable to all types of DNA. Ιε is accordingly now possible for che first time to transform B. thuringiensis and/or 3. cereus in a controlled manner, it being possible to use apart from homologous plasmid DNA, that is to say plasmid OKI occurring naturally in B. thuringiensis er the closely related 33. cereus, also plasmid DMA of heterologous origin.

This aay be either plasmid DMA that recurs naturally ia an organism other chan 3. thuringiensis er che closely related B- cereus, such as, for example, plasmids pUBHO and pC!94 from Staphylococcus aureus (‘^horinouehi S. end Weishlum 3., 1982^ ^?olak J. ©nd Novick S.P., 26) 1982) and plasmid pIM!3 from 3. subtilis ( 'Hahler J. and Balvorson H.0., I960), which ar® capable &s replicating in B. thuringiensis and/or B. cereus, or hybrid plasmid DMA constructed by recombinant DNA technology from homologous plasmid DNA or from heterologous plasmid DNA or alternatively from a combination of homologous and heterologous plasmid DNA. The last-mentioned hybrid plasmid DNA is better suited for work with recombinant DNA than the natural isolates.

There aay be mentioned by way of example here, without the subject of che present application in any «ay being limited, the plasmids p3D64 27) C ujycxan Ϊ. et al., 1980), p3D347, pBD348 and pD316S4.

The cloning vectors already established for B. subtilis, such as, for example, pBD6&, may bo of particular importance for carrying ouc the cloning experiments in various 3. thuringiensis and 3. cereus strains.

Apart from plasmid DNA, it is now possible within the scope of the present invention to introduce any other DNA into 3. thuringiensis and 3. cereus by transformation. The transformed DNA can replicate either autonomously or integrated in the chromosome. It may be, for example, a vector DNA derived not from a plasmid but from a phage.

Especially preferred within the scope of this invention is the use of bifunctional (hybrid) plasmid vectors, so-called shuttle vectors, that are capable of replicating in one or in several heterologous host organisms apart from in 3. thuringiensis or the closely related B. cereus, and that are identifiable both in homologous and in heterologous host systems.

Heterologous host organisms are to be understood within the scope of this invention as all those organisms that do not belong to tha B. thuringiensis/B. cereus group and that are capable of maintaining in a stable condition a self-replicating DNA.

According to the above definition it is therefore possible for both prokaryotic and eukaryotic organisms to function as heterologous host organisms. At this point there saay be mentioned by way of example, as representatives from the prokaryotic host organism group, individual examples from the genera Bacillus, such as, for example, B. subtilis or B. megaterium, Staphylococcus, such as, for example, S. aureus, Streptococcus, sueh as, for example. Streptococcus faecalis, Strepcomyces, such as, for example Streptorayces spp., Pseudomonas, such as, for example, Pseudomonas spp., Escherichia, such as, for example, X. coli. Agrobacterium, such as, for example. A. tumefaciens or A. rhisogenes, Salmonella, Erwinia, etc. From the eukaryotic host group there may be mentioned especially yeasts and animal and plant cells. This list of examples is not final and is not intended to limit the subject of the present invention In any w®v. Other suitable representatives from the prokaryotic and eukaryotic host organism groups are known to the skilled person.

Especially preferred within the scope of this invention are 3. subtilis or 3. megaterium. Pseudomonas spp., and especially E. coli from the group of prokaryotic hosts as well as yeasts and animal or plant cells from the group of eukaryotic hosts.

More especially preferred are bifunctional vectors that are capable of replicating in both B. thuringiensis and/or 3. cereus cells as well as in E. coli.

The present invention involves the use of the said bifunctional vectors for the transformation of 3. thuringiensis and 3. cereus.

'’Shuttle" vectors are constructed using recombinant DMA technology, plasmid DMA of homologous (3. thuringiensis, 3. cereus) or heterologous origin initially being cleaved using suitable restriction entymes ©nd then those DMA fragaents containing the functions essential for replication in the respective desired host systea being joined to one another again in the presence of suitable enzymes.

The afore-mentioned heterologous host organisms can act as a source of plasmid DMA of 'heterologous origin.

Th® joining of the various DMA fragments must be effected in such a manner that the functions essential for replication in the different host systems are retained.

In addition, obviously also plasmid DMA of purely heterologous origin csn be used for the construction of shuttle vectors, but at least one of the heterologous fusion partners must contain regions of DMA that render possible a replication in homologous 3. thuringiensis/3. cereus host systems.

As a source of plasmid DHA of heterologous origin chat is nevertheless capable of replicating in a 3. thuringiensis/B. cereus host system there may be mentioned at this point, by way of example, a few representatives from ths group 'of gram-positive bacteria, selected from the group consisting of the genera Staphylococcus, such as, for example. Staphylococcus aureus, Streptococcus, such as, for example. Streptococcus faecalis, Bacillus, such as, κοκ example, Bacillus aegaterium or B. subtilis, Streptomyees. such as, for example, Streptomyces spp., etc. In addition to the representatives from the group of gram-positive bacteria listed hare by way of example, there is a whole series of other organisms known to the skilled parson that can be used in the process of the invention.

The production of bifunctional vectors that are suitable for transforming 3. thuringiensis and/or 2. cereus can be achieved by a) first of all breaking down plasmid DNA of homologous or heterologous origin into fragments using suitable restriction enzymes and b) then joining to one another again, in the presence of suitable enzymes, those fragments containing the functions essential for replication and selection in the respective desired host system, this being effected in such a manner that the functions essential for replication and selection in th® various host systems are retained.

In this manner bifunctional plasmids are obtained that contain, in addition to the functions necessary for replication in B. thuringiensis or B, cereus, further DNA sequences that ensure replication in at least one other heterologous host system.

To ensure rapid ©nd efficient selection of the bifunctional vectors in both homologous and heterologous host systera(s) it is advantageous to provide tha said vectors with specific selectable markers that can be used in B. thuringiensis and/or B. cereus as well as in heterologous host system(s), that is to say that render possible a rapid and uncomplicated selection. Especially preferred within the scope of this invention is the «se of DNA sequences coding for antibiotic resistances, especially DNA sequences that code for resistance to antibiotics selected from the group consisting of kanamycin, tetracycline, chloramphenicol, erythromycin etc..

Also preferred are genes that code for enzymes with a ehroraogenic substrate, such as for example, X-gal (5"bromo-4-chloro3"indolyl-S-’D'-galactoside) . The transformed colonies can then be detected very easily by way of a specific colour reaction.

Other phenotypic marker genes are known to the skilled person and can also be used within the scope of1 this invention.

Als© preferred sr® shuttle* vectors that replicate on the aae hand either ia' B. thuringiensis or B. cereus or ia both, ©nd oa the other hand ia eukaryotic host systems selected from the group consisting of yeast, animal sad plant cells, etc..

More especially preferred is th® us® of ’"shuttle" vectors that, in addition to DNA sequences that are necessary for replication of the said vectors.in B. thuringiensis or B. cereus or in both systems, also contain DNA sequences that render possible replication of the said ’"shuttle" vectors in E. coli.

Examples of such starting plasmids for the construction of "’shuttle" vectors for the B. thuringiensis-B. cereus/E. coli system, which must sot, however, be regarded as in any way limiting, are tha B. cereus plasmid p3C16, ©nd th® plasmid pUC8 derived from the E. coli plasmid pBR322 (2^vieirs J. and Messing J.. 1982).

The present invention also relates to the use of bifunctional ("shuttle) vectors that, in addition to she functions essential for replication and selection in homologous and heterologous hose systems, also contain one or more genes in expressible form or other useful DNA sequences. These vectors can be prepared by inserting the said genes or other useful DNA sequences into these bifunctional vectors with the aid of suitable enzymes.

Using the ’’shuttle vectors in the afore-described transformation process it is thus now possible for the first time to introduce into B. thuringiensis and/or B. cereus cells by transformation, with a high degree of efficiency, DNA sequences that have been cloned outside 3. thuringiensis cells in a foreign host system.

Accordingly it is now possible for the first time for genes or other useful DMA sequences, especially also those having a regulatory function, to be introduced in a stable manner into B. thuringiensis and 3. cereus cells and, if desired, expressed therein, as a result of which B. thuringiensis and 3. cereus cells with novel and desirable properties are obtained.

Both homologous and heterologous gene(s) or DMA and synthetic gane(s) or DMA according to the definition given within the scope of th® present inveation, as well as combinations of the said DMAs, can be used as genes in the process of the invencion.

The coding DMA sequence can be constructed exclusively from genomic DNA, from cDNA or from synthetic DNA. Another possibility is the construction of a hybrid DNA sequence consisting of both cDNA and of genomic DMA and/or synthetic DNA, or alternatively a combination of those DMAs.

In that case, the cDNA may originate from the same gene as the genomic DNA, or alternatively both the cDNA and the genomic DMA may originate from different genes. In any case, however, both the genomic DNA and/or the cDNA may each be prepared individually from the same or from different genes.

If the DNA sequence contains parts of more than ona gene, these genes may originate from one and the same organism, from several organisms that belong to different strains, or to varieties of the same kind or different species of the same genus, or from organisms that belong to more than one genus of the same or of another taxonomic unit.

In order to ensure the expression of the said structural genes in the bacterial cell, the coding gene sequences must first of all be operably joined to expression sequences capable of functioning in B. thuringiensis and/or B. cereus cells.

The hybrid gene constructs of the present invention thus contain, in addition to the structural gene(s), expression signals that include both promoter and terminator sequences ©a well as other regulatory sequences of 3* and 5 untranslated regions.

Especially preferred within che scope of thi© invention ere the natural expression signals of B. thuringiensis and/or B. cereus themselves and mataats. and variants thereof that are substantially homologous with the natural sequence. Within the scope of this invention, one DMA sequence is substantially homologous with a second DMA sequence when ac least 70 %, preferably st least 80 ®, but especially ac least 90 %, of the active regions of the DNA sequence are homologous. According co che present definition of the expression substantially homologous", two different nucleotides in a DNA sequence of a coding region are regarded as homologous if th® exchange of th® one nucleotide for th® other is a silent mutation.

Host especially preferred is ehe use of sporulation-dependent promoters of B. thuringiensis that ensure expression ®s a function of the sporulation.

Especially preferred for the transformation of 3. thuringisnsls or 3. cereus within tha scope of this invention is the use of DNA sequences that code for a δ-endotoxin.

The coding region of the chimaaric gens of the invention preferably contains a nucleotide sequence coding for a polypeptide that occurs naturally in B. thuringiensis or, alternatively,, for a polypeptide chat is substantially homologous therewith, that is to say that at least has substantially the toxicity properties of a crystalline «-sno'o toxin protein of B. thuringiensis. W-ithin the scope of the present invention, by definition a polypeptide has substantially the toxicity properties of the crystalline S-endotoxin protein of B. thuringiensis if it has an insecticidal activity against a similar spectrum of insect larvae to that of the crystalline protein, of a sub-species of 3. thuringiensis. Some suitable sub-species are, for example, those selected from the group ι δ consisting of kurstaki. berliner, alesfci, tolworthi, sotto, dendrolimus, tenebrionis and israelensis. The preferred subspecies for Lepidoptera larvae is kurstaki and, especially, kurstaki HDI.

The coding region may thus be a region that occurs naturally in 3. thuringiensis. Altenatively9 the coding region ean if desired also contain a sequence that is different from the sequence in 3. thuringiensis but chat is equivalent to ic on account of the degeneration in the genetic code.

The coding region of the chimaerie gene can also code for a polypeptide that is different from a naturally occurring crystalline δ-endotoxin protein but that still has substantially the insect-toxicity properties of the crystalline protein. Such a coding sequence will normally be a variant of a natural coding region. A variant of a natural DNA sequence within the scope of this invention should, by definition, be understood ss a modified form of a natural sequence chat, however, still fulfils the same function. The variant may be a mutant or a synthetic DNA sequence and is substantially homologous with the corresponding natural sequence. Within the scope of this invention a DNA sequence is substantially homologous with a second DNA sequence when at least 70 %, preferably at least 80 %, but especially ac least 90 %, of the active regions of the DNA sequence are homologous. According to the present definition of the expression ’substantially homologous, two different nucleotides in a DNA sequence of a coding region are regarded as homologous if the exchange of one nucleotide for the other is a silent mutation.

Within the scope of the present invention, it is accordingly possible to use any chimaeric gene coding for an amino acid sequence that has the insecticidal properties of a B. thuringiensis δ-endotoxin and that meets the disclosed and claimed requirements. Especially preferred is the use of a nucleotide sequence that Is substantially homologous at least with the part or the parts of the natural sequence that is (are) responsible for the insecticidal activity and/or tha host specificity of the 3. thuringiensis toxin.

The polypeptide expressed by tha chimaeric gene as a rule also has at least some immunological properties in common with β natural crystalline protein, because it has at least some of the same antigenic determinants.

Accordingly. the polypeptide that is encoded by the said chimaeric gene is preferably structurally related co the δ-endocoxin of the crystalline protein produced by B. thuringiensis. B. thuringiensis produces a crystalline protein with o subunit that corresponds to a protoxin having a aolocralar weight (MW) of approximately from 130,000 to 140,000. This subunit can be cleaved by proteases or by alkali into insecticidal fragments having « iff ef 70,000 and possibly even less.

For th® construction of chimaeric genes in which the coding region includes such fragments of the protoxin or even smaller parts, fragmenting the coding region can be continued for as long as the fragments or parts of those fragments still have the necessary insecticidal activity. The protoxin, insecticidal fragments of the protoxin and insecticidal parts of those fragments can be joined to ocher molecules, such as polypeptides and proteins.

Coding regions suitable for use within tha scope of the process of the invention can be obtained from genes of B. thuringiensis that code for the crystalline toxin gene (Uhiteley et al., PCT application VO86/O1536 and US Patents 4 448 885 and 4 467 036). A preferred nucleotide sequence that codes for'® crystalline protein is located between nucleotides 156 and 3623 in formula I or is a shorter sequence that codes for an insecticidal fragment of such s crystalline protein (^Geiser et al., 2986 and 2? 238 441).

Formal ΐ 30 40 50 60 GTTAACACCC TGGGTCAAAA ATTGATATTT AGTAAAATTA GTTGCaCTTT GTGCATTTTT 80 90 100 110 120 TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA AACAGTATTA TATCATAATG 3,8 130 140 150 160 170 180 AATTGGTATC TTAATAAAAG AGATGGAGGT AACTTATGGA TAACAATCCG AACATCAATG 190 200 210 220 230 240 AATGCATTCC TTATAATTGT TTAAGTAAGG CTGAAGTAGA AGTATTAGGT GGAGAAAGAA 250 260 270 280 290 300 TAGAAACTGG TTACACCCCA ATCGATATTT CCTTGTCGCT AACGCAATTT CTTTTGAGTG 310 320 330 340 350 360 AATTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATAATATGG GGAATTTTTG 370 380 390 400 410 420 GTCCCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA GTTAATTAAC CAAAGAATAG 4 30 440 450 460 470 480 AAGAATTCGC TAGGAACCAA GCCATTTCTA GATTAGAAGG ACTAAGCAAT CTTTATCAAA 490 500 510 520 530 540 TTTACGCAGA ATCTTTTAGA GAGTGGGAAG CAGATCCTAC TAATCCAGCA TTAAGAGAAG 550 560 570 580 590 600 AGATGCGTAT TCAATTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTCTTTTTG 610 620 630 640 650 660 CAGTTCAAAA TTATCAAGTT CCTCTTTTAT CAGTATATGT TCAAGCTGCA AATTTACATT 670 680 690 700 710 720 TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG GGGATTTGAT GCCGCGACTA 730 740 750 760 7 70 780 TCAATAGTCG TTATAATGAT TTAACTAGGC TTATTGGCAA CTATACAGAT CATGCTGTAC 790 800 810 820 830 840 GCTGGTACAA TACGGGATTA GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATAAGAT 850 860 870 880 890 900 ATAATGAATT TAGAAGAGAA TTAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA 910 920 930 940 950 960 ACXATGATAG TAGAACGTAT CCAATTCGAA CAGTTTCCCA ATTAACAAGA GAAATTTATA 970 980 990 1000 1010 1020 CAAACCGAGT ATTAGAAAAT TTTGATGGTA GTTTTCGAGG CTCGGCTCAG GGCATAGAAG 1030 1040 1050 1050 1070 1080 GAAGTATTAG GAGTCCACAT TTGATGGATA TACTTAACAG TATAACCATC TAIACGGATG 1090 1100 1110 1120 1130 1140 CTGATAGAGG AGAATATTAT TGGTCAGGGC ATCAAATAAT GGCTTGTCCT GTAGGGTTTT 1150 1160 1170 1180 1190 1200 CGGGGCCAGA ATTCACTTTT CCGCTATATG GAACTATGGG AMTGCAGCT CCACAACAAC 1210 1220 1230 1240 1250 1260 GTATTGTXGC TCAACTAGGT CAGGGCGTGT ATAGAACATT ATCGTCCACT TTATATAGAA 1270 1280 1290 1300 1310 1320 GACCTTTTAA TATAGGGATA AATAATCAAC AACTATCTGT TCTTGACGGG ACAGAATTTG 1330 • 1340 1350 1360 1370 1380 CTTATGGAAC CTCCTCAAAT TTGCCATCCG CTGTATACAG AAAAAGCGGA ACGGTAGATT 1390 1400 1410 1420 1430 1440 CGCTGGATGA AATACCGCCA CAGAATAACA ACGTGCCACC TAGGCAAGGA TTTAGTCATC 1450 1460 1470 1480 1490 1500 GATTAAGCCA TGTTTCAATG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 1560 GAGCTCCTAT GTTCTCTTGG ATAGATCGTA GTGCTGAATT TAATAATATA ATTCCTTCAT 1570 1580 1590 1600 1610 1620 CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT TGGCTCTGGA ACTTCTGTCG 1630 1640 1650 1660 1670 1680 TTAAAGGACC AGGATTTACA GGAGGAGATA TTCTTCGAAG AACTTCACCT GGCCAGATTT 1690 1700 1710 1720 1730 1740 CAACCTTAAG AGTAAATATT ACTGCACCAT TATCACAAAG ATATCGGGTA AGAATTCGCT 1750 1760 1770 1780 1790 1800 ACGCTTCTAC CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG 1810 1820 1830 1840 1850 1860 GGAATTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC TTTAGGACTG 1870 1880 1890 1900 1910 1920 TAGGTTTTAC TACTCCGTTT AACTTTTCAA ATGGATCAAG TGTATTTACG TTAAGTGCTC 1930 1940 1950 1960 1970 1980 ATGTCTTCAA TTCAGGCAAT GAAGTTTATA TAGATCGAAI TGAATTTGTT CCGGCAGAAG 1990 2000 2010 2020 2030 2040 TAACCTTTGA GGCAGAATAT GATTTAGAAA GAGCACAAAA GGCGGTGAAT GAGCTGTTTA 2050 • 2060 2070 2080 2090 2100 CTTCTTCCAA TCAAATCGGG TTAAAAACAG ATGTGACGGA TTATCATATT GATCAAGTAT 2110 2120 2130 2140 2150 2160 CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTGTGGA TGAAAAAAAA GAATTGTCCG 2170 2180 2190 2200 2210 2220 ACAAAGTCAA ACATGCGAAG CGACTTAGTG ATGAGCGGAA TTTACTTCAA GATCCAAACT 2230 2240 2250 2260 2270 2280 TTAGAGGGAT CAATAGACAA CTAGACCGTG GCTGGAGAGG AAGTACGGAT ATTACCATCC 2290 2300 2310 2320 2330 2340 aaggagggga TGACGTATTC aaagagaatt ACGTTACGCT ATTGGGTACC TTTGATGAGT 2350 2360 2370 2380 2390 2400 GCTA7CGAAG GTATTTATAT gaaaaaatag ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 2420 2430 2440 2450 2460 ACCAATTAAG AGGGTATATC GAAGATAGTC AAGACTTAGA AATCTATTTA ATTCGCTACA 2470 2480 2490 2500 2510 2520 ATGCCAAACA CGAAACAGTA AATGTGCCAG GTACGGGTTC CTTATGGCCG CTTTCAGCCC 2330 2540 2550 2560 2570 2580 CAAGTCCAAT CGGAAAATGT GCCCATGATT CCCATCATT" CTCCTTGGAC ATTGATGTTG 2590 2600 2610 2620 2630 2640 GATGTACAGA CTTAAATGAG GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGAGGCAAG 2650 2660 2670 2680 2690 2700 ATGGCCATGC AAGACTAGGA AATCTAGAAT TTCTCGAAGA GAAACCATTA GTAGGAGAAG 2710 2720 2730 2740 2750 2760 CACTAGCTCG TGTGAAAAGA GCGGAGAAAA AATGGAGAGA CAAACGTGAA AAATTGGAAT 2770 • 2780 2790 2800 2810 2820 GGGAAACAAA TATTGTTTAT AAAGAGGCAA AAGAATGTGT AGATGCTTTA TTTGTAAACT 2830 2840 2850 2860 2870 2880 CTCAATATGA TAGATTACAA GCGGATACCA ACATCGCGAT GATTCATGCG GCAGATAAAC 2890 2900 2910 2920 2930 2940 GCGTTCATAG CATTCGAGAA GCTTATCTGC CTGAGCTGTG TGTGATTCCG GGTGTCAATG 2950 2960 2970 2980 2990 3000 CGGCTATTTT TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA 3010 3020 3030 GAAATGTCAT TAAAAATGGT GATTTTAATA 3070 3080 3090 ATGTAGATGT AGAAGAACM. AACAACCACC 3130 3140 3150 CAGAAGTGTC ACAAGAAGTT CGTGTCTGTC 3190 3200 3210 CGTACAAGGA GGGATATGGA GAAGGTTGCG 3250 3260 3270 ACGAACTGAA GTTTAGCAAC TGTGTAGAAG 3310 3320 3330 GTAATGATTA TACTGCGACT CAAGAAGAAT 3370 3380 3390 GATATGACGG AGCCTATGAA AGCAATTCTT 3430 3440 3450 AAGAAAAAGC ATATACAGAT GGACGAAGAG 3490 • 3500 3510 GGGATTACAC ACCACTACCA GCTGGCTATG 3550 3560 3570 CCGATAAGGT ATGGATTGAG ATCGGAGAAA 3610 3620 3630 AATTACTTCT TATGGAGGAA TAATATATGC 3040 3050 3060 ATGGCTTATC CTGCTGGAAC GTGAAAGGGC 3100 3110 3120 GTTGGGTCGT TGTTGTTCCG GAATGGGAAG 3160 3170 3180 CGGGTCGTGG CTATATCCTT CGTGTCACAG 3220 3230 3240 TAACCATTCA TGAGATCGAG AACAATACAG 3280 3290 3300 AGGAAGTATA TCCAAACAAC ACGGTAACGT 3340 3350 3360 ATGAGGGTAC GTACACTTCT CGTAATCGAG 3400 3410 3420 CTGTACCAGC TGATTATGCA TCAGCCTATG 3460 3470 3480 ACAATCCTTG TGAATCTAAC AGAGGATATG 3520 3530 3540 TGACAAAAGA ATTAGAGTAC TTCCCAGAAA 3580 3590 3600 CGGAAGGAAC ATTCATCGTG GACAGCGTGG 3640 . 3650 3660 ITTATAATGT AAGGTGTGCA AATAAAGAAT 3670 3680 3690 3700 3710 3720 GATTACTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT ATATGAATAA AAAACGGGCA 3730 3740 3750 3750 3770 3780 TCACTCTTAA AAGAATGATG TCCGTTTTTT GTATGATTTA ACGaG x GaxA TTTAAATGTT 3790 3800 3810 3820 3830 3840 TTTTTTGCGA AGGCTTTACT TAAGGGGGTA CCGCCACATG CCCATCAAGT TAAGAATTTG 5 3850 3850 3870 3880 3890 3900 CACXACCCCC AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC 392© 3920 3930 3940 3950 3950 Ai-iTTTXATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCXGAAG AGCTGTATCG 3970 3980 3990 4000 4010 4020 ΊΟ TCATTTAAGC CGTTCTCTTT TGGAAGAACT CGCTAAAGAA TTAGGTTTTG TAAAAAGAAA 4030 4040 4050 4050 4070 4080 ACGAAAGTTT TCAGGAAATG AATTAGCTAC CATATGTATC TGGGGCAGTC AACGTACAGC 4090 4100 4110 4120 4130 4140 GAGTGATTCT CTC6TTCGAC TATGCAGTCA ATTACACGCC GCCACAGGAC TCTTATGAGT 15 4150 4150 4170 4180 4190 4200 CCAGAAGGAC TGAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ΑΪΑΤΑΤΤΤΤΤ 4210 • 4220 4230 4240 4250 4260 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTCAAGTGC AGCACTCACG 4270 4280 4290 4300 4310 4320 20 TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC AAGTACCGAA ACATTTAGCA 4330 4340 4350 4360 CATGTATATC CTGGGTCAGG TGGTTGTGCA CAAACTGCAG The coding region defined by nucleotides 155 to 3623 of formula ϊ codes for « polypeptide of formula II. 'formal II Met lie Val Asp Pro Glu Asn Ty * Val Asn Asn Leu Pro Asn He Cys Leu Ser Asn Asn Arg Glu Pro He Cys Glu Glu 10 20 30 Gly Gly Glu 5 Gly Tvr Thr Pro He Asp τχ^ Ser L'S US 40 Ser Leu Thr Gin Phe Leu Leu Ser Glu Phe 50 Val Pro Gly Ala Gly PHg2 Val At® 13 Gly Leu 60 Val Asp He He Trp Gly He Phe Gly Pro 70 Ser Gin A 57jp Asp Ala Phe Leu Val Gin lie 80 10 Glu Gin Leu He Asn Gin Arg He Glu Glu 90 Phe Ala Arg Asn Gin Ala Ila Ser Arg Leu 100 Glu Gly Leu Ser Asn Leu Tyr Gin He Tyr no Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp 120 Pro Thr Asn Pro Ala Leu Arg Glu Glu Met 130 15 Arg He Gin Phe Asn Asp Met Asn Ser Ala 140 Leu Thr Thr Ala Xie Pro Leu Phe Ala Val 150 Gin Asn Tyr Gin Val Pro Leu Leu Ser Val 160 Tyr Val Gin Ala Ala Asn Leu His Leu Ser 170 Val Leu Arg Asp Val Ser Val Phe Gly Gin 180 20 Arg Trp Gly Phe Asp Ala Ala Thr T Jig Asn 190 Ser Arg Tyr Asn Asp Leu Thr Arg Leu lie 200 Giv Asn Tyr Thr Asp His Ala Val Arg Trp 210 Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly 220 Pro Asp Ser Arg· Asp Trp lie Arg Tyr Asn 230 25 Gin Phe Arg Arg Glu Leu Thr Leu Thr Val 240 Leu Asp He Val Ser Leu Phe Pro Asn Τ Ί/ψ- J ** 250 Asp Ser Arg Thr Tyr Pro He Arg Thr Val 260 Ser Gin Leu Thr Arg Glu He Tyr Thr Asn 270 Pro Val Leu Glu Asn Phe Asp Gly Ser Phe 280 30 Arg Gly Ser Ala Gin Gly He Glu Gly Ser 290 He Arg Ser Pro His Leu Met Asp He Leu 300 Asn Ser He Thr He Tyr Thr Asp Ala His 310 Arg Gly Glu Tyr Tyr Trp Ser Gly His Gin 320 Ils Met Ser Pro Val Gly Phe Ser Gly 330 35 Pro Glu Phe Thr Phe Pro Leu Tyr Gly Thr 340 Met Gly Asn Ala Ala Pro Gin Gin Arg Tig 350 Val aX«> Gin Leu Gly Gin Gly Val *yr Arg 360 Sar Ser Thr Leu Tyr Arg Arg Pro 370 Phe {S'Loi’Afl II® Gly 11® Asn Asn Gin Gin Leu 380 Ser Val Asp Gly Thr Glu Ph® Ala Tyr 390 Sly "hr Ser Ser Asn Pro Ser Ala Val 400 Tvr & Lys Ser Gly Thr Val Ser Leu 410 Asp Glu He Pro Pro Gin Asa ,ί!*&ί£®Ώ Asn Val 420 Pro Pre Arg Gin Gly Ph® Ser Bis Arg Leu 430 Ser His Val Ser Met Phe Arg Ser Glv Phe 440 Ser Asn Ssr Sar Val Ser He He a «"ο Ala 450 Pro Het Phe Sar Trp He Bis As g Ser Ala 460 ©la Phe Ass» Asn j> 1® XI® Pro S«r Ser Gin 470 11« T%«» Gin II® Pro <1? Thr Lys Ser Λ h A 480 Ass» Less Gly Sar Gly Thr Ser Val V®1 Lys 490 ©ly Pro Gly Phe *1*1=» e* AflOfc Gly Gly Asp He Leu 500 Arg Arg Λ Smi Ser F&O Gly Gin lie Ser Thr 510 Law Arg Val Asn Ils XH it Al© Pro Ser 520 ©ln Arg Tyr Arg Val Arg He Arg Tv^ ** a · Ala 530 Ser Thr &ΙΑΡ.Λ. Asn Leu Gin Phe S»·» «· Αίώ R&* TV A QO& Ser 540 He Asp Gly Arg Pro He Asn Gin Gly .Asn 550 Ph® Ser Als Thr Met Ser Ser Glv Ser As 8» 560 Leu ©In S^» i. Gly Ser Phe Arg Thr Val Gly 570 Phws Thr Pro Ph® Asn Phe Ser Asn Gly 580 S®*r Ser Val Phe δ hr Leu Ser aXg His v®l 590 Pfe Asn Ser Gly- Asn Glu Val Tvr He «sp SOO «•Tfe's» <£> IX® Glu phs Val Pro Al© Glu v®l Thr 610 Ph® Glu Al© Glu Tyr Asp Lea Glu Arg Als 620 Gin Lys Ala Val Asn Glu Leu Phe Thr Ser 630 Se? Asn Gia Xl<* Gly Leu Lys Thr Asp Val 640 Thr Asp Tv^ Λ His He Asp Gin V®1 Ser Asn 650 Lsu Val Glu Cys Lau Ser Asp Glu Ph® Cys 660 Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys 670 Val Lys His, «'a Lys Arg Leu Ser Asp Glu 680 Arg Asn Leu Leu Gin Asp Pro Asn Phe Arg 690 Gly He Asn Arg Gin Leu Arg Gly Trp 700 Arg Gly Ser Thr Asp He Thr Ils Gin Gly 710 Gly Asp Asp Val Phe Lys Glu β#« Tyr Val 720 Thr Pro Ser Leu Leu Thr Lys Arg Leu Tyr Leu Gly Gly Lau Lys Tyr Thr Tyr Ala Xla Phe Gin Tyr Glu Asp Lys Thr Asp Glu He Arg Ser Cys Asp Tvr Gia Tyr Glu Gin Asp 730 740 750 760 5 Leu Glu He Tvr Leu χ X© Arg Tyr Asn Ai© 770 Lys His Glu Thr Val Asa Val Pro Gly Thr 780 Gly Ser Leu Trp Pro Leu Ser Ala Pro Sar 790 Pro He Gly Lys Cys Ala His His Ser His 800 His Phe Ser Leu Asp He Asp Val Gly Cys 810 10 Thr Asp Asn Glu Asp Leu Gly Val Trp 820 Val He Phe Lys He Lys Thr Gin Asp Gly 830 His Ala Leu Gly Asn Leu Glu Ph© Leu 840 Glu Glu Lys Pro Leu Val Gly Glu Ala Leu 850 Ala Arg Val Lys Arg Ala Glu Lys Lys Trp 860 15 Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu 870 Thr Asn He Val Tyr Lys Glu Ala Lys Glu 880 Ser Val Ala Leu Phe V®1 Asn Sar Gin 890 Tyr Asp Arg Lau Gin Ala Asp Thr Asn XX 900 Ala Met ϊ le His Ala Ala Asp Lys Arg Val 910 20 His Ser X le Arg Glu Ale; Tyr Leu Pro Glu 920 Leu Ser Val He Pro Gly Val Asn Ala Ala 930 Ils Phe Glu Glu Leu Glu Gly Arg Xla Phe 940 Thr Ala Pha Ser Lau Tyr Asp Ala Arg Asn 950 Val He Lys Asn Gly Asp Phe Asn Asn Gly 960 25 Leu Ser Cys Trp Asn Val Lys Gly His Val 970 Asp Val Glu Glu Gin Asn Asn His Arg Sar 980 Val Leu v«l Val Pro Glu Trp Glu Ala Glu 990 Val Ser Gin Glu Val Arg Val Cys Pro Gly 1000 Arg Gly Tyr He Leu Arg Val Thr Ala Tvr Λ J 1010 30 Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr 1020 He His Glu He Glu Asn Asn Thr Asp Glu 1030 Leu Lys Phe Ser Asn Cys Val Glu Glu Glu 1040 Val Tvr «Ζ ** Pro Asn Asn Thr Val Thr Cys Asn 1050 Asp Tyr Thr Ala Thr Gin Glu Glu Tyr Glu 1060 35 Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr 1070 Asp Gly Ala Tyr Glu Sar Asn Ser Ser Val 1080 Pro Ala Asp <5* ι \r e· ώ y * Ala Ser Ala Tyr Glu Glu 1090 1100 Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asm Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Ty* Thr Pro Leu Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Ph® Pre Glu Thr Asp Lys Val Trp Xie Glu He Gly Glu Thr Glu Gly Thr Phe lie Val .Asp Ser Val Glu Leu Lets Leu Her Glu Glu 2nd 1110 1120 1130 1140 1X50 1156 2a order so introduce a chinaeric gene into 3. thuringiensis or S. cereus cells hy transformation using che process of che invention* the gene may be preferably first inserted into a cammonly-known cloning vector if the corresponding gene is not available is sa amount sufficient for ehe insertion ins© eh® Bacillus cells,, vector can then first be amplified by replication in a heterologous host cell. Bacterial cells ©r yeast colls are best suited for ch© aaplification of genes. When a sufficient amount of the gene is available it is cloned into a bifunctional vector and inserted into the Bacillus cells. The insertion of th© gone in,to B- thuringiensis or B. cereus cells is preferably carried out with the same vector as was used for the replication.

A few examples of bacterial host cells that are suitable for replication of the chinaeric gone include bacteria selected from the genera Escherichia, such ss E. coli. Agrobacterium, such as A. tunefaciens ar A. rhisogenes, Pseudomonas, sueh as Pseudomonas spp.. Bacillus, such as 3. megaterium or 3. subtilis. etc.. As a result of she transformation process of the invention ie is no« possible for the first tine, vithin the scope of this invention, also to use 3. thuringiensis and B. cereus thenselves as host cells. Processes for cloning heterologous genes in bacteria ar® described in US Patents 4 237 224 ©nd 4 468 464.

The replication of genes in E. coli that code for sh© crystalline protein 29) of 3. thuringiensis is described by ' Wong et al. (1983).

Some examples of yeasc hose cells chat are suitable for the replication of the genes of the invention include those selected from the genus Saccharomyces (European Patent Application EP 0 238 441).

Any vector into which the chimaeric gen® can be inserted and which is replicated in a suitable host cell, such as in bacteria or yeast, can be used for the amplification of the genes of the invention. The vector aay be derived, for example, from a phage or from a plasmid. Examples of vectors that ©re derived from phages and that can be used within the scope of this invention are vectors derived from Ml3- and from λ-phages. Some suitable vectors derived from Ml 3 phages include Ml3mpl8 and ml3mp!9. Some suitable vectors derived from λ-phages include Xgtll, Xgt/ and \Charon4.

Of the vectors that are derived from plasmids and are especially suitable for replication in bacteria, there may be mentioned her® by way of ) example pBR322 ( Bolivar et al., 1977), pUC18 and pUCl9 31) 32) ( " Norrander et al., 1983) and Ti-plasmids ( Sevan et al., 1983), without the subject of the invention being in any way limited thereby.

Preferred vectors for the amplification of genes in bacteria are pBR322, pUC18 and pUC19.

Without any limitation being implied, especially direct cloning vectors, such as, for example, pBD347„ pBD348, pBD64 and pUBi 664,, may be mentioned for cloning directly in B. thuringiensis and/or B. cereus.

Amongst the bifunctional vectors especially preferred within the scope of this invention are pXI61 (=pK61) and pXl93 (=ρΚ93) which vectors, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB and B. cereus 569K, have been deposited at the Deutsche Sammlung von Mikroorganismen (Braunschweig, federal Republic of Germany), recognised as an International Depository, in accordance with the requirements or I the Budapest Treaty under the number DSM 4572 (ρΧϊοϊ, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB) and DSM 4571 (pXX93, introduced by transformation into B. thuringiensis vsr. kurstaki HDlcryB) and DSM 4573 (pXX93, introduced by transformation into 3. cereus 5S9K).

In order to construct a chinaeric gene suitable for replication in bacteria, a promoter sequence, s 5 untranslated sequence,, a coding sequence and a 3’ untranslated sequence ate inserted into a vector or are assembled in the correct sequence in one of she afore-described vectors.

Suitable vectors according to the invention are those that are capable of being replicated in che host cell.

The promoter, the 5’ untranslated region» ch© coding region and th® 3’ untranslated region can, if desired, first of all be combined in ©ne unit outside the vector and than inserted into the vector. Alternatively, parts of the chimaeric gene can also be inserted into the vector individually.

In the case of B. thuringiensis and 3. cereus cloning vectors this process step can be omitted since th© entire unit isolated froa 3. thuringiensis, consisting of © 5 untranslated region, the coding region and a. 3' untranslated region, can be inserted into sh© vector.

The vector furthermore preferably also contains a marker gene which confers oa the hose cell a property by which ic is possible to recognise the cells transformed with the vector. Harker genes that cod© for an antibiotic resistance ©re preferred. Some examples of suitable antibiotics are ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G 418 and kanamycin.

Also preferred are marker genes that code for enzymes having a ebromogenie substrate, such as, for example, X-gal (5-brOsao-4-.chloro-3"indolyl'’fl-D-galaccoside). The transformed colonies can then be detected vary easily by way of a specific colour reaction. 5fl The insertion of the gene into, or the assembly of the gene in, the vector is carried out by way of standard processes, for example using 33) recombinant DMA ( Maniatis et al., 1982) and using homologous 34) recombination ( Hinnen et al., 1978).

The recombinant DMA technology processes are based on the vector first of all being cleaved and the desired DMA sequence being inserted between the cleaved portions of the vector, the ends of the desired DMA sequence are then joined to the corresponding ends of th® vector.

Ths vector is preferably cleaved with suitable restriction endonucleases.

Suitable restriction endonucleases are. for example, those that form blunt ends, such as Sma I, Hpa I and Eco RV, as wall as those that form cohesive ends, such as Eco RI, Sac I and Bam HI.

The desired DNA sequence normally exists as a region of a larger DNA molecule, such as a chromosome, a plasmid, a transposon or a phage. The desired DNA sequence is in these cases excised from its original source and, if desired, so modified that its ends can be joined to those of the cleaved vector. If the ends of the desired DNA sequence and of the cleaved vector are blunt ends, then they can, for example, be joined to one another with ligases specific for blunt ends, such as T4 DNA ligase.

The ends of the desired DMA sequence can also be joined in the form of cohesive ends to the ends of the cleaved vector, in which case a ligase specific for cohesive ends, which may also be T4 DNA ligase, is used. Another suitable ligase specific for cohesive ends is, for example, the E- coli DMA ligase.

Cohesive ends are advantageously formed by cleaving the desired DNA sequence and the vector with the same restriction endonuclease, in which case the desired DNA sequence and Che cleaved vector have cohesive ends that are complementary to each other.

The cohesive ends can also be constructed by adding complementary 3Q homopolymer tails to the ends of the desired DNA sequence and of the cleaved vector with the aid of terminal deoxynucleotidyl transferase.

Alternatively, cohesive ends can be produced by adding a synthetic oligonucleotide sequence that is recognised by a particular restriction endonuclease and is known as a linker, and cleaving the sequence with the 33) endonuclease (m«, for example, Maniatis et al., 1982).

It is thus now possible for the first time, within the scope of this iwaatiea, genetically to modify B. thuringiensis gene®, and especially d-endotoxin**encoding DMA sequences, outside B. thuringiensis, to clone those genes and then to return them into B. thuringiensis and/or B. cereus cells, where th® said δ-endotoxin genes can be expressed (in a hasolagOHS bacterial host system).

This means that it is now possible also for the genome of B. thuringiensis to be manipulated genetically in a specifically controlled manner by first of all generating large amounts of plasmid material in a foreign cloning system and then introducing this into B. thuringiensis by transformation.

The possibility of modifying the δ-endotoxin genes and the control sequences regulating the expression of those genes is of particular Interest here.

Apart from chimaeric genes, it is obviously also possible for any other chimaeric genetic construct to be inserted into Bacillus thuringiensis and/or Bacillus'cereus cells using th® process of the invention.

It is thus, for example, conceivable, using the process of the invention, to insert non-coding ’’anti-sense DNA into the genome of a Bacillus thuringiensis and/or Bacillus cereus call, so that in the course of the expression of the said anti-sense DNA a mRNA is transcribed that Inhibits ch® expression of the corresponding sense" DMA. In this manner it is possible to inhibit in © specifically controlled manner the expression in Bacillus thuringiensis and/or Bacillus cereus of certain undesired genes.

Furthermore, apart from the preparation of improved, well-defined 3« thuringiensis strains for the preparation of improved bioinseeticides, it is now also possible to use B. thuringiensis as a general host for cloning and. if desired, expressing heterologous and/or homologous genes.

In a specific and preferred embodiment of the process of the invention it is furthermore now possible for the first time to clone new genes, and especially new protoxin genes, directly in the natural host, that is to say in 3. thuringiensis or B. cereus.

In the search for new protoxin genes, first of all a gene library of B. thuringiensis is created.

In a first process step, the total DMA of a protoxin-producing B. thuringiensis strain is isolated by processes that are known per sa and then broken down into individual fragments. The B. thuringiensis DMA can be fragmented either mechanically, for example by the action of shearing forces, or, preferably, by digestion with suitable restriction enzymes. Digestion of the DNA sample is partial or complete, depending on the choice of enzymes. Within the scope of this invention, the use of restriction enzymes chat contain quaternary recognition sites and/or result in a partial digestion of the 3. thuringiensis DMA are especially preferred, such as, for example, the restriction enzyme Sau IIIA, but this preference does not imply any limitation. Obviously, it is also possible to use any other suitable restriction enzyme in the process of the invention.

The restriction fragments obtained in the afore-described manner are then separated according to size by processes known per se. Size-dependent separation of DNA fragments is usually effected by centrifuging processes, such as, for example, saccharose gradient centrifugation, or by electrophoretic processes, such as agarose gel electrophoresis, or by a combination of those processes.

Those fractions containing fragments of the correct size, that is to say fragments that on account of their size are capable of coding for a protoxin, are pooled and used for the next process steps.

The previously isolated fragments ©re first of all inserted into suitable eloning vectors using standard processes, and then inserted directly ins© Bacillus thuringiensis or Β» cereus, hut preferably into pro toxin-free strains of Bacillus thuringiensis, using the transformation process of the invention.

The vectors used are ch© shuttle" vectors described in detail hereinbefore. The shuttle vector pXl200, which is described in detail hereinafter (see Example 9.1), is especially preferred within che scope of this invention. Suitable vectors contain DNA sequences that ensure easy idencification of the transformed, vector-containing clones from among the immense number of untransformed clones. Especially preferred are DMA sequences coding tor a specific marker that on expression results in an easily selectable feature, such as, for example aa antibiotic resistance. There may be mentioned by way of example here a resistance t© ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, 6418 or kanamycin.

Also preferred are marker genes that code for enzymes; having a ebromogenie substrate, such as, for example. X-gal (5-bromo-4~ehloro-3-indolyl-e~D~galactoside). The transformed colonies can then he detected very easily by «ay of a specific colour reaction.

After electroporation tha treated Bacillus thuringiensis or 3. cereus cells are transferred to a selective sporulation medium ©nd are incubated until sporulation is complete at a temperature of from 10°C to 40®C, preferably from 20°C to 3S**C, and more especially at a temperature of from 29°C to 31 eC. The sporulation medium contains as selective substance preferably one of the above-mentioned antibiotics, depending on the vector used, and a suitable solidifying agent, such as, for example, agar, agarose, gelatin etc..

In the course of sporulation, autolysis of the sporulsting cells occurs, which is advantageous in industrial scale processing for the subsequent screening since breaking open the cells artificially is dispensed with.

Xn clones that contain the desired protoxin gene and are expressed under the control of their natural promoter, the crystalline proteins formed are freely accessible in th® medium. These crystalline proteins which exist freely in the medium can then be immobilised, for example with the aid of membrane filters or by other suitable measures. Suitable membrane filters are, for example, nylon or nitrocellulose membranes. Membranes of this kind are freely available on the market.

The crystalline proteins immobilised in this manner can then be located and identified very simply in a suitable screening process.

Immunological screening using protoxin-specifie antibodies Is preferred within the scope of this invention. Immunological screening processes are ) known and are described in detail, for example, in Young et al., 1983. The use of monoclonal antibodies that recognise quite specifically a particular region of the protein molecule is especially preferred within the scope of the process of the invention. These antibodies can be used either on their own or in the form of a mixture. It is, of course, also possible, however, to use polyclonal antisera for the immunological screening. Mixtures based on monoclonal and polyclonal antibodies are also possible.

Processes for the production of monoclonal antibodies to Bacillus thuringiensis protoxin proteins are known and are described in detail, for example, in’^^^Huber-Lukac (1984) and in ^^^Huber-Lukac et al, (1986). These processes can also be used In the present case.

The immunological screening process based on antibodies is part of the present invention.

It is obviously also possible within the scope of this invention to use other suitable screening processes for locating novel DNA sequences in B. thuringiensis and/or 3. cereus.

Bacillus thuringiensis ©nd 3. cereus cells ehat have bees transformed «using the afore-described process, and the toxins produced by these transformed Bacillus cells, are excellently suitable far controlling iaseets, but especially for controlling Insects &£ the orders lepidoptera, Dipcera and Coleoptera, For use as insecticides, the transformed living or dead B. thuringiensis or B„ cereus cells, containing the recombinant B. thuringiensis toxin gene,., including mixtures of living ©nd dead B. thuringiensis and B. cereus cells, as well ss the toxin proteins produced by the said transformed cells, are used in unmodified fora or, preferably, together with adjuvants customarily employed in the art of formulation, and are formulated in a manner known per se, for example into suspension concentrates, coetable pastes, directly sprayable or dilutible solutions, wettable powders, soluble powders, dusts, granulates, and also encapsulations in, for example, polymer substances.

As with the nature of the compositions, the methods of application, such as spraying, atomising, dusting, scattering, coating or pouring, are chosen in accordance with th® intended objectives and the prevailing circumstances.

Furthermore it is obviously also possible to use insecticidal mixtures consisting of transformed living or dead B- thuringiensis and/or B. cereus cells and cell-free crystalline body preparations containing a protoxin produced by the said transformed Bacillus cells.

Tha formulations, that is to say th® compositions or preparations containing the transformed living or dead Bacillus cells or mixtures thereof and also the toxin proteins produced by the said transformed Bacillus calls and, where appropriate, solid or liquid adjuvants, are prepared in known manner, for example by intimately mixing the transformed cells and/or toxin proteins with solid carriers and, where appropriate, surface-active compounds (surfactants).

The solid carriers used e.g. for dusts and dispersible powders, are normally natural mineral fillers such as calcite, talcum, kaolin, montmorillonite or attapulgite. In order to improve the physical properties it is also possible to add highly dispersed silicic acid or highly dispersed absorbent polymers. Suitable granulated adsorptive carriers are porous types, for example pumice, broken brick, sepiolite or bentonite: and‘suitable nonsorbent carriers are. for example, calcite or sand. In addition, a great number of pregranulated materials of inorganic or organic nature can be used, e.g. especially dolomite or pulverised plant residues.

Suitable surface-active compounds are non-ionic, cationic and/or anionic surfactants having good dispersing and wetting properties. The term surfactants will also be understood as comprising mixtures of surfactants.

Both so-called water-soluble soaps and also water-soluble synthetic surface-active compounds are suitable anionic surfactants.

Suitable soaps are the alkali metal salts, alkaline earth metal salts or «snsubstituted or substituted ammonium salts of higher fatty acids (Cie-Cgs), β-g· the sodium or potassium salts of oleic or stearic acid or of natural fatty acid mixtures which can be obtained e.g. from coconut ©il sr callow oil. Mention aay also bs made of fatty acid methyltaurin salts, such as, for example, the sodium salt of cxs-2~(methyl"9-©ctadecenylaniiao)-eth«nesulfonic acid (content in formulations preferably approximately 3 %).

Hore frequently, however, so-called synthetic surfactants are used, •j 0 especially fatty sulfonates, fatty sulfates, sulfonated benzimidazole derivatives or alkylarylsulfonates or fatty alcohols, sueh as, for example, 2,4,7t9-tetramethyl-5-decyne-4,7~diol (content in formulations preferably approximately 2 %).

The fatty sulfonates or sulfates are usually in the form of alkali metal salts, alkaline earth metal salts or unsubstituted or substituted nismnonium salts and contain a Cg-Gggalkyl radical which also includes the slkyl moiety of ©cyl radicals, e.g. ths sodium or calcium salt of lignosulfonic acid, of dodecylsulfate or of « mixture of fatty alcohol sulfates obtained from natural fatty acids. These compounds also comprise 2o th© sales of sulfated and sulfonated fatty alcohol/ethylene oxide adducts. The sulfonated benzimidazole derivatives preferably contain sulfonic acid groups and one fatty scid radical containing to 22 carbon’atoms. Examples of alkylarylsulfonates are the sodium, calcium or triethanolamine salts of dodecylbenzenesulfonic acid, di~ butylnaphthalenesulfonic acid, or of a condensate of naphchalenesulfonic acid and formaldehyde.

Also suitable are corresponding phosphates, e.g. salts of the phosphoric acid ester of an adduct of p-nonylphenol with 4 to 14 moles of ethylene oxide.

Non-ionic surfactants are preferably polyglycol ether derivatives of aliphatic or cycloaliphatic alcohols, saturated or unsaturated fatty acids and alkylphenols. said derivatives containing 3 to 30 glycol ether groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon moiety and 6 to 18 carbon atoms in the alkyl moiety of the alkylphenols.

Further suitable non-ionic surfactants are the water-soluble adducts of polyethylene oxide with polypropylene glycol, ethylenediaminopolypropylene glycol and alkylpolypropylene glycol containing 1 to 10 carbon atoms in the alkyl chain, which adducts contain 20 co 250 ethylene glycol ether groups and 10 to 100 propylene glycol ether groups. These compounds usually contain 1 to 5 ethylene glycol units per propylene glycol unit.

Examples of non-ionic surfactants are nonylphenolpolyethoxyethanols, castor oil polyglycol ethers, polypropylene/polyethylene oxide adducts, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxypolyethoxyethanol, ratty acid esters of polyoxyethylene sorbitan, e.g. polyoxyethylene sorbitan trioleate, are also suitable non-ionic surfactants.

Cationic surfactants are preferably quaternary ammonium salts which contain, as N-substituent, at least one Cg-Cszalkyl radical and, as further substituents, unsubstituted or halogenated lover alkyl, benzyl or hydroxy-lower alkyl radicals. The salts are preferably in the form of halides, methylsulfates or ethylsulfates, e.g. stearyltrimethylammonium chloride or benzyldi(2-chloroethyl)ethylammonium bromide.

The surfactants customarily employed in the art of formulation are described, inter alia, in the following publications: ) 71986 International McCutcheon's Emulsifiers & Detergents, The Manufacturing Confectioner Publishing Co., Glen Rock, NJ, USA, Helmut Stache Tensid-Taschenbuch Carl Hanser-Verlag Munich/Vienna 1981.

Th® agrochemical compositions usually contain 0.1 to 99 X, preferably 0.Ϊ co 95 , of the transformed living or dead Bacillus cells or mixtures thereof or of che toxin protceins produced by the said transformed Bacillus cells, 99.9 co 1 3», preferably 99.8 to 5 *, o£ .¾ solid ar liquid adjuvant, and 0 to 25 X, preferably 0.1 to 25 X, of a surfactant.

Whereas commercial products will preferably be formulated as concentrates* sh® end user will normally employ dilute formulations.

The compositions may also contain further auxiliaries such as stabilisers. antifoaas, viscosity regulators, binders, tackifiers as well as fertilisers or other ,active ingredients for obtaining special effects.

The transformed living or dead Bacillus cells or mixtures thereof containing the recombinant B. thuringiensis toxin genes, as well as the toxin proteins produced by the said transformed Bacillus cells, are excellently suitable for controlling insect pests. Plant-destructive insects of the order Lepidoptera should preferably be mentioned here, especially those of the genera Pieris, Heliothis, Spodoptera and Plutella, such as, for example, Pieris brassicae, Heliothis virescens, Heliothis tea, Spodoptera littoralis and Plutella xyloscella.

Other insect pests that can be controlled by the afore-described insecticidal preparations ©re, for example, beetles of the order Coleoptera, especially those of the Chrysomelidae family, such as, for example, Diabrotie© undecimpunctata, D. longicornis, D. virgifera, SJ. undeclmpunctata howardi, Agelastica alni, Leptinotarsa decemlineata etc., as well ©s insects of the order Diptera, such as, for example. Anopheles sesgentii, Uranatenia unguiculata, Culex univittatus, Aedes aegypti. Culex pipiens, etc..

Th® amounts in which che Bacillus cells or the toxin proteins produced by them sr® used depends on the respective conditions, such as, for exampl®, che weather conditions, the soil conditions, the plant growth and the time of application.

Formulation Examples for material containing 3. thuringiensis toxin In the following Formulation Examples the term Bacillus cells5' is used to mean those B° thuringiensis snd/or B. cereus cells containing a recombinant 3. thuringiensis gene of th® invention. (The figures given are percentages by weight throughout).

Fl. Granulates, Bacillus cells and/or toxin protein produced by these cells kaolin highly dispersed silicic acid attapulgite a) b) % 10% % % % The Bacillus cells and/or toxin protein produced by these cells are first of all suspended in methylene chloride, then the suspension is sprayed onto tha carrier, and the suspending agent is subsequently evaporated off in vacuo.

F2. Dusts Bacillus calls and/or toxin protein produced by these cells highly dispersed silicic acid talcum kaolin a) b) % 5 % % 5 % % % Ready-for-use dusts are obtained by intimately mixing the carriers with the Bacillus cells and/or with toxin protein produced by these cells.

F3. Wet table powders Bacillus cells and/or toxin protein produced by these cells sodium lignosulfohate sodium laurylsulfate sodium diisopropylnaphthalenesulfonate a) b) c) % 50 % 75 % % 5 % % - 5 % δ % 10 % SI oetylphenol polyethylene glycol ether (7=>8 moles of ethylene oxide) highly dispersed silicic acid kaolin % % 10 % 10 % % 27 % The Bacillus calls and/or toxin protein produced by these cells are carefully nixed with the adjuvants and the resulting aixture is then thoroughly ground in a suitable nill, affording wettable powders, which can be diluted with water to give suspensions of th® desired concentration. ?4. Extruder granulates Bacillus calls and/or toxin protein produced by these cells 10 % sodium lignosulfonate 2 % carboxyaathylcellulos® 1 % kaolin 87% The Bacillus cells .and/or toxin protein produced by these cells are mixed with th® adjuvants, carefully ground, and the mixture is subsequently aoistened with water. The mixture is extruded and then dried in a stream of air. ?5. Coated granulate Bacillus cells snd/or toxin protein produced by these cells 3 % polyethylene glycol 200 3 % kaolin 94 % The homogeneously mixed Bacillus cells and/or toxin protein produced by these cells are uniformly applied, in a mixer, to che kaolin moistened with che polyethylene glycol. Non-dusty coated granulates are obtained in this manner.

F6. Suspension concentrate Bacillus cells and/or toxin protein produced by these cells % §2 ethylene glycol 10 % nonylphenol polyethylene glycol (15 moles of ethylene oxide) 6 % alkyIbenzenesuIfonic acid triethanolamine salt* 3 % carboxymethylcellulose 1 % silicon® oil in the form of a % aqueous emulsion 0.1 % water 39 % *Alkyl is preferably linear alkyl having from 10 to 14, especially from 12 to 14, carbon atoms, such as, for example, n-dodecylbenzenesulfonic acid triethanolamine salt.

The homogeneously mixed Bacillus cells and/or toxin protein produced by these cells are intimately mixed with the adjuvants, giving a suspension concentrate from which suspensions of any desired concentration can be obtained by dilution with water.

Examples General recombinant DMA techniques Since many of the recombinant DNA techniques used in this invention are routine for the- skilled person, a brief description of the techniques generally used is given in the following so that these general details need not be given in the Embodiment Examples themselves. Unless expressly indicated otherwise, all of these methods are described in the reference 33) work by 'Maniatis et si., 1982.

A. Cleaving with restriction endonucleases The reaction mixture will typically contain about 50 pg/ml to 500 pg/ml DNA in the buffer solution recommended by the manufacturer. New England Biolabs, Beverly, MA.. From 2 to 5 units of restriction endonuclease are added for every pg of DNA and the reaction mixture is incubated at the temperature recommended by the manufacturer for from one to three hours.

S3 The reaction is stopped by heating ac 65°C for 10 minutes or by extraction with phenol, followed by precipitation of th© DNA with ethanol. This 33) technique is ©Iso described on pages 104 to 106 of the Maniatis ec al. reference work.

B. Treatment of the DNA with polymerase to produce blunt ends © pg/ml to 500 pg/ml DNA fragments are added to a reaction mixture ia Che buffer recommended by the manufactures. New England Biolabs. The reaction mixture contains all four deoxynucleotide triphosphates in concentrations of 0.2 mM. An appropriate DNA polymerase is added ©nd the reaction is carried out for 30 minutes at 15°C and is then stopped by heating for 10 minutes ac 65°C. for fragments obtained by cleaving with restriction endonucleases that produce 5' cohesive ends, such ss Eco RI and 3am HI, the large fragment, or Klenow fragment, of DNA polymerase is used. For fragments obtained using endonucleases chat produce 3' cohesive ends, such as Pst I and Sac I, T4 DNA polymerase is used. The use of these two enzymes is described on pages 113 to 121 of the 33) Maniatis et al. reference work.

C. Agarose gel electrophoresis and cleaning DNA fragments to remove gel contaminants Agarose gel electrophoresis is carried out in a horisontal apparatus as 33) described on pages 150 to 163 ot the Maniatis et al. reference work. The buffer used corresponds to the Tris-borate buffer or Tris-acetate described therein. The DNA fragments ar© stained with 0.5 yg/ml ethidium bromide which either is present in the gel or tank buffer during electrophoresis or is not added until after electrophoresis, as desired. The DNA is made visible by illumination with long-wave ultra-violet light. If the fragments are to be separated from the gel, an agarose that gels ®t low temperature, obtainable from Sigma Chemical, St. Louis, Missouri, is used. After electrophoresis, the desired fragment is excised, placed in a small plastics tube, heated at 65°C for about 15 minutes, extracted three times with phenol and precipitated twice with ethanol. This method has been changed slightly compared with the method described by 33) Maniatis et al. on page I/O.

Alternatively, the DNA can be isolated from the agarose gel with the aid of the 'Geneclean Kit’ (Bio 101 Inc., La Jolla, CA, USA).

D. Removal of 5’ terminal phosphates fro® DNA fragments During the plasmid cloning steps, treatment of the plasmid vector with phosphatase reduces the recircularisation of the vector (discussed on 33) page 13 of the Maniatis at al. reference work). After cleaving the DNA with the appropriate restriction endonuclease, one unit of calf intestinal alkaline phosphatase, which can be obtained from Boehringer-Mannheim, Mannheim, is added. The DNA is incubated for one IQ hour at 37°C and then extracted twice with phenol and precipitated with ethanol.

E. Joining of DNA fragments If fragments having complementary cohesive ends are to be joined to one another, about 100 ng of each fragment are incubated in a reaction -j 5 mixture of from 20 pi to 4Q pi with about 0.2 unit of T4 DNA ligase from New England Biolabs in the buffer recommended by the manufacturer. The incubation is carried out for from 1 to 20 hours at 35°C. If DNA fragments having blunt ends are to be joined, they are incubated as described above except that the amount of T4 DNA ligase is increased co from 2 co 4 units.

F. Transformation of DNA in E. coli E. coli strain H3103 is used for most experiments. DNA is introduced into 33) E. coli using the calcium chloride process described by Maniatis et al pages 250 co 251.

S5 G„ Screening of E. coli for plasmids After transformation, the resulting colonies o£ £. coli are examined for the presence of the desired plasoid by a rapid plasmid isolation process Two commonly used processes ®r® described on. pages 366 to 369 of th® gq) Maniatis et al. reference work.

S. Large-scale isolation of plasmid DMA Processes for the large-scale isolation of plasmids from E. coli ar© 33) described on pages 88 to 94 of the Maniatis et al. reference work.

Media and Buffer Solutions LB medium (g/1] tryptone 10 yeast extract 5 NaCl 5 Antibiotic medium No. 3 (Difco Laboratories) ί g/X 1 bovine meat extract 1.5 yeast extract 1.5 peptone · 5 glucose 1 NaCl 3.5 KjHPOfe 3.68 O2?0fe 1.32 SCGY medium [g/1] casamino acids 1 yeast extract 0.1 glucose 5 KzHPOi. 14 KH2PCE 6 Naa-citrate 1 (NHfchSO», 2 HgSOis · 7 HgO 0.2 22) ffYS medium ( Tousfcen & Rogoff, 1969) ig/1] glucose 1 yeast extract 2 (NHOzSOu 2 KgHP0& 0.5 MgSOfc - 7 n20 0.2 CaCl2 · 2 H20 0.08 MnSOfc · H20 0.05 pH adjusted to 7.3 before autoclavi; P3S buffer (mM J saccharose MgCl 2 phosphate buffer, pH 6.0 T3ST buffer Tween 20* Tris/HCl* (pH 8.0) NaCl 400 [ mM ] 0.05 % (w/v) 10 150 *Tween (RIM) 20; polyethoxysorbitan Iaurate *Tris/HCl: e,o,c-Tris(hydroxymethyl)methylaminohvdrochloride Th© internal reference pi< chosen for designating the plasmids in the Priority Document has been replaced in the Auslandsfassung (foreign filing text) by the officially recognised reference pXI.

Also, th® designation for the asporogenic B. thuringiensis HDl mutants used in th© Embodiment Exaraples has been changed from cryfi to cryB.

Example 1ϊ Transformation of 3. thuringiensis using electroporation Example 1.1s 10 ml of an LB medium (trypcone 10 g/1, yeast extract 5 g/1, NaCl 5 g/1) are inoculated with spores of 3. thuringiensis var. kurstaki 3®) HQlcryB ( ' Stably D.B. et al.» 1978)» a plasmid-free variant of B. thuringiensis var. kurstaki HDl.

This batch is incubated overnight ac a temperature of 27°C using © rotary shaker at 50 revs/min. Subsequently the 3. thuringiensis culture is diluted 100-£old in from 100 ml to 400 ml of LB medium, and further cultured at a temperature of 30°C using ® rotary shaker at 250 revs/min until aa optical density (OD550) ox 0.2 is reached.

Th® cells are harvested by centrifugation and suspended ia 1/40 volume of an ice-cooled BBS buffer (400 mM saccharose, 1 mM MgCig, 7 mM phosphate buffer pH 6.0). Centrifugation and subsequent suspension of the harvested B. thuringiensis cells in BBS buffer is repeated once more.

The cells pretreated in this manner can b® electroporated either directly, or alternatively after the addition of glycerin to the buffer solution (20 % (w/v)J, and are scored at from -20°C to -70°C, and used at a latter point in time. 800 pi aliquots of the ice-cooled cells are chen transferred into 40) precooled cuvettes, 0.2 pg pBC!6 plasmid DNA ( Bernhard K. et al., 1978) (20 pg/ml) is subsequently added, and the entire bateh is incubated at 4°C for 10 minutes.

If deep-frozen cell material is used, a suitable aliquot of frozen eells is first thawed ia Ice or at room temperature. The further treatment is analogous to the procedure used for fresh cell material.

The cuvette is then introduced into an electroporation apparatus and the 3. thuringiensis cells present in the suspension are electroporated by the action of voltages of from 0.1 kV to 2.5 kV from a single discharge of a capacitor.

Tha capacitor used has a capacitance of 25 μϊ' and the distance between the electrodes in the cuvette is 0.4 cm, which, when discharge occurs results, depending on the setting, in sn exponentially decreasing field strength with initial peak values of from 0.25 kV/cm to 6.25 W/cm. The exponential decay time lies in the range of from 10 ms to 12 ms.

An electroporation apparatus from the firm Bio Rad (Gene Pulsar Apparatus, #165-2075, Bio Rad, 14J4 Harbour Way South, Richmond, CA 94804, USA), for example, can be used for th® described electroporation experiments.

Xt is obviously also possible to use any other suitable apparatus in the process of the invention.

After a further 10 minutes' incubation at 4°c, the cell suspension is diluted with 1.2 ml of LB medium, and incubated for 2 hours at a temperature of 30°C using a rotary shaker at 250 revs/min.

Suitable dilutions are then plated out onto L3 agar (LB medium solidified with agar, 15 g/1), which contains as an additive an antibiotic suitable for the selection of the newly obtained plasmid. In the case of pBClo this is tetracycline, which is added to the medium in a concentration of 20 mg/1.

The transformation frequencies achieved for 3. thuringiensis HDlcryB and p3C16 as a function of the initial voltage applied for a given distance between plates are reproduced in Figure 1.

The expression of the inserted DNA can be detected by way of the tetraeyeline resistance that occurs. As soon as 2 hours after the introduction by transformation of pBGlS into 3. thuringiensis a complete phenotypic expression of the newly introduced tetracycline resistance occurs (see Table 2).

Example 1.2; Tho transformation of 3. thuringiensis cells is carried out in exactly the same manner as that described in Example 1.1* except that the volume of the cell suspension provided for the electroporation is in this case 400 μί.

Ta® transformation frequency can be increased by a factor of 10 by this measure.

Example 2: Transformation of B.thuringiensis HDlcryB with a number of different pla_smids Most of the tests are carried out with plasmid pBClo, a naturally occurring plasmid of 3. cereus. ϊη addition, however, other naturally occurring plasmids can also be successfully inserted into 25) thuringiensis cells, such as, for example, pUBilO ( Polsck J. and 24) Novik R.P., 1982), pCl94 ( 'Horinouchi S. and Weisblum B.„ 1982) and pIMl3 ("^Mahler X. and Halvorson S.O. 1980) (see Table 3).

Also, variants of these plasmids that are better suited th^n sh® natural isolates for work with recombinant DNA can be introduced by transformation into the B. thuringiensis strain HDlcryB using the process of the invencion* such as, for example, the 3. subtilis cloning vector pBD64 C z6ryczan T. et al., 1980) and plasmids pBD347, pBD348 and pUBl6S4 (sag Table 3; plasmids pBD347, pBD348 and pUBla64 can be obtained from Dr, V. Schurter, CIBA-GEIGY AG, Basle).

The transformation results in Table 3 show clearly that using the transformation process of th® invention, transformation frequencies are achieved that, with one exception, are all in the rang® of from 10s co 10', irrespective of the plasmid DNA used.

Example 3: Construction, of a shuttle vector for Bacillus thuringiensis Existing bifunctional vectors for E. coli and 3. subtilis, such ss, for example, pHV33 ( primrose S-B. and Ehrlich S.D., Plasmid, 6" 193-201. 1981) are not suitable for 3. thuringiensis HDlcryB (see Table 3).

For the construction of a potent bifunctional vector, first of all the large Eco RI fragment of pBClfi is inserted with the aid of T4 DNA ligase into the Eco RI site of plasmid pUC8 (" Vieira J. and Messing J. 1982). E. coli calls are then transformed with this construct. A construct recognised as correct by restriction analysis is designated pXl62.

The removal of the Eco RI cleavage sits situated distally from the pUC8 polylinker region then follows. pXlG2 is linearised by a partial Eco RI digestion. The cohesive Eco RI ends are made up with Klenow polymerase and joined together again with T4 DNA ligase. After introduction into E. coli by transformation, a construct, recognised as correct by restriction analysis is selected and designated ρΧΙόϊ. A map of ρΧΙόϊ with the cleavage sites of restriction enzymes that cleave ρΧΙόϊ only once, is shown in Figure 6.

This construct can be introduced directly into B. thuringiensis HDlcryB using the transformation process described in Example 1.

On account of the strong restriction barriers in 3. thuringiensis strains, the transformation rates are lower when using ρΧΙόϊ DNA originating from E. coli than when using plasmid DNA originating from B. thuringiensis HDlcryB (see Table 3). Nevertheless pXIfil proves to be very suitable for carrying out cloning experiments in B. thuringiensis.

Example 4; Insertion of the Kurhdl delta-endotoxin gene into strains of B. thuringiensis and B. cereus The DNA sequence coding for a Kurhdl delta-endotoxin protein used within the scope of this invention for insertion and expression in B. thuringiensis and 3. cereus originates from plasmid pK36. which was deposited on 4th March 1986 under the Deposit Number DSM 3668 in accordance with the requirements of the Budapest Treaty for the International ?1· Recognition of the Deposit of Microorganisms for the Purposes of Patenting, at the Deutsche Sammlung von Mikroorganismen, Federal Republic of Germany,, which ie recognised aa an International Depository* &. detailed description of the process for Identifying and isolating the 2~eadotoxin genes and for the construction of plasmid pK36 is contained ia European Patent Application EP 0 238 441 and is a part of the present invention in th© fora of -3 reference. pK36 plasmid DMA is completely digested with the restriction enzymes Pst I and 3am HI and the 4.3 Kb fragment, which contains the Kurhdl delta-endotoxin gene (cf. formula I)„ is Isolated from an agarose gel. This fragment is then inserted into pXl61, which has previously been digested with Pst I and Bam HI and treated with alkaline phosphatase from calf's stomach. After the transformation of E. coli HB101, a construct recognised as correct by restriction analysis is isolated and designated pXX93. A restriction map of pXX93 is reproduced in Figure 7. pXl93 can be introduced into 3. thuringiensis HDlcryB in 2 different ways. a) 3. thuringiensis cells are transformed directly with a pXI93 isolate of E. coli using the transformation process of the invention described in Example 1. b) pXI93 is first of all introduced into B. subtilis cells.by transformation, as described by Chang and Cohen, 1979. The complete and intact pXl93 plasmid DMA contained in a transformant is isolated and then introduced into B. thuringiensis HDlcryB by transformation using the electroporation process described in Example 1.

Both methods result in transformants that contain the intact pX!93 plasaid, which can be demonstrated by restriction analysis.

Example 5: Evidence of the expression of the delta-endotoxin gene in B. thuringiensis Sporulsting cultures of 3. thuringiensis HDlcryB, HDlcryB (pXXSl), HDlcryB (pXX93) ©nd HDl are compared under a phase contrast microscope at a magnification of 400. The typical hipyrimidal protein crystals can he detected only in the strain containing pX!93 and in HDl. Extracts from the same cultures are separated electrophoretically on an SDS polyacrylamide gel. A protein band of 130.000 Dalton, which corresponds to the Kurhdl gene product, could be detected on the gel only for the strain containing plasmid pXX93 and in HDl (Figure 8a).

In a Western blot analysis (Figure 8b), this 130,000 Dalton protein and its degradation products react specifically with polyclonal antibodies that have been prepared previously against crystalline protein of B. thuringiensis var. kurstaki HDl. in accordance with the process 42) . described by Huber-LukacH.. 1982. A detailed description of this process can be found in European Patent Application EP 238 441,, which is a part of this invention in the form of a reference. Located on plasmid pXl93, upstream of the toxin-encoding region, is a 156 Bp DNA region, which contains the afore-described sporulacion-dependent tandem promoter 29) ( Wong H.C. et al., 1983). This sequence is adequate for a high expression of the delta-endotoxin gene in B. thuringiensis HDlcryB and 3. cereus 569K.

Example 6: Evidence of the toxicity of recombinant 3. thuringiensis HDlcrvB (pXl93) 3. thuringiensis HDlcryB and HDlcryB (pXT93) are cultured at 25°C in sporulation medium (GTS medium). When sporulation is complete, uhich is checked using a phase contrast microscope, spores and (if present) protoxin crystals are harvested by centrifugation and spray-dried. The resulting powder is admixed in various concentrations with the food of L-l larvae of Heliothis virescens (tobacco budworm). The mortality of the larvae is ascertained after six days.

As expected, the protoxin gens-fres strain HDlcryB is non-toxic to Heliothis virescens* whilst the strain transformed with plasmid pXI93 causes a dosage-dependent mortality of 3. virescens (Table 4). This demonstrates that recombinant strains produced by the electroporation process can actually Toe used as bioinseeticides.

Example 7s Electroporaeion of various 5- thuringiensis and 3. spec. strains The transformation protocol for B. thuringiensis HDlcryB described under Example 1 can also be applied co other strains.

All tested strains of B. thuringiensis var. kurstaki can be very simply and efficiently transformed by this process (Table 5).

Excellent transformation frequencies can also be achieved with a laboratory strain of B. cereus. The same applies also to other tested B. thuringiensis varieties (var. israelensis* v»r. kurstaki). By contrast, transformation of 3. subtilis by the electroporation process is very poor.

Using the protoplast-dependent PEG method for 3. subtilis, on ths other hand, transformation rates of 4 x 106/pg plasmid DMA were achieved.

The low transformation rates of 3. subtilis obtained using ths electro20 poration technique are not associated with incorrectly selected parameters, such as, for example, an unsuitable voltage* or with a high mortality rate caused by electric pulses, as can be seen from Figure 9.

Example 8: Transformation of 3. thuringiensis HDlcryB with the 8-galactosidase gene 8.1. Insertion of a Bam HI restriction cleavage site directly before the first AUG codon of the B. thuringiensis protoxin gene Before th© S-galactosidase gene from the plasmid piWiTh5 (obtainable from Dr. M. Geiser, CXBA-GEIGY AG, Basle. Switzerland) can be joined to tha promoter of the Kurhdl e-endotoxin gens of B. thuringiensis, the DNA sequence of the protoxin gene located in the region of the AUG start codon must first be modified.

This modification is carried out by oligonucleotide-directed mutagenesis, using the single-stranded phage M'13mp8. which contains the 1.8 kB Hint ΙΙ-Hind III fragment, of the δ-endotoxin gene containing the 5' region of that gene.

First of all 3 pg of plasmid pK36 (cf. Example 4) are digested with the restriction enzymes Hind III and Mine II. The resulting 1.8 kb fragment is purified by agarose gel electrophoresis and then isolated from the gel.

In parallel with this, 100 ng of Ml3mp8 RF phage DNA (Biolab, loser Road, Beverly MA, 01915, USA or any other manufacturer) are digested with the restriction enzymes Sma I and Hind III, treated with phenol, and precipitated by the addition of ethanol. The phage DNA treated in this manner is then mixed with 200 ng of the previously isolated protoxin fragment and joined thereto by the addition of 74 DNA ligase.

After the transfection of E. coli JM103, δ white plaques are selected and analysed by restriction mapping.

An isolate in which the join between the β-galactosidase gene and the promoter of the Kurhdl δ-endotoxin gene of 3. thuringiensis has been carried out correctly is selected and designated Ml3mp8/Hinc-Hind.

An oligonucleotide with the following sequence is synthesized using a DNA synthesizing apparatus (APPLIED BIOSYSTEM DNA SYNTHESIZER): (5°) GTTCGGATTGGGATCCATAAG (3s) This synthetic· oligonucleotide is complementary to the M13mp8/Hinc-Hind DMA in a region that extends from position 153 to position 173 ©f the KsrdiM ©-endotoxin gone (cf. formula I). The oligonucleotide sequence reproduced above has a ’’mismatch" in positions 162 and 163, however, compared with the sequence reproduced in formula I, so that the formation of a Ban HI restriction cleavage site is necessary. The general procedure JEor ch® mutagenesis is described by J. M. Zoller and M. Smith 43) ( J.H. Zoller and M. Smith; 19). Approximately 5 pg of single-stranded Hl3mp!8/Hinc~Hind phage DNA is mixed with 0.3 pg of phosphorylated oligonucleotides in a total volume of 40 pi. This mixture is heated for minutes at 6SeC, cooled first to 50°C and then, gradually, to 4°C.

Buffer, nucleotide triphosphates, ATP, T4 DNA ligase and tha large fragment of DNA polymerase are then added and the bateh is incubated 43) overnight at 15eC in the manner described ( J.M. Zoller and H. Smith). After agarose gel electrophoresis, circular double-stranded DNA is purified ©nd inserted into E. coli strain JM103 by transfection. As an alternative, the E. coli strain JM107 can be us©d.

The resulting plaques are examined for sequences that hybridize with 8’P-labelled oligonucleotide; the phages are examined by DMA restriction endonuclease analysis.

A phage that contains a correct construct in which a Bam HI cleavage site is located directly before tha first AUG codon of the protoxin gene is designated Ml3mp8/Hinc-Hind/Bam. 8.2. Joining tha 8-galactosidase gene to the 6-endotoxin promoter 8.2.1s The ©-endotoxin promoter is on a 162 Bp Eco RI/Bam HI fragment of tha Ml 3mp8/Hinc-Hind/Bam phage DNA. RF phage DNA is digested with restriction enzyme Baa HI» The projections resulting ac the 5’ ands are removed by treatment with ’’Mung Bean" nuclease (Biolabs) in accordance with the manufacturer's instructions. Subsequently, the DNA is digested with tha restriction endonuclease Eco RI and. after carrying out agarose gel electrophoresis, the 162 Bp fragment is isolated from the agarose gel.

The β-galactosidase gene is isolated from plasmid piWiThS. piWiThS DNA is first of all cleaved at the single Hind III cleavage site. The 3" recessed ends are made up using th® Klenou fragment of DNA polymerase (cf. ^Maniatis at al., 1983, page 113-114) and th® modified DNA is then digested with the restriction enzyme Sal 1. Ths DNA fragment containing the β-galactosidase gens is isolated by agarose gel electrophoresis.

The vector ρΧΙόΙ (cf. Example 3) is digested with the restriction enzymes Eco RI end Sal I and th® two previously isolated fragments are inserted into the vector pXl61.

After transformation of this ligation mixture in the E. coli strain HB101 or JM107, the correctly joined clones are selected by restriction analysis and by their β-galactosidase activity wish respect to the ehromogenic substrate X-gal ( 5-bromo-4-chloro-3-indolyl-B-D-galactoside). A clone containing a correct genetic construct is designated pXl80. 8.2.2: In an alternative embodiment, the 162 Bp Eco RI/Bam HI fragment containing the 6-endotoxin promoter is isolated by cleavage of Ml3mp8/Hinc-Hind/Bam with Eco RI and 3am HI, followed by separation by gel electrophoresis.

The β-galactosidase gene is isolated from plasmid piWiTh5 in this instance too (cf. Example 8.1.). In this case, the plasmid DNA is digested with the restriction enzymes Bam MI and Bgl II and the large fragment is eluted from the agarose gel after gel electrophoresis.

The vector pHY300 PLK (#PHY-001; Toyobo Co., Ltd.. 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan), which can be obtained commercially (cf. Example 9.1), is digested with tha restriction enzymes Eco RI and Bgl II. The two previously isolated fragments are then inserted into the vector pHY300 PLK.

The satire ligation mixture is than introduced by transformation into the E. coli strain JM107 (Bethesda Research Laboratories (BRL), 411 Η» Sconestreet Avenue, Rockville, HD 20850, USA). A clone having © B-galactosidase activity is further analysed by restriction digestions. A clone containing a correct genetic construct is designated pXHOl. g._3. Introduction by transformation into B. subtilis and B. thuringiensis. of plasmid aXl80 or aXIlOI pXISO or pXHOl plasmid DMA is first of all introduced into B. subtilis protoplasts by transformation according to a known test protocol des13) «Bribed by Chang and Cohen ( Chang ©nd Cohen, 1979).

A correct cion® is selected, the DMA co be transformed is isolated by standard processes and introduced by transformation into B. thuringiensis HDlcryB cells by way of electroporation (cf. Example 1).

The transformed B. thuringiensis cells are plated out onto GTS agar (sporulation medium), which contains X-gal as an additive.

Correctly transformed clones turn blue uhan sporulation commences.

A 3. thuringi»ensis HDlcryB strain transformed by the pXIol vector, on the other hand, remains white under th® same conditionsRestriction analysis shows that with correctly transformed clones, an intact pX!80 or pXHOl plasmid is present in the B. thuringiensis cells. 8-4. Q-galactosidase gene under the control of a sporulation-dependent promoter 3. thuringiensis HDlcryB cells containing plasmid pX180 or pXHOl are cultured on GTS medium in the manner described hereinbefore. At intervals during the growth phase (both during tha vegetative growth phase ©nd during the sporulation phase) a B-galactosidase assay is carried out in 44) accordance with the test protocol described by J.H. Miller (Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972, Experiment 48 and 49).

The individual differences from the above-mentioned test protocol concern the use of X-gal as ebromogenie substrate and the measurement of the coloured hydrolysis product, which is formed by the cells after approximately 1 hour.

The cells are then removed by centrifugation, and the optical density of the supernatant is ascertained at a wavelength of 650 nm (ODgso).

An increase in the optical density as a function of sporulation is observed. The non-transformed 3. thuringiensis cells, on the other hand, cannot hydrolyse the chromogenic substrate X-gal.

Example 9: Creation of gene banks in Bacillus thuringiensis 9.1. Construction of pXX200 Plasmid pX!200 is a derivative of plasmid pHY300 PLK, which can be obtained commercially from Toyobo Co.» Ltd. ($PHY-OOl; Toyobo Co.» Ltd.» 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan). Plasmid pHY300, the construction of which is described in European Patent Application R R EP 162 725, contains both an ampicillin (amp ) and a tetracycline (tetr° ) resistance gene.

Plasmid pHY300 PLK is completely digested with Bgl I and Pvu X. The resulting restriction fragments are then separated by agarose gel electrophoresis. The 4.4 Kb fragment is isolated from the agarose gel, purified and then religated with T4 DNA ligase.

The whole ligation batch is introduced by transformation into E. coli HB101. After incubation of the transformed E. coli H3101 cells at 37°C on a selective L-agar containing 20 pg/ml tetracycline, che tetracyclineresistant (Ter) transformants are selected. It is then possible to isolate from an ampicillin-sensitive (Aps) clone (X00 pg/ml ampicillin) a plasmid that has lost the Pst X cleavage site in the Apr gene together with the 0.3 Kb Pvu I/3gl I fragment. This plasmid is designated pXX200. 9.2 Cloning protoxin genes of Bacillus thuringiensis var. kurstaki HDl in Bacillus thuringiensis HDlcryB Tho total DNA (50 pg) of Bacillus thuringiensis var kurstaki HDl is cosipletely digested by incubation with th© restriction enzymes Pst 1 and Spa 3« The restriction fragment® so obtained are transferred to a continuous saccharose gradient (5 % (w/v) - 23 « (w/v)) where they are separated according co size by density gradient centrifugation and collected in 500 yl fractions. The centrifugation is carried out in a TST 41-rotor (Kontron (R.T.M.) Ausschwingrotor) at a temperature of 15°C at was: 2»4 x 10s g for a period of 16 hours. Subsequently, in order to determine She fragment size aliquots, each of 50 μί. ace transferred So ao agarose gel (0.8 % (w/v) agarose in Tris acetate EDTA or Tris borate EDTA; see 'Maniatis et al.. 1982). Those fractions containing fragments between 3 Kb ©nd 6 Kb are pooled and concentrated to © volume of 10 μί by ethanol precipitation. of the shuttle" vector pXl200 described in Example 9.1 ©re digested with the restriction enzymes Pst 1 and Sm® 1. The 5 phosphate groups of the resulting restriction fragments ©re then removed by treatment with calf intestinal alkaline phosphatase. 0.2 pg co 0.3 pg of the previously isolated HDl DNA is then mixed with 0.5 pg of the pXI200 vector DNA and incubated overnight at 14°C with the addition of 0.1 U of TA DNA ligase (so-called Weiss Units: one unit of TA DNA ligase corresponds to an enzymatic activity sufficient to convert 1 nM (32?) from pyrophosphate at a temperature of 37°C and within a period of 20 minutes into a Noritabsorbable material). The entire ligation batch is then introduced by transformation directly into Bacillus thuringiensis HDlcryB cells by aeans of electroporation (cf. Example 1). The electroporated B. thuringiensis cells are then plated out onto a selective speculation ©gar containing 20 ug/ml of tetracycline as selecting agent, and incubated at s temperature of 25°C until sporulation is complete. 9.3. Manufacture of monoclonal antibodies to B. thuringiensis protoxin protein The manufacture of monoclonal antibodies to δ-endotoxin of Bacillus thuringiensis var. kurstaki HDl is carried out analogously to th® - description in ^Huber-Lukac (1984) and in ' Huber-Lukacet al.» (1986).

The hybridoma cells used for the antibody manufacture are fusion products 45) of Sp2/O-Ag myeloma cells (described in ' Shulman ct al., 1978; can be obtained at the American Type Culture Collection in Rockville, Maryland, USA) and splenocytes of Balb/c mice that have previously been immunised with δ-endotoxin of B. thuringiensis var. kurstaki HDl.

In this manner it is possible to obtain monoclonal antibodies that are directed specifically against the δ-endotoxin of B. thuringiensis. Especially preferred are monoclonal antibodies that either bind specifi15 cally to an epitope in the N-terminal half of the protoxin protein (for example antibody 54.1 of the Huber-Lukac et al., 1986 reference), or recognise en epitope in the part of the protein constant in Lepidopteraactive protoxins, the C-terminal half (for example antibody 83.16 of the Huber-Lukac et al.„ 1986 reference).

It is. however, also entirely possible for ocher monoclonal or also polyclonal antibodies to be used for the subsequent immunological screening (cf. Example 9.4). 9.4. Immunological Screening The monoclonal antibodies produced in accordance with Example 9.3, or other suitable monoclonal antibodies, are used for the immunological screening.

First of all. the crystalline proteins present in free form after the sporulation of the B. thuringiensis cells are bound by means of transfer • membranes (for example Pall Biodyne (RE4) transfer membrane; Pall Ultrafine Filtration Corporation, Glen Cove, N.Y.) by applying the filter membranes to the plates for a period of approximately 5 minutes. The filters are subsequently washed for 5 minutes with T3ST buffer (0.05 % (w/v) Tween 20, 10 mM Tris/HCl (pH 8.0), 150 sM NaCl in bidist. H?,O] ©nd then, in order to block non-specific binding, Incubated in a mixture of TBST buffer and 1 % (w/v) skimmed milk for from 15 to 30 minutes.

The filters prepared in this wanner are then incubated overnight with the protoxin-specific antibodies ί antibody mixture of 54.1 and 83-16 ( 'Buber~Luka£ et al·, (1986)]. The unbound antibodies arc removed by washing the filter three tiuies with TBST buffer for from 5 to 10 minutes each time. To detect she antibody-bound protoxin the filters are incubated with a further antibody, The secondary antibody used is an anti-mouse antibody labelled with alkaline phosphatase, which can be obtained commercially, for example, from Bio-Rad (Kacalog 0170-6520. goat’s anti-mouse XgG(H+L)-alkaline phosphatase conjugate]. After an incubation period of 30 minutes the unbound secondary antibodies are removed in the manner described above by washing the filters with TBST buffer three times (for from 5 to 10 minutes each time). The filters are then incubated with a substrate mixture consisting of NBT [’p-nicro blue tetrazolium chloride; nitro-blue tetrazolium chloride] and BCI? (5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt]. The enzymatic reaction is carried out in accordance with the manufacturer's instructions (Bio-Rad; 1414 Harbour Way South, Richmond CA, 94804, USA].

Positive, that is to say protoxin-containing clones, can be recognised very easily by their violet colouring. This occurs as a result of the enzymatic reaction of the alkaline phosphatase with the afore-mentioned substrate mixture. Between 800 ©nd 1000 transformants result from the transformation described in Example 9.2 with the ligation batch indicated in that Example. Of these transformants 2 colonies exhibit clearly positive signals in the above-described enzyme reaction.

Plasmid DMA is isolated from positive clones in which expression of the protoxin gene could be detected by way of the described enzyme reaction. Th® cloned protoxin genes can be further characterised and ultimately identified by restriction analysis and comparison with known restriction maps.

Both clones contain a recombinant plasmid with an insert of 4.3 Kb. The subsequent restriction digestions with Hind III, Pvu II» Eco RI ©nd Xba I permit identification of the gene on the insert by comparison with the known restriction maps of the endotoxin genes of 3. thuringiensis var. kurstaki HDl. In both cases the gen® is the Kurhdl gene, which is also known as the 5.3 Kb protoxin gene and is described in ^Geiser et al., 1986.

This gens, cloned directly in 3. thuringiensis and identified by immunological screening, furthermore hybridises with a 184/ Bp Baa HI/Hind III fragment of the 5.3 Kb gene in plasmid pK36 ( Geiser et al.» 1986). In the SDS/PAGE, both clones exhibit a band of 130,000 Dalton typical of the protoxin, which in a Western blot ( ^Towbin et al., 1979) react specifically with the afore-described (see Example 9.4) monoclonal antibodies.

Tables Table 1: Influence of the incubation time at 4°C, before and after electroporation, on the transformation frequency. B. thuringiensis HDlcryB was transformed using the electroporation process with 0.2 pg pBC!6 per batch.

Example 1 2 3 4 5 6 7 8 preincubacion * (minutes) 0 5 10 20 20 20 20 20 subsequent iacabacion ** (aissotes) 20 20 20 20 0 5 10 20 Transfermacion frequency (Trans- formants /pffi Plasmid DNA) 2.6x10s 2.1x10s 2.23:10s 2.3x10s 2.5x10s 1.9x10s 3.3x10s 1.7x10s Incubation at 4°C between the addition of DNA and electroporation ** Incubation at 4 C between electroporation and the beginning of the expression period Table 2; Expression of che cecracydine resistance of pBCl6 after introduction into B. thuringiensis HDlcryB by transformation 3- thuringiensis HDlcryB was transformed with pBCIS plasmid DNA using the electroporation protocol according co the invention. After various incubation periods in LB medium at 30°C, the transformed cells are selected by plating out onto LB agar containing 20 pg/ml tetracycline.

Time taken co express tetracycline resistance (hours) Transformation frequency (Transformant s/pgDNA) Number of living cells 0.5 0 4 χ 108 3 1.6 x 10s 10s . 2 8.8 x 10s 1.4 X 10s 3 8 x 10s 1.6 χ 109 Table 3: Transformation of the B. thuringiensis strain HDlcryB with various plasmids Plasmid Origin resistance marker gram negative| gram positive Transformation frequency naturally occuring plasmids pBCIS 3. cereus Tc 1.9 x 10s pUBilO Staphylococcus Km, Ble 3.3 x 10®* aureus pC!94 S. aureus - Cm 6 x 10s* pIM13 B. subtilis — Em 1.8 x 10s modified plasmids/cloning vectors pBD64 pUBilO replicon - Km, Cm 5 x 10® pBD347 pIMl3 repli- con, - Cm 2.9 x 10s pBD348 pIM13 repli- con. - Em, Cm 1.1 x 10s pUB1664 pUBilO repli- con, Cm, Em 3.5 x 10" shuttle" vectors pHV33 pBR322/pC194, Amp, Tc Cm < 50* pK61 pUC8/ pBCl6, Amp Tc 2.8 x 10" 1: Tc: tetracycline; Km: kanamycin; Ble: bleomycin; Cm: chloramphenicol: Em: erythromycin 2: All plasmid DNA originates from B. thuringiensis HDlcryB with the exception of. * isolated from 3. subtilis L3G4468.

Table 4; Biotest of 3. thuringiensis HDlcryB and HDlcryB (pXX93) against Heliothis virescens.

Spray-dried sporuiated cultures (spores and (if present) protoxin crystals) are admixed, in the amounts indicated, with the food of L-l larvae of Heliothis virescens.

Concentration of spores and protoxin crystal® (pg/g tood) Mortality (%) of H. virescans caused by? HDI cryB HDI cryB (pXI93) 200 0 57 100 0 43 50 3 27 25 0 10 L±! 0 0 Table 5; Transformability of strains of B. thuringiensis, B. cereus and 3. subtilis. All strains were transformed with plasmid pBCIS in accordance with tha electroporation process described under Example 1 Strain Transformation^ frequency 3_. thuringiensis var. kurstaki HDlcryB HDI dipel HDI-9 HD 73 BD 191 B. thuringiensis var. thuringiensis HD 2-D6-4 B. thuringiensis var. israelensis ' L3G 3-4444 3. cereus 569 S 3. subtilis L3G 3-4468 ^relative values achieved with B. 0.25 0.9 0.1 0.5 13.8 2.6 7.5 0,0002 based on the transformation frequency, defined es 1. thuringiensis var. kurstaki HDlcryB.

Deposit of Microorganisms A culture of each of the microorganisms listed in th® following that are used within tha scope of the present invention has been deposited at the ’’Deutschs Saamlung von Mi&roorganismen", recognised as an International Depository, in Braunschweig, Federal Republic of Germany, in accordance with the requirements of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purposes of Patenting. A declaration concerning the viability of the deposited samples has been issued by the said International Depository.

Deposit of Micoorganisas Microorganisms Deposit Date Deposit Number Date of the viability certificate HB 101 (pK36) (E. coli HB1O1 transformed with pK36 plasmid DNA) 4. March 1986 DSM 3668 7. March 1986 *HD1 cryS (Bacillus thucingiensis var. kurstaki HDl cryS 4. May 1988 DSM 4574 4. May 1988 *HD1 cryS (*pK 61) (B. thuringiensis HDl cryS transformed with *pK61 plasmid DNA) 4. May 1988 DSM 4572 4. May 1988 *HD1 cryS (*pK 93) (B. thuringiensis HDl cryS transformed with *pK93 plasmid DNA) 4. May 1988 DSM 4571 4. May 1988 569 K (Bacillus cereus 569 K) 4. May 1988 DSM 4575 4. May 1988 569 K (*pK 93) (3. cereus 569 K transformed with *pK93 plasmid DNA) 4. May 1988 DSM 4573 4. May 1988 The internal reference pK selected for the designation of the plasmids in tha Priority Document has been replaced for the Auslandsfassung (foreign filing text) by the officially recognised designation pXI.

Also, the designation for the asporogenic B. thuringiensis HDl mutants used in the Embodiment Examples has been changed from cryS co cryB.

Literature references 1. Goldberg L. ©nd Margalit J-» Mosquito News. 37: 355-358, 1977 2. Krieg A. ec al,» Z. Ang. Ent., 96: 500-508» 1983 3» Schnepf, H.E. and Whiteley H.R., Proc. Natl. Acad. Sci., USA, 78: 2893-2897, 1981 4. Klier A. et al»» The EH30 J»„ 1: /91-799, 1982 - Gaiser M. ©t al., Gene, 48: 109-118, 1986 6. Haider M-Z. et al., Gen®, 32: 285-290» 1987 7. Gonzalez J.M. et al., Proc. Neel. .Acad. Sci- USA, 79: 6951-6955» 1982 8. Obukowicz M.G. et al., J. Bacteriol., 168: 982-989, 1986 9. Donovan L.P. et al.. Mol. Gen. Genet.» 214: 365-372» 1988 . Schnepf H.E. and Whitely H.R., J. Biol. Chem., 260: 6273» 1985 11. Klier A. et al., Mol. Gen. Genet.» 191: 257-262» 1983 12» Bibb J.J. et al.» Nature, 274: 398-400» 1978 13» Chang S. and Cohen S.N., Molec. Gen. Genet.» 168: 111-115, 1979 14. Brown 3.J. and Carlton B.C., J. Bacteriol., 142: 508-512» 1980 . Rondo J.K. and McKay L.L., Appl. Environ. Microbiol.» 48: 252-259» 1984 16. Wirch R. et al-, J. bacteriol., 165: 831-836. 1986 17» Yoshihama M. et al., J. Bacteriol»» 162: 591-597, 1985 18. Alikhanian S.J. et al., J. Bacteriol., 146, 7-9» 1981 19. Martin P.A. et al.» J. Bacteriol., 145: 980-983, 1981 . Fischer H.M., Arch. Microbiol., 139: 213-217» 1984 21. Schall D., venubertragung zwischen Isolaten von Bacillus thuringiensis dutch Protoplastentransformation und -fusion (Gene transfer between isolates of Bacillus thuringiensis by protoplast transformation and fusion). Dissertation, University of Tubingen, 1986. 22. Shivarova H., Zeitschr. Allgem. Mikrobiol., 23: 595-599, 1983 23. Youston A.A. and Rogoff Μ.Η.» J. Bacteriol., 100: 1229-1236. 1969 24. Horinouchi S., and Waisblum 3., J. Bacteriol., 150: 815-825, 1982 . Polak J. and Novick R.P., Plasmid, 7: 152-162» 1982 26. Mahler J. and Halvorson H.O.» J. Gen. Microbiol., 120: 259-263» 1980 27. Gryczan T. et al., J. Bacteriol., 141: 246-253» 1980 28. Vieira J. and Messing J., Gene, 19: 259-268, 1982 29. Wong et al., J. Biol. Chem.» 258: 1960-1967» 1983 . Bolivar et al., Gens 2: 95-113, 1977 31. Norrander et ©1., Gene, 26: 101-104» 1983 32. Bevan et al., Nature, 304: 184-187, 1983 33. Maniatis st al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982 34. Hinnen et al., Proc. Natl. Acad. Sci.» USA, 75: 1929-1933, 1978 . Young R.A. et al.» Proc. Natl. Acad. Sci., USA, 80: 1194-1198, 1983 36. Huber-Lucac M., Dissertation No. 7547 Zur Interaktion des deltaendotoxins von Bacillus thuringiensis salt aonoklonalen Antikorpern und Lipiden (on th® interaction of the delta-endotoxin of Bacillus thuringiensis with monoclonal antibodies and lipids), ETH Zurich, 1984 37. Huber-Lucac M. et al., Infect. Immunol., 54: 228-232, 1986 38. McCutcheon's, 1986 International McCutcheon’s Emulsifiers & Detergents. The Manufacturing Confections Publishing Co·» Glen Rock, NJ, USA. 39. Stahly D.P. et al.» Bioehem. Biophys. Res. Comm., 84: 581-588, 1978 40. Bernhard K. at al., J. Bacteriol., 133: 897-903, 1978 43. Primrose S.B., Ehrlich S.D., Plasmid 6; 193-201, 1981 42. Huber-LukacH., Dissertation, Eidgenossische Technische Hochschule, Zurich, Switzerland, Ko. 7050, 1982 43. Zoller J.M. and Smith M., Nucl. Acids Res., 10: 6487, 1982 44. Miller J.H., Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972 45. Shulman et'al., Nature, 276: 269, 1978 46. Towbin H. et al., Proc. Natl. Acad. Sci.» USA, 76: 4350-4354, 1979 Patent Literature EP 162 725 EP 238 441 W0 86/01536 US-P 4 448 885 US-P 4 447 036 US-P 4 237 224 US-P 4 468 464

Claims (10)

1.What is claimed is: L A process for inserting and cloning DNA sequences ia gram positive bacteria selected fioo the group consisting of Bacillus ttetringiensis and BacUbts cereus t comprising: (a) isolating the DNA ϊ© be introduced; (b) dotting the dins isolated DNA in a dotting vector that is capable of replicating in a bacterial host cdl selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; (c) directly introducing the thus cloned vector DNA into die said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction present in the said bacterial cells; and (d) cultivating die thus transformed bacterial cells and isolating the thus cloned vector DNA.

2. A process for insetting» cloning and expressing DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacillus cereus, comprising: (a) isolating the DNA to te introduced and optionally ligating die thus isolated DNA with exprossion sequences that are capable of functioning in bacterial cells selected from the group consisting· ©f Bacillus thuringiensis sad Bacillus cereus cells; (b) dotting the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; (c) directly introducing the thus cloned vector DNA into the said bacterial cell via decoqporation at a transformation rate sufficient to overcome the restriction present in the said bacterial cells; and (d) .cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA and the expressed gene product.

3. A process according to claim 2, wherein said transforming comprises a) preparing a suspension of host cells in an aerated medium sufficient to allow for growth ©f the cells; b) separating the grown cells from she cell suspension and resuspending the grown cells in an inoculation buffer, c) adding a DNA sample comprising she cloned DNA in a concentration suitable for the electroporation co the buffer: d) introducing she batch of step c) into an electroporation apparatus; c) subjecting she thus introduced batch to at least one capacitor discharge to produce a high electric field strength that is sufficient co render the bacterial cell wall penneable to che DNA to be introduced, for a period of time sufficient to transform the bacterial host (Cells with she recombinant DNA; f) selecting the thus transformed bacterial host cells.

4. A process according to claim 3» which comprises using B. thuringiensis spores as starting material for the preparation of the cell suspension of step (a).

5. A precess according to claim 3, which comprises using thawed bacterial cells, which cells have previously been deep-frozen, as starting material for the preparation of the cell suspension of step (a).

6. A process according to claim 3, wherein the culture medium of step (a) comprises a) complex nutrient media with readily assimilable carbon and nitrogen sources that are conventionally employed for culturing aerobic Bacillus species; or b) fully synthetic or semi-synthetic nutrient media that contain bj) a complex or alternatively a defined readily assimilable carbon and nitrogen source or a combination of the two and also bo) essential vitamins and metal ions.

7. A process according to claim 3, wherein in step a) the said Bacillus cells are grown until an optical density [OD 550 ] of from 0.1 to 1.0 is achieved.

8. A process according to claim 3, wherein the inoculation buffer of step b) is a phosphate buffer that has been osmotically stabilized by addition of an osmotic stabilizing agent.

9. A process according to claim 8, wherein the said phosphate buffer contains sugars or sugar alcohols as an osmotic stabilizing agent SO. A process according ro claim 9, wherein she said stabilizing agent is saccharose, which is present in a concentration of tens Ο.ϊ M ro LO M. 11. A process according ro claim 8, wherein the said phosphate buffer has ε pH value of from pH 5.0 ro pH 8.0. IX A process according ro claim 3, wherein tiro incubation of tiro bacterial cells is earned oat as a tenoperature of from 0°C to 35°C before, during and after electroporation. 13» A process according ro claim 12, wherein the incubation ©f the bacterial cells is earned out at a temperature of from 2®C to 15°C before, during and after electroporation. K A process according to claim 3, wherein the concentration of the added DNA sample is from 1 ag to 20 gg. 15. A process according ro claim 3, wherein the field strength are from 3000 V/cra to 4500 V/cm. Id. A process according ro claim 3, wherein she exponential decay time of the pulse acting on the bacterial cell suspension lies within a range ©f ten 2 ms ϊ© 50 ms. 17. A process according ro claim 3, wherein selection of the transformed bacterial host (Cells comprises plating out the electroporated cells, after & subsequent incubation phase, onto solid media .containing an additive Suitable for the selection of the -transformed bacterial cells. 18. A process according to claim 17, wherein the said additive is an antibiotic suitable for the selection B. Ontringiensis or B. cereus or both, selected from the group consisting of tetracycline, kanamycin, chloramphenicol, erythromycin. 19» A process according ro claim 18, wherein die said additive is a ehromogenic substrate suitable for the selection of B. thuringiensis or B. cereus or both. 20. A process according ro anyone of claims 1 cr 2» wherein the DNA to be introduced bi© the said bacterial host cell is a recombinant DNA which is of homologous or heterologous origin or is a combination of homologous and heterologous DNA. 21. A process according ¢0 claim 20, wherein die said recombinant DNA contains one or more, structural genes and 3’ and 3’ flanking regulatory sequences that are capable of functioning in che said bacterial host cells, which sequences are operably linked to the structural gene(s) and thus ensure the expression of the said structural gene(s) in said 5 bacterial host cells. 22. A process according to claim 21» wherein the said 3* and 5’ flanking regulatory sequences comprise a sporulation-dependeni promoter ox B. thuringiensis. 23. A process according to claim 21, wherein the said structural gene co-des for a ^-endotoxin polypeptide occurring naturally in 8. thuringiensis, or for a polypeptide that has substantial structural homologies therewith and has still substantially she toxicity

10. 1 0 properties of the said crystalline δ-endotoxin polypeptide. 24. A process according to claim 23, wherein the said δ-endotoxin-encoding DNA sequence is substantially homologous with at least the part or parts of the natural δ-endotoxin-encoding sequence that is (are) responsible for the insecticidal activity. 25. A process according to claim 23, wherein the said polypeptide is substantially -j 5 homologous with a δ-cndotoxin polypeptide of a suitable sub-species of 3. thuringiensis, selected from the group consisting of kurstaki, Berliner, alesti, sotto, tolworthi, dendrolisnus, tenebrionis and israelensis. 26. A process according to claim 23, wherein the said δ-endotoxin-encoding DNA sequence is a DNA fragment of B. thuringiensis var. kurstaki HDl located between 20 nucleotides 156 and 3623 in formula Ϊ, or is any shorter DNA fragment that still codes for a polypeptide having insect-toxic properties: Formula I 10 GTTAAGACCG 20 TGGGTCAAAA 30 ATTGATATTT 40 AGTAAAATTA 50 GTTGCACTTT SO 70 80 90 100 5 GTGCATTTTT TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA 110 120 130 140 150 AACAGTATTA TATCATAATG AATTGGTATC TTAATAAAAG AGATGGAGGT 160 170 180 190 200 AACTTATGGA TAACAATCCG AACATCAATG AATGCATTCC TTATAATTGT 10 210 220 230 240 250 TTAAGTAACC CTGAAGTAGA AGTATTAGGT GGAGAAAGAA TAGAAACTGG 260 270 280 290 300 TTAGACCCCA ATCGATATTT CCTTGTCGCT AACGCAATTT CTTTTGAGTG 310 320 330 340 350 15 AATTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATAATATGG 360 370 380 390 400 GGAATTTTTG GTCCCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA 410 420 430 440 450 GTTAATTAAC CAAAGAATAG AAGAATTCGG TAGGAACCAA GCCATTTCTA 20 460 470 480 490 500 GATTAGAAGG ACTAAGCAAT CTTTATCAAA TTTACGCAGA ATCTTTTAGA 510 520 530 540 550 GAGTGGGAAG GAGATCCTAC TAATCCAGCA TTAAGAGAAG AGATGCGTAT 560 570 580 590 600 TCAATTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTCTTTTTG 610 620 630 640 650 CAGTTCAAAA TTATCAAGTT CCTCTTTTAT CAGTATATGT TCAAGCTGCA 660 670 680 690 700 AATTTACATT TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG 710 720 730 740 750 GGGATTTGAT GCCGCGACTA TCAATAGTCG TTATAATGAT TTAACTAGGC 760 770 780 790 800 TTATTGGCAA CTATACAGAT CATGCTGTAC GCTGGTACAA TACGGGATTA 810 820 830 840 850 GAGCGTGTAT GGGGACCGGA. TTCTAGAGAT TGGATAAGAT ATAATCAATT 860 870 880 890 900 TAGAAGAGAA TTAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA SIO 920 930 94 0 950 ACTATGATAG TAGAACGTAT CCAATTCGAA CAGTTTCCCA ATTAACAAGA 960 970 980 990 1000 GAAATTTATA CAAACCCAGT ATTAGAAAAT TTTGATGGTA GTTTTCGAGG 1010 1020 1030 1040 1050 CTCGGCTCAG GGCATAGAAG GAAGTATTAG GAGTCCACAT TTGATGGATA 1060 1070 1080 1090 1100 TACTTAACAG TATAACCATC TATACGGATG CTCATAGAGG AGAATATTAT 1110 1120 1130 1140 1150 TGGTCAGGGC ATCAAATAAT GGCTTCTCCT GTAGGGTTTT CGGGGCCAGA 1160 1170 1180 1190 1200 ATTCACTTTT CCGCTATATG GAACTATGGG AAATGCAGCT CCACAACAAC 1210 1220 1230 1240 1250 GTATTGTTGC TCAACTAGGT CAGGGCGTGT ATAGAACATT ATCGTCCACT 1260 1270 1280 1290 1300 TTATATAGAA GACCTTTTAA TATAGGGATA AATAATCAAC AACTATCTGT 1310 1320 1330 1340 1350 TCTTGAGGGG ACAGAATTTG CTTATGGAAC CTCCTCAAAT TTGCCATCCG 1360 1370 1380 1390 1400 CTGTATACAG AAAAAGCGGA ACGGTAGATT CGCTGGATGA AATACCGCCA 1410 1420 1430 1440 1450 CAGAATAACA ACGTGCCACC TAGGCAAGGA TTTAGTCATC GATTAAGCCA 1460 1470 1480 1490 1500 TGTTTCAATG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTGAATT TAATAATATA 1560 1570 1580 1590 1600 ATTCCTTCAT CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT 1610 1620 1630 1640 1650 TGGCTCTGGA ACTTCTGTCG TTAAAGGACC AGGATTTACA GGAGGAGATA 1660 1670 1680 1690 1700 TTCTTCGAAG AACTTCACCT GGCCAGATTT CAACCTTAAG AGTAAATATT 1710 1720 1730 1740 1750 ACTGCACCAT TATCACAAAG ATATCGGGTA AGAATTCGCT ACGCTTGTAC 17 SO 1770 1780 1790 1800 CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG 1810 1820 1830 184.0 1850 GGAATTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC I860 1870 1880 1890 1900 TTTAGGACTG TAGGTTTTAC TACTCCGTTT AACTTTTCAA ATGGATCAAG 1910 1920 1930 1940 1950 TGTATTTACG TTAAGTGCTC ATGTCTTCAA TTCAGGCAAT GAAGTTTATA 1960 1970 1980 1990 2000 TAGATCGAAT TGAATTTGTT CCGGCAGAAG TAACCTTTGA GGCAGAATAT 2010 2020 2030 2040 2050 GATTTAGAAA GAGCACAAAA GGCGGTGAAT GAGCTGTTTA CTTCTTCCAA 2060 2070 2080 2090 2100 TCAAATCGGG TTAAAAACAG ATGTGACGGA TTATCATATT GATCAAGTAT 2110 2120 2130 2140 2150 CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTGTGGA TGAAAAAAAA 2160 2170 2180 2190 2200 GAATTGTCCG ACAAAGTCAA ACATGCGAAG CGACTTAGTG ATGAGCGGAA 2210 2220 2230 2240 2250 TTTACTTCAA GATCCAAACT TTAGAGGGAT CAATAGACAA CTAGACCGTG 2260 2270 2280 2290 2300 GCTGGAGAGG AAGTACGGAT ATTACCATCC AAGGAGGCGA TGACGTATTC 2310 2320 2330 2340 2350 AAAGAGAATT ACGTTACGCT ATTGGGTACC TTTGATGAGT GCTATCCAAC 9? 2360 2370 2380 2390 2400 GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 2420 2430 2440 2450 ACCAATTAAG AGGGTATATC GAAGATAGTC AAGACTTAGA AATCTATTTA 2460 2470 2480 2490 2500 ATTCGCTAGA ATGCCAAACA CGAAACAGTA AATGTGCCAG GTACGGGTTC 2510 2520 2530 2540 2550 CTTATGGCCG CTTTCAGCCC CAAGTCCAAT CGGAAAATGT GCCCATCATT 2560 2570 2580 2590 2600 CCCATCATTT CTCCTTGGAC ATTGATGTTG GATGTACAGA CTTAAATGAG 2610 2620 2630 2640 2650 GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGACGCAAG ATGGCCATGC 2660 2670 2680 2690 2700 AAGACTAGGA AATCTAGAAT TTCTCGAAGA GAAACCATTA GTAGGAGAAG 2710 2720 2730 2740 2750 CACTAGCTCG TGTGAAAAGA GCGGAGAAAA AATGGAGAGA CAAACGTGAA 2760 2770 2780 2790 2800 AAATTGGAAT GGGAAACAAA TATTGTTTAT AAAGAGGCAA AAGAATCTGT 2810 2820 2830 2840 2850 AGATGCTTTA TTTGTAAACT CTCAATATGA TAGATTACAA GCGGATACCA 2860 2870 2880 2890 2900 ACATCGCGAT GATTCATGCG GCAGATAAAC GCGTTCATAG CATTCGAGAA 2910 2920 2930 2940 2950 GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTCAATG CGGCTATTTT 2960 2970 2980 2990 3000 TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA 3010 3020 3030 3040 3050 GAAATGTCAT TAAAAATGGT GATTTTAATA ATGGCTTATC CTGCTGGAAC 3060 3070 3080 3090 3100 GTGAAAGGGC ATGTAGATGT A.GAAGAACAA AACAACCACC GTTCGGTCCT 3110 3120 3130 3140 3150 TGTTGTTCCG GAATGGGAAG CAGAAGTGTC ACAAGAAGTT CGTGTCTGTC 3160 3170 3180 3190 3200 CGGGTCGTGG CTATATCCTT CGTGTCACAG CGTACAAGGA GGGATATGGA 3210 3220 3230 3240 3250 GAAGGTTGCG TAACCATTCA TGAGATCGAG AACAATACAG ACGAACTGAA 3260 3270 3280 3290 3300 GTTTAGCAAC TGTGTAGAAG AGGAAGTATA TCCAAACAAC ACGGTAACGT 3310 3320 3330 3340 3350 GTAATGATTA TACTGCGACT CAAGAAGAAT ATGAGGGTAC GTACACTTCT 3360 3370 3380 3390 3400 CGTAATCGAG GATATGACGG AGCCTATGAA AGCAATTCTT CTGTACCAGC 3410 3420 3430 3440 3450 TGATTATGCA TCAGCCTATG AAGAAAAAGC ATATACAGAT GGACGAAGAG 3460 3470 3480 3490 3500 ACAATCCTTG TGAATCTAAC AGAGGATATG GGGATTACAC ACCACTACCA 3510 3520 3530 3540 3550 GCTGGCTATG TGACAAAAGA ATTAGAGTAC TTCCCAGAAA CCGATAAGGT 3560 3570 3580 3590 3600 ATGGATTGAG ATCGGAGAAA GGGAAGGAAC ATTCATCGTG GACAGCGTGG 3610 3620 3630 3640 3650 AATTACTTCT TATGGAGGAA TAATATATGC TTTATAATGT AAGGTGTGCA 3660 3670 3680 3690 3700 AATAAAGAAT GATTAGTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT 3710 3720 3730 3740 3750 ATATGAATAA AAAACGGGCA TCACTCTTAA AAGAATGATG TCCGTTTTTT 3760 3770 3780 3790 3800 GTATGATTTA ACGAGTGATA TTTAAATGTT TTTTTTGCGA AGGCTTTACT 3810 3820 3830 3840 3850 TAACGGGGTA CCGCCACATG CCCATCAACT TAAGAATTTG CACTACCCCC 3860 3870 3880 3890 3900 AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC 3910 3920 3930 3940 3950 ATTTTTTATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCTGAAG 3960 3970 3980 3990 4000 AGCTGTATCG TCATTTAACC CCTTCTCTTT TGGAAGAACT CGCTAAAGAA 4010 4020 4030 4040 4050 TTAGGTTTTG TAAAAAGAAA ACGAAAGTTT TCAGGAAATG AATTAGCTAC 4060 4070 4080 4090 4100 CATATGTATC TGGGGCAGTC AACGTACAGC GAGTGATTCT CTCGTTCGAC 4110 4120 4130 4140 4150 TATGCAGTCA ATTACACGCC GCCACAGCAG TCTTATGAGT CCAGAAGGAC 4160 4170 4180 4190 4200 TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT 4210 4220 4230 4240 4250 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTCAAGTGC 4260 4270 4280 4290 4300 AGCACTCACG TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC 4310 4320 4330 4340 4350 AAGTACCGAA ACATTTAGCA CATGTATATC CTGGGTCAGG TGGTTGTGCA 4360 CAAACTGCAG 27. A process according to any one of claims 1 or 2 wherein the cloning vector used in step (b) is a bifunctional vector that apart from being capable of replicating in bacterial cells selected from the group consisting of B. thuringiensis and B. cereus ceils is capable of replicating at least in one other heterologous host organism, and that is identifiable in both the homologous and the heterologous host system. 28. A process according to claim 27« wherein the said heterologous host organisms are a) prokaryotic organisms selected from the group consisting of the genera Bacillus, Staphylococcus, Streptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacteriwn, Salmonella, and Erwinia or b) eukaryotic organisms selected from the group consisting of yeast, animal and plant cells. 29. A process according to claim 28. wherein the said heterologous host organism is E. coli. 30. A process according to claim 27, wherein the bifunctional vector comprises under the control of expression sequences that arc capable of functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells a structural gene encoding a δ-endotoxin polypeptide that occurs naturally in B. thuringiensis, or for a polypeptide that has substantial structural homologies therewith 1Q1 and has still substantially the toxicity properties of (he said crystalline frendotoxin palypeptida 31. A process accenting to claim 30, wherein the said expression sequences comprise a ipaeaferi-oa-depesdest promores* of B. thuringiensis. 32. A bacterial host call selected fiom die group consisting of B. thuringiensis and B. census cells prepared by a method as described in any one of claims 1 or 2 comprising a recombinant DNA molecule accenting to any one of claims 20 to 26 or a bifunctional vector according to any on® of claims 27 ro 31. 33. Β. thuringiensis var. Jaawfci HDlcryB according to claim 32, transformed with the bifunctional vector pXE>3 (pl£93) and deposited under the number DSM 4571. 34. 3.. cereus 569S according to claim 32, transformed with the bifunctional vector p3O93 (pK93) and deposited under the number DSM 4573. 35. A method of controlling insects which comprises treating insects or their habitat a) wish a bacterial host cell according to claim 32, or with a mixture thereof; or alternatively b) with a cell-free crystal body preparation containing £ protoxin that is produced by a bacterial host cell according so claim 32. 3a A· method according to daim 35, wherein die insects are insects of she orders Lgptacp$sr& e Dipeera or Ccieopisra. 37. A method according to claim 3ti, wherein the insects are insects of the order Lepidoptera. 38. A composition for controlling insects, comprising a) a bacterial host cell according to claim 32» or a mixture thereof, or alternatively b) a cell-free crystal body preparation containing a protoxin that is produced by a bacterial host cell according to claim 32» together wish carriers, dispersing agents or carriers and dispersing agents. 39. A process according to claim 1, wherein die DNA of step a) is obtainable by 102 digesting total DNA of a bacterial donor selected from the group consisting of Bacillus thuringiensis and 3. cereus. 40. A process for the identification of new δ-endotoxin encoding genes in Bacillus thuringiensis, which process comprises (a) digesting the total DNA of Bacillus thuringiensis using suitable restriction enzymes; (b) isolating froa the resulting restriction fragments those of suitable size; (c) inserting the said fragments into a suitable vector; (d) constructing a genomic DNA library by transforming Bacillus thuringiensis host cells with the said vector using a process according to claim 1; (e) screening the thus obtainable DNA library for new S-endotoxin encoding genes. 41. A process according to claim 40, wherein a bifunctional vector is used. 42. A precess according to claim 40, wherein an immunological screening process is used to locate new δ-endotoxin encoding genes. 43. A process according to claim 1 or 2, substantially as hereinbefore described and exemplified. 44. A gram positive bacterium with an altered genome whenever obtained by a process claimed in any one of claims 1 - 31, 39 or 43. 45. A bacterial host cell according to claim 32,, substantially as hereinbefore described. 46. A method of controlling insects according to claim 35, substantially as hereinbefore described. 47. A composition according to claim 38, substantially as hereinbefore described and exemplified. 48. A process according to claim 40 for the identification of δendotoxin encoding genes in Bacillus thuringiensis substantially as hereinbefore described and exemplified.